Embed Size (px)
Citation preview
www.elsevier.com/locate/gene
Gene 338 (2004) 55–64
CemaT1 is an active transposon within the
Caenorhabditis elegans genome
J.C. Brownliea,b,*, S. Whyarda
aDivision of Entomology, CSIRO GPO Box 1700, Canberra ACT 2601, AustraliabDepartment of Botany and Zoology, Australian National University, Canberra ACT 2601, Australia
Received 18 December 2003; received in revised form 13 April 2004; accepted 17 May 2004
Available online 17 July 2004
Received by D. FinneganAbstract
The maT clade of transposons is a group of transposable elements intermediate in sequence and predicted protein structure to mariner and
Tc transposons, with a distribution thus far limited to a few invertebrate species. In the nematode Caenorhabditis elegans, there are eight
copies of CemaT1 that are predicted to encode a functional transposase, with five copies being >99% identical. We present evidence, based
on searches of publicly available databases and on PCR-based mobility assays, that the CemaT1 transposase is expressed in C. elegans and
that the CemaT transposons are capable of excising in both somatic and germline tissues. We also show that the frequency of CemaT1
excisions within the genome of the N2 strain of C. elegans is comparable to that of the Tc1 transposon. However, unlike Tc transposons in
mutator strains of C. elegans, maT transposons do not exhibit increased frequencies of mobility, suggesting that maT is not regulated by the
same factors that control Tc activity in these strains. Finally, we show that CemaT1 transposons are capable of precise transpositions as well
as orientation inversions at some loci, and thereby become members of an increasing number of identified active transposons within the C.
elegans genome.
D 2004 Elsevier B.V. All rights reserved.
Keywords: mariner; Tc; RNAi; Excision; Transposition
1. Introduction
Transposable elements (TEs) were once considered
parasitic elements of the genome, but are now often
regarded as important agents of genomic evolution and
population adaptation (Shapiro, 1999). Excisions and trans-
positions of TEs can be mutagenic as gene expression is
affected by local insertions or deletions of these mobile
fragments of DNA, while recombinations between related
elements at non-homologous sites can create changes to
gene order and chromosome organisation. The most char-
acterised transposons (DNA-based TEs) within the genome
0378-1119/$ - see front matter D 2004 Elsevier B.V. All rights reserved.
doi:10.1016/j.gene.2004.05.011
Abbreviations: bp; base pair; ds; double stranded; kb; kilobase; ORF;
open reading frame; RNAi; RNA interference; QPCR; quantitative PCR;
siRNA; short interfering RNA; TEs; transposable elements.
* Corresponding author. The University of Queensland, School of Life
Sciences, Department of Zoology and Entomology, St. Lucia 4072,
Brisbane, QLD, Australia. Tel.: +61-733469218; fax: +61-73365155.
E-mail address: [email protected] (J.C. Brownlie).
of the nematode Caenorhabditis elegans are the Tc1 and
Tc3 transposons (Emmons and Yesner, 1984; Collins et al.,
1989). When first described, Tc1 was initially thought to
be active only within somatic tissues (Emmons and Yesner,
1984). However, a subsequent survey of various C. ele-
gans strains revealed that some, referred to as mutator
strains, contained Tc1 elements capable of germline trans-
position (Plasterk, 1991). Furthermore, the copy number
and activity of Tc1 in the mutator strains were much higher
than that observed for the standard reference strain, N2.
The higher level of Tc1 activity in mutator strains may be
due to the presence of highly active forms of Tc1 and/or a
deficiency of mechanisms that can suppress the trans-
poson’s mobility. It has been suggested that one such
suppressive mechanism is the gene silencing process
RNA interference (RNAi), as many strains deficient in
RNAi have higher frequencies of Tc1 and Tc3 genome
insertions (Ketting et al., 1999).
Active copies of various TEs, such as Mos1 (Jacobson
et al., 1986), have been detected through the mutations
J.C. Brownlie, S. Whyard / Gene 338 (2004) 55–6456
they cause when inserted into genes, however, many more
TEs have been identified on the basis of sequence identity
to other known TEs (Shao and Tu, 2001; Claudianos et al.,
2002; Feschotte et al., 2002). A novel intermediate clade of
the mariner/Tc1 superfamily, called maT, was recently
described and identified in a number of invertebrate spe-
cies, including C. elegans (Claudianos et al., 2002). On the
basis of a low copy number and high sequence conserva-
tion among the most common maT elements in C. elegans,
it was suggested that these CemaT1 elements represented a
relatively recent invasion of the C. elegans genome,
compared to the more abundant and variable mariner and
Tc elements. Eight of the 12 copies of CemaT1 in the C.
elegans genome contain intact open reading frames. Five of
these eight copies are >99% identical, and secondary
structure predictions and alignment with other known
active transposases of the mariner-Tc superfamily suggest
that this most common CemaT1 variant encodes a func-
tional transposase (Claudianos et al., 2002). For these
reasons, we expected that CemaT1 would be capable of
excisions and transpositions, and we set out to determine
whether this transposon was mobile in its host’s genome.
Through a combination of database searches and experi-
mental evidence, we show that CemaT1 transposase is
expressed and that the transposons are capable of excising
from the C. elegans genome. Furthermore, we show that
CemaT1 elements are able to excise in both somatic and
germline cells, and are capable of precise transposition
events, targeting a TA dinucleotide sequence that is dupli-
cated upon insertion. Finally, we developed a quantitative
PCR assay to determine the rate at which CemaT1 excises
from the genome of five strains of C. elegans and compare
these rates to that estimated for Tc1.
2. Methods and materials
2.1. Nematode strains and DNA extractions
The following strains were used in this study: N2, AB2,
TR403, CB4852, CB4856, KR314, NL917 and RW7000,
and each is described in detail elsewhere (Egilmez et al.,
1995). DNA was extracted from mixed developmental
stages of nematodes grown in liquid culture (Hope, 1999)
using Qiagen’s Genome 100 tip kit, according to the
manufacturer’s instructions.
2.2. Reverse transcriptase PCR
Reverse transcriptase PCR (RT-PCR) was used to
determine whether CemaT1 transposase was transcribed.
Total RNA from mixed stages of C. elegans N2 strain
was extracted using a SV Total RNA Isolation System
(Promega). Contaminating genomic DNA was removed
by treatment with RNase-free DNase I. Reverse transcrip-
tion and PCR was carried out using a SuperScript One-
Step RT-PCR with Platinum Taq (Invitrogen) in a 25-
Al reaction mixture containing CemaT1 transposase-spe-
cific primers (CemaT1 forward: 5V-ATGAGAGCGTCACCCATGCGTGAACCC-3V; CemaT1 reverse: 5V-TTAAAGTTCGAAAATATCTCCATTAGC-3V) and 100 pg of
total RNA. Absence of genomic DNA in the RNA
preparations was verified by omitting the RT/Platinum
Taq mix and substituting Platinum Taq DNA polymerase
(Invitrogen) in the reaction. The cDNA synthesis and
PCR amplification reactions were performed on a Perkin
Elmer 9600 DNA thermocycler according to the manu-
facturer’s specifications.
2.3. PCR-based excision assays
Nested PCR was used to assess whether CemaT1
elements at four different loci were capable of excising.
Primers were designed to flank each of the four trans-
posons (Table 1), so that both full-length non-excised
CemaT1 elements and sites lacking the element due to a
previous excision could be detected. The PCR products
were analysed on 1% agarose gels and putative excision
products were gel purified using a QIAquick Gel Ex-
traction kit (Qiagen). Five microliters of eluted DNA
were used as template for direct DNA sequencing or
cloned into pGEM-T-Easy (Promega) and purified plas-
mid DNA (MOBIO Miniprep Plasmid kit) was se-
quenced using Big-Dye terminator chemistry (Applied
Biosystems).
2.4. Quantitative PCR assays
Excision frequencies for three different CemaT1 loci
were determined using a quantitative PCR (QPCR) ap-
proach. QPCR reactions were performed on 20 and 100
ng of genomic DNA with primers at a concentration of
0.8 AM. All other reagents were supplied within the
SYBR Green PCR Master Mix kit (Applied Biosystems).
All PCR reactions were performed in an Applied Bio-
systems Prism 7000 Sequence Detection System (cycling
conditions: 50 jC for 2 min, 95 jC for 10 min, 40 cycles
of 95 jC for 15 s, 60 jC for 1 min) and the standard
dissociation protocol (Applied Biosystems) was used to
perform melt-curve analyses to assess the purity of am-
plified products. PCR amplifications of loci containing
non-excised and excised transposons were performed in
separate reactions, using primers (Table 1) that were
designed using the Primer Express program (Applied
Biosystems). PCR primers were designed such that the
PCR products of the excised and non-excised transposons
were of similar size (f 80 bp) and GC% content
(f 57%) to permit a direct comparison of PCR product
fluorescence intensities. QPCR was used to assess the
relative amount of the C. elegans 26S rRNA gene for all
DNA sample dilutions and the threshold cycle (CT) values
for all transposon loci quantitations were then normalised
Table 1
PCR primers used to detect and estimate frequencies of excision of CemaT1 elements in C. elegans
Primersa 5V–3VSequence Size (kb)b
CemaT1 Excision Primers
K03H6.Ex#1.F (IV) GTGATCCGAGATATTTGTAC 1.7/(0.8)
K03H6.Ex#2.F TCTTGAGTTAACATTTATTGCGTTCA
K03H6.Ex#1.R CTGAGCCATCTGAGCACTG
K03H6.Ex#2.R GCACTAGTAGCGCTTGCTCCGAACAG
T14G12.Ex#1.F (X) CAGATTATGTGTATCGCTTGTTAGAT 1.6/(0.5)
T14G12.Ex#2.F ATAGCTATGGAATCCGGGAG
T14G12.Ex#1.R AAATTAACCTTTCTCTTGGCAAACTC
T14G12.Ex#2.R GGGACTGGGGCAATTGGG
W06G6.Ex#1.F (V) AAAGCAGCCGACAGTGATTGAGGTTC 1.5/(0.75)
W06G6.Ex#2.F CCCTTACCTCTGCATCACG
W06G6.Ex#1.R CAGGCCCTCCATCTCCAATCCGCTAT
W06G6.Ex#2.R TCAAGTTCTGTATTGCC
Y104H12.Ex#1.F (I) CAGGAACAAGTGCCGAGAGACAACA 1.6/(0.5)
Y104H12.Ex#2.F GAAGCCAAATGAGGATGTAGAGTGTG
Y104H12.Ex#1.R TGAGCCGTCACAACTTTCTTT
Y104H12.Ex#2.R GACTATACCATGTATTTTCCAAAACGCTAA
Control rRNA primers
26s_F TGA CGC GCA TGA ATG GAT TTA
26s_R TTG GCT GTG GTT TCG CTA GAT A
QPCR primers
CemaT primers
F26H9 ExF CGGAGCCTGGAGAAGTTTATAGAA
F26H9 Ex/NonEx R GGGAAAGTCAATTTATTTTATTGCAACTAG
F26H9 NonEx F CCATAATTTTGACTCACCCTGTAGAA
W04G5 Ex F CACCGGTTGTTTTTAAGATTATATACACA
W04G5 Ex/NonEx R GTTTGTCACTTTGTTATTCTGTTTTACGA
W04G5 NonEx F CTTACCATAATTTTGACTCACCCTGTATAC
Y51A2D Ex F CTGTGTTTTAGTGTATAATTTTCCGTCAA
Y51A2D Ex/NonEx R GGTTACTGTAGGCTGGTGTTTGC
Y51A2D NonEx F TTACCATAATTTTGACTCACCCTGTAAT
Tc1 primers
T22F3 Ex F GATTATCAAAAATGGACAGCTATGTATATTCC
T22F3 Ex/NonEx R ATGACTACTGTAGCGCTTGTATCGA
T22F3 NonEx F ATCTTTTTGGCCAGCACTGTATATT
Y94A7B Ex/NonEx F GGAATGGCTAAACGTGAATATGG
Y94A7B Ex R TCCAAAAACATCACTTATGTACATGCAA
Y94A7B NonEx R GCCAGCACTGTACATGCAACA
ZK1251 Ex/NonEx F GCGTCTATTCTTATATTTTACTCTAATCAGTTG
ZK1251 Ex R CATCTCTAATTGTGCAGGTATGTATGC
ZK1251 NonEx R TGGCCAGCACTGTATGCAAA
a Primers were designed to unique flanking sequences of four different CemaT1 elements as described by ACeDB (January 2000); their chromosomal
locations are given in parentheses. First round PCR primers are designated by #1, second round PCR primer pairs by #2. Primer names reflect the cosmid in
which the particular CemaT1 element is located. F-type primers are 5Vof the putative transposase starting methionine, while R-type primers are 3Vof the stopcodon. As not all CemaT1 elements are in the same orientation at all loci, not all F- or R-type primers will have the same orientation to each other.
b Expected sizes of PCR products after nested PCR are provided (kb), with values in parentheses reflecting the size of the PCR product following excision
of the CemaT1 element.
J.C. Brownlie, S. Whyard / Gene 338 (2004) 55–64 57
relative to this endogenous internal standard. The fold
difference between the number of non-excised and excised
transposons at each locus was determined using the
formula 2(CTE–CTN), where CTE is the normalised thresh-
old cycle value for the excised transposon and CTN is the
normalised threshold cycle for a non-excised transposon.
The excision frequency at each locus was then expressed
as the percentage of transposon loci containing an exci-
sion footprint.
3. Results
3.1. CemaT1 elements are actively expressed in C. elegans
The expression profiles of CemaT1 ORFs were assessed
by examining the data from two genome-wide microarray
experiments, one determining expression levels throughout
development of C. elegans from oocyte to adult nematodes
(http://www.cmgm.stanford.edu/~kimlab/dev/), the other
Fig. 1. Detection of transposon excisions using nested PCR. (A) A CemaT1
element (at the Y92H12 locus) containing intact ITR sequences (double
arrowheads), is flanked by nested PCR primers (small arrows). (B) PCR
products derived from genomic DNA of mixed populations of the N2 strain.
Non-excised CemaT1 (1.5–1.8 kb PCR products) and CemaT1 excision
footprints (0.5–0.7 kb PCR products) are indicated (M=DNA size
markers, Invitrogen’s). DNA sequencing confirmed the presence or absence
of the CemaT1 transposon in each PCR product. Similar results were
obtained for four additional wild type strains (data not shown).
J.C. Brownlie, S. Whyard / Gene 338 (2004) 55–6458
profiling expression differences between germline and
somatic tissue (http://www.cmgm.stanford.edu/~kimlab/
germline) (Reinke et al., 2000; Kim, 2001). Based on
microarray expression profiles of 12 full-length CemaT1
ORFs, six ORFs (C52D10.5, F26H9.3, H28G03.4,
K03H6.3, T14G12.1 and W04G5.1) may be transcribed in
C. elegans. One of the six transcribed ORFs, H28G03.4,
contained a frameshift mutation within the coding region of
the catalytic domain, while the remaining five ORFs were
predicted to encode full length and functional transposase
proteins. Using reverse transcriptase PCR on total RNA
isolated from mixed stages of worms to detect full-length
CemaT1 transposase sequences, we confirmed that CemaT1
transposase transcripts are present (data not shown). Given
that the six ORFs are highly similar (>99%), it is not
possible to distinguish from the microarray analysis which
of the CemaT1 loci are actually transcribed. Examining the
six ORFs as a group, no obvious developmental or tissue-
specific trend for the expression of CemaT1 transposase was
observed, as all six ORFs are transcribed throughout the
development of C. elegans in all tissues examined, with
little variation (data not shown). The CemaT1 expression is
in stark contrast to the expression profiles observed for C.
elegans mariner and Tc3 elements. The 102 mariner ele-
ments examined showed, on average, a significantly higher
level of expression in sperm relative to oocytes, while the 11
Tc3 elements examined displayed a high level of expression
in male somatic tissue relative to other tissues (Kim et al.,
2001). However, like CemaT1, the 27 Tc1 ORFs examined
showed no tissue or developmental specific expression (data
not shown). These observed differences in expression sug-
gest that expression of mariner and Tc TEs in C. elegans are
subjected to different forms of regulation, which may be due
to adjacent sperm specific enhancers in the case of mariner
elements or male soma enhancers in the case of Tc3 (Kim et
al., 2001). Based on the observed CemaT1 expression
profiles, it is unlikely that CemaT1 TEs are located near
such enhancers.
3.2. CemaT1 excises in both somatic and germline cells of
C. elegans
To determine if CemaT1 TEs could excise from the C.
elegans genome, a PCR-based assay was developed. PCR
products of either 1.5–1.8 kb or 0.5–0.7 kb in length were
simultaneously amplified from the N2 genome using sets of
nested PCR primers that flanked CemaT1 TEs at four
different loci (K03H6, T14G12, W06G6 and Y92H12;
Fig. 1). DNA sequencing of the larger PCR products
confirmed that they contained the CemaT1 transposons
and their adjacent locus-specific flanking sequences. The
smaller PCR products were found to contain only locus-
specific sequences that flanked the CemaT1 transposon
sequences, with the CemaT1 transposon missing (Fig. 1);
presumably, the CemaT1 TEs had excised, leaving behind a
TATA excision footprint. Nested PCR was then used to
detect excisions of CemaT1 transposons in an additional six
strains of C. elegans at the same four loci examined in the
N2 strain. For four of the six additional strains, both non-
excised CemaT1 transposons and TATA excision footprints
were found at all four loci examined (data not shown). As
related Tc1 and mariner elements typically produce foot-
prints with two or three nucleotides between the TA dinu-
cleotides (Plasterk et al., 1999), we cloned and sequenced at
least three excision footprints from each locus in every
strain, and only TATA footprints were detected. Meanwhile,
at the Y92H12 locus in the AB2 and TR403 strains, only a
single 0.5 kb PCR product was amplified; a larger 1.6 kb
product, representing a non-excised CemaT1 TE, was not
detected when the two strains were first examined (see Fig.
4, G0). Sequencing of the single PCR product confirmed the
absence of the CemaT1 transposon and the presence of the
TATA excision footprint (Fig. 4). The most parsimonious
explanation for this result is that a germline excision event
had occurred at this locus in these two strains subsequent to
the divergence of these strains from N2.
3.3. Estimated excision frequencies of Tc1 and CemaT1 in
different C. elegans strains
Excision frequencies of Tc1 and CemaT1 transposons at
three different loci in the C. elegans genome were deter-
mined using a novel QPCR-based assay. In separate QPCR
reactions, either non-excised transposons (and some flank-
ing sequences) or sequences resulting from a precise exci-
sion of the transposon and subsequent gap repair were
amplified and quantified. For each locus examined, three
primers were designed: (1) a primer that flanked the
transposon, approximately 50 nucleotides from the left
Fig. 2. The QPCR assay used to estimate the frequency of TE excisions. A
common primer was used in both PCR reactions, located in the DNA
sequence adjacent to the TE (black double arrowhead). To detect and
amplify non-excised TEs, a primer (Non Ex) that spanned the ITR
sequence, its flanking TA dinucleotide, and part of the adjacent flanking
sequence was used. To detect and amplify loci that were devoid of the TE, a
primer (Ex) was designed to the predicted sequence generated after a
precise excision and subsequent repair of the excision lesion, and included
both transposon-flanking sequences and the excision footprint.
J.C. Brownlie, S. Whyard / Gene 338 (2004) 55–64 59
ITR; (2) a reverse primer that spanned the left ITR and some
of the immediately flanking nucleotides; and (3) a reverse
primer that spanned the site of a putative excision footprint
(Fig. 2). The first pair of primers would detect a non-excised
transposon, while the first and third primers would detect a
transposon excision. Amplification efficiencies for all tar-
gets (excised and non-excised transposon loci and the
internal standard 26S rRNA) were approximately equal
(results not shown), and hence, threshold cycle (CT) values
Fig. 3. Excision frequencies of three CemaT1 and three Tc1 transposons in five
transposon loci containing an excision footprint. (A) Excision frequencies of th
frequencies for the CemaT1 transposon at the F26H9, W04G5, and Y51A2D loci.
NL917, and CB4856) that were significantly different than that observed in the t
**P < 0.01; Student’s t-test). Note the difference in the scaling of the Y-axes of (A
experiments.
of the excised and non-excised transposons could be nor-
malised relative to the internal standard 26S rRNA gene
sequence, and the percentage of loci containing a transposon
excision footprint was calculated.
To verify that the QPCR-based assay could distinguish
differences in rates of transposon excision in different
strains of C. elegans, the excision frequencies of Tc1 TEs
at three loci were examined, as differences in Tc1 activity in
different C. elegans strains have been previously estimated
by comparing changes in hybridisation intensities of bands
on Southern blots (Emmons and Yesner, 1984). Although
Tc1 excisions can generate a variety of footprints, only the
most common footprint, TACATA (Plasterk, 1991), was
examined in this study. Using our assay, we observed that
two of the Tc1 loci, ZK1251 and Y94A7, excised at
essentially the same frequency as each other within each
of the five strains of C. elegans (Fig. 3A). In the N2
genome, approximately 2% of these loci were devoid of
the Tc1 TE, which is comparable to previous excision
frequency estimations (1–10%) of Tc1 (Emmons and Yes-
ner, 1984). These results suggest that despite examining
only one Tc1 footprint, the QPCR assay has not noticeably
underestimated the transposon excision frequency. The Tc1
TE located at the third locus, T22F3, excised at a frequency
approximately ninefold less than was observed for the other
two Tc1 TEs within each genome (Fig. 3A), which indicated
different C. elegans strains. QPCR was used to assess the percentage of
e Tc1 transposon at the T22F3, Y94A7, and ZK1251 loci. (B) Excision
Excision frequencies of the CemaT1 and Tc1 loci in mutator strains (TR403,
wo wild type strains, N2 and AB2 are indicated with astrices (*P < 0.05 or
) and (B). All values represent the meanF standard error for five replicate
Excision product
CAGTTATATGAG
CAGTTA TA TATGAG
Transposition product
0.5
1.0
1.5
2.0
(kb)
G0 G120 M
Fig. 4. PCR detection of germline excision and transposition events in the
TR403 strain at the Y92H12 locus. Germline excisions were observed in a
population of TR403 (G0). After f 120 generations, two PCR products
were recovered, the expected 0.5 kb product, which contained the excision
footprint, and a larger PCR product which contained a CemaT1 TE.
Sequencing of the adjacent sequence detected the presence of an additional
TA dinucleotide sequence (bold text), which was duplicated upon insertion
of the CemaT1 TE (M=DNA size markers, Invitrogen).
J.C. Brownlie, S. Whyard / Gene 338 (2004) 55–6460
that excision rates might be affected by chromosomal
position effects.
Egilmez et al. (1995) observed that the activity of Tc1 in
N2 and AB2 strains of C. elegans was similar, while in the
mutator strains TR403 (Egilmez et al., 1995) and NL917
(Ketting et al., 1997), Tc1 activity has been shown to be
considerably higher. Our QPCR assays confirmed that each
of the three Tc1 TEs examined had higher excision frequen-
cies in the TR403 and NL917 mutator strains compared to
the excision frequencies in wild type strains. In the NL917
strain, each Tc1 excised approximately three to nine times
more frequently than the corresponding locus in either of the
N2 or AB2 wild type strains, while the Tc1 TEs in the
TR403 strain excised approximately three times more fre-
quently than in wild type strains. Intriguingly, Tc1 TEs
within the CB4856 strain excised at a frequency almost
five times greater than was observed in the N2 strain.
Historically, the CB4856 strain has been considered a non-
mutator strain (Egilmez et al., 1995), although recent
evidence has shown that this strain is deficient for a
functional RNAi pathway within germline tissues (Tijster-
man et al., 2002a), which might explain the higher frequen-
cy of Tc1 excisions within this strain.
Given that the QPCR assay was sufficiently sensitive to
detect both inter and intrastrain variation of transposon
activity, three CemaT1 loci were subsequently assayed for
excision activity. Two of the three CemaT1 TEs excised
consistently at a frequency that exceeded that of the third
locus examined (Fig. 3B), which supports the idea that
excision frequencies can be influenced by general influen-
ces from chromosomal position and/or by subtle effects
from local DNA conformations and structures. The fre-
quencies at which CemaT1 excised from the N2, AB2 and
CB4856 genomes were similar to that observed for Tc1 in
the N2 strain, with between 0.5% and 2.3% of CemaT1 loci
lacking the TE. Unlike Tc1, CemaT1 did not excise at a
greater frequency in the TR403 or NL917 mutator strains.
Instead, CemaT1 excision frequencies showed a three- to
eight-fold decrease in these two mutator strains relative to
excision frequencies in the N2 strain. The reduction of
CemaT1 activity within the NL917 strain was somewhat
unexpected, as several other related mariner/Tc TEs have
shown elevated levels of activity within this strain (Plasterk,
1991; Fischer et al., 2003). Evidently, the excision activity
of CemaT1 TEs is not regulated by the same factors that
affect other members of the mariner/Tc superfamily of
transposons.
3.4. CemaT1 transpositions and inversions
Nested PCR was used to assess the stability of four
CemaT1 loci (Y92H12, K03H6, T14G12 and W04G5) in
three different C. elegans strains (N2, AB2, and TR403) after
approximately 120 generations of culturing (Fig. 4). Non-
excised TEs and excision footprints were detected for all four
loci examined in the N2 strain, as well as the K03H6,
T14G12 and W04G5 loci in the AB2 and TR403 strains.
Similarly, the CemaT1 excision footprint, TATA, at the
Y92H12 locus remained unchanged in the AB2 strain (data
not shown). In the TR403 strain however, both af 0.5 kb
PCR product, expected to contain the excision footprint, and
a largerf 1.6 kb PCR product, not previously detected at G0,
were amplified (Fig. 4). Sequencing of the 0.5 kb PCR
product confirmed the presence of an excision footprint
identical to that observed at G0, while sequencing of the
1.6 kb PCR product revealed the presence of a newly
inserted CemaT1 transposon, with an additional third TA
dinucleotide sequence flanking the ITR sequences. Evident-
ly, a CemaT1 TE had transposed back into this locus,
duplicating one of the TA dinucleotides upon insertion.
Thus, CemaT1 is an element capable of precise and targeted
transposition into TA dinucleotides within the C. elegans
genome.
For a limited number of CemaT1 TEs, the 5V to 3Vorientation of the transposon within three strains (N2,
AB2 and TR403) was determined, using a combination of
flanking and internal transposon primers (Table 2, Fig. 5).
An expected 600 bp PCR fragment (based on the genome
sequence www.wormbase.org) was amplified from all
three strains using a forward-oriented flanking primer
(K03H6_Ex#2F) and an internal CemaT1 reverse-oriented
primer (ORF_Ex_R). Unexpectedly, a similar sized prod-
uct was amplified from all three strains, although at a
lower intensity, using the same flanking primer and a
second divergent (opposite orientation) internal primer
(ORF_Ex_F; Fig. 4). This suggested that some CemaT1
transposons at this locus had inverted their orientation.
PCR amplification of the 3V end of the transposon and
flanking sequence (using the K03H6_Ex#2R primer; Ta-
ble 2) likewise suggested that inversions had occurred.
Similar results were observed at a second locus (W06G6;
Table 2). Although only two loci were examined, these
results suggest that CemaT1 TEs are capable of inverting
at every locus. Sequencing of the inverted CemaT1
transposon and flanking DNA confirmed that only the
Table 2
Inverted CemaT1 transposons
Primers Sequence adjacent to and including part of
CemaT1 ITRa
W06G6 locus (RH-end only)
W06G6_X_3V+ gaactacttaccataattttgactcaccctgTATACACAAAA
Fig. 5. Inversions of CemaT1 in C. elegans. (A) PCR was used to detect
CemaT1 transposon inversions at two loci in three different C. elegans
strains. The white dotted arrow denotes the 5Vto 3Vorientation of the CemaT1transposon (black arrow heads are ITRs). Short arrows indicate primers
used to detect ‘sense’ and ‘antisense’ orientations at each locus. (B) Short
(0.6 kb) PCR products were amplified using either the ORF_Ex_F (lane 1)
or the ORF_Ex_R (lane 2) primers in conjunction with the external Ex_3Vprimer, indicating that the transposon was present in both orientations at the
W06G6 locus. DNA sequencing confirmed that no additional TA
duplication was present in either orientation, which suggests that the
inversions were not typical excision-transposition events. Similar results
were obtained for the two loci examined in three nematode strains (results
not shown). (M= 1 kb DNA ladder, Invitrogen).
J.C. Brownlie, S. Whyard / Gene 338 (2004) 55–64 61
TEs had inverted, without any internal or flanking
sequences being affected. No additional duplicated TA
dinucleotides, indicative of an excision and subsequent
transposition of CemaT1 into the locus were detected
with these inversions. It appears that the CemaT1 TEs
had excised and ligated directly back into the locus in an
inverted orientation, in a manner similar to that seen for
the bacterial transposon Tn916 and for Tc1 TEs in non-
host mammalian cell cultures (Li et al., 1998; O’Keeffe et
al., 1999).
ORF_EX_RW06G6_EX_3V+ORF_EX_F
cctcgacttaccataattttgactcaccctgTATACACAAAA
K03H6 locus (LH-end)
K03H6_EX_5V+ORF_EX_F
ATTGATCTAcagggtgagtcaaaattatggtaagtcgagg
K03H6_EX_5V+ORF_EX_R
ATTGATCTAcagggtgagtcaaaattatggtaagtagttcc
K03H6 locus (RH-end)
K03H6_EX_3V+ORF_EX_R
gaactacttaccataattttgactcaccctgTACATTAAAT
K03H6_EX_3V+ORF_EX_F
cctcgacttaccataattttgactcaccctgTACATTAAAT
a Sequencing of the amplified products confirmed the inversion of the
CemaT1 sequences only (non-ITR CemaT1 sequences are italicised, ITR
sequences are underlined), with no apparent inversion of the adjacent
sequence up to 200 bp from the ITR sequence (data not shown; duplicated
TA sequences bolded, flanking genomic sequence plain text).
4. Discussion
The presence of seemingly intact CemaT1 TEs with
conserved transposase DNA binding structures and catalytic
motifs in C. elegans suggested that these elements could be
active within the host genome (Claudianos et al., 2002).
Our analysis of published microarray data (Reinke et al.,
2000; Kim et al., 2001) suggested that six CemaT1 ORFs
were actively expressed and like Tc1, CemaT1 transposase
ORFs are expressed continuously throughout development
in both somatic and germline tissues. Using both conven-
tional and quantitative PCR-based excision assays, we have
further shown that CemaT1 is capable of excising from the
C. elegans genome from a number of loci in several
different strains.
The microarray data indicated that Tc1 transposase is
expressed in both somatic and germline tissues, yet Tc1
mobility in wild-type strains is nevertheless restricted to
somatic cells (Emmons and Yesner, 1984). Germline-spe-
cific suppression of Tc1 activity undoubtedly protects the
germ cells from too many transposition-induced mutations.
Similarly, the majority of the CemaT1 excisions that we
detected in the N2 strain are likely somatic rather than
germline events, as the proportion of loci carrying excision
footprints was considerably lower than would be expected if
the excisions were predominantly germline-specific. Studies
on the long-term propagation of finite populations of C.
elegans and its effect on the maintenance of Tc1 TEs at a
given locus showed that if germline excisions occurred at a
frequency of 1% per generation per site, then after 70
generations, more than 50% of the population would lack
the TE at that locus (Harris and Rose, 1986). As all CemaT1
loci in the N2 strain have remained intact for over five years
(>500 generations) since the genome sequencing project
was completed (Consortium, 1998), and more than 98% of
the CemaT1 TEs at three loci that we examined still
contained non-excised TEs (Fig. 4b), it seems likely that
the majority of excisions that we detected were in somatic
tissues.
While most excisions were somatic, a single conserved
germline excision was nevertheless observed in two nema-
tode strains. The fact that this excision and a subsequent
transposition occurred at the same locus (Y92H12) sug-
gested that it was a hotspot for CemaT1 activity. Similar
preferential insertions into a single locus have been ob-
served for mariner/Tc1 and other transposons (Van Luenen
and Plasterk, 1994; Ketting et al., 1997; Guimond et al.,
J.C. Brownlie, S. Whyard / Gene 338 (2004) 55–6462
2003). QPCR-based excision assays indicated that both
CemaT1 and Tc1 TEs excised with different frequencies
from the various loci, indicating that transposon activity is
position-dependent. These differences may be due to local
chromatin structures that inhibit the transposase enzyme
from interacting with the transposon sequence. Examination
of up to 1 kb of the flanking sequence surrounding the
Y92H12 locus revealed some sequence variation among the
six strains assayed, however none of these variations were
found exclusively in the two strains (AB2 and TR403) with
germline excisions (data not shown). Thus, the immediate
flanking sequence does not seem to share any obvious
motifs that could either predispose CemaT1 elements to
undergo germline excisions in these strains, or to exclude
such excisions from occurring in other strains.
So-called mutator strains of C. elegans display high
frequencies of spontaneous mutations, presumably resulting
from an increase in Tc1 mobilisation in both germline and
somatic tissues (Ketting et al., 1997). To determine if such
CemaT1 mutator strains existed, a QPCR assay was used to
estimate the relative frequencies of TE excision in five
strains of C. elegans. The frequency at which CemaT1
excised varied among the five strains of C. elegans
examined, with the AB2 strain having marginally higher
(f 1.5 times) excision frequencies than those observed in
the CB4856 and N2 strains. While this increased activity is
not as pronounced as the increased excision frequencies
that we saw in Tc1 mutator strains, it is likely, given the
observed frequency of excisions, that CemaT1 activity
could contribute to increased mutation rates in most strains
of C. elegans. While somatic activity of transposons may
have limited impact on many eukaryotes, it could be
detrimental to C. elegans, as somatic cells in the adult do
not undergo further divisions and cannot be replaced if
they develop deleterious mutations. Increased somatic
activity of transposons has previously been attributed to
decreased longevity in both Drosophila melanogaster
(Woodruff, 1992) and C. elegans (Egilmez and Shmookler
Reis, 1994).
Unlike Tc1, CemaT1’s activity is not enhanced in the
mutator strains that we examined. While the TR403 strain
appears to affect only Tc1 activity and not other related TEs
(Egilmez et al., 1995), the NL917 strain, which is RNAi-
deficient, shows elevated activities of several related TEs,
including Tc1, -3, -4, -5 and -7 (Ketting et al., 1997). It has
been proposed that a natural function of RNAi is to protect
the genome from transposon activity (Plasterk and Ketting,
2000), and hence a deficiency in RNAi could result in
uncontrolled transposon activity. RNAi is a transcriptional
silencing process that is triggered by the presence of double-
stranded RNA (dsRNA), which is processed into short
interfering RNAs (siRNAs) that direct the sequence-specific
destruction of target RNAs by an RNA-induced silencing
complex (RISC) in a wide range of organisms (see Tijster-
man et al., 2002b; Hannon, 2002; Cerutti, 2003 for reviews).
siRNAs have been detected from Tc1 sequences in C.
elegans (Ambros et al., 2003), which could effectively
reduce transposase transcripts and prevent Tc1 activity in
non-mutator strains. Sijen and Plasterk (2003) detected Tc1-
derived dsRNAs within C. elegans, with dsRNA ITR
sequences found in the greatest abundance. They speculated
that these dsRNAs are the result of fortuitous read-through
transcription, by adjacent promoters, of the entire transpos-
able element. Such expression would allow the complemen-
tary ITR sequences to form dsRNA structures, and once
formed, would initiate the RNAi machinery. Once activated,
Tc1 expression and subsequent mobilisation are ultimately
silenced (Sijen and Plasterk, 2003).
Intriguingly, our results indicate that CemaT1 activity
was not strongly affected by RNAi suppression, and in fact,
CemaT1 activity was slightly reduced in the mutator strain
deficient for RNAi. One explanation for this may be that,
unlike Tc1, read-through transcription rarely occurs for
CemaT1 transposons, and therefore CemaT1 does not
produce sufficient dsRNA triggers, and hence siRNAs, for
effective RNAi-mediated control. While Tc1 activity in-
creased in mutator strains, CemaT1 activity decreased,
suggesting that the two types of transposons may compete
for a limiting cofactor. Several reports have found that
mariner/Tc1 TEs appear to function independently of host
factors in both in vivo and in vitro systems (Coates et al.,
1998; Lampe et al., 2000; Fischer et al., 2001, 2003).
However, it was recently observed that a DNA binding
protein, a high-mobility group protein (HMGP-1), was an
important cofactor for efficient transposition of the mariner-
like Sleeping Beauty (SB) transposon in mammalian cells
(Zayed et al., 2003). It was shown that in the absence of
HMGP-1, activity of SB was severely depressed, while
activity was dramatically increased if HMGB-1 was over-
expressed (Zayed et al., 2003). Based on Kim et al.’s
microarray data (http://www.cmgm.stanford.edu/fkimlab/
dev/) (Reinke et al., 2000; Kim, 2001), 25 Tc1 copies are
transcribed in the N2 genome, compared to a maximum of
only six for CemaT1. As the microarray analyses did not
suggest that CemaT1 was more strongly expressed than Tc1
(data not shown), it is likely that there is considerably more
Tc1 than CemaT1 transposase in the N2 strain. In mutator
strains, where Tc1 activity is increased, the difference in
transposase levels between Tc1 and CemaT1 may be further
enhanced. Consequently, if a shared cofactor is required for
the activity of these two transposons, increased Tc1 expres-
sion in mutator strains could result in suppression of
CemaT1 activity.
The inversions of CemaT1 observed at two different loci
in the C. elegans genome could also be explained by a low
abundance of CemaT1 transposase. Similar inversions of
Tc1 have been observed after Tc1 TEs were introduced into
mammalian cells (Li et al., 1998; Schouten et al., 1998). The
cause of the Tc1 inversions was thought to be the result of
poor expression of the Tc1 transposase in mammalian cells,
resulting in a suboptimal ratio of transposase to transposon
inverted terminal repeats (Li et al., 1998). The insufficient
J.C. Brownlie, S. Whyard / Gene 338 (2004) 55–64 63
amount of transposase may only facilitate an incomplete or
aborted excision and transposition event that results in the
transposon inversion. A bacterial transposon, Tn916, has
also been shown to invert within its host genome (O’Keeffe
et al., 1999), which suggests that transposon inversions may
be a more general occurrence than previously thought. How
such inversions impact upon the genome and gene expres-
sion is not known, although one might speculate that in
cases where transposons have inserted into or adjacent to
transcribed genes, transcriptional read-through of a transpo-
son sequence could generate both sense and antisense
transposon-specific RNA in cells where the transposon is
present in both orientations at different loci or on different
homologous chromosomes. Co-occurrence of sense and
antisense RNAs could result in dsRNA formation and
subsequent suppression of transposon activity through an
RNAi mechanism. It will be of interest to determine whether
Tc1 and other transposons undergo similar inversions in C.
elegans, and whether the inversions are predominantly
restricted to germline cells.
In an attempt to identify factors that regulate CemaT1
mobility, a novel QPCR-based excision assay was used to
identify nematode strains that contained highly active copies
of CemaT1. Although no CemaT1 mutator strain was
identified, it will be of interest to examine other RNAi
mutants to determine whether RNAi plays a role in sup-
pressing CemaT1 activity in C. elegans, and how regulation
of CemaT1 activity differs from that of related TEs. The
absence of any recorded mutation associated with an inser-
tion of a CemaT1 TE suggests that these elements have not
yet impacted significantly upon the C. elegans genome.
However, the low copy number and low sequence variation
of CemaT1 (Claudianos et al., 2002) suggests that this
transposon is a relatively new arrival to the nematode’s
genome, and given its modest level of activity, it will
undoubtedly contribute to the genetic variation of this
species over time.
The QPCR assay described is a highly sensitive tech-
nique for measuring the frequency of precise transposon
excisions, and is a relatively inexpensive and easy assay to
perform. Admittedly, the QPCR assay may underestimate
the excision frequency if a transposon generates many
different excision footprints, but for most transposons, the
majority of excision footprints are identical, with various
aberrant footprints occurring less frequently (Bryan et al.,
1990; Plasterk, 1991; Van Luenen and Plasterk, 1994;
Lampe et al., 1996). Similarly designed QPCR assays could
be used to measure the frequency of other transposons’
activities, in order to gauge the impact that TE movements
have on their host genomes. In addition to assessing the
stability of endogenous TEs, the QPCR assay could be used
to measure transgene stability. When designing a transpo-
son-based transformation vector, it is desirable to use a
transposon that is not present in the target genome, in order
to avoid subsequent transposase-mediated mobilisations.
However, even related TEs can cause transgene instability
by cross-mobilising integrated transposon vectors (Pisabarro
et al., 1991; Evgen’ev et al., 1997; Sundararajan et al.,
1999). As both germline and somatic TE mobilisations can
significantly effect gene expression, this novel QPCR assay
could be a useful and relatively straightforward method to
monitor TE and transgene stability in a broad range of host
genomes.
Acknowledgements
Nematode strains used in this study were kind gifts of the
CGC at the University of Minnesota, USA. The authors
wish to thanks N. Johnson, J. Oakeshott and D. Rowell for
critical review of the manuscript. J. Brownlie was supported
by an Australian Postgraduate Award scholarship.
References
Ambros, V., Lee, R.C., Lavanway, A., Williams, P.T., Jewell, D., 2003.
MircoRNAs and other tiny endogenous RNAs in C. elegans. Curr. Biol.
13, 807–818.
Bryan, G., Garza, D., Hartl, D., 1990. Insertion and excision of the trans-
posable element mariner in Drosophila. Genetics 125, 103–114.
Cerutti, H., 2003. RNA interference: travelling in the cell and gaining
functions? Trends Genet. 19, 39–46.
Coates, C.J., Jasinskiene, N., Miyashiro, L., James, A.A., 1998. Mariner
transposition and transformation of the yellow fever mosquito, Aedes
aegypti. Proc. Natl. Acad. Sci. U. S. A. 95, 3748–3751.
Collins, J., Forbes, E., Anderson, P., 1989. The Tc3 family of transposable
genetic elements in Caenorhabditis elegans. Genetics 121, 47–55.
Consortium, 1998. Genome sequence of the nematode C. elegans: a plat-
form for investigating biology. Science 282 (5396), 2012–2018.
Claudianos, C., Brownlie, J.C., Russell, R., Oakeshott, J.G., Whyard, S.,
2002. maT-a clade of transposons intermediate between mariner and
Tc1. Mol. Biol. Evol. 19 (12), 2101–2109.
Egilmez, N.K., Shmookler Reis, R.J., 1994. Age-dependent somatic exci-
sion of transposable element Tc1 in Caenorhabditis elegans. Mutat.
Res. 316, 17–24.
Egilmez, N.K. , Ebert II, R.H., Shmookler Reis, R.J. 1995. Strain evolution
in Caenorhabditis elegans: transposable elements as markers of inter-
strain evolutionary history. J. Mol. Evol. 40, 372–381.
Emmons, S.W., Yesner, L., 1984. High-frequency excision of transposable
element Tc1 in the nematode Caenorhabditis elegans is limited to so-
matic cells. Cell 36, 599–605.
Evgen’ev, M.B., Zelentsova, H., Shostak, N., Kozitsina, M., Barskyi, V.,
Lankenau, D.H., Corces, V.G., 1997. Penelope, a new family of trans-
posable elements and its possible role in hybrid dysgenesis in Drosoph-
ila virilis. Proc. Natl. Acad. Sci. U. S. A. 94, 196–201.
Feschotte, C., Jiang, N., Wessler, S.R., 2002. Plant transposable elements:
where genetics meets genomics. Nat. Rev., Genet. 3, 329–341.
Fischer, S.E.J., Wienholds, E., Plasterk, R.H.A., 2001. Regulated transpo-
sition of a fish transposon in the mouse germ line. Proc. Natl. Acad. Sci.
U. S. A. 98 (12), 6759–6764.
Fischer, S.E., Wienholds, E., Plasterk, R.H., 2003. Continuous exchange of
sequence information between dispersed Tc1 transposons in the Caeno-
rhabditis elegans Genome. Genetics 164 (1), 127–134.
Guimond, N., Bideshi, D.K., Pinkerton, A.C., Atkinson, P.W., O’Brochta,
D.A., 2003. Patterns of Hermes transposition in Drosophila mela-
nogaster. Mol. Genet. Genomics 268 (6), 779–790.
Hannon, G.J., 2002. RNA interference. Nature 418, 244–251.
Harris, L.J., Rose, A.M., 1986. Somatic excision of transposable element
J.C. Brownlie, S. Whyard / Gene 338 (2004) 55–6464
Tc1 from the Bristol genome of Caenorhabditis elegans. Mol. Cell.
Biol. 6, 1782–1786.
Hope, I.A. (Ed.), 1999. C. Elegans: A Practical Approach. Oxford Univer-
sity, Oxford.
Jacobson, J.W., Medhora, M.M., Hartl, D.L., 1986. Molecular structure of a
somatically unstable transposable element in Drosophila. Proc. Natl.
Acad. Sci. U. S. A. 83, 8684–8688.
Ketting, R.F., Fischer, S.E., Plasterk, R.H., 1997. Target choice determi-
nants of the Tc1 transposon of Caenorhabditis elegans. Nucleic Acids
Res. 25, 4041–4047.
Ketting, R.F., Haverkamp, T.H., van Luenen, H.G., Plasterk, R.H., 1999.
Mut-7 of C. elegans required for transposon silencing and RNA inter-
ference, is a homolog of Werner syndrome helicase and RNaseD. Cell
99, 133–141.
Kim, S.K., 2001. Functional genomics: the worm scores a knockout. Curr.
Biol. 11, R85–R87.
Kim, S.K., Lund, J., Kiraly, M., Duke, K., Jiang, M., Stuart, J.M., Eizinger,
A., Wylie, B.N., Davidson, G.S., 2001. A gene expression map for
Caenorhabditis elegans. Science 293 (5537), 2087–2092.
Lampe, D.J., Churchill, M.E.A., Robertson, H.M., 1996. A purified mari-
ner transposase is sufficient to mediate transposition in vitro. EMBO J.
15, 5470–5479.
Lampe, D.J., Walden, K.K.O., Sherwood, J.M., Robertson, H.M., 2000.
Genetic engineering of insects with mariner transposons. In: Handler,
A.M.J., James, A.A. (Eds.), Insect Transgenesis. Methods and Appli-
cations. CRC Press, Boca Raton, pp.
Li, Z.H., Liu, D.P., Wang, J., Guo, Z.C., Yin, W.X., Liang, C.C., 1998.
Inversion and transposition of Tc1 transposon of C. elegans in mam-
malian cells. Somat. Cell Mol. Genet. 24 (6), 363–369.
O’Keeffe, T., Hill, C., Ross, R.P., 1999. In situ inversion of the conjugative
transposon Tn916 in Enterococcus faecium DPC3675. FEMS Micro-
biol. Lett. 173, 265–271.
Pisabarro, A.G., Martine, W.F., Peterson, P.A., Saedler, H., Gierl, A., 1991.
Molecular analysis of the Ubiquitous (Uq) transposable element of Zea
mays. Mol. Gen. Genet. 230, 201–208.
Plasterk, R.H., 1991. The origin of footprints of the Tc1 transposon of
Caenorhabditis elegans. EMBO J. 10, 1919–1925.
Plasterk, R.H., Ketting, R.F., 2000. The silence of the genes. Curr. Opin.
Genet. Dev. 10, 562–567.
Plasterk, R.H., Izsvak, Z, Ivics, Z, 1999. Resident aliens: the Tc1/mariner
superfamily of transposable elements. Trends Genet. 15, 326–332.
Reinke, V., Smith, H.E., Nance, J., Wang, J., Van Doren, C., Begley, R.,
Jones, S.J., Davis, E.B., Scherer, S., Ward, S., Kim, S.K., 2000. A
global profile of germline gene expression in C. elegans. Mol. Cell 6,
605–616.
Schouten, G.J., van Luenen, H.G., Verra, N.C., Valerio, D., Plasterk, R.H.,
1998. Transposon Tc1 of the nematode Caenorhabditis elegans jumps
in human cells. Nucleic Acids Res. 26, 3013–3017.
Shao, H., Tu, Z., 2001. Expanding the diversity of the IS630-Tc1-mariner
superfamily: discovery of a unique DD37E transposon and reclassifi-
cation of the DD37D and DD39D transposons. Genetics 159 (3),
1103–1115.
Shapiro, J.A., 1999. Transposable elements as the key to a 21st century
view of evolution. Genetica 107, 171–179.
Sijen, T., Plasterk, R.H., 2003. Transposon silencing in the Caenorhabditis
elegans germ line by natural RNAi. Nature 20 (426 (6964)), 310–314.
Sundararajan, P., Atkinson, P.W., O’Brochta, D.A., 1999. Transposable
element interactions in insects: cross-mobilization of hobo and Hermes.
Insect Mol. Biol. 8 (3), 359–368.
Tijsterman, M., Okihara, K.L., Thijssen, K., Plasterk, R.H., 2002a. PPW-1,
a PAZ/PIWI protein required for efficient germline RNAi, is defective
in a natural isolate of C. elegans. Curr. Biol. 12 (17), 1535–1540.
Tijsterman, M., Ketting, R.F., Plasterk, R.H., 2002b. The genetics of RNA
silencing. Annu. Rev. Genet. 36, 489–519.
van Luenen, H.G., Plasterk, R.H., 1994 (Feb. 11). Target site choice of the
related transposable elements Tc1 and Tc3 of Caenorhabditis elegans.
Nucleic Acids Res. 22 (3), 262–269.
Woodruff, R.C., 1992. Transposable DNA elements and life history traits.
I. Transposition of P DNA elements in somatic cells reduces the life-
span of Drosophila melanogaster. Genetica 86, 143–154.
Zayed, H., Izsvak, Z., Khare, D., Heinemann, U., Ivics, Z., 2003. The
DNA-bending protein HMGB1 is a cellular cofactor of Sleeping Beauty
ransposition. Nucleic Acids Res. 31 (9), 2313–2322.
