HIV1 Infection Induces Acetylation of NPM1 That Facilitates Tat Localization and Enhances Viral Transactivation

doi:10.1016/j.jmb.2011.04.009 J. Mol. Biol. (2011) 410, 997–1007

Contents lists available at www.sciencedirect.com

Journal of Molecular Biologyj ourna l homepage: ht tp : / /ees .e lsev ie r.com. jmb

HIV-1 Infection Induces Acetylation of NPM1That Facilitates Tat Localization and EnhancesViral Transactivation

Shrikanth S. Gadad1†, Roshan Elizabeth Rajan2†, Parijat Senapati1,Snehajyoti Chatterjee1, Jayasha Shandilya1, Prasanta Kumar Dash2,Udaykumar Ranga2 and Tapas K. Kundu1⁎1Transcription and Disease Laboratory, Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for AdvancedScientific Research, Jakkur, Bangalore, India2HIV AIDS Laboratory, Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced ScientificResearch, Jakkur, Bangalore, India

Received 31 January 2011;received in revised form1 April 2011;accepted 4 April 2011

Edited by M. F. Summers

Keywords:acetylation;HIV;NPM1;Tat;transactivation

*Corresponding author. E-mail [email protected].† S.S.G. and R.E.R. contributed eqAbbreviations used: HIV-1, huma

virus type 1; NPM1, nucleophosminrepeat; HAT, histone acetyltransferainterfering RNA; ChIP, chromatin imPBS, phosphate-buffered saline; EDTethylenediaminetetraacetic acid.

0022-2836/$ - see front matter © 2011 E

Human immunodeficiency virus type 1 (HIV-1) following integrationhijacks host cell machineries where chromatinization of the viral genomeregulates its latency, transcription, and replication. The cooperation amongATP-dependent chromatin remodeling factors, posttranslational modifyingenzymes, and histone chaperones is well established during transcriptionalactivation in eukaryotes. However, the role of histone chaperones intranscription of the HIV promoter is poorly understood. Previous studiesfrom our group have established the role of the human histone chaperonenucleophosmin (NPM1) in the acetylation-dependent chromatin transcrip-tion. NPM1 is known to interact with HIV-Tat. Here, we report that infectionby HIV-1 induces the acetylation of histone chaperone NPM1. Acetylation ofNPM1 was found to be critical for nuclear localization of Tat as well as Tat-mediated transcription alluding to the critical role for the host factor towardsviral pathogenesis. Furthermore, knockdown experiments mediated by smallinterfering RNA identified the critical role played by the chaperone NPM1 intranscriptional activation of the integrated provirus. These results shed furtherinsights into the possible role of histone chaperone NPM1 acetylation in viralgene transcription, which could be a potential therapeutic target.

© 2011 Elsevier Ltd. All rights reserved.

ess:

ually to this work.n immunodeficiency; LTR, long terminalse; siRNA, smallmunoprecipitation;A,

lsevier Ltd. All rights reserve

Introduction

Upon infecting susceptible cells, the viral genomeof the human immunodeficiency virus (HIV) andother retroviruses integrates into the host chromo-somes. The chromosomal integration packages theproviral DNA into specifically positioned nucleo-somes, and as a consequence, viral gene expression istranscriptionally silenced until stimulated.1 Suchlatent viruses reside in specific cellular reservoirsand allow the infected cells to escape fromantiretroviral therapies. Viral latency thus forms a

d.

mailto:[email protected]

http://dx.doi.org/10.1016/j.jmb.2011.04.009

998 NPM1 Acetylation Links to HIV-1 Multiplication

formidable hindrance to effectively combating thevirus.2–4 Therefore, exploring the molecular mecha-nisms that control transcriptional activation, silenc-ing, and reactivation of theHIV-1 provirus followingintegration would help in understanding the HIVdisease pathogenesis and in designing new-generation combinatorial therapeutics.5,6 Chromati-nization essentially represses transcription from theintegrated HIV-1 promoter7 as is evident from thetwo distinct nucleosomes, nuc-0 and nuc-1, whichare precisely positioned at the 5′ long terminal repeat(LTR), separated by a nucleosome-free region.8 Ofthe two, nuc-1 has been shown to be critical intranscriptional regulation owing to its location nearthe transcription start site.8 This nucleosome un-dergoes remodeling, when transcription from HIV-LTR is activated.9 The various factors, including thehistone acetyltransferases (HATs), involved in remo-deling of the chromatinized viral LTRs are poorlyunderstood. Histone acetylation acts as an activa-tion/repression switch in transcription by regulatingDNA accessibility to regulatory proteins. Acetyla-tion and deacetylation of histones and of nonhistoneproteins are regulated by HATs and histone deace-tylases, respectively.10–12 Additionally, HIV-1 geneexpression is also regulated by modification of thehistone tails. The role of HATs in reactivation of thelatent virus by regulating the acetylation status of Tatand nuc-1 has been well established.13 Consistentwith this understanding, targeting HATs, especiallyp300, with small-molecule inhibitors such ascurcumin14 or LTK1415 demonstrated promisingresults in viral suppression.Histone chaperones are involved in both

replication-dependent and replication-independentassembly and disassembly of histones.16 Themajor emphasis in recent times has been onunderstanding the mechanism by which histonechaperones regulate transcription. Recently, it hasbeen shown that NAP1, a histone chaperone, isinvolved in Tat-mediated transactivation.17 Nucleo-phosmin (NPM1), a human histone chaperone,activates chromatin transcription in an acetylation-dependent manner,18 presumably through removalof promoter proximal histones. Acetylation ofNPM1 has been implicated in oral cancer mani-festation by regulating the genes involved inproliferation.19 Association of NPM1 with HIV-1Tat and its role in targeting the latter to thenucleolus have been previously reported.20 Giventhat reversible acetylation of HIV-1 Tat is critical forviral pathogenesis,21,22 we asked if NPM1 acetyla-tion could also have a similar impact on viralreplication and/or transactivation. Remarkably, wehave found that HIV-1 infection induces theacetylation of NPM1 in infected cells. Furthermore,acetylation of NPM1 is found to be essential for thelocalization of Tat in the nucleus and therebyconsequent viral proliferation.

Results and Discussion

NPM1 is hyperacetylated followingviral infection

Several HIV proteins interact with host proteinswith functional consequences. It was reported thatthe multifunctional, highly dynamic nucleolar pro-tein NPM1 directly interacts with HIV-1 Tat.20 Wewere interested in determining the functionalsignificance of NPM1 acetylation for HIV-1 patho-genesis. In agreement with the previous report, wetoo observed a direct interaction between NPM1and Tat under in vitro and in vivo experimentalconditions (Fig. S1, Supplementary Information).Overexpression of NPM1 is often observed in

human cells under the conditions of stress such ascancer.23 Different posttranslational modifications,such as phosphorylation, acetylation, and sumoyla-tion, play an important role in regulating thelocalization and function of NPM1.24 For instance,we have recently demonstrated an elevated expres-sion of acetylated NPM1 in oral cancer and aconcomitant induction of genes involved in theestablishment of malignancy.19 To examine if viralinfection could lead to augmented NPM1 acetylation,we infected SupT1 cells with increasing concentra-tions ofHIV-1NL4-3 virus (subtypeB) andmonitoredsyncytia formation and p24 production at twodifferent time points following viral infection. Adose-dependent syncytia formation (Fig. 1a and Fig.S2a) and viral production (Fig. 1b and Fig. S2b) wereobserved at days 2 and 4 following infection.However, a lot of cell death occurred at day 6following infection, which is reflected in the amountof viral production (Fig. S2a and S2b). Cell lysatesprepared from the infected cells at the same timepoints were subjected to Western blot analysis usinganti-NPM1 or anti-acetylated NPM1 antibodies (Fig.1c).Weobserved an increase in the levels of acetylatedNPM1 in a time-dependent (days 2 and 4 post-infection) and dose-dependent (viral p24 used forinfection at 0, 5, 20, or 80 ng) manner in the infectedSupT1 cells (Fig. 1c, compare lanes 2–4with lane 1). Asignificant increase was noted in the levels ofacetylated NPM1 on day 4 (Fig. 1c, lane 4), whichcorrelated with the number of syncytia formed (Fig.1a) and the concentration of p24 (Fig. 1b) at the sametimepoint.However, the increase in acetylatedNPM1was not significant at day 6 (Fig. S2c). In contrast, thelevels of NPM1 remained constant throughout theexperimental period independent of viral dose andduration of infection (Fig. 1c, compare lanes 2–4 withlane 1). Furthermore, expression of GAPDH (used asthe loading control) remained unaffected across thepanels (Fig. 1c, compare lanes 2–4 with lane 1). Thequantitation of the bands of acetylated NPM1 andNPM1 at day 2 and day 4 of three independent

Fig. 1. Levels of acetylated NPM1 increase following viral infection. (a) Syncytia formation following viral infectionwas monitored in SupT1 cells, infected with increasing concentrations of NL4-3 virus, as indicated by the viral p24 protein(0, 5, 20, or 80 ng), and the syncytia formation was recorded following viral infection marked by arrows. (b) Viral antigenp24 secreted into the culture medium was measured, using a commercial antigen-capture ELISA kit, at two different timepoints following infection (day 2 and day 4). (c) At the same time points, infected cells were lysed and the lysates weresubjected to Western blot analysis using antibodies against NPM1, acetylated NPM1 (AcNPM1) and GAPDH (loadingcontrol). Shown here are representative images. Densitometric quantitation of the AcNPM1 and NPM1 bands in (c) at day2 (d) and day 4 (e) is shown. The data were analyzed using one-way ANOVA (⁎⁎Pb0.01, ⁎⁎⁎Pb0.001, ns: nonsignificant).Values are means± standard deviation of at least three independent experiments.

999NPM1 Acetylation Links to HIV-1 Multiplication


experiments is presented in Fig. 1d and e, respec-tively. We observe a 1.7-fold and 3.8-fold increase atday 2 and day 4, respectively, when the highest viral

Fig. 2. Acetylation of NPM1 is crucial for Tat-mediated viupstream of the luciferase gene) and (b) HLM-1 (stably integratco-transfected with Tat expression vector (50 ng) and FLAG-harvested 24 h post-transfection. pcDNA3.1, the parental vectoconstant in the assay. TZM-bl cells were lysed to perform lucifused for p24 estimation. HLM-1 cells were co-transfected witFLAG-tagged NPM1 or FLAG-(7K-7R) NPM1 as indicated andvector, was used as filler DNA to keep the DNA concentrationwere used for p24 estimation. Means of FLAG vector and TatTat were statistically analyzed using Student's t test; values artransfection experiments (⁎⁎Pb0.01, ⁎⁎⁎Pb0.001, ns: nonsigni

load (80 ng) was used for infection (Fig. 1d and e).Importantly, we have previously shown that SIRT1, aclass III, NAD+-dependent deacetylase, could

ral transcription. (a) TZM-bl (stably integrated HIV-LTRed HIV viral genome devoid of a functional Tat) cells weretagged NPM1 or FLAG-(7K-7R) NPM1 as indicated andr, was used as filler DNA to keep the DNA concentrationerase assay, and culture supernatants of HLM-1 cells wereh Tat expression vector, either 50 ng (c) or 1 μg (d), andharvested 72 h post-transfection. pcDNA3.1, the parentalconstant in the assay. Culture supernatants of HLM-1 cellsversus FLAG-NPM1 and Tat or FLAG-(7K-7R) NPM1 ande means± standard deviation of at least two independentficant).

image of Fig. 2


deacetylate NPM1 under in vitro and in vivo experi-mental conditions.19 An earlier study demonstratedthat HIV-1 Tat could inhibit SIRT1 following viralinfection and, as a consequence, induce hyperactiva-tion of T cells.21 Collectively, the data presented herein conjunctionwith the previous findings allude to thepossibility that virus-expressed Tat could augmentNPM1 acetylation by inhibiting SIRT1. Our data thusfor the first time establish a correlation betweenhyperacetylation of NPM1 and viral infection byHIV-1.

Acetylation of NPM1 synergistically enhancesTat-mediated transactivation of the integratedHIV-1 promoter

We used two different cell models of viralinfection to probe if induced hyperacetylation ofNPM1 following the viral infection could lead toenhanced transactivation from the viral promoter.One of these cell lines, TZM-bl cells, is permissive toinfection by HIV-1, HIV-2, and simian immunode-ficiency virus. It contains stably integrated reportergenes β-galactosidase and luciferase under HIV-1LTR, and these genes are expressed in a Tat-responsive manner. The other cell line, HLM-1,contains a stably integrated HIV-1 provirus thatlacks a functional Tat and produces virus only whenthe cells are complemented with functional Tat. Thechromatinized viral promoter in both of these celllines is in an appropriate context, mimicking thein vivo scenario of a provirus, thus providing anopportunity to study the latent virus and itsreactivation. The effect of acetylated NPM1 on Tat-mediated transactivation of the integrated HIV-1promoter was studied by co-transfecting these cellswith Tat and either FLAG-WT NPM1 or FLAG-(7K-7R) NPM1 (acetylation-defective mutant of NPM1)expression plasmids.19 In TZM-bl cells, co-transfectionof Tat and FLAG-WT NPM1 significantly enhancedthe Tat-mediated transactivation as shown by theluciferase reporter assay compared to Tat withpCMV-FLAG (vector control) (Fig. 2a, comparelane 6 with lane 3), whereas co-transfection withFLAG-(7K-7R) NPM1 failed to do so (Fig. 2a,compare lane 7 with lane 3). Identical results wereobtained in HLM-1 cells. FLAG-WT NPM1 signifi-cantly enhanced the Tat-mediatedHIV replication asseen by the increased p24 production (Fig. 2b,compare lane 6 with lane 3). On the other hand,FLAG-(7K-7R) NPM1 could not elevate viral repli-cation compared to Tat (Fig. 2b, compare lane 7 withlane 3). Western blot analysis using anti-FLAG andanti-GAPDH antibodies showed an equal expres-sion of both FLAG-WT NPM1 and (7K-7R) NPM1proteins (Fig. 2b, bottom panel, lanes 4–7). NPM1 isknown to oligomerize through its N-terminaldomain. We presume that the formation of hetero-oligomers of acetylation-defective NPM1 mutant

and endogenous NPM1 prevented the latter fromacting on the HIV-1 LTR promoter. This couldexplain the reduced reporter gene expression asshown in the transactivation studies of acetylation-defective (7K-7R) NPM1. However, the amount ofp24 produced was very low (in picograms permilliliter). This could be due to the low amount(50 ng) of Tat transfected and the shorter time periodduring which the assay was performed (24 h post-transfection). Hence, we performed the same assaywith 50 ng (Fig. 2c) and 1 μg (Fig. 2d) of Tattransfection, and the p24 levels were estimated 72 hpost-transfection. We observed a significant increasein the p24 production (Fig. 2c), and they were evenhigher (Fig. 2d) when 1 μg of Tat was transfected.Collectively, these results suggest that acetylation ofhuman histone chaperone NPM1 modulates Tat-mediated transactivation of the viral promoter.

Tat influences the recruitment of acetylatedNPM1 at the viral promoter

HIV-1 infection of T cells resulted in enhancedacetylation of NPM1 (Fig. 1c). Acetylation of NPM1 isessential for its transcriptional co-activator activity.18

Therefore, we analyzed the acetylation status ofNPM1 at the HIV-LTR in TZM-bl cells upontransactivation by Tat. The chromatin structure inthe proviral 5′ LTR is composed of two distinctnucleosomes, nuc-0 and nuc-1, which are positionedwith respect to the cis-acting regulatory elements. Inthe provirus, these nucleosomes define two largenucleosome-free areas. The first one is composed ofthe core promoter (containing three tandem Sp-1binding sites and the TATA box sequence) and theenhancer region (target for many transcription factorbinding sites such as NF-κB, Ets-1, and USF).25 Thesecond open area spans the primer-binding siteimmediately downstream of the 5′ LTR. These twoopen regions are separated by the single nucleosomenuc-1 that is specifically and rapidly destabilizedduring transcriptional activation. The position of nuc-1 is in close proximity to the transcription start site andits disruption during transcriptional activation estab-lishes the vital role of chromatin in the repression ofHIV-1 transcription during latency.26 To determinewhether transcriptional activation byTat enhances therecruitment of NPM1 and acetylated NPM1 to theviral promoter in vivo, we analyzed the viral promoterin Tat-transfected TZM-bl cells using chromatinimmunoprecipitation (ChIP) assay. Formaldehydecross-linked, sonicated chromatin fragments fromTZM-bl cells were immunoprecipitated using anti-acetylatedNPM1, NPM1, and anti-Tat antibodies.Weexamined three different sites in the LTR thatmappedto contiguous regions in the HIV-1 proviral DNA,mostly according to the positions of the nucleosomes(nuc-1 and nuc-2) and the nucleosome-free region(PPR) (Fig. 3a). The ChIP results were analyzed by

Fig. 3. Acetylated NPM1 is recruited to the LTR in a Tat-dependent manner. (a) Schematic representation of the HIV-LTR. (b) Fold enrichment of acetylated NPM1 (AcNPM1), NPM1, and Tat at the HIV-LTR (at different nucleosomepositions: nuc-1, nuc-2, and PPR region) in the presence of Tat was analyzed in the TZM-bl cells by ChIP assay. Histogramrepresents fold enrichment of AcNPM1, NPM1, and Tat proteins over vector-transfected cells as observed by quantitativePCR analysis.


quantitative PCR using different regions spanning thethree sites in HIV-LTR. nuc-1 is established as theprimary nucleosome that is targeted for hyperacetyla-tion and remodelingduring transactivation of the LTRby Tat.27 Interestingly, we observed that there was asignificant enrichment of acetylated NPM1 as com-pared to NPM1 at the PPR region (Fig. 3b). This resultsuggests that acetylated NPM1 could be involved inthe maintenance of dynamic chromatin environmentat the integratedHIV-LTR. The transcription initiationsite, TATA box, and TAR binding sites reside in PPR.8

The occupancy of acetylated NPM1 at PPR could bedue to its association with the pre-initiation complexor its interaction with Tat, given that Tat is known tointeract with several components of the pre-initiationcomplex.28 To ascertain this assumption, we checkedthe occupancy of Tat at PPR, nuc-1, and nuc-2 byChIPusing an anti-Tatmonoclonal antibodyE1.1 inTZM-bl

cells (Fig. 3b).We found that Tat is enriched at the PPRregion significantly. These results indicate that acety-lated NPM1 is recruited to the HIV-LTR in a Tat-dependent manner.

Acetylated NPM1 regulates nuclear localizationof Tat

The role of NPM1 in the nuclear localization of Tatwas implicated in a previous report.20 Recently, wehave reported that acetylated NPM1 predominantlyresided in the nucleoplasm.19 Since our data suggestthat acetylation of NPM1 is a prerequisite for theenhanced Tat-mediated transactivation (Fig. 2a andb), we next askedwhether acetylatedNPM1has a rolein the nuclear localization of Tat. To investigate this,we co-transfected Tat with either GFP-WT NPM1 orGFP-(7K-7R) NPM1 in TZM-bl cells and performed a

image of Fig. 3

Fig. 4. Acetylation of NPM1 is critical for nuclear localization of Tat. TZM-bl cells were co-transfected with a Tatexpression vector and GFP-WTNPM1 or GFP-(7K-7R) NPM1. The cells were fixed at 15 h after co-transfection and stainedwith anti-Tat antibody (red). DNA staining with Hoechst is shown in blue. The scale bar represents 10 μm.


co-immunofluorescence analysis at different timepoints following the transfection. The nuclear locali-zation of Tat was monitored in GFP-expressing cellsusing a monoclonal antibody E1.1 to Tat (12 and 15 h;Fig. S3 and Fig. 4, respectively). The results revealedthat overexpression of GFP-WT NPM1 enhancedlocalization of Tat to the nucleus, while cells over-expressing GFP-(7K-7R) NPM1 were deficient innuclear localization of Tat at all the time pointsstudied (Fig. S3b andFig. 4).However, the localizationof GFP-(7K-7R) NPM1 was unaltered as compared tothat of the GFP-WT NPM119 (Fig. S3a and S3c).Collectively, our data allude to the critical role playedby acetylated NPM1 in Tat nuclear localization. Thesedata also suggested that acetylation-defective (7K-7R)NPM1 (FLAG-tagged as well as GFP-tagged con-structs) repressed not only Tat-mediated viral tran-scription (Figs. 2 and 4; Fig. S3) but also localization ofTat to the nucleus. Presumably, acetylated NPM1could be an integral component ofHIV-1 transcriptioninitiation machinery.

Endogenous NPM1 is essential for HIV-LTRtransactivation and viral replication

Next, to investigate the role of endogenous NPM1in Tat-mediated transactivation at the integratedHIV-1 promoter, we silenced endogenous NPM1using specific small interfering RNA (siRNA) inTZM-bl or HLM-1 cells. First, NPM1 siRNA or acontrol siRNA was used for the transfection; 48 hlater, the cells were transfected with a Tat expression

vector to induce viral promoter transactivation.Knockdown of NPM1 in TZM-bl cells inhibited theTat-mediated transactivation in a dose-dependentmanner (Fig. 5a). A four- to fivefold reduction in theluciferase activity was observed following NPM1silencing using 5 and 10 nM siRNA, respectively, ascompared to 10 nM scrambled RNA (Fig. 5a,compare lanes 4 and 5 with lane 3). However,NPM1 silencing did not lead to any change in Tatexpression (Fig. S4b). A similar effect was observedupon silencing NPM1 in HLM-1 cells (Fig. 5b). Therewas a dose-dependent reduction of p24 levels inNPM1 silenced cells compared to scrambled RNAtransfected control (Fig. 5b, compare lanes 4 and 5with lane 3; Fig. S4c). The statistical analysisrevealed a significant reduction in the readouts ofboth of the reporter systems following NPM1knockdown. Western blot analysis confirmed asignificant knockdown of NPM1 in a dose-dependentfashion (Fig. 5a and b, bottompanels, compare lanes 4and 5with lane 3). Furthermore, the importance of theacetylation status of NPM1 in facilitating transactiva-tion of the viral genes was studied by first knockingdown NPM1 expression by NPM1 siRNA for 48 h inTZM-bl cells, followed by transfection of FLAG-tagged WT or mutant (7K-7R) NPM1 along with Tatin the silenced cells. The results showed that WTNPM1, but not the acetylation-defective mutant,could rescue the effect of silencing (Fig. 6, lane 11).The (7K-7R) NPM1 had lower efficiency to enhanceHIV transactivation (Fig. 6, lane 12). Taken together,these results suggest that acetylated NPM1 is directly

image of Fig. 4

Fig. 5. NPM1 is required for HIV-LTR activation: (a) TZM-bl cells and (b) HLM-1 cells were transfected with NPM1siRNA or the control scRNA (scrambled RNA) for 48 h. Subsequently, CMV-Tat was transfected into the cells and theinduced HIV-LTR-driven virus production was monitored in HLM-1 cells. Tat-mediated transactivation from the viralpromoter was measured by luciferase assay. Western blot analysis was performed using anti-NPM1 and anti-GAPDH(loading control) antibodies to confirm the silencing of NPM1. Values are means± standard deviation of two independentexperiments (⁎⁎Pb0.01, ⁎⁎⁎Pb0.001).


involved in the Tat transactivation of the viralpromoter.Productive infection of HIV-1 requires efficient

transcription from the integrated provirus that isregulated by several viral and host factors. Thechromatinized HIV-LTR is transcriptionally inactiveand requires host cell factors to trigger chromatinmodification and remodeling and thereby transcrip-tion initiation. The initial viral transcripts generated byNF-kB-mediated transcription serve as the source ofviral regulatory proteins such as Rev, Nef, and Tat.Following translation and nuclear localization, Tatexerts its transactivating properties by recruiting

several host factors to the viral promoter that in turnbring about chromatin remodeling andmodulate bothtranscription initiation and elongation. Based on thedata presented here, we propose that acetylatedNPM1 plays a critical role not only in the nuclearlocalization of Tat but also in the transcriptionalactivation of the integrated viral promoter. Our studyhas shed light on one of the important cellularmechanisms hijacked by HIV-1 to establish viralinfection. These findings could be of significancein enhancing our understanding of the host–viralinteractions, as well as in the designing of new-generation therapeutics, targeting acetyltransferases.

image of Fig. 5


Materials and Methods

Viruses and infection

To determine the correlation between the levels ofacetylated NPM1 and the extent of viral infection, we usedthree different concentrations (5, 20, and 80 ng of p24) ofNL4-3 virus. NL4-3 virus was made in 293T cells usingstandard methods, and the viral stocks were stored at−80 °C in aliquots. The quantity of p24 present in the viralstocks was assessed using an antigen-capture commercialkit (Perkin Elmer). The virus was incubated with SupT1cells (0.5×106/well) in 10% RPMI, containing 10 μg/mlPolybrene, for 6 h. After incubation, the cells were washedin 1× phosphate-buffered saline (PBS) extensively toremove free virus. Subsequently, 2 ml of fresh mediumwas added and the cells were incubated at 37 °C in a CO2incubator. The HIV core protein p24 was estimated fromthe spent medium at days 2 and 4. The cells were lysed inTNN buffer (50 mM Tris–HCl, pH 7.4, 250 mM NaCl, 1%NP40, 1 mM DTT, 1 mM PMSF, 50 mM NaF, and SigmaProtease Inhibitor Cocktail) after respective incubationperiods. A negative control (wells without the virus) wasincluded in all the experiments. Syncytia formation wasobserved and imaged using light microscope at 10×resolution. Lysates were subjected to Western blotanalysis using anti-NPM1 (Invitrogen) monoclonal anti-bodies as well as anti-acetylated NPM1 and anti-GAPDH(raised in-house) polyclonal antibodies.

Cell lines

SupT1 human T lymphocytic cell lines were cultured inRPMI 1640 medium (Sigma) supplemented with 10% FCS,100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °Cand 5% CO2. TZM-bl cells are modified HeLa cells thatexpress high levels of CD4 and both of the co-receptorsCXCR4 and CCR5 and are stably transduced to carry two

independent reporter cassettes: LTR-driven firefly lucifer-ase and β-galactosidase. HLM-1 is an engineered HeLacell line that is stably transfected to contain a single copyof full-length HIV-1 provirus with a triple terminationcodon at the first AUG of the Tat gene. The HLM-1 cellsproduce low levels of virus under normal conditions andsignificantly high quantities of the virus when appropri-ately stimulated using activators including Tat, TNF-α,sodium butyrate, and trichostatin A.

Luciferase assay

The TZM-bl cells were co-transfected with Tat expres-sion vector and FLAG vectors, FLAG-NPM1, or FLAG-(7K-7R) NPM1 constructs. The acetylation sites mutated inthe 7K-7R mutant of NPM1 are K212, K215, K229, K230,K257, K267, and K292.19 The spent media were removed24 h post-transfection, and the cells were washed twicewith 1× PBS and lysed with cell culture lysis reagent (Cat.no. E2661, Promega). Following this, the Bright-Glo™luciferase assay system (Cat. no. E2620, Promega) wasused to quantify the luciferase activity, which wasmeasured as luciferase activity (rLU/s) using a BertholdLuminometer. The luciferase activity values were normal-ized with equal protein content (GAPDH) and equalexpression (FLAG).

Chromatin immunoprecipitation

The HIV-LTR was induced in TZM-bl cells by transfect-ing Tat, and these cells were used for the ChIP assayperformed as described elsewhere.29 Briefly, 12 h post-transfection of Tat, cross-linking was performed with 1%formaldehyde followed by cell lysis in SDS lysis buffer [1%SDS, 10 mM ethylenediaminetetraacetic acid (EDTA), and50 mM Tris–HCl, pH 8]. After sonication of the chromatin(6 times for 10 s at a power setting of 91%), cold dilutionbuffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA,16.7 mM Tris–HCl, pH 8, and 167 mM NaCl) was added

Fig. 6. Acetylated NPM1 canrescue the effect of silencing ofendogenous NPM1 on HIV-LTRtransactivation. In TZM-bl cells,48 h following transfection withNPM1 siRNA or scRNA (scrambledRNA), Tat alone (unt), Tat withFLAG vector (vec), Tat with FLAG-NPM1 (wt), or Tat with FLAG-(7K-7R) NPM1 (mut) was transfected toinduce HIV-LTR-driven luciferasegene expression. The results wereevaluated using Student's t test.Values are means± standard devi-ation of three independent experi-ments (⁎⁎Pb0.01, ⁎⁎⁎Pb0.001, ns:nonsignificant).

image of Fig. 6


along with pre-blocked protein G-Sepharose (AmershamPharmacia) and anti-AcNPM1 (acetylated NPM1), anti-NPM1 (invitrogen), anti-Tat, or anti-acetylated histone H3(Calbiochem) antibodies, and the sample was incubatedovernight for binding. The sonicated samples were pre-cleared prior to immunoprecipitation. Beads were washedsuccessively with low-salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris–HCl, pH 8, and 150 mMNaCl), high-salt buffer (0.1% SDS, 1% Triton X-100, 2 mMEDTA, 20 mM Tris–HCl, pH 8, and 500 mM NaCl), LiClbuffer (250 mM LiCl, 1% NP40, 1% NaDOC, 1 mM EDTA,and 10 mM Tris–HCl, pH 8), and TE (10 mM Tris–HCl,pH 8, and 1 mM EDTA). Elution buffer (0.2% SDS and100 mMNaHCO3) along with 200 mMNaCl was added tothe washed beads, and the bead solution was incubatedovernight at 65 °C. The next day, 0.1 mg/ml of proteinaseK (Sigma) and 0.04 mg/ml of RNase A (Qiagen) wereadded to the bead solution and the mixture was incubatedfor 2 h at 55 °C. The immunoprecipitated samples weredeproteinized, ethanol-precipitated, and used for real-timePCR analysis. The following region-specific primer setswere used for the real-time PCR analysis:27

Primer
Region Primer sequence L1f (forward) PPR CGAGAGCTGCATCCGGAGTA L1r (reverse) AGCTTTATTGAGGCTTAAGC Nu1f (forward) Nuc-1 AGTAGTGTGTGCCCGTCTGT Nu1r (reverse) TTGGCGTACTCACCAGTCGC Nu2f (forward) Nuc-2 ATTTTGACTAGCGGAGGCTA Nu2r (reverse) ACAGCCTTCTGATGTCTCTA
Immunofluorescence

The cells were grown on poly-L-lysine-coated coverslipsand co-transfected with either GFP-WT NPM1 or GFP-(7K-7R) NPM1 constructs and Tat. Equal amounts of GFP-WT NPM1 and GFP-(7K-7R) NPM1 DNA were used fortransfection. Cells were fixed using 2% paraformaldehyde12 or 15 h following transfection, and the GFP fluorescencewas acquired. After image acquisition, the cells werepermeabilized using 1% Triton X-100 and blocked using1% FBS. Probing was performed with an anti-Tatmonoclonal antibody E1.1 followed by a secondaryantibody conjugated to Alexa-633 (Invitrogen). Thenucleus was stained with 0.1 μg/ml Hoechst 33258(Sigma) in PBS. Fluorescence for Alexa-633 and Hoechstwas visualized by using different filters of the Carl Zeissconfocal microscope LSM 510 META using LSM 5 ImageExaminer software.

siRNA-mediated silencing

The two siRNAs (Qiagen) used for NPM1 knockdownare as follows:

NPM1 siRNA #1 (sense, 5-[GAAUUGCUUCCGGAU-GACU]dTdT;antisense, 5-[AGUCAUCCGGAAGCAAUUC]dTdT)

andNPM1 siRNA #2 (sense, 5-[AGGUGGUUCUCUUCC-

CAAA]dTdT;antisense, 5-[UUUGGGAAGAGAACCACCU]dTdT).

Alexa-488-conjugated AllStars Negative Control siRNA(Human Starter Kit, Qiagen) was used as control. siRNAtransfections in TZM-bl and HLM-1 cells were performedfor 48 h with HiPerFect Transfection Reagent (Qiagen)according to the manufacturer's instructions. The knock-down efficiency was checked by reverse transcriptase PCRand Western blot analysis using anti-NPM1 antibody. Thecells were transfected with equal amounts of a CMV-Tatplasmid and assayed for luciferase (24 h) or p24 (72 h) inTZM-bl and HLM-1 cells, respectively. The primers usedfor reverse transcriptase PCR were NPM1 forward (5′-gTgAAgAAATCTATACgAgATACTCCAgCC-3′), NPM1reverse (5′-CTTCCACTTTgggAAgAgAACCACC-3′), Tatforward (5′-TAGAATTCGCCGCCGCCATGGAGCCAG-TAGATCCTAACCTA-3′), and Tat reverse (5′-AGAGTC-TAGACTAGTCGAAGGGGTCTGTCTCTGTCTT-3′).Supplementary materials related to this article can be

found online at doi:10.1016/j.jmb.2011.04.009

Acknowledgements

This work was supported by the Department ofBiotechnology, Government of India, and theJawaharlal Nehru Centre for Advanced ScientificResearch. We also acknowledge Ms. B. S. Suma forher assistance with the confocal microscopy experi-ments. We also thank Rajesh Murali for technicalhelp. S.S.G. and P.S. are Senior and Junior ResearchFellows, respectively, of the Council of Scientificand Industrial Research, Government of India.

References

1. Greene, W. C. & Peterlin, B. M. (2002). Charting HIV'sremarkable voyage through the cell: basic science as apassport to future therapy. Nat. Med. 8, 673–680.

2. Finzi, D., Hermankova, M., Pierson, T., Carruth, L. M.,Buck, C., Chaisson, R. E. et al. (1997). Identification of areservoir for HIV-1 in patients on highly activeantiretroviral therapy. Science, 278, 1295–1300.

3. Wong, J. K., Hezareh, M., Günthard, H. F., Havlir,D. V., Ignacio, C. C., Spina, C. A. & Richman, D. D.(1997). Recovery of replication-competent HIV despiteprolonged suppression of plasma viremia. Science,278, 1291–1295.

4. Pierson, T., McArthur, J. & Siliciano, R. F. (2000).Reservoirs for HIV-1: mechanisms for viral persistencein the presence of antiviral immune responses andantiretroviral therapy. Annu. Rev. Immunol. 18,665–708.

5. Finzi, A., Bruno, A. & Perondi, R. (1999). Exercise-induced paroxysmal atrioventricular block duringnuclear perfusion stress testing: evidence for transientischemia of the conduction system. G. Ital. Cardiol. 29,1313–1317.

6. Cohen, O. J. & Fauci, A. S. (2001). Current strategies inthe treatment of HIV infection. Adv. Intern. Med. 46,207–246.

http://dx.doi.org/10.1016/j.jmb.2011.04.009


7. Marzio, G., Tyagi, M., Gutierrez, M. I. & Giacca, M.(1998). HIV-1 tat transactivator recruits p300 andCREB-binding protein histone acetyltransferases tothe viral promoter. Proc. Natl Acad. Sci. USA, 95,13519–13524.

8. Gatignol, A. (2007). Transcription of HIV: Tat andcellular chromatin. Adv. Pharmacol. 55, 137–159.

9. Marcello, A., Lusic, M., Pegoraro, G., Pellegrini, V.,Beltram, F. & Giacca, M. (2004). Nuclear organiza-tion and the control of HIV-1 transcription. Gene,326, 1–11.

10. Gibbons, R. J. (2005). Histone modifying and chroma-tin remodelling enzymes in cancer and dysplasticsyndromes. Hum. Mol. Genet. 14, R85–92.

11. Verdone, L., Caserta, M. &DiMauro, E. (2005). Role ofhistone acetylation in the control of gene expression.Biochem. Cell Biol. 83, 344–353.

12. Yang, X. J. (2004). The diverse superfamily of lysineacetyltransferases and their roles in leukemia andother diseases. Nucleic Acids Res. 32, 959–976.

13. Kiernan, R. E., Vanhulle, C., Schiltz, L., Adam, E.,Xiao, H., Maudoux, F. et al. (1999). HIV-1 tattranscriptional activity is regulated by acetylation.EMBO J. 18, 6106–6118.

14. Balasubramanyam, K., Varier, R. A., Altaf, M.,Swaminathan, V., Siddappa, N. B., Ranga, U. &Kundu, T. K. (2004). Curcumin, a novel p300/CREB-binding protein-specific inhibitor of acetyl-transferase, represses the acetylation of histone/nonhistone proteins and histone acetyltransferase-dependent chromatin transcription. J. Biol. Chem.279, 51163–51171.

15. Mantelingu, K., Kishore, A. H., Balasubramanyam, K.,Kumar, G. V., Altaf, M., Swamy, S. N. et al. (2007).Activation of p300 histone acetyltransferase by smallmolecules altering enzyme structure: probed bysurface-enhanced Raman spectroscopy. J. Phys.Chem. B, 111, 4527–4534.

16. Shandilya, J., Gadad, S., Swaminathan, V. & Kundu,T. K. (2007). Histone chaperones in chromatindynamics: implications in disease manifestation.Subcell. Biochem. 41, 111–124.

17. Vardabasso, C., Manganaro, L., Lusic, M., Marcello,A. & Giacca, M. (2008). The histone chaperone proteinNucleosome Assembly Protein-1 (hNAP-1) bindsHIV-1 Tat and promotes viral transcription. Retrovi-rology, 5, 8.

18. Swaminathan, V., Kishore, A. H., Febitha, K. K. &Kundu, T. K. (2005). Human histone chaperonenucleophosmin enhances acetylation-dependent chro-matin transcription. Mol. Cell. Biol. 25, 7534–7545.

19. Shandilya, J., Swaminathan, V., Gadad, S. S.,Choudhari, R., Kodaganur, G. S. & Kundu, T. K.(2009). Acetylated NPM1 localizes in the nucleo-plasm and regulates transcriptional activation ofgenes implicated in oral cancer manifestation. Mol.Cell. Biol. 29, 5115–5127.

20. Li, Y. P. (1997). Protein B23 is an important humanfactor for the nucleolar localization of the humanimmunodeficiency virus protein Tat. J. Virol. 71,4098–4102.

21. Kwon, H. S., Brent, M. M., Getachew, R., Jayakumar,P., Chen, L. F., Schnolzer, M. et al. (2008). Humanimmunodeficiency virus type 1 Tat protein inhibitsthe SIRT1 deacetylase and induces T cell hyperactiva-tion. Cell Host Microbe, 3, 158–167.

22. Pagans, S., Pedal, A., North, B. J., Kaehlcke, K.,Marshall, B. L., Dorr, A. et al. (2005). SIRT1 regulatesHIV transcription via Tat deacetylation. PLoS Biol. 3,e41.

23. Grisendi, S., Mecucci, C., Falini, B. & Pandolfi, P. P.(2006). Nucleophosmin and cancer.Nat. Rev. Cancer, 6,493–505.

24. Okuwaki, M. (2008). The structure and functions ofNPM1/Nucleophsmin/B23, a multifunctional nucle-olar acidic protein. J. Biochem. 143, 441–448.

25. Jones, K. A. & Peterlin, B. M. (1994). Control of RNAinitiation and elongation at the HIV-1 promoter.Annu. Rev. Biochem. 63, 717–743.

26. Verdin, E., Paras, P. & Van Lint, C. (1993). Chromatindisruption in the promoter of human immunodefi-ciency virus type 1 during transcriptional activation.EMBO J. 12, 3249–3259.

27. Lusic, M., Marcello, A., Cereseto, A. & Giacca, M.(2003). Regulation of HIV-1 gene expression byhistone acetylation and factor recruitment at the LTRpromoter. EMBO J. 22, 6550–6561.

28. Suzuki, Y. & Craigie, R. (2007). The road tochromatin—nuclear entry of retroviruses. Nat. Rev.,Microbiol. 5, 187–196.

29. Kishore, A. H., Batta, K., Das, C., Agarwal, S. &Kundu, T. K. (2007). p53 regulates its own activator:transcriptional co-activator PC4, a new p53-respon-sive gene. Biochem. J. 406, 437–444.

Documents

HIV1 Infection Induces Acetylation of NPM1 That Facilitates Tat Localization and Enhances Viral Transactivation