View
236
Download
2
Category
Preview:
Citation preview
9th International Scientific Conference
THE VITAL NATURE SIGN May 14 – 16, 2015
Kaunas, Lithuania
ABSTRACT BOOK
ISSN 2335-8653
2
Scientific Committee
1. Prof. Habil. Dr. Audrius Maruška, Vytautas Magnus University, Lithuania
2. Prof. Habil. Dr. Algimantas Paulauskas, Vytautas Magnus University,
Lithuania
3. Prof. Stellan Hjerten, Uppsala University, Sweden
4. Prof. Hartmut Frank, University of Bayreuth, Germany
5. Prof. Dr. Jolanta Liesienė. Kaunas University of Technology, Lithuania
6. Prof. Dr. Liudvikas Pranevičius, Vytautas Magnus University, Lithuania
7. Prof. Dr. Vitalis Briedis, Lithuanian University of Health Sciences, Lithuania
8. Prof. Dr. Douglas Westerlund, Uppsala University, Sweden
9. Prof. Dr. Staffan Nilsson, Lund University, Sweden
10. Prof. Olav Rosef, Telemark University College, Norway
11. Prof. Dr. Ute Pyell, University of Marburg, Germany
12. Dr. Akos Vegvari. Lund University, Biochemical center, Sweden
13. Dr. Susanne Wiedmer, University of Helsinki, Finland
14. Dr. Nicola Tiso, Chromatography Institute of the CNR, Italy
Organizing Committee
Chairman: Prof. Habil. Dr. Audrius Maruška, Vytautas Magnus University, Lithuania
1. Dr. Ona Ragažinskienė, Vytautas Magnus university, Kaunas, Lithuania
2. Prof. Dr. Algirdas Raila, Aleksandras Stulginskis University, Kaunas Lithuania
3. Asoc. Prof. Dr. Saulius Šatkauskas, Vytautas Magnus University, Lithuania
4. Prof. Dr. Gintas Saulis, Vytautas Magnus University, Lithuania
5. Dr. Saulius Mickevičius, Vytautas Magnus University, Lithuania
6. Tomas Drevinskas, Vytautas Magnus University, Lithuania
7. Kristina Bimbiraitė-Survilienė, Vytautas Magnus University, Lithuania
8. Mantas Stankevičius, Vytautas Magnus University, Lithuania
9. Jurgita Mikašauskaitė, Vytautas Magnus University, Lithuania
10. Dr. Violeta Bartkuvienė, Vytautas Magnus University, Lithuania
11. Dr. Vilma Kaškonienė, Vytautas Magnus University, Lithuania
12. Dr. Rūta Mickienė, Vytautas Magnus University, Lithuania
13. Gintarė Naujokaitytė, Vytautas Magnus University, Lithuania
14. Academic youth society Modusas, Vytautas Magnus University, Lithuania
Abstract speech of authors were not edited
© Vytautas Magnus University, 2015
BAR CODE 9772335865005
ISSN 2335-8653
3
Tomas Drevinskas, Audrius Maruška Applications and Future Perspectives of Contactless
Impedance Measuring Detectors for Capillary Electrophoresis.........................................................
14
Tautvydas Jakevičius, Audrius Maruška, Tomas Drevinskas Optimization Of Phenolic Compounds
Extraction Procedure From Coal Tar ................................................................................................ 15
Karolina Kalasauskaitė, Vilma Kaškonienė, Gintarė Naujokaitytė The Evaluation of Interaction of
Several Antioxidants by Spectrophotometric Methods Karolina Kalasauskaitė, Vilma Kaškonienė,
Gintarė Naujokaitytė.......................................................................................................................... 16
Agnė Katilevičiūtė, Jurgita Mikašauskaitė, Vilma Kaškonienė Comparison Of Antioxidant
Properties In Bee Pollen Fermented By Lactic Acid Bacteria ......................................................... 17
Skaistė Mikulytė, Vilma Kaškonienė The Impact Of Lactic Acid Bacteria Fermentation On
Phytochemical Composition Of Bee Pollen ..................................................................................... 18
Justina Stasiulionytė, Ona Ragažinskienė, Violeta Bartkuvienė Chemical Analysis Of Biologically
Active Compounds Of Ground Ivy (Glechoma Hederacea L.) Using Gas Chromatography/Mass
Spectrometry (Gc/Ms) Method ......................................................................................................... 19
Eurika Sukackaitė, Ona Ragažinskienė, Violeta Bartkuvienė Extraction From The Medicinal Raw
Material Of Glechoma Hederacea L. Optimization By Using Spectrophotometric Methods For
Total Amount Of Phenolic Compounds And For Evaluation Of Antioxidant Activity ................... 20
Rūta Kuleševičiūtė, Ona Ragažinskienė, Violeta Bartkuvienė Determination Of Total Phenolic
Compounds Content In Rhaponticum Carthamoides (DC. Iljin) By Spectrophotometry Method In
Different Vegetation Phases ............................................................................................................. 21
Andrius Aleliūnas, Gintaras Brazauskas Association Of Single Nucleotide Polymorphisms With
Freezing Tolerance Traits In Perennial Ryegrass ............................................................................. 22
S.Bogačiovienė, L.Česonienė, R.Daubaras, A.Paulauskas, J.Žukauskienė DNA Analysis Of 6
Actinidia L. Cultivars Using SSR Method ....................................................................................... 23
J.Dailidavičienė, R.Budreckienė, R.Gružauskas, S.Kerzienė, S.Makauskas The Dynamic Of
Productivity And Somatic Cell Count In Milk Of Lithuanian Black-And-White Cattles On The
Influence Of Probiotic Additives And Multienzyme Composition .................................................. 24
Agnese Huna,Laura Klavina, Diana DudareChemical Composition And Biological Activity Of Bog
Bilberries And Blueberries .............................................................................................................. 25
Laura Klavina, Gunta Springe, Diana Dudare Extraction And Analysis Of Moss Secondary
Metabolites ....................................................................................................................................... 26
Kamila Gajduskova, Ondrej Sedo, Eva Drozdova27Anthropo-Genetical Exploration Of Human
Skeletal Remains From Archeological Site Rousínov – Ferobet.......................................................17
ISSN 2335-8653
4
Matas Galdikas, Jana Radzijevskaja, Algimantas Paulauskas Genetic Characteristic Of
Dermacentor Reticulatus Ticks Using 12S And 16S Rrna Markers ................................................ 28
Nptx2 And Chi3l1 Genes Promoters Methylation Status And Expression Level In Different Grade
Of Gliomas I. Golubickaitė, R. Stakaitis, D. Skiriutė, P. Vaitkienė, A. Kazlauskas, A. Bunevičius,
G. Steponaitis .................................................................................................................................... 29
Hazel Dormouse (Muscardinus Avellanarius) Genetic Variability Research In LithuaniaKamilė
Morkutė, Algimantas Paulauskas, Vaclovas Gedminas .................................................................... 30
Comparison Of Cyclosporine And Erythropoietin In The Experimental Model Of Acute Myocardial
Injury AlesyaV. Korda, VolhaF.Kardash, Natalia G.Tihonova ........................................................ 31
The Yeasts Strains Isolated From The Berries In Lithuania And Belarus Irina Kolesnik, Juliana
Lukša, Živilė Strazdaitė-Žielienė, Ramunė Stanevičienė, Vytautas Melvydas, Elena Serviene ....... 32
Odontological Problem In Ophthalmological Practice Aušra Povilauskienė, Albertas Kriaučiūnas,
Regina Marija Stakaitytė, Rasa Liutkevičienė, Loresa Kriaučiūnienė .............................................. 33
Occurence Of Methicillin-Resistant Staphylococci In Broilers And Wild Birds Lina Vaškevičiūtė,
Modestas Ružauskas, Rita Šiugždinienė, Irena Klimienė, Marius Virgailis, Raimundas Mockeliūnas
Phototropic Responses Of Garden Cress Leaves To Ultraviolet-A And Blue Light In Artificial
Microgravity EnvironmentR. Losinska-Sičiūnienė, R. Stanevičienė, D. Švegždienė, D. Raklevičienė
........................................................................................................................................................... 35
Genetic Diversity In Vaccinium Corymbosum, V. Australe, And V. Angustifolium Based On
Microsatellite Analysis ...................................................................................................................... 36
D. Mardosaitė-Busaitienė1, R. Rugienius3, J.Žukauskienė1, A.Paulauskas1, S.Bogačiovienė1,
L.Česonienė2, R.Daubaras2 ................................................................................................................ 36
Synergistic And Antagonistic Interactions Between Secondary Metabolites In Monarda Didyma L.
And Angelica Archangelica L. .......................................................................................................... 37
Ruta Mickiene1, Ona Ragazinskiene2, Audrius Sigitas Maruska1 ..................................................... 37
Morphological Identification Of Digenean Isthmiophora Melis (Digenea: Echinostomatidae) From
Mustelids In Lithuania ....................................................................................................................... 38
Dovilė Nugaraitė, Vytautas Mažeika, Algimantas Paulauskas ......................................................... 38
Investigation Of Tick-Borne Pathogens In Baltic Countries ............................................................. 39
Algimantas Paulauskas ...................................................................................................................... 39
Staphylococcus Hominis Isolated From Hospital Patient Resistance To Antibiotics And Resistance
To Antimicrobial Genes .................................................................................................................... 40
Alvydas Pavilonis, Rita Plančiūnienė, Žaneta Maželienė, Povilas Kavaliauskas, Modestas
Ružauskas, Marius Virgailis, Irena Klimienė, Rita Šiugždinienė, Raimundas Mockeliūnas ........... 40
ISSN 2335-8653
5
Synthesis And Characterizations Of Silver Nanoparticles Using Black Currant Extract ................. 41
Judita Puišo1, Matas Damonskas1, Paulius Danilovas2 ..................................................................... 41
Copper Effects On The Growth Of Common Duckweed (Lemna Minor L.).................................... 42
Jūratė Žaltauskaitė 1, Giedrė Pėstininkaitė 2 ...................................................................................... 42
Selection Of AP-PCR Markers And Conditions For Hypericum Maculatum Crantz ....................... 43
Gianni Barcaccia1, Giulio Galla1, Lina Zybartaitė2, Indrė Railienė 2, Algimantas Paulauskas2,
Eugenija Kupčinskienė2 ..................................................................................................................... 43
Genes Encoding Antimicrobial Resistance In Methicillin-Resistant Staphylococcus Haemolyticus
Isolated From Humans And Dogs ..................................................................................................... 44
Modestas Ružauskas, Rita Plančiūnienė, Marius Virgailis, Irena Klimienė, Rita Šiugždinienė, Lina
Vaškevičiūtė, Raimundas Mockeliūnas, Alvydas Pavilonis ............................................................. 44
Dirofilaria Repens Infection In Lithuania ......................................................................................... 45
Vytautas Sabūnas1,2, Povilas Sakalauskas1, Algimantas Paulauskas1, Jana Radzijevskaja1 ............. 45
Light As A Tool For Manipulation Of Plant Responses - Morphogenetic Effects (Part I) ............... 46
Giedrė Samuolienė1,2, Akvilė Viršilė1, Aušra Brazaitytė1, Alina Čeidaitė1, Pavelas Duchovskis1,2 . 46
The Prevelence Of Tick Born Pathogens In Small Mammals In Lithuania ...................................... 47
Karolis Sivickis1, Paulauskas Algimantas Paulauskas1, Jana Radzijevskaja1, Vaclovas Gedminas2,
Linas Balčiauskas3 ............................................................................................................................. 47
Analysis Of Bacteria Sensitivity To Encapsulated Nisin .................................................................. 48
Ramunė Stanevičienė1, Juliana Lukša1, Rūta Žiukelytė1,2, Regina Losinska-Sičiūnienė1, Tatjana
Krivorotova2, Jolanta Sereikaitė2, Elena Servienė1,2 ......................................................................... 48
Selection Of Amplified Fragment Length Polymorphism Markers For Investigation Of Genetic
Diversity Of Impatiens Parviflora ..................................................................................................... 49
Kristė Stravinskaitė1, Lina Zybartaitė1, Eugenija Kupčinskienė1, Walter Durka2 ............................ 49
Saccharomyces Cerevisiae K2 Toxin Fusion With GFP................................................................... 50
Živilė Strazdaitė-Žielienė1, Iglė Vepštaitė1, Lukas Birgiola1,2, Elena Servienė1,2............................. 50
Freshwater Bryozoa Study In Lithuania: Past And Present .............................................................. 51
J.Rutkauskaitė- Sucilienė, I. Šatkauskienė ........................................................................................ 51
Effects Of The Urban Environmental Conditions On The Physiology Of Two Biological Indicators
........................................................................................................................................................... 52
ISSN 2335-8653
6
Gintarė Sujetovienė, Vilma Galinytė ................................................................................................ 52
Studies On Green Synthesis, Characterization And Anti Proliferative Potential Of Silver
Nanoparticles Using Medicinal Plants Collected From Yelagiri Hills ............................................. 53
Giridharan.T*1, Chandran. M1, Sindhu. S2, Arumugam. P2 ............................................................... 53
Metrology In Radiotherapy: Tlds In Brachytherapy Case................................................................. 54
Benas G. Urbonavičius1, Diana Adlienė1, Paulius Kaškonas ............................................................ 54
Detection Of Bacteria And Fungi By Multiplex Real-Time PCR And FRET Technique ................ 55
Máté Vadovics, Rita Anyanwu .......................................................................................................... 55
Association Of Genetic Variants In PNPLA3, MERTK, PCSK7 And RNF7 With Liver Cirrhosis .. 56
Irena Valantienė1, Juozas Kupčinskas1, Greta Varkalaitė2*, Gediminas Kiudelis1, Vitalija
Petrenkienė1, Jolanta Šumskienė1, Limas Kupčinskas1 ..................................................................... 56
Current Distribution And The Diversity Of Babesia Canis Strains In Europe ................................. 57
Linas Venslovaitis, Jana Radzijevskaja, Asta Aleksandravičienė, Vytas Sabūnas, Dalytė
Mardosaitė-Busaitienė, Algimantas Paulauskas ................................................................................ 57
Stargardt’s Macular Dystrophy: Clinical Case .................................................................................. 58
Alvita Vilkeviciute², Mantas Banevicius¹, Arvydas Gelzinis¹, Brigita Glebauskiene¹, Loresa
Kriauciuniene¹,², Rasa Liutkeviciene1,2 ............................................................................................. 58
MMP-2 Rs24386 (C→T) Polymorphism And The Phenotype Of Early Age-Related Macular
Degeneration ...................................................................................................................................... 59
Alvita Vilkeviciute², Rasa Liutkeviciene¹,², Vaiva Lesauskaite³, Giedre Sinkunaite-Marsalkiene³,
Loresa Kriauciuniene¹,², Dalia Zaliuniene¹ ........................................................................................ 59
Cadmium Effects To The Growth Of Thymes (Thymus Vulgaris) And Their Extracts Quality ...... 60
Jūratė Žaltauskaitė, Audronė Minelgaitė ........................................................................................... 60
Connexin - Dependent Migration of Cancer Cells ............................................................................ 61
Mindaugas Žukauskas, Lina Rimkutė, Ieva Antanavičiūtė ............................................................... 61
Cellular Response To Ionizing Radiation: Application Of Different Murine Models ...................... 62
Vaidotas Stankevičius1,2, Rimantė Čeponytė1,2, Diana Schveigert1, Jonas Venius1, Konstantinas P.
Valuckas1, Eduardas Aleknavičius1,3, Ričardas Rotomskis1,4 and Kęstutis Sužiedėlis1,2.................. 62
Mutation Identification In Sucrose Synthase 1 Gene And It’s Impact On Cold Acclimation In
Winter Wheat ..................................................................................................................................... 63
ISSN 2335-8653
7
Rita Armonienė, Gintaras Brazauskas ............................................................................................... 63
The Impact Of Supplemental Blue And Green LED And HPS Lamps Lighting Effects On The
Photosynthesis Parameters Of Sweet Pepper Transplants ................................................................. 64
Aistė Bagdonavičienė1, Julė Jankauskienė1, Irena Januškaitienė2, Skirmantė Deksnytė2, Pavelas
Duchovskis1,3, Aušra Brazaitytė1 ....................................................................................................... 64
Separation Of Surfactin From B.Subtilis Suspension And It‘S Antibacterial Effect ........................ 65
Evaldas Bolskis, Lina Ragelienė ....................................................................................................... 65
The Effect Of Crop Load On Pigment And Macro Element Quantity In Malus Domestica With P22
Rootstocks ......................................................................................................................................... 66
Alina Čeidaitė, Darius Kviklys, Pavelas Duchovskis, Giedrė Samuolienė ....................................... 66
Identification and Characterization of NADPH-oxidase Genes in Domestic Apple (Malus ×
domestica Borkh.) .............................................................................................................................. 67
Darius Čepauskas1, Danas Baniulis2, Gražina Stanienė2, Inga Miliūtė2, Vidmantas Stanys2 .......... 67
The Effect of Photosynthetic Photon Flux Density on Cucumber Transplants Growth Indoors ...... 68
Skirmantė Deksnytė1, 2*, Aistė Bagdonavičienė1, Aušra Brazaitytė1, Julė Jankauskienė1, Pavelas
Duchovskis1, Giedrė Samuolienė1 ..................................................................................................... 68
The Influence Of Fermented With Certain Lactic Acid Bacteria Satureja Hortensis On The Quality
And Technological Parameters Of Pork And Beef Loin ................................................................... 69
Erika Mozuriene1*, Elena Bartkiene1, Grazina Juodeikiene2, Daiva Zadeike2, Audrius Maruska3,
Ona Ragazinskiene4 ........................................................................................................................... 69
Removal Of Heavy Metals By Fungal Biomass And Its Polysaccharides ........................................ 70
Emanuela Galli .................................................................................................................................. 70
Pathogen Elicitor Induced ROS Production And Gene Expression In Apple (Malus × Domestica)
Cell Suspension ................................................................................................................................. 71
Rimantė Grencevičiūtė1, Gražina Stanienė2, Inga Miliūtė2, Algirdas Kaupinis3, Mindaugas Valius3,
Danas Baniulis2 ................................................................................................................................. 71
Light Spectral Effects On Alkaloid Contents In Catharanthus Roseus ............................................ 72
Laurita Grigaitytė1, Akvilė Viršilė2, Ramūnas Sirtautas, Aušra Brazaitytė ...................................... 72
The Influence Of Nitrogen Fertilizers On Winter Wheat Quality Indicators .................................... 73
Aistė Juchnevičienė1, Ilona Vagusevičienė1, Aušra Brazaitytė2, Pavelas Duchovskis1,2 .................. 73
ISSN 2335-8653
8
Cloning And Expression Of Transmembrane Domain Segments Of Arabidopsis Thaliana RBOH D
Enzyme .............................................................................................................................................. 74
Andrius Kočevas1, Kristina Druceikaitė2, Danas Baniulis2 ............................................................... 74
Rich By Collagen Recycled Solid Waste Of Leather As Nitrogen Source For Agriculture ............. 75
Ineta Komiciute, Ilona Jonuskiene, Justa Sirvaityte, Virgilijus Valeika ........................................... 75
Nitrogen And Micro-, Macroelement Ratios In Current-Year Needles Of Juniperus Communis L.
Lithuania Populations ........................................................................................................................ 76
Edvina Krokaitė, Ramūnas Vilčinskas, Lina Zybartaitė, Algimantas Paulauskas, Eugenija
Kupčinskienė ..................................................................................................................................... 76
The Effect Of Light-Emitting Diodes Spectra On Mineral Elements Content In Brassicaceae
Microgreens ....................................................................................................................................... 77
Birutė Lekstutytė1, Akvilė Viršilė2, Aušra Brazaitytė2, Viktorija Vaštakaitė2 .................................. 77
Chitin Characterization Of Two Baltic Sea Shrimp Species: Palaemon Elegans And Crangon
Crangon ............................................................................................................................................. 78
Evaldas Lelešius1,2, Murat Kaya2, Vaida Tubelytė 1, Radvilė Nagrockaitė1,2, Vykintas Baublys1 ... 78
Studies Of Lactococcus Lactis Infection By Phage C2 ..................................................................... 79
Vygandas Marozas, Inga Žievytė, Rimantas Daugelavičius ............................................................. 79
Water Pollution By Pharmaceuticals: Assessment Of Ibuprofen Tolerance, Phytometabolisation
And Phytoremediation Potential In Model Plant Species Of The Riparian And Aquatic Ecosystems
........................................................................................................................................................... 80
Fabrizio Pietrini, Valentina Iori, Daniela Di Baccio, Massimo Zacchini.......................................... 80
Effect Of Salinomycin, Antimycin, Sodium Phenylbutyrate And Glucose Deprivation On Cancer
Cell Viability And Mobility .............................................................................................................. 81
Gintarė Milašiūtė1,2, Sandra Puidokaitė1, Ieva Ceslevičienė1, Ieva Antanavičiūtė1, Valeryia
Mikalayeva1 ....................................................................................................................................... 81
A Physicochemical Characterization Of Chitin Extracted From Edible Lithuanian Mushrooms ..... 82
Radvilė Nagrockaitė1,2, Murat Kaya2, Vykintas Baublys1, Evaldas Lelešius1,2, Vaida Tubelytė1 .... 82
HIF-1 Is Indirectly Involved In Hypoxia Dependent Splicing Regulation ....................................... 83
Egle Jakubauskiene1, Inga Pečiulienė1, Laurynas Vilys1, Arvydas Kanopka1 ................................ 83
Characteristics Of Polymorphic Markers For Juniperus Communis L. From Lithuania .................. 84
ISSN 2335-8653
9
Ramūnas Vilčinskas, Lina Zybartaitė, Audrius Petrauskas, Algimantas Paulauskas, Eugenija
Kupčinskienė ..................................................................................................................................... 84
Serum Albumin Corona on ZnO NPs has Opposite Effect in Cellular and Mitochondrial Toxicity
Experimental Models ......................................................................................................................... 85
Karolina Rilskytė1, Zita Naučienė1, Valentinas Snitka2, Rasa Žūkienė1 ........................................... 85
Modified pyridine nucleotides in biosynthesis of DNA .................................................................... 86
Algirdas Mikalkėnas1, Bazilė Ravoitytė1, Daiva Tauraitė2, Rolandas Meškys2, Saulius Serva1,3 .... 86
Investigations Of Resistance To Cold And Hardening In Vitro Of Rosaceae Family Plants ........... 87
Rytis Rugienius1, Lina Šnipaitienė2 .................................................................................................. 87
Amino Acid Impact On Rape (Brassica Napus L.) Germination ...................................................... 88
Kristina Teiserskyte, Ilona Jonuskiene, Justa Sirvaityte, Virgilijus Valeika..................................... 88
The Effect Of Light-Emitting Diodes Photoperiod On Tocopherols Content In Brassicaceae
Microgreens ....................................................................................................................................... 89
Monika Valaitytė1, Akvilė Viršilė2, Aušra Brazaitytė2, Viktorija Vaštakaitė2, Julė Jankauskienė2,
Ramūnas Sirtautas2 ............................................................................................................................ 89
The Impact Of Supplemental UV-A Irradiation On Phytochemical Content Of Microgreens In
Greenhouse ........................................................................................................................................ 90
Viktorija Vaštakaitė, Akvilė Viršilė, Aušra Brazaitytė, Julė Jankauskienė, Ramūnas Sirtautas ...... 90
The Concentration of Non-essential Elements in Lithuania Populations of Juniperus communis L. 91
Edvina Krokaitė, Ramūnas Vilčinskas, Lina Zybartaitė, Algimantas Paulauskas, Eugenija
Kupčinskienė ..................................................................................................................................... 91
Light as a Tool for Manipulation of Plant Responses – Internal and External quality (Part II)........ 92
Akvilė Viršilė1, Giedrė Samuolienė1,2, Aušra Brazaitytė1, Viktorija Vaštakaitė1, Ramūnas Sirtautas1,
Pavelas Duchovskis1,2 ........................................................................................................................ 92
Extraction And Characterization Of Chitins From Coackroach Ootheca ......................................... 93
Murat Kaya1, Mujtaba Muhammad1, Bahar Akyuz1, Esra Bulut1, Karwan Sofi1, Laura Zelencova1,2,*
........................................................................................................................................................... 93
Selection Of Inter-Simple Sequence Repeat Markers For Investigation Of Genetic Diversity Of
Impatiens Spp. Populations ............................................................................................................... 94
Lina Zybartaite, Edita Sajonaite, Rasa Janulioniene, Eugenija Kupcinskiene, Algimantas Paulauskas
........................................................................................................................................................... 94
ISSN 2335-8653
10
A Research of a Behaviour of Saccharomyces Family Yeast in Contact with PAHs ....................... 95
VioletaVaitkeviciene1, Mantas Vaitkevicius2, Neringa Venslauskaite1 ............................................ 95
Antibiotic-Resistant Bacteria Isolated From Dairy Cattle With Endometritis .................................. 96
Mindaugas Levickis1*, Vytuolis Žilaitis1, Anita Rokaitytė2, Irmantas Rokaitis2 .............................. 96
Evaluation of cannabidiol and plant antioxidant activity dynamics in Lithuania cultivated Cannabis
sativa L. ............................................................................................................................................. 97
Ignas Popa1, Vidmantas Dirsė2, Guoda Kiliuvienė3 .......................................................................... 97
Determination Of Changes Of Common Lungwort (Pulmonaria Officinalis L.) Composition Of
Biologically Active Substances During Different Phenological Phases Using Instrumental Analysis
Methods ............................................................................................................................................. 98
Simonas Juodis1, Audrius Maruška1, Ona Ragažinskienė2 ................................................................ 98
Platinum Group Metals Measurement In Used Automobile Catalyst With Two Pulse LIBS Method
........................................................................................................................................................... 99
Deivydas Kiznys1, Karolis Gedvilas1, Valdas Girdauskas1,2 ............................................................. 99
Influencing factors of chemical element accumulation in peat and ................................................ 100
peat humic substances ..................................................................................................................... 100
Diana Dudare1, Maris Klavins1 ....................................................................................................... 100
Ectoparasites From Nests And Burrows Of Swallow (Hirundinidae) In Lithuania ........................ 101
I. Lipatova1, E. Šukauskaitė1, V. Matulaitytė1, A. Paulauskas1, J. Radzijevskaja1, A. Petraitis ..... 101
Stable Isotope Method For Tracing The Poultry Farm Environment .............................................. 102
Raminta Skipitytė1, Agnė Mašalaitė1, Andrius Garbaras1, Rūta Mickienė2, Ona Ragažinskienė3,
Bronius Bakutis4, Jūratė Šiugždaitė4, Violeta Baliukonienė4, Saulius Petkevičius4, Audrius Sigitas
Maruška2 ir Vidmantas Remeikis1 ................................................................................................... 102
Formation Of Nanoclusters On Pre-Expanded Polystyrene Beads ................................................. 103
Šarūnas Varnagiris, Darius Milčius ................................................................................................. 103
High Precision Parallel Implementation Of Four-Particle Harmonic Oscillator Transformation
Brackets For Nuclear Calculations .................................................................................................. 104
Augustinas Stepšys1 , Saulius Mickevičius2 , Darius Germanas3 , Ramutis K Kalinauskas3 ......... 104
Ab Initio Calculations Of Six-Body Systems .................................................................................. 105
Augustinas Stepšys1 , Saulius Mickevičius2 , Darius Germanas3 , Ramutis K Kalinauskas3 ......... 105
ISSN 2335-8653
11
Plasma Based Ex-Situ And In-Situ Hydrogenation Of Mg Films ................................................... 106
Dalius Girdzevicius, Darius Milcius, Marius Urbonavicius............................................................ 106
The Effect Of Foliar Spray Fertilizers On Hordeum Vulgare Resistance To Combined UV-B
Radiation And Drought Stress Effect .............................................................................................. 107
Irena Januškaitienė1, Inga Ivankova1 ............................................................................................... 107
Species Composition And Distribution Of Terrestrial Isopods (Isopoda) In Region Alytus Of
Lithuania .......................................................................................................................................... 108
Karolina Kvašnauskaitė1, Ingrida Šatkauskienė2............................................................................. 108
Characterization of low flux neutron sources by using neutron activation analysis, MCNP6
modeling and solid state nuclear track detectors ............................................................................. 109
Elena Lagzdina, Danielius Lingis, Artūras Plukis, Rita Plukienė, Darius Germanas, Jevgenij
Garankin .......................................................................................................................................... 109
The Effect Of Equal Cd And Cu Exposure In Peat Substrate On Growth And Bioaccumulation Of
Hordeum Vulgare ............................................................................................................................ 110
Irena Januškaitienė1, Martynas Klepeckas1 ..................................................................................... 110
Radiation Interaction Impact On Environment And Technology ................................................... 111
S. Mickevičius1 D. Adlienė2 ............................................................................................................ 111
Hydrogen Production By Reacting Activated Aluminum Metal With Water ................................. 112
Marius Urbonavičius, Darius Milčius ............................................................................................. 112
Safety Aspects of Higher Value Wheat Bread ................................................................................ 113
Elena Bartkiene1, Vadims Bartkevics2,3 Iveta Pugajeva2,3, Ida Jakobsone2, Vita Krungleviciute1,
Grazina Juodeikiene4, Daiva Vidmantiene4, Loreta Basinskiene4, Gerhard Schleining5 ................ 113
Optimization of Extraction of Linden Flowers Phenolics with Water Using Response Surface
Method ............................................................................................................................................. 114
Agnė Birštonaitė, Vytenis Venclovavičius, Raimondas Raudonis ................................................. 114
Growth Parameters Of Centaurium Erythraea Cell Culture In Relation To Its Chemical
Composition And Antiradical Activity ........................................................................................... 115
Anete Boroduske1, Ilva Nakurte1, Agneta Lindmane2, Madara Lazdane3, Signe Tomsone3 .......... 115
Characterization Of Plant Extracts In Cell And Tissue Culture-Based In Vitro Test Systems For
Development Of New Cosmetic Compositions For Skin Renewal And Whitening ..................... 116
ISSN 2335-8653
12
Martins Boroduskis1,2, Anna R-Stunda1,2, Elza Kaktina1, Anete Boroduske1, Ilva Nakurte1, Janis
Ancans1,2 .......................................................................................................................................... 116
Express test for honey quality ......................................................................................................... 117
Violeta Krasevič1, Bogumila Kurtinaitiene2, Justinas Kretavičius2, Violeta Čeksterytė3 ............... 117
Blueberry Genotypes for the Selection of New Cultivars with Higher Contents of Biologically
Active Compounds .......................................................................................................................... 118
Vilma Kraujalytė1, Petras Rimantas Venskutonis1, Audrius Pukalskas1, Laima Česonienė2,
Remigijus Daubaras2 ....................................................................................................................... 118
Determination Of Total Anthocyanin Content In Cranberry (Vaccinium OxycoccoL.) Fruit Using
UV Spectrophotometry .................................................................................................................... 119
Eglė Ignatavičiūtė, Asta Kubilienė1 , Guoda Kiliuvienė1 , Kristina Gaivelytė2 .............................. 119
Isotope Ratio Mass Spectrometry Application in Food Authenticity Studies ................................. 120
Andrius Garbaras, Raminta Skipitytė, Matas Pocevičius and Vidmantas Remeikis ...................... 120
Investigation of Antioxidant Activity in Medicinal Plants and Their Mixtures, Identical to
Commercial Teas, by Spectrophotometric and Chromatographic Methods.................................... 121
Liudvika Juškaitė1, Vilma Kaškonienė1, Ona Ragažinskienė2 ........................................................ 121
Formulation And Quality Evaluation Of Protective Lipstick With Oenothera Biennis L. Oil ....... 122
Ieva Kaminskienė, Zenona Kalvėnienė, Giedrė Kasparavičienė, Jurga Bernatonienė, Arūnas
Savickas ........................................................................................................................................... 122
The Application Of Chemometric Techniques For The Classification Of Bee Products: A Review
......................................................................................................................................................... 123
Vilma Kaškonienė ........................................................................................................................... 123
Variation Of Phenolic Compounds In Buckwheat Grain At Different Growth Stages ................... 124
Ilona Kerienė1, Audronė Mankevičenė1, Saulius Bliznikas2, Rūta Česnulevičienė1 ....................... 124
Impact Of L. Sakei On Dairy Cattle Production And Ruminal Processes ....................................... 125
Vita Krungleviciute1, Elena Bartkiene1, Rasa Zelvyte1, Igrida Monkeviciene1, Jone Kantautaite1,
Rolandas Stankevicius1, Grazina Juodeikiene2 ............................................................................... 125
Development And Evaluation Of Herbal Cosmeceutical For Skin Care ........................................ 126
Akash S Mali1, P Karekar*, Y Gurav*, Dr Yadav A* ..................................................................... 126
Antioxidant Activity Of Solidago L. Using HPLC- Cupric Reducing Antioxidant Capacity
(CUPRAC) Assay With Post-Column Detection ............................................................................ 127
ISSN 2335-8653
13
Mindaugas Marksa1, Justas Mačinskas1, Jolita Radušienė2, Liudas Ivanauskas1, Valdas Jakštas3 . 127
Moisture And Short-Term UV-B Radiation Effect On Nitrate And Photosynthesis In Spinacia
Oleracea .......................................................................................................................................... 128
Ingrida Odminytė1, Akvilė Viršilė2, Sandra Sakalauskienė2 ........................................................... 128
Effect Of Commercial Starter Cultures On Physicochemical ......................................................... 129
Characteristics, Microbial And Biogenic Amines Counts Composition ......................................... 129
Of Fresh Pork Sausage .................................................................................................................... 129
Anita Rokaityte1*, Gintare Zaborskiene1 ......................................................................................... 129
Analysis Of Micro- And Macro- Elements Of Lupine Seeds Bred In Lithaunia By Using Inductively
Coupled Plasma Mass Spectrometry (ICP-MS) .............................................................................. 130
Vytaute Starkute1, Elena Bartkiene1, Vadims Bartkevic2, Zita Maknickiene3, Grazina Juodeikiene4
......................................................................................................................................................... 130
Food Supplement Legislation In The Eurasian Economic Union ................................................... 131
Natalia Tsemborevitch1, Ekaterina Fedorenko ................................................................................ 131
Optimisation of Supercritical CO2 Extraction of Lycopene from Red Tomato .............................. 132
D. Urbonavičienė1,2, R. Bobinaitė1, J. Viškelis1, Č. Bobinas1, P. Viškelis1 .................................... 132
Hop as an Important Source of Phytomedicinally Active Compounds ........................................... 133
Eva Ürgeová, Natália Fehérová, Ivana Pšenáková .......................................................................... 133
Optimisation of Water Extraction of Medicinal Herbal Tea of Birch Leaves Using Response
Surface Method ............................................................................................................................... 134
Vytenis Venclovavičius, Agnė Birštonaitė, Raimondas Raudonis.................................................. 134
Phytochemical Analysis Of Bidens Tripartita L. Using Spectrophotometric And Liquid
Chromatographic Methods .............................................................................................................. 135
Gintarė Naujokaitytė1, Audrius Sigitas Maruška1, Ona Ragažinskienė2 ......................................... 135
Influence Of Different Extraction Methods Of Rosmarinic Acids Yield From Origanum Vulgare L.
Herb ................................................................................................................................................. 136
Justė Baranauskaitė*a, Jurga Bernatonienėa, Rūta Marksienėb ....................................................... 136
Comparison of Different Extraction Methods and Influence of Extraction Conditions on the Total
Phenolic Content and Antioxidant Activity of Rosemary Extracts ................................................. 137
Ugnė Čižauskaitė1, Jurga Bernatonienė1 ......................................................................................... 137
ISSN 2335-8653
14
Impact of production chemical hazard on element status of welders .............................................. 138
Tatyana M. Rybina, Victor A. Zaitsev, Liudmila S. Ivashkevich, VolhaF.Kardash ....................... 138
ISSN 2335-8653
15
Applications and Future Perspectives of Contactless Impedance Measuring Detectors
for Capillary Electrophoresis
Tomas Drevinskas, Audrius Maruška
Vytautas Magnus University, Faculty of Natural Sciences, Dept. of Biology, Vileikos str. 8 LT44404 Kaunas,
tomas.drevinskas@gmail.com
Abstract
The science of today focuses on miniaturized techniques. Contactless conductivity detectors offer
following advantages: cost effectiveness, high performance, simple integration, low energy
consumption and possibility to miniaturize. Many of applications for capillary electrophoresis and
ion chromatography coupled to first generation contactless conductivity detectors are described in
literature [1]. Recently, the advances in electronics allowed of upgrading contactless conductivity
detectors to second generation miniaturized single-chip based Capacitance-to-Digital detectors [2].
High performance, battery powered, portable wireless version of the Capacitance-to-Digital
detector is described in literature as well [3]. Hardware improvements allows second generation
Capacitance-to-Digital detectors to be used with portable capillary format instrumentation or
stand-alone robotic rover. Third generation of impedance measuring detectors for capillary format
separation includes Impedance-to-Digital systems, where spectra can be recorded during
separation process. Hardware and design aspects will be discussed during the conference.
Keywords: Capacitance-to-Digital, Contactless conductivity detector, capillary electrophoresis,
Impedance-to-Digital.
References: [1] T. Drevinskas, V. Bartkuvienė, A. Maruška, Chemija 2014, 4, 25, 206–212
[2] T. Drevinskas, M. Kaljurand, A. Maruška, Electrophoresis 2014, 16, 35, 2401–2407
[3] T. Drevinskas, A. Maruška, V. Briedis, Electrophoresis 2015, 2, 36, 292–297
ISSN 2335-8653
16
Optimization Of Phenolic Compounds Extraction Procedure From Coal Tar
Tautvydas Jakevičius, Audrius Maruška, Tomas Drevinskas
Dep. Of Biology, Vytautas Magnus University, Vileikos 8, LT-44404 Kaunas, Lithuania
Abstract
Coal tar is one of the fractions of petroleum distillation process that contains polycyclic aromatic
hydrocarbons and phenolic compounds. The aim of this work was to extract only phenolic
compounds and some heterocyclic compounds like Antraquinone from coal tar without PAH.
The majority of phenols have negative effect on human’s health because of chemical structure that
leads to low metabolic degradation level and high harmful effect. Enormous amount of phenols
and PAH contain railway sleepers impregnated with creosote.
Developing extraction method with sodium hydroxide solution makes easier the whole extraction
process from many solid or liquid matrices. This extraction method can be widely used to extract
phenols from coal tar, railway sleepers and soil as well. The extraction procedure was performed
in several steps: (I) solvent extraction of phenols using sodium hydroxide solution and (II)
cleaning of the obtained extract using solid phase extraction.
This presentation discusses the optimization of phenolic compounds extraction procedure and the
quality of this process using different concentration of sodium hydroxide as well as the importance
of this process improving quality of oil’s products.
Keywords: Phenolic compounds, HPLC, coal tar, solvent extraction, solid-phase extraction.
Acknowledgement: Tautvydas Jakevičius acknowledge support by project "Promotion of Student
Scientific Activities" (VP1-3.1-ŠMM-01-V-02-003) from the Research Council of Lithuania. This
project is funded by the Republic of Lithuania and European Social Fund under the 2007-2013
Human Resources Development Operational Programme’s priority 3. Also this project was
financed by EUSFA, Nr.(VP1-3.1-ŠMM-10-V-02-010 (BIOREM).
ISSN 2335-8653
17
The Evaluation of Interaction of Several Antioxidants by Spectrophotometric
Methods
Karolina Kalasauskaitė, Vilma Kaškonienė, Gintarė Naujokaitytė
Faculty of Natural Sciences, Vytautas Magnus University, Vileikos 8, LT- 44404 Kaunas, Lithuania
Nowadays, the demand of natural antioxidants has increased, because antioxidants can reduce or
even stop the progression of many chronic diseases and can restore damaged structures of the
human body. Antioxidants are found in various plants and are used for production of food
supplements or can be used as natural food additives. People often use different plant extracts in
order to get a stronger effect, considering only biological characteristics of a single plant.
However, the question do biologically active substances of plants inhibit or promote each other is
not answered yet.
The general purpose of this work was to evaluate the interaction between several potential
antioxidants by spectrophotometric methods. Four flavonoids (kaempherol, rutin, naringenin,
myricetin) and three phenolic acids (ferulic, caffeic and salicylic acids) were selected for the
analysis.
The total amount of phenolic compounds was evaluated by the Folin–Ciocalteu method; the total
content of flavonoids was determined by aluminium trichloride assay. There were used different
combinations of methanolic (75%) solutions of flavonoids or phenolic acids, including 2 or 3
components. The mixture of two components was mixed in three different ratios (1:1, 1:2, 2:1),
mixture of three components in 1:1:1 ratio. The absorbance of all mixtures were compared with
standard solutions absorbances.
Keywords: flavonoids, phenolic compounds, interaction between antioxidants,
spectrophotometric methods
Acknowledgements
The study was financially supported by the Research Council of Lithuania. Project „Promotion of Students’
Scientific Activities“ (grant No. PS-15-07).
ISSN 2335-8653
18
Comparison Of Antioxidant Properties In Bee Pollen Fermented By Lactic
Acid Bacteria
Agnė Katilevičiūtė, Jurgita Mikašauskaitė, Vilma Kaškonienė
Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, LT-44404 Kaunas, Lithuania
In the recent years most of research were done about the bee pollen and bee bread components and
their useful properties. Bee collected pollen is very valuable natural product. It contains a large
amount of polyphenolic compounds. Pollen consist mainly of flavonoids which may act as
potential antioxidants. According to the published data, bee bread possess higher antioxidant
activity than bee pollen. However the production of bee bread by the bees is longer process than
collection of bee pollen. This study was focused on the production of artificial bee bread. There
are no data about artificially fermented bee pollen. The main task of this analysis was to perform
the fermentation of bee pollen using lactic acid bacteria and compare its antioxidant activity with
natural bee pollen. Phenolic compounds were analysed using spectrophotometric methods with
Folin-Ciocalteau reagent and results were expressed using rutin equivalents. Flavonoids analysis
was carried out by colorimetric reaction with aluminium trichloride, results were also expressed
using rutin equivalents. 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay was used for the evaluation
of radical scavenging activity in the samples. Bee pollen fermentation process was performed by
Lactobacillus rhamnosus and Lactobacillus delbruleckii lactic acid bacteria. Fermentation lasted
from 8 to 12 days, first 2 days at 37 degrees the remaining days at 22 degrees.
Keywords: Bee pollen, fermentation, antioxidant activity, lactic acid bacteria.
ISSN 2335-8653
19
The Impact Of Lactic Acid Bacteria Fermentation On Phytochemical
Composition Of Bee Pollen
Skaistė Mikulytė, Vilma Kaškonienė
Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, Kaunas, Lithuania,
skaiste.mikulyte@gmail.com
Abstract
Bee bread is the bee pollen with added honey and bee secretions and stored in the comb. Natural
fermentation of pollen in beehive lasts for a few months. The biological value of some medicinal
plants increases after lactic acid fermentation, but there is no literature data about the artificially
fermented pollen collected by bees. The aim of this study was to get product similar to the bee
bread, which has higher biological value compared to the natural bee pollen. Fermentation of bee
pollen was performed by lactic acid bacteria, namely Lactobacillus rhamnosus and Lactobacillus
delbruleckii. The influence of different parameters (medium composition, pH, temperature,
duration) to fermentation process was determined. Free radical 2,2-diphenyl-1-picrylhydrazyl
(DPPH) scavenging activity and total amounts of phenolic compounds and flavonoids were
evaluated using spectrophotometric methods.
Keywords: Bee pollen, fermentation, lactic acid bacteria, flavonoids, antiradical activity
Acknowledgements
The study was financially supported by the Research Council of Lithuania. Project „Promotion of Students’ Scientific
Activities“ (grant No. PS-15-08).
ISSN 2335-8653
20
Chemical Analysis Of Biologically Active Compounds Of Ground Ivy
(Glechoma Hederacea L.) Using Gas Chromatography/Mass Spectrometry
(Gc/Ms) Method
Justina Stasiulionytė1, Ona Ragažinskienė1, Violeta Bartkuvienė1
1Vytautas Magnus University, Faculty of Natural Sciences, Dept. of Biology, Vileikos 8, LT44404 Kaunas
Abstract
The present study deals with the composition of Glechoma hederacea L. six species from Kaunas
Botanical Garden of Vytautas Magnus University of different vegetation periods: buddying 2013,
buddying 2014, start of blossoming, massive blossoming, end of blossoming and frudification.
Essential oils produced by hydrodistillation were analysed using GC and GC / MS methods.The
most predominant compound was germacrene D (3.73-3.99%) and eucalyptol (3.67-4.11%). The
other major constituents were myrcene (3.07%), γ-pinene (2.83%), menthol (3.68-3.72%),
germacrene B (3.86-4.52%), estragole (5.05-5.30%), thymol (3.92-4.91%), β-elemene (3.56-
4.16%), carvacrol (5.42-5.83%), hexanol (3.32%), methyl- eugenol (4.50%). Germacrenes A, B
and C are less stable than germacrene D and they may be sometimes converted into β-, γ- and δ-
elemenes under GC conditions. Glechoma hederacea is known in traditional medicine. Its dried
leaves, flowers, stems contains more than 20 different essential oils.
Keywords: Gas chromatography, Glechoma hederacea L.
ISSN 2335-8653
21
Extraction From The Medicinal Raw Material Of Glechoma Hederacea L.
Optimization By Using Spectrophotometric Methods For Total Amount Of
Phenolic Compounds And For Evaluation Of Antioxidant Activity
Eurika Sukackaitė1, Ona Ragažinskienė1, Violeta Bartkuvienė1
1Vytautas Magnus University, Faculty of Natural Sciences, Dept. of Biology, Vileikos 8, LT44404 Kaunas
Lots of studies with medical raw material are being done because the need of herbal
medical products is rapidly increasing. Scientists are trying to find the most efficient technological
solutions. There is a great interest in herbal raw antioxidant activity. Antioxidants counteract
againts the progression of many chronic diseases. Phenolic compounds are natural antioxidants
and they can improve blood circulation, inhibit fat peroxidation and have anti-inflammatory effect.
Phenolic compounds are found in plants as secondary metabolites.
Glechoma hederacea L. is a potential, not fully known herb what gives an
inspiration to work harder with this plant. Besides, this herb is not mentioned in pharmacopoeial
articles although there is a huge amount of information that Glechoma hederacea L. could be very
useful in pharmacy. Glechoma hederacea L. is a widespread herb of the Nepetoideae subfamily
which is also known as ground ivy. It grows widely in Europe, southwestern Asia and has been
introduced to North America.
Spectrophotometric method enables to detect and evaluate phenolic compounds in
Glechoma hederacea L. This method is based on sample solution’s chemicals ability to absorb the
light. Extraction optimization must be done to obtain the best results. It allows to find out how to
get maximum of phenols. Two types of solvents were used in this study: methanol and ethanol.
0,2 g of five different plant life stages medical raw was filled up with 20 ml of different solvent.
After 24 hours of shaking they were filtered and analyzed spectrophotometrically. 100 of a
sample was mixed with 3 ml of 20% sodium carbonate solution and 100 of Folin – Ciocalteu
reagent (2N). Sample was incubated in room temperature for 30 min and then measured at 760
nm. Quantification was done with respect to the standard calibration curve of rutin. The biggest
amount of phenolic compounds was found in butonization phase, in phase when plant started
flowering and when Glechoma hederacea L. ripened it’s fruit. Many other researches need to be
done using different extraction conditions to get the biggest quantity of phenols.
Keywords: extraction optimization, Glechoma hederacea L., antioxidant activity.
References should be listed as below: [1] A. Matkowski, Adv Clin Exp Med, 2008, 17, 615-624, ISSN 1230-025X. Antioxidant Activity of Extracts and
Different Solvent Fractions of Glechoma hederacea L. and Orthosiphon stamineus (Benth.) Kudo.
ISSN 2335-8653
22
Determination Of Total Phenolic Compounds Content In Rhaponticum
Carthamoides (DC. Iljin) By Spectrophotometry Method In Different
Vegetation Phases.
Rūta Kuleševičiūtė1, Ona Ragažinskienė1, Violeta Bartkuvienė1
1Vytautas Magnus University, Faculty of Natural Sciences, Dept. of Biology, Vileikos 8, LT44404 Kaunas
Since ancient times people were using various herbs to heal illnesses, regain strenght
and improve health. One of many valuable herbs is Rhaponticum carthamoides (DC. Iljin) (also
known as Maral root). Rhaponticum carthamoides is poorly examined. For our experiment we use
Rhaponticum carthamoides (DC. Iljin) (rootstock, blossom and leafs) collected and prepared in
Vytautas Magnus University botanic garden. There was analysed these 5 phases: intensive growth
(2012-05-21), budding (2012-05-28), blossoming (2012-06-01), massive blossoming (2012-06-
05), ending of blossoming and frudification(2012-06-18). We made methanol extract and then
started the determination. The results showed that the biggest amount of phenolic compounds
were found in massive blossoming phase. Phenols determine plant colours, smell, affects growth.
ISSN 2335-8653
23
Association Of Single Nucleotide Polymorphisms With Freezing Tolerance
Traits In Perennial Ryegrass
Andrius Aleliūnas, Gintaras Brazauskas
Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, Instituto a. 1, Akademija, LT-
58344 Kėdainiai distr., Lithuania
e-mail: andrius.aleliunas@lzi.lt
Perennial ryegrass is a species of paramount economic importance used both for turf and forage.
However, it‘s poor winter survival limits the cultivation at northern latitudes. As freezing injury is
caused primarily by ice formation, LpIRI1 protein has the potential to minimize the damage as ice
recrystallization inhibitor. An association study was conducted using single nucleotide
polymorphisms obtained through allele sequencing of the LpIRI1 gene, while phenotypic data
were collected in a perennial ryegrass association mapping population of 76 diverse genotypes.
Tiller survival and electrolyte leakage at -8 °C and -12 °C were determined under controlled-
environment conditions, as well as proline content in cold-acclimated plants was measured prior to
the freezing test. Significant variation in all examined traits was observed among genotypes in this
panel. Electrolyte leakage and percentage of tiller survival revealed significant negative
correlations at -8 °C and -12 °C (rs = -0.40 and -0.49, repectively). Cold-acclimated plant proline
content, however, did not show significant correlations with any of the measured traits. The
association analysis of the LpIRI1 gene revealed two non-synonymous SNPs being associated with
increased electrolyte leakage at the freezing temperatures, both being located in the LpIRI1
leucine-rich repeat. The results indicate that allelic variation in the LpIRI1 gene has an important
role in the cell membrane integrity during freezing. Further population-wise testing of the freezing
tolerance in 155 diverse perennial ryegrass populations under controlled-environment conditions
will enable evaluation of freezing tolerance in populations which will be extended to the
identification of causal SNP markers confering higher freezing tolerance in populations combining
with population-wise GWAFF genotyping.
Keywords: Association mapping, electrolyte leakage, proline
ISSN 2335-8653
24
DNA Analysis Of 6 Actinidia L. Cultivars Using SSR Method
S.Bogačiovienė1, L.Česonienė2, R.Daubaras2, A.Paulauskas1, J.Žukauskienė1
1Department of Biology, Vytautas Magnus University, Vileikos str.8, LT-44404 Kaunas
2Kaunas Botanical Garden of Vytautas Magnus University, Ž. E. Žilibero 6, LT-46324 Kaunas
Email: s.bogacioviene@gmf.vdu.lt
Abstract
The genus Actinidia Lindl. is large, containing between 50 and 70 species of
climbing plants originating mainly in southern China [1]. Actinidia L. genus plants accumulate
large quantities of biologically active substances: vitamins, phenolic compounds, various organic
acids. These climbing Actinidia Lindl. genus plants are not only decorative, but the berries also
accumulate a lot of ascorbic acid [2]. Until now most research is dedicated to A. deliciosa and A.
chinensis species. Therefore A. kolomikta, A. arguta, A. melanandra, A. purpurea and A.callosa
species and varieties genetic and chemical studies will be new not only in Lithuania, but also
internationally.
For genetic analysis were used young Actinidia L. leaves, which were collected in
Vytautas Magnus University Kaunas Botanical Garden. The DNA was extracted of 6 cultivars
young leaves with a DNA-silica columns. Amplification was carried out on a Master Gradient
(Eppendorf, Germany) thermal cycler using the following temperature profile by Man et al. (2011)
: 95 ° C for 5 min; then 6 cycles of 94 ° C for 50 s, 61 ° C for 50 s, and 72 ° C for 1 min; followed
by 30 cycles of 94 ° C for 50 s, 56 ° C for 50 s, and 72 ° C for 1 min; finishing with 72 ° C for 8
min. The amplification products were separated on 8% denaturing polyacrylamide gel and
visualized by silver staining.
For analysis were selected A. melanandra, A. arguta and A. kolomikta cultivars. Six
microsatellite primers were selected for actinidia: EST24, EST64, EST147, GB-AA-393, GB-AA-
370, GB-AA-369. The primers were optimized and suitable for Actinidia L. genus plants genetic
diversity analysis. The total number of fragments was ranged from 1 to 8, and the size - from 100
bp to 250 bp. The most – 8 alleles detected with the primer GB-AA-393 at A. melanandra
cultivars “E2b” and “E1a”.
Keywords: Actinidia L., SSR method, Microsatellite Markers.
References: [1] Ferguson AR: The need for characterisation and evaluation of germplasm: kiwifruit as an example. Euphytica
2007, 154(3):371-382.
[2] Latocha, P. Aktinidia roślina ozdobna i owocowa. Warszawa 2006, 80 p. ISBN83-89211-77-7.
ISSN 2335-8653
25
The Dynamic Of Productivity And Somatic Cell Count In Milk Of Lithuanian
Black-And-White Cattles On The Influence Of Probiotic Additives And
Multienzyme Composition
J.Dailidavičienė1, R.Budreckienė2, R.Gružauskas3, S.Kerzienė4, S.Makauskas3
1Department of Animal Anatomy and Physiology, Lithuanian University of Health Science, Tilzes str. 18, Kaunas,
Lithuania, 2Department of Biochemistry, Lithuanian University of Health Science, 3Institute of Animal Rearing Technologies, Lithuanian University of Health Science, 4Department of Physics, Mathematics and Biophysics, Lithuanian University of Health Science.
Main author email address: Jurgita.Dailidaviciene@lsmuni.lt
Abstract
The probiotic additives of live yeast cultures (Saccharomyces cerevisiae) with organic selenium
have been added to diets for lactating dairy cows to attempt to improve ruminal fermentation,
potentially increasing dry matter intake and milk yield. Selenium plays a crucial and ubiquitous
role in the organism. The health benefits of selenium supplementation in ruminants are well
recognized. In dairy cows, this is directly reflected by the potential of selenium supplementation to
reduce somatic cell count (SCC) in milk and prevent sub-clinical mastitis. A universal
multienzyme composition increases productivity, feed energy exchange and digestibility of protein
and amino acids, improves feed conversion, reduces viscosity of the digestive tract and the
incidence of diarrhea.The effects of Saccharomyces cerevisiae and multienzyme composition
supplementation of 28 diary cows were investigated. Animals were divided into three
experimental groups (A, B, C) and Control group containing of 7 cows in each group. The cattle
had a standard, commonly balanced ration with the 40 g supplement of additive Biogrom® SC for
the Group A, 40 g supplement of additive Biogrom® Lux for the Group B and 0.2 g supplement of
additive Vilzim® for the Group C daily. Milk samples were analysed every 30 days during the 90
days period for milk yield, fat, protein, urea and SCC.
In this study live yeast and multienzyme composition supplementation to dairy cows significantly
increased milk production in all milking periods. Milk yield was 2.64 %, 1.75 % and 1.4 % higher
in Group A, B and C respectively comparing with the Control group. The SCC in milk in all
experimental groups were lower comparing to the Control group. The lowest SCC values were
evaluated in the B group after 60 days of experiment as well as there were the highest values of
SCC in the Control group after the 60 days of experiment. There were minimal dynamics of SCC
values in all other groups. The results indicate that probiotic additives and multienzyme
composition supplementation to dairy cows improved rumen environment in a way that increased
dry matter intake and stabilised rumen pH and in consequence enhanced the productivity and
decreased the SCC in milk.
ISSN 2335-8653
26
Chemical Composition And Biological Activity Of Bog Bilberries And
Blueberries
Agnese Huna, Laura Klavina, Diana Dudare
University of Latvia, Geography and Earth science faculty, email: agnese.huna@gmail.com
Abstract
One of the biggest values in Latvia are woods which provides resources such as berries. Bog
bilberry Vaccinium uliginosum L. is higher plant belonging to Eric family. In Latvian conditions
bog bilberry are very common species it is because of the damp forest and marsh habitats –
especially moss and nearby wet forests, which are suitable for the growth of bilberries and
blueberries. In forests this naturally-growing berries (blueberries Vaccinium corymbosum and
bilberries Vaccinium uliginosum L.) often are mixed with each other that is why bog bilberries are
rarely used in food and poorly studied.
Optimal growing conditions of bilberries and best growing areas are not completely studied, but
what is more important – there are very little studies about bog bilberries chemical composition
and biologically active substances. That is why researches about bog bilberry extraction,
extraction condition optimization, chemical composition and biologically active substances are
very important. For the further research of berries while maintaining maximal diversity of
chemical compounds, bilberries and blueberries were dried in liofilizator. For optimization of
extraction conditions and berry biological active indicator determination several extracts were
prepared and used different extraction methods. As extrahents were used: methanol, ethanol,
acetone, DMSO, dioxane, followed by after-treatment: ultrasonic bath, microwave apparatus, and
supercritical CO2 extraction. Extraction efficency was evaluated based on number of parameters.
In research were analyzed compound group indicators –total amount of polyphenols, flavonoids,
carbohydrates and radical scavenging activity as well as dry matter content.
Results showed that increase of solvent dilution with water (ethanol, DMSO, acetons) reduce
amount of polyphenols, while methanol extracts showed higher results with presence of water.
The optimum extrahent in Vaccinium uliginosum L. extraction are 96% ethanol and 100% acetone,
in the meantime duration of treatment with ultrasound does not cause significant differences in
contentrations of extracted substances. Results shows that one of the most optimal treatment is
microwave, but the most effective results shows treatment with supercritical CO2. Obtained results
indicate that there are a relationship between the total amount of polyphenols and antiradical
activity. Especially high correlation between these indicators shows enthanol, acetone, DMSO
extracts. However antiradical activity in bog bilberry extracts determines not only amount of
polyphenols, but also presence of other compounds – as evidence the high correlations between
other indicators (carbohydrate-flavonoids, dry matter-flavonoids, carbohydrate-dry matter).
ISSN 2335-8653
27
Extraction And Analysis Of Moss Secondary Metabolites
Laura Klavina, Gunta Springe, Diana Dudare
Department of Environmental science, University of Latvia, Raina Blvd. 19, Riga, Latvia, corresponding author:
laura.klavina@lu.lv
Abstract
Secondary metabolites in plants are responsible for such functions as adaptation and defense
against herbivores and diseases. Plant secondary metabolites are often used as flavorings, food
additives and for bioprospecting of new pharmaceuticals, at first, studying secondary metabolites
of higher plants. Nevertheless research has shown many new secondary metabolites with
biological activity can also be found in lower plants, such as mosses. This study aimed to extract
and analyse secondary metabolites of mosses characteristic for Northern Europe. In order to better
evaluate amount and diversity of secondary metabolites in mosses 2 types of extracts were
prepared. 15 moss species from Northern Europe forest and bog ecosystems were chosen.
Extraction was done using two types of methods and solvents- microwave extraction with 60%
ethanol and ultrasound extraction using chloroform. To better evaluate approximate amount of
secondary metabolites in mosses 13C NMR analysis was done before and after exhaustive
extraction. Ethanol extracts were tested using LC-TOF analysis for more hydrophilic substances
such as amino acids and polyphenols. Standard for LC-MS analysis was gallic acid. Chloroform
extracts were analysed using GC-MS analysis for hydrophobic substances. Hydrophobic extracts
prior to analysis were silylated using BSTFA+TMS for higher volatility of some substances. For
GC-MS analysis two standards were used – palmitic acid and progesterone, substance
identification was done using NIST MS search 2.0 databases. No major differences were seen in
comparison between 13C NMR before and after exhaustive extraction. Obtained results suggest
that secondary metabolite content in mosses is lower than initially expected. In ethanol extracts a
range of polyphenols and amino acids were identified and quantified, but as expected the amounts
of these substances were not high. The differences between different moss species were seen, but
no characteristic substances for moss species were detected. Approximately 100 substances were
identified using GC-MS analysis. High number of different substances has been identified in the
extracts of mosses, as well as there can be found many unidentified peeks, which allows further
investigation.
Acknowledgments: This work was supported by the ESF project Nr. 2014/0009/1DP/
1.1.1.2.0/13/APIA/VIAA/044.
ISSN 2335-8653
28
Anthropo-Genetical Exploration Of Human Skeletal Remains From
Archeological Site Rousínov – Ferobet
Kamila Gajduskova1, Ondrej Sedo2, Eva Drozdova3 1, Laboratory of Biological and Molecular Anthropology, Masaryk University, Brno
2The Institute of Archaeology of the Academy of Sciences of the Czech Republic, Brno 3 Laboratory of Biological and Molecular Anthropology, Masaryk University, Brno
k.gajduskova@email.cz
Abstract
The most interesting archaeological findings are usually discovered during rescue excavations.
During rescue excavation in Rousínov archeologists found crouched skeleton provisionally dated
to the period of the Moravian painted pottery ware culture or to the Roman period. Discovery of
such an old skeletal material presents a rare opportunity to study a member of historical
populations. Significantly damaged skeletal remains have for an anthropological research
relatively little value. In such cases comes the genetic analysis, which allows to obtain biological
information from ancient DNA extracted from damaged skeletal material where anthropology with
morphological analysis can not succeed. The aim of this paper is to propose an anthropological
and genetic processing of skeletal material with regard to dating, circumstances of skeleton
finding and archaeological theory. It includes mechanical processing, next it is described the
anthropological analysis mainly age, which is necessary for further research. The last part is
connected with genetic analysis, which deals with the determination of gender, population
genetics, determination of blood groups and pigmentation.
Keywords: anthropology, aDNA, genotypization, sex determination, age determination,
population genetics, ABO System, pigmentation
References:
[1] Adler C. J., Haak W., Donlon D., Cooper A., The Genographic Consortium. 2011. Survival and recovery of DNA
from ancient teeth and bones. Journal of Archaeological Science 38: 956–964
[2] Bass W. M. 2005. Human Osteology. A Laboratory Field Manual. Columbia, Special Publication of the Missouri
Archaeological Society. 5th Edition.
[3] Cappellini E., Chiarellia B., Sineob L., Casolic A., Di Gioiac A., Vernesid C., Biellae M. C., Caramelli D. 2004.
Biomolecular study of the human remains from tomb 5859 in the Etruscan necropolis of Monterozzi, Tarquinia
(Viterbo, Italy). Journal of Archaeological Science 31: 603–612
[4] Walsh S., Chaitanya L., Clarisse L., Wirken L., Draus-Barini J., Kovatsi L., Maeda H., Ishikawa T. 2014.
Developmental validation of the HIrisPlex system: DNA-based eye and hair colour prediction for forensic and
anthropological usage. Forensic Science International: Genetics 9: 150–161
ISSN 2335-8653
29
Genetic Characteristic Of Dermacentor Reticulatus Ticks Using 12S And 16S
Rrna Markers
Matas Galdikas, Jana Radzijevskaja, Algimantas Paulauskas1
1Vytautas Magnus University
E-mail address to the main (corresponding) author (Times New Roman 10, Italic, and Centered)
Abstract
Dermacentor spp. ticks are obligate hematophagous ectoparasites of wide range of mammals.
Over past few decades these ticks have been spreading rapidly through Europe. Molecular
phylogeny of this species is not yet properly described. In this study we analyzed genetic diversity
of D. reticulatus using 12S and 16S ribosomal RNA sequences. D. reticulatus were collected from
six different locations in Lithuania. DNA from ticks was extracted by lyses in 2.5% ammonium
hydroxide solution. We successfully amplified and sequenced 380 bp fragments of 12S rRNA
derived from D. reticulatus ticks and compared obtained sequences with those previously
published in Gene Bank. The sequences of the 12S rRNA obtained from ticks collected in
Lithuania were identical to each other and 100–99.9% were similar to the corresponding D.
reticulatus 12S rRNA sequences from Gene Bank. Investigation of 12S rRNA gene of
mitochondrial DNA showed that this marker is not very suitable for D. reticulatus intraspecific
diversity. However it could be useful for taxonomical identification of Dermacentor species, and
investigation of interspecific diversity.
Keywords: Dermacentor reticulatus ticks, 12S rRNA, 16S rRNA, genetic diversity
ISSN 2335-8653
30
Nptx2 And Chi3l1 Genes Promoters Methylation Status And Expression Level
In Different Grade Of Gliomas
I. Golubickaitė, R. Stakaitis, D. Skiriutė, P. Vaitkienė, A. Kazlauskas, A. Bunevičius, G.
Steponaitis
Laboratoty of Neurooncology and genetics, Neuroscience Institute, Lithuanian University of Health Sciences, Eiveniu
str. 4, Kaunas, LT 50009, Lithuania; E-mail: r.stakaicio@gmail.com
Background. Gliomas are the most common malignancies in central nervous system classified by
whether they are low-grade (I or II) or high-grade (III or IV). It is hard to accurately characterize
gliomas only by its morphological appearance. That is why molecular examination is needed to
improve accuracy and efficiency of diagnostics, prognostics and treatment. Unfortunately there is
not enough systematic information about genetic and epigenetic factors in glioma which could be
used as a potential biomarkers. The purpose of this research was to investigate how methylation
and expression levels of NPTX2 and CHI3L1 genes reflects on glioma malignancy and patients’
clinical outcome. NPTX2 gene over-expression induces apoptosis, prevents proliferation and
independent growth, makes glioma cells chemosensitive. CHI3L1 gene is involved in anti-
apoptotic pathways, promoting angiogenesis and remodeling of extracellular matrix. Thus making
NPTX2 gene an oncosuppressor and CHI3L1 gene – oncogene.
Material and methods. 150 astrocytomas with different grade of malignancy were used for this
study: 13 grade I, 43 grade II, 27 grade III, 67 grade IV. Brain tumor tissue specimens after
dissection were snap-frozen in liquid nitrogen and stored until analysis. Tumor DNA and RNA
was purified from 50-100mg of frozen tissue using salting-out and TRIzol methods respectively.
Methylation status of gene promoter was detected by MS-PCR followed by DNA bisulfite
treatment. PCR products were analyzed by 2% agarose gel electrophoresis. mRNA expression
level was detected by two step quantitative RT-PCR using TaqMan probes for target genes and
SybrGreen I for endogenous control – B-actin.
Results. Consistently increased NPTX2 gene promoter methylation frequency was typical for
higher malignant tumor: 0% (0 out of 13) of I grade, 30,43% (9 out of 43) of II grade, 39% (11 out
of 27) of III grade and 63,01% (51 out of 67) of IV (GBM) glioma patients. These data were in
line with tendency of decreased mRNA expression in higher degree of malignancy. Survival
analysis revealed strong association between patient survival and NPTX2 gene methylation
(Mantel-Cox p<0.001). Log Rank (Mantel-Cox) test did not reveal significant (p=0.411)
differences between NPTX2 mRNA expression groups and patient survival. mRNA expression of
CHI3L1 was found to be upregulated in higher malignancy tumors, while promoter methylation of
this gene did not show relation between glioma grades. Survival analysis showed that patients
with higher CHI3L1 mRNA expression had significant poorer survival prognosis than patients
with medium or low expression (Mantel-Cox p<0.001). Pilot study data indicates that both of
analyzed targets are related with gliomagenesis process and after further research could potentially
be used as a diagnostic and/or prognostic biomarkers for glial tumor.
Keywords. Glioma, NPTX2, CHI3L1, epigenetics, mRNA, expression, methylation, CNS
ISSN 2335-8653
31
Hazel Dormouse (Muscardinus Avellanarius) Genetic Variability Research In
Lithuania
Kamilė Morkutė1, Algimantas Paulauskas1, Vaclovas Gedminas2
1-Faculty of Natural Science, Vytautas Magnus University, Vileikos 8, LT - 44404 Kaunas, Lithuania,
2 –Kaunas Tadas Ivanauskas Zoological Museum, Laisvės 106, LT – 44253 Kaunas, Lithuania
e-mail: a.paulauskas@gmf.vdu.lt
Abstract
A preliminary genetic analysis of common dormouse was conducted on 17 samples (13 were
taken from 9 different Lithuania locations and 4 samples from Latvia) collected in 2013-2014.
DNA was extracted from hair using the DNeasy Tissue kit (Qiagen Inc., Valencia, CA, USA)
following the manufacturer‘s instructions. In order to assess the genetic diversity of the common
dormouse 5 microsatellite loci were used (Mav002, Mav005, Mav011, Mav023 and Mav028).
PAAG electrophoresis results showed 41 polymorphic loci with fragment size - from 120 to 300
base pairs. Data genetic variability were evaluated using GenAlEx and MEGA 6.06 software.
Neither's genetic distance between dormouse populations studied ranged from 0.291 to 1.219.
Keywords: dormouse, Muscardinus avellanarius, non-invasive, microsatellite
References: [1] Mills C. A. Conservation Genet Resour, 2013, 5, 687–692.
ISSN 2335-8653
32
Comparison Of Cyclosporine And Erythropoietin In The Experimental Model
Of Acute Myocardial Injury
AlesyaV. Korda, VolhaF.Kardash, Natalia G.Tihonova
Scientific Practical Centre Of Hygiene
E-mail: Kordo18@mail.ru
Abstract
Recent experimental evidence suggests that cyclosporine (C) and erythropoietin (EPO) has been
shown to exert cytoprotective effects. However there are few studies which compare cyclosporine
and erythropoietin cardioprotective effects.
Aim of the study was to compare cyclosporine and erythropoietin cardioprotective effects.
Materials and Methods. All the animals used in this study received human care in compliance with the “Principles of
Laboratory Animal Care” formulated by the National Society for Medical Research and the
“Guide for the Care and Use of Laboratory Animals”. Acute myocardial injury in Wistar rats
(n=6, DG) induced by dopamine (D) (3 mg/kg) intravenous (iv) injection. Wistar rats in C group
(CG, n=6) were treated with C (10 mg/kg) and then the same dose of D. Wistar rats in EPO group
(EG, n=6) were treated with EPO-β (2000 U/kg) and then the same dose of D. Six Wistar rats with
0.9% NaCl solution iv injection saved as a control (KG). Protective effects were assessed by
electrocardiogram (ECG) and creatine kinase (CK) assay. Bioelectric activity of the rat
myocardium was recorded under anesthesia (10% thiopental sodium) in II standard lead by the
computer electrocardiographs ‘Poly-Spectrum 8/B’(‘Neurosoft’, Russia) at base and during 30
minutes after D injection.Amplitude and time parameters, cardiac arrhythmias(VTA) (in
accordance with the international agreement Lambeth Conventions)were estimated. Blood
samples were obtained by carotid artery puncture at 31st minute. The CK levels in the blood serum
were determined with biochemical commercial sets Cormay-Diana (Belarus) in the semi-
automatical photometer «DialabAutolyzer» (Austria). Statistical analysis was conducted with the
use of nonparametric Mann- Whitney test for independent samples in the application package
STATISTICA 6.0.
Results.
VTAarrhythmias afterinjection of D were observed in 6, 2 and 3 animals from DG, CG and EG,
respectively (p<0.05).RS-T segment elevation after drugs injection was more pronounced
(p<0.02) in DG (0.10[0.07;0.12]mV) and EG (0.10[0.09;0.011]mV) than in CG (0.02[0.02;0.03]
mV). CK level increased up to 5642.5 [4151.5-7154.0] U/l in DG. There were no differences in
CK level between CG and KG, EG and KG. However CK level in EG (2621.0 [1855.0-
3633.0]U/l) was elevated compared with CG (1644.0 [1512.0-2299.0]U/l, p=0.043).
Conclusions. It can be concluded that cyclosporine significantly reduces ischemic damage in
myocardial experimental animals and so has a more pronounced cardioprotective effect compared
with erythropoietin-β.
Keywords: Cyclosporine, Erythropoietin, Dopamine, Cardioprotection.
ISSN 2335-8653
33
The Yeasts Strains Isolated From The Berries In Lithuania And Belarus
Irina Kolesnik1, Juliana Lukša2, Živilė Strazdaitė-Žielienė2, Ramunė Stanevičienė2, Vytautas
Melvydas2, Elena Serviene2
1 Yanka Kupala State University of Grodno, Ozheshko str. 22, 230023, Grodno, Belarus.
E-mail: i.kolesnik@grsu.by 2 Laboratory of Genetics, Institute of Botany, Nature Research Centre, Akademijos St. 2, LT-08412 Vilnius, Lithuania.
E-mail: elena.serviene@botanika.lt
Abstract
The biodiversity of the yeast is widely investigated in all winemaking subareas, therefore the
strains of the autochthonous starter cultures are of interest for regional wine production. The most
important isolates are selected by conventional molecular and growth tests and applied for further
analysis.
The aim of our research was to analyze the yeast strains isolated from spontaneous plums,
strawberry, currants, cherries, strawberries, blueberries and grape fermentations, to compare their
morphological and physiological features and perform molecular identification. The material for
the study was collected during 2014 summer period in Vilnius and Grodno regions. Yeasts were
cultivated on solid medium YEPD with chloramphenicol and analyzed by applying
microbiological and molecular biology methods.
Based on the growth in liquid media, the yeast strains divided into 2 groups, independently
on the place of the gathering and sort of the berries. The first group formed sediment on the third
day of growth; the second group was distinguished by the ring on the surface of the liquid growth
medium and at the same time formed sediment. The yeast colonies varied in size (from 2 to 4
mm), surface (smooth, folded and grained) and consistency (oleaginous, paste-like).
Some differences in cell parameters of yeast spread in different regions were observed
microscopically. In liquid nutrient medium, strains have formed the cells of various shapes -
round, oval, elongated. In the yeast isolated from Belarus berries, the length of the cells varied
from 5.03 ± 0.31 µm to 7.91 ± 0.33 µm, and the width ranged from 3.69 ± 0.19 µm to 4.92 ± 0.15
µm. In strains isolated from Lithuania plants, the length of the cells varied from 6.04 ± 0,33 µm to
9.32 ± 0.31 µm, and the width ranged from 4.08 ± 0.12 µm to 4.13 ±0.16 µm.
Molecular approaches have been used for genotyping of yeast strains. Genomic DNA was
isolated and internal transcribed spacer of regions 1 and 4 of the rRNA gene operon have been
amplified by PCR. Based on ITS fragment length polymorphism and restriction fragment length
polymorphism as well as phenotypic characteristics, several yeast strains were assigned to
Saccharomyces, Metschnikowia, Hanseniaspora, Pichia and Zygosaccharomyces species.
Keywords: yeast, spontaneous fermentations.
Acknowledgement: This research work was financially supported by the Education Exchanges
Support Foundation Higher education Programmes Unit (Lithuanian state scholarships No. AM-
2014-LT-1311).
ISSN 2335-8653
34
Odontological Problem In Ophthalmological Practice
Aušra Povilauskienė2, Albertas Kriaučiūnas1, Regina Marija Stakaitytė3, Rasa
Liutkevičienė1,2, Loresa Kriaučiūnienė1,2 1Lithuanian University of Health Sciences; 2Ophthalmological department; 3Oral and Maxillofacial surgery
department
E-mail address of the main (corresponding) author: loresa@takas.lt
Abstract
Aim: In this case we want to show, what influence odontological problems have (in this case -
periodontitis) to eye structures pathological processes (in this case - scleritis).
Methods and materials: 55 years old female was investigated in Kaunas Eye Clinic. She had
severe pain in left eye. We could see hard irritation of the left eye. The movements of the eyeball
were very painfull. Ultrasonic eye examination of the left eye revealed increased posterior wall
thickness to 1,26mm. Objective ophthalmological examination showed diagnosis of acute scleritis
(posterior wall inflammation).
Results: After full ophthalmological examination and precise anamnesis we detected
odontological problem. Patient undergo odontological examination. Orthopantomogram revealed
multiple periodontal and periapical inflammations in maxilla and mandibula. Most intensive
periodontitis was in the left side of maxilla and mandibulla, in the same side as pathology of the
left eye (scleritis). The problem of periodontitis patient had for about two years and it hasn’t been
treated. In ophthalmological treatment we used hormone-therapy. But final results can only be
received after full treatment of periodontitis.
Conclusion: 1. Odontological problem can be the background of an ophthalmological problem. 2.
During ohpthalmological examination, much more attention must be paid to odontological
treatment of infection.
Keywords: odontology, ophthalmology, periodontitis, scleritis.
ISSN 2335-8653
35
Occurence Of Methicillin-Resistant Staphylococci In Broilers And Wild Birds
Lina Vaškevičiūtė, Modestas Ružauskas, Rita Šiugždinienė, Irena Klimienė, Marius
Virgailis, Raimundas Mockeliūnas
Microbiology and Virology Institute, Lithuanian University of Health Sciences
lina.vaskeviciute@lsmuni.lt
Abstract
The resistance of bacteria to antimicrobials becomes a rising health problem in the world. The aim
of the study was to investigate the presence and frequency of methicillin- resistant staphyloccoci
prevalent in broilers and wild birds.
For this purpose faecal samples of slaughtered broilers from three large poultry farms (n=357) as
well as feaces from wild birds (n=270) were collected at Kaunas city dump. For Staphylococcus
isolation Mannitol Salt Agar (Oxoid) was used. Species identification was performed using
MicrobactTM12S (Oxoid) biochemical identification system. Minimum inhibitory concentrations
of oxacillin were determined using “Sensititre” plates and ARIS 2X (Thermo Fisher) incubator.
Interpretation of results was based on EUCAST recommendations. Detection of mec genes in
resistant isolates was performed by PCR.
The rate of Staphylococcus spp. isolation was 56.3% from broilers and 65.6% from wild birds.
Phenotypical resistance to oxacillin was 9.9% and 9.6% in broiler and wild birds isolates
respectively. The mecA gene was detected in 30% of the isolates from broilers and in 42.3% of the
isolates from wild birds. The mecC gene was not detected. Fourteen species of Staphylococcus
were found to be methicillin-resistant. The most prevalent methicillin-resistant species from
broilers was S. hyicus 25%, whereas S. xylosus was the most prevalent species in wild birds
19.2%. Among methicillin-resistant staphylococci S. aureus (MRSA) was identified in 10% from
the total number of broilers isolates and in 15.4% of the wild birds isolates. Another most
frequently detected methicillin-resistant species included S. warneri, S. haemolyticus, S. caprae
and S. cohnii.
Conclusions. Methicillin-resistant staphylococci including MRSA are prevalent both in broilers
and in wild birds. Large variety of methicillin-resistant Staphylococcus species were detected
during this study. The results obtained indicate that safety measures according to the protection of
domestic birds from contact with wild birds (and vice versa) should be implemented.
Keywords: staphyloccoci, antimicrobial resistance, poultry, wild birds, genes.
Acknowledgements: this research was funded by a grant SVE-05/2014 from the
Research Council of Lithuania and by a grant for L. Vaškevičiūtė PhD studies supported by
LUHS.
ISSN 2335-8653
36
Phototropic Responses Of Garden Cress Leaves To Ultraviolet-A And Blue
Light In Artificial Microgravity Environment
R. Losinska-Sičiūnienė, R. Stanevičienė, D. Švegždienė, D. Raklevičienė
Nature Research Centre, Institute of Botany, Akademijos 2, Vilnius LT-08412, Lithuanian,
E-mail: regina.ska@gmail.com
Abstract
Light and Earth’s gravity (1g) are used by plant to orient body parts to more suitable environments. It is
well established that phototropism is predominantly a blue-light effect; however, blue light is not the only
wavelength that can elicit alike effect. Only microgravity (weightlessness) environment provide an
opportunity to distinguish the effects of light from those of gravity. The aim of this research was to reveal
the growth responses of garden cress (Lepidium sativum L.) leaves to separate or simultaneous irradiation
with ultraviolet-A (UV-A) and blue light in microgravity environment simulated by slow horizontal
clinostat (3 rpm). The illumination was performed by an original autonomous lighting system which had
been made using UV-A (370 nm) and blue (450 nm) light emitting diodes. Before the test, the plants were
grown for 8 days under a 12 h white light/12 h dark cycle vertically and then divided in two groups. The
first group has been transferred to the clinostat while the other one – remained to grow vertically. After 24
hours in the darkness, the appropriate irradiation has been applied laterally to the base of leaves. The
response of cotyledons and true leaves in degrees was measured during the 3-h period. It was determined
that the leaves of both types showed a comparable movement towards the UV-A source. After 3 hours,
their response reached the angle of 25° in microgravity, while it was two times smaller under the natural
gravity. Blue light effect on the response of true leaves was found to be more pronounced than that of
cotyledons throughout whole lighting period. After 3 hours in microgravity, the curvature of true leaves
equaled to the angle of 34° and that of cotyledons – 29°. Under the gravity, true leaves and cotyledons
curved by the angle of 25° and 19°, respectively. There the simultaneous illumination by blue light and
UV-A provoked any phototropic response of cotyledons though a slight bending of true leaves has been
observed after two hours. In microgravity, that illumination induced active curving up to 32-36 degrees in
both type leaves. In summary, the leaves show phototropic responses to UV-A irradiation as well as to blue
light. The phototropic movement is more evident in microgravity than under Earth’s gravity. Obtained data
allow a supposition about a being of interactions between signaling pathways of both spectral components
which are integrated with gravity signaling pathway.
Keywords: microgravity, clinostat, UV-A, blue light, leaf, phototropism
ISSN 2335-8653
37
Genetic Diversity In Vaccinium Corymbosum, V. Australe, And V.
Angustifolium Based On Microsatellite Analysis
D. Mardosaitė-Busaitienė1, R. Rugienius3, J.Žukauskienė1, A.Paulauskas1, S.Bogačiovienė1,
L.Česonienė2, R.Daubaras2
1Faculty of Natural Sciences, Vytautas Magnus University, Vileikos 8, LT- 44404 Kaunas, Lithuania,2Kaunas
Botanical Garden of Vytautas Magnus University, Ž.E. Žilibero 6, LT-46324, Kaunas, Lithuania, 3Institute of
Horticulture LRCAF, Kaunas st. 30, Babtai, LT-54333, Kaunas dist., Lithuania dalytemardosaite@gmail.com
Abstract
Poland research center for cultivar testing (COBORU) certified two Lithuanian cultivars 'Freda'
and 'Danutė' of blueberry at the end of 2011. These two cultivars have passed the international
expertise and satisfied all the requirements for varieties distinctness, uniformity and stability.
According to that we decided to accomplish genetic analysis using microsatelite markers and
compare 54 genotypes of highbush, lowbush and half-highbush blueberry, that is new Lithuanian
cultivars, up-and-coming New Zelandand German genotypes (cultivars and selected clones) and
variuos certified cultivars. Using eight of thirty microsatellite markers (SSRs) to determine genetic
diversity between blueberry gentotypes. Total amount of 195 alleles were detected with eight
primers. They ranged from 4 to 37 per primer. The most unique alleles were determined for
genotypes of high bush blueberry. The genotypes of New Zealand and German breeding were
characteristic of 8 unique allele sand Lithuanian cultivars contained 9 unique alleles. Cluster
analysis was performed by the UPGMA classified 54 genotypes into two clusters, Lithuanian
cultivars ‘Danutė’ and ‘Freda’ was in one cluster with N. Zeland varieties.
This work was partly supported by project "Promotion of Student Scientific Activities" (VP1-3.1-
ŠMM-01-V-02-003) from the Research Council of Lithuania (D.M.-B.). This project is funded by
the Republic of Lithuania and European Social Fund under the 2007-2013 Human Resources
Development Operational Programme’s priority 3.
Keywords: blueberry, Vaccinium corymbosum L., SSR, molecular markers
ISSN 2335-8653
38
Synergistic And Antagonistic Interactions Between Secondary Metabolites In
Monarda Didyma L. And Angelica Archangelica L.
Ruta Mickiene1, Ona Ragazinskiene2, Audrius Sigitas Maruska1
1Vytautas Magnus University, Faculty of Natural Sciences, Vileikos st. 8-204, LT-44404 Kaunas, Lithuania 2 Kaunas Botanical Garden of Vytautas Magnus University, Z.E. Zilibero st., LT-46324 Kaunas, Lithuania
mickiene@lva.lt
Abstract
This research focuses on synergistic and antagonistic interactions between secondary
metabolites in Monarda didyma L., Angelica archangelica L. and antimicrobial activities of
compounds isolated and identified from these species. The compounds pinene-α, terpinene-α,
terpinene-γ, borneol, terpinen-4-ol, terpineol-α, estragole, methyl thymol, thymoquinone,
caryophyllene, murolene-γ, germacrene, cadinene-δ, thymohydroquinone, phytone, hexadecanol,
limonene, α-pinene, phellandrene-d-α, carophyllene-β, linalool, borneol, four macrocyclic
lactones, various coumarins and other compounds were tested for their ability to compose the
synergistic and antagonistic interactions. The antimicrobial activity of combinations secondary
metabolites in Monarda didyma L. and Angelica archangelica L. originated from the sector of
medicinal plants, Kaunas botanical garden of Vytautas Magnus University Lithuania, were tested
by the method of series dilutions, against different bacteria species. This is a novel study of
synergistic and antagonistic interactions between combinations plant secondary metabolites.
Investigated microorganisms were Escherichia coli, Proteus vulgaris and Staphylococcus aureus
with and without antibiotic resistances originating from livestock. The antimicrobial activities of
extracts were described by determination of the minimal inhibitory concentration. The total
amounts of phenolic compounds and total amounts of flavonoids were tested in the methanolic
extracts of the plants. Identification of the phenolic compounds and evaluation of the radical
scavenging activity of the compounds were performed by means of high performance liquid
chromatography coupled with on-line 2.2-diphenyl-1-picrylhydrazyl radical scavenging reaction
detection (HPLC-DPPH) analysis. The essential oils were analyzed by gas chromatography – mass
spectrometry (GC-MS). Strong synergy of phenolic fraction and essential oils of the plants was
determined against the tested bacteria.
Keywords: synergism, antagonism, secondary metabolites, antimicrobial activities, plant,
essential oils, phenols.
ISSN 2335-8653
39
Morphological Identification Of Digenean Isthmiophora Melis (Digenea:
Echinostomatidae) From Mustelids In Lithuania
Dovilė Nugaraitė, Vytautas Mažeika, Algimantas Paulauskas
Vytautas Magnus University, Department of Biology, Vileikos str. 8, Kaunas LT-44404, Lithuania,
E-mail address to (corresponding) author: d.nugaraite@gmf.vdu.lt
Isthmiophora melis belongs to the family Echinostomatidae and had one of the most complicated
and richest history. This species parasitize in small intestine of order Carnivora in Europe, Asia
and North America. I. melis is important in veterinary and medicine as it can parasitize more than
thirty species of vertebrates including humans (Radev et al., 2009). Family Echinostomatidae is
characterized by high morphological diversity. The aim of recent study was to identify flukes from
mustelids by morphological features.
The flukes were collected from American mink (Neovison vison) and European polecat (Mustela
putorius). Mustelids were hunted from different localities of Lithuania in the period 2011–2014.
Specimens were processed for morphological studies following standard procedures of temporary
and permanent preparations. Measurements were made using temporary preparations. Digeneans
were characterized by 34 features described by Kostadinova and Gibson (2002).
Digeneans from both species of mustelids have short forebody (16.6% of body length), dorsal
aboral collar (61×13) spines are shorter than dorsal oral ones (67×14), post-testicular region is
very long (38.8%), very long armed cirrus, short (1-15%) uterus, large eggs (134×85) and small
collar and large 27 collar spines. On bases of these features flukes were identified as Isthmiophora
melis.
Keywords: Isthmiophora melis, Neovison vison, Mustela putorius
References
[1] A. Kostadinova, D.I Gibson, Systematic Parasitology. 2002, 52(3), 205-217
[2] V. Radev, I. Kanev, D. Khrusanov, B. Fried. Parazitologiia. 2009, 43(6), 445-453
ISSN 2335-8653
40
Investigation Of Tick-Borne Pathogens In Baltic Countries
Algimantas Paulauskas
Vytautas Magnus University, Vileikos 8, Kaunas, Lithuania E-mail address a.paulauskas@gmf.vdu.lt
Abstract
Tick-borne diseases are of major importance on human and animal health in the world. Tick-borne
diseases are increasingly recognized as important threats to public health in Baltic countires. The
ecology and epidemiology of tick-borne diseases are complex and diverse, and affected by the
relationship between the pathogen, the host (vector or vertebrate host) and the environment. For
today tick-borne encephalitis (TBE), Lyme borreliosis are widely distributed and well recognized
tick-borne diseases in Baltic States. The geographical and spatial distributions of some European
tick vectors have been changing in the last few decades, and new viral, bacterial and protozoan
tick-borne pathogens have been detected in former non-endemic areas. During the past two
decades D. reticulatus has expanded its range in the Baltic countries, and new localities with D.
reticulatus occurrence have been found in Latvia. Canine babesiosis has emerged in Latvia and
become widely distributed and quite frequent in Lithuania. Climatic changes, the significant
increase of tourism and travel of dogs across Europe have caused an increase in the geographical
range of different infections. In recent years Baltic countries have witnessed the introduction of
previously unknown human and animal pathogen. In recent years the variability of ticks and tick-
borne pathogens in Baltic countries has been investigated. The advances in molecular biology
during the last two decades and using of molecular diagnostic techniques have allowed researchers
in Baltic countries to better diagnose, trace and characterize pathogens, and have led to the
discovery of new vector-borne pathogenic organisms.
Keywords: Tick-borne diseases, Baltic countries.
ISSN 2335-8653
41
Staphylococcus Hominis Isolated From Hospital Patient Resistance To
Antibiotics And Resistance To Antimicrobial Genes
Alvydas Pavilonis, Rita Plančiūnienė, Žaneta Maželienė, Povilas Kavaliauskas, Modestas
Ružauskas, Marius Virgailis, Irena Klimienė, Rita Šiugždinienė, Raimundas Mockeliūnas
Microbiology and Virology Institute, Lithuanian University of Health Sciences
alvydas.pavilonis@lsmuni.lt
Abstract
The aim of this study was to determine antimicrobial resistance to antibiotics level Staphylococcus
hominis isolated from hospital patients.
One hundred twenty-five samples were tested for isolated Staphylococcus hominis (S. hominis).
Isolation of staphylococci was performed using Mannitol Salt Agar and Plasmacoagulase test was
performed as well. Species identification was performed using Microgen Staph ID (Microgen
Bioproducts) as well as 16S rRNR gene sequencing. Antimicrobial susceptibility was performed
using “Sensititre” (Trek Diagnostic Systems) plates. Interpretation of results were evaluated
according to EUCAST recommendations. Genes encoding resistance to separate classes of
antimicrobials were detected by PCR.
125 hospital patients were investigate. Thirty one isolates of Staphylococcus hominis was obtained
from humans patients (24.8%). 26 (83.9%) S. hominis strains were obtained from 31 demonstrated
resistance to one or more antibiotcs. The resistance of S. hominis isolates was detected to
penicillin (77.41%) and ampicillin (61.2%), erythromycin (80.6%), tetracycline (48.3%),
trimethoprim/sulfamethoxazole (25.8%), ciprofloxacin (25.8%), clindamycin (29.0%),
gatifloxacin (22.5%), levofloxacin (19.3%), rifampin (9.6%) and gentamicin (6.4%). 11 (35.5%)
isolated from S. hominis strains were resistant to methicillin, all strains were susceptible to
vancomycin, quinupristin/dalfopristin, ceftriaxone, daptomycin and linezolid. All methicillin
resistance S. hominis strains carried the mecA as well as blaZ genes. S. hominis strains resistant to
tetracycline carried the tetK gene (32%), to macrolides - msrAB gene (19.4%). ermC gene was
also prevalent in 9.6% isolates. Gentamicin resistant genes aac(6′)-Ie-aph(2")-Ia and aph(3′)-IIIa
were detected in 3.2% S. hominis strains. Resistance to trimethoprim in S. hominis strains was
encoded by dfrG (6.5%).
The results suggest that clinical S. hominis strains are resistant to antibiotics. In spite that S.
hominis is known as a human pathogen, the variety of the genes encoding resistance to different
classes of antimicrobials was more expressed. It should take protective measures to prevent
antibiotic-resistant and methicillin-resistant spread in hospitals.
The study was funded by grant (MIP-075/2013) from the Research Council of Lithuania.
Keywords: Staphylococcus hominis, Antibiotics, Biosafety, Genes.
ISSN 2335-8653
42
Synthesis And Characterizations Of Silver Nanoparticles Using Black Currant
Extract
Judita Puišo1, Matas Damonskas1, Paulius Danilovas2
1Department of Physics, Kaunas University of Technology, Studentų str. 50, LT-51368 Kaunas, Lithuania, 2Department of Polymer Chemistry and Technology, Kaunas University of Technology, Radvilenu pl. 19, LT-50254
Kaunas, Lithuania
judita.puiso@ktu.edu
Abstract
Biogenic synthesis of silver nanoparticles is based on the reduction of silver ions by enzymes of
some microorganisms or by natural substances and plant extracts. Preparation of silver
nanoparticles in aqueous solution using reducing agents from berries, fruits vegetables, plant
opened possibilities of their „green synthesis“. These silver nanoparticles preparation methods are
environmentally friendly. In the present study, we have synthesized silver nanoparticles using
dried black currant (Ribes nigrum) extract by photoreduction method. The silver nanoparticles
formation was confirmed by the color change of extract of black currant and further confirmed by
UV-Vis spectroscopy. The size and size distribution of colloids of silver nanoparticles were
studied using dynamic light scattering (DLS). Effect of silver nanoparticles on the wettability of
colloid solutions was evaluated by contact angle measurements. We have elaborated the new
method of direct formation of silver nanoparticles in black currant extract for antibacterial,
wound's healing and other applications in medicine.
Keywords: silver nanoparticles, black currant, surface plasmon resonance, UV-VIS, DLS.
ISSN 2335-8653
43
Copper Effects On The Growth Of Common Duckweed (Lemna Minor L.)
Jūratė Žaltauskaitė 1, Giedrė Pėstininkaitė 2
1, 2 Vytautas Magnus University, Vileikos st. 8-223, LT-44404 Kaunas, Lithuania.
Emails: 1 j.zaltauskaite@gmf.vdu.lt; 2 giedre.pestininkaite@fc.vdu.lt
Abstract
Heavy metals pollution is one of the main environmental problem, which is mainly caused by
anthropogenic impact. Even low concentrations of heavy metals can have a negative impact to
biota. The aim of this work was to investigate the impact of copper (Cu) to the growth of common
duckweed (Lemna minor L.). The plants were affected by 1-1000 µl/l concentrations of Cu in their
growth medium for 10 days and the effects on Lemna minor morphometric (fresh and dry weight,
growth rate), physiological (chlorophyll a, chlorophyll b, carotenoids) and biochemical (lipid
peroxidation) parameters were examined. The results showed that copper Cu inhibited the
production of new fronds of Lemna minor and growth rate inhibition increased linearly along with
the metal concentration in the medium. The metal had a significant negative impact on the amount
of photosynthetic pigments in Lemna minor. The application Cu provoked an oxidative stress. The
content of malondialdehyde in the tissue of duckweeds exposed to 1000 μg/l of Cu was by 65.5%
higher than in control plants.
Keywords: Copper, common duckweed (Lemna minor L.), growth rate, oxidative stress
ISSN 2335-8653
44
Selection Of AP-PCR Markers And Conditions For Hypericum Maculatum
Crantz
Gianni Barcaccia1, Giulio Galla1, Lina Zybartaitė2, Indrė Railienė 2, Algimantas
Paulauskas2, Eugenija Kupčinskienė2
1University of Padova, Campus of Agripolis, Viale dell'Università, 16, 35020 Legnaro (Italy)
gianni.barcaccia@unipd.it 2Vytautas Magnus University, Viliekos g 8-212, LT-44404, Kaunas, (Lithuania),
e.kupcinskiene@gmail.com
Abstract
Species belonging to Hypericum L. genus are rich in flavonoids and essential oils and have been
widely used in pharmacology. DNA markers as a standard approach to relate these molecular
systems nowadays are widely used. Hypericum perforatum and Hypericum maculatum are two
widely spread species in Lithuania. Throughout the world various aspects of biology of H.
perforatum including molecular genetics has got much bigger attention in comparison to H.
maculatum. Present study is aimed at development and specialization of arbitrarily chosen primers
and conditions of the polymerase chain reaction (PCR) for H. maculatum. Five different sequences
containing universal primer M13 (GACGGCCAGT) were chosen for investigation: APPCR_KA2
(GACGGCCAGTCGTGTCCGAG); APPCR_KB2 (GACGGCCAGTCGTATACTCC);
APPCR_KX2 (GACGGCCAGTTTGTACATGAC); APPCR_KM2 (ACGGCCAGTT ACGCACAAC);
APPCR_KR2 (TTGTAAAACGACGGCCAGTRTGTATACATAYGTAAC), hereafter used in
abbreviated form – KA2, KB2, KX2, KM2, KR2. Polymerase Chain Reaction mixture consisted
of 3 µl genomic DNA, 0.5 µl of each primer (100 µM/µL), 0.2 µl Taq polimerase (5 U/µl), 2 µl
10xNH4 Taq buffer, 0.8 µl dNTP (25nM), 12.2 µl H2O. Requirements of MgCl2 were not equal
and ranged between 0.8-1.2 µl (50 nM). Only KR2_KA2 primer combination required addition of
5 µl (4 µl +1 µl) of CES (2.7 M betaine, 6.7 mM DTT, 6.7% DMSO, 55 mg/ml BSA) in order to
avoid potential inhibitory affect on PCR caused by secondary metabolites. Separated subsequent
addition of universal labeled primer M13 provided better PCR results in comparison to
simultaneous application of all markers. Universal primer M13 (GACGGCCAGT) end was
conjugated with fluorescent tags 6FAM (blue), TAMRA (black) and HEX (green). Amplification
cycles were divided into three stages differently to two stages applied by Welsh, McClelland
(1990). Additional stage of amplification was added in behalf of extension of cycle numbers from
42 (Welsh) to 52 cycles and in the main amplification elongation period was specified for each
primer and ranged between 20 s to 300 s. Obtained PCR products were analysed by capillary
electrophoresis. Three (KA2; KX2; KM2) out of 5 primers in pairs with KR2 have generated
reproductive and scorable DNA fragments for all 8 selected populations of H. maculatum of
Lithuania. Each primer set was generating fragment numbers ranging for each individual of
population from 110 up to 250 and polymorphic at the species level.
Keywords: medicinal plants, herbs, Hypericaceae, Imperforate St. John's-wort, population,
genetic diversity, primers
ISSN 2335-8653
45
Genes Encoding Antimicrobial Resistance In Methicillin-Resistant
Staphylococcus Haemolyticus Isolated From Humans And Dogs
Modestas Ružauskas, Rita Plančiūnienė, Marius Virgailis, Irena Klimienė, Rita
Šiugždinienė, Lina Vaškevičiūtė, Raimundas Mockeliūnas, Alvydas Pavilonis
Microbiology and Virology Institute, Lithuanian University of Health Sciences
modestas.ruzauskas@lsmuni.lt
Abstract
The aim of this study was to compare antimicrobial resistance profile of methicillin-resistant
Staphylococcus haeamolyticus (MRSH) prevalent in humans and dogs.
Three hundred and thirty six samples of human clinical material as well as 470 samples of
diseased dogs were screened for isolation of MRSH using oxacillin- and cefoxitin-based selective
media. Identification of the isolates was performed using biochemical testing (Microbact 12S;
Oxoid, UK) as well as 16S rRNR gene sequencing. Genes encoding resistance to separate classes
of antimicrobials were detected by PCR.
Twenty isolates of methicillin-resistant Staphylococcus haemolyticus were obtained from humans
(6.0%) and 11 isolates from dogs (2.3%). All MRSH strains carried the mecA as well as blaZ
genes. Resistance to tetracycline was found in 12 human isloates (11 of them carried the tetK
gene) and 7 dog isolates (6 of them carried the tetK gene and one isolate – the tetM gene).
Resistance to macrolides was detected in 18 human and 10 dog isolates. msrAB genes were
prevalent both in human (10) and dog (7) isolates. ermC gene was also prevalent in human (7) and
dog (2) isolates however, ermA was found only in the isolates (2) from dogs. Resistance to
gentamicin was detected in 13 human and 9 dog isolates. Two genes aac(6′)-Ie-aph(2")-Ia and
aph(3′)-IIIa were found in human (13 and 7 respectively) and dog isolates (8 and 6 respectively)
encoding resistance toward aminoglycosides. Resistance to trimethoprim in 10 human isolates was
encoded by dfrG gene whereas 3 isolates from dogs carried the dfrG and 2 – dfrK gene.
According to the results obtained it could be outlined that S. haemolyticus and particularly MRSH
might be treated as zoonotic pathogen with similar antimicrobial resistance profile both in humans
and dogs. In spite that S. haemolyticus is known as a human pathogen the variety of the genes
encoding resistance to different classes of antimicrobials was more expressed in dog isolates.
Safeguard measures should be taken in order to avoid cross-spreading of MRSH between dogs and
their owners.
The study was funded by grant (MIP-075/2013) from the Research Council of Lithuania.
Keywords: Antibiotics, Biosafety, Dogs, Genes.
ISSN 2335-8653
46
Dirofilaria Repens Infection In Lithuania
Vytautas Sabūnas1,2, Povilas Sakalauskas1, Algimantas Paulauskas1, Jana Radzijevskaja1
1Vytautas Magnus University, Department of Biology, Vileikos str. 8, Kaunas LT-44404, Lithuania, 2 “Siaurio Snauceris” Small Animal Clinic, Chemijos av. 31A, LT-44001 Kaunas, Lithuania
E-mail: povilas.sakalausk@gmail.com
Abstract
Dirofilaria repens is a filarial nematode, which can cause subcutaneous disease in dogs, cats
and other carnivores and can also accidentally infect humans by the bites of mosquitoes. Canine
dirofilariasis in the last 50 years have become recognized worldwide as an emerging parasitic
disease. The climate change, extensive movement of dogs across countries and continents has
contributed to the expanding of distribution range of Dirofilaria spp. to areas they had never found
before. Accurate identification of filarial species is clinically important, because of the zoonotic
concerns and therapeutic implications. In Lithuania, the first cases of canine dirofilariasis caused by
D. repens have been reported from Department of Infectious Diseases, Veterinary Academy
(Kaunas, Lithuania) in 2010–2011. Six human cases of D. repens infection was recorded in
Lithuania during 2011-2014. In this study we have investigated 1280 blood samples of randomly
selected dogs presented in Kaunas small animal clinic (UAB “Siaurio Šnauceris”) during 2014.
Blood samples were stained in Diff-quick stains and analyzed by blood smear microscopic
technique. The species of the microfilariae were determined on the basis of their morphometrical
characteristics. All positive samples additionally were investigated using Modified Knott’s test. Ten
samples (0.78%) were positive for the presence of microfilariae. We also used PCR-based method
for differentiation and accurate identification of the filarial species.
This work was partly supported by project "Promotion of Student Scientific Activities" (VP1-3.1-
ŠMM-01-V-02-003) from the Research Council of Lithuania (P.S.). This project is funded by the
Republic of Lithuania and European Social Fund under the 2007-2013 Human Resources
Development Operational Programme’s priority 3.
Keywords: Dirofilaria repens, canine dirofilariasis, Lithuania.
ISSN 2335-8653
47
Light As A Tool For Manipulation Of Plant Responses - Morphogenetic Effects
(Part I)
Giedrė Samuolienė1,2, Akvilė Viršilė1, Aušra Brazaitytė1, Alina Čeidaitė1, Pavelas
Duchovskis1,2
1 Lithuanian Research Centre for Agriculture and Forestry, Institute of Horticulture, Kaunas str. 30, Babtai, LT-
54333, Lithuania 2Aleksandro Stulginskio Universitetas, Studentų g. 11 LT – 53361, Akademija, Kauno raj.,
g.samuoliene@lsdi.lt
Abstract
Plant respond to light stimulus by growing, differentiating, sensing the intensity, the time of day
duration, and seasons. Light is the energy source for plant growth, plants have evolved highly
sensitive mechanisms for perceiving light and using that information for regulating development
changes to help maximize light utilization for photosynthesis. Plants grow and develop using light
in a process known as photomorphogenesis. Thus, light affects plant development in many ways
throughout all stages of development. Photoreceptors are able to detect and react to light changes
and activate metabolic reactions, which evokes specific morphogenetic responses. In order to
optimize the formation of generative elements during different development stages, to improve
effectiveness of selection it is very important to know plant morphogenetic mechanisms, to control
processes of growth and development and their ratio. Photoperiodic changes are very important
for biannual and perennial plant flowering initiation. Spectral composition and light intensity also
enables to control plant morphogenetic responses in different levels, such as reaction of
photosynthetic system, primary and secondary metabolite changes in photomorphogenetic
processes. Some morphogenetic effects, which might be controlled by light, are presented in this
work
Keywords: carbohydrates, intensity, light-emitting diodes, pigments, photoperiod,
phytohormones.
ISSN 2335-8653
48
The Prevelence Of Tick Born Pathogens In Small Mammals In Lithuania
Karolis Sivickis1, Paulauskas Algimantas Paulauskas1, Jana Radzijevskaja1, Vaclovas
Gedminas2, Linas Balčiauskas3 1
Faculty of Natural Sciences, Vytautas Magnus University, Lithuania, 2Kaunas Tadas Ivanauskas Zoological
Museum, Lithuania, 3 Nature Research Centre, Lithuania
Karolis.siv@gmail.com
Abstract
Ticks born disease are important problem in the European countries (Gray et al., 2009). Ticks now
are second most important pathogens vector after mosquito, which cause people and animals
illness (Beugnet and Marie, 2009). Small mammals are vectors in ticks born diseases life cycle.
Rodents are recognized as main reservoir host for tick born disease (Meerburg, 2010). This study
aim was to evaluate Babesia spp., Bartonella spp. pathogens prevalence in Lithuanian small
mammals. Mammals were collected from three different biotopes: woodland, grassland, beaver
lodge, and great cormorant colony. Small mammals were captured from 2013 to 2014. A total of
388 small rodents representing 8 species were trapped. Captured rodents were identified as
Apodemus flavicollis, A. sylvaticus, Micromys minutus, Microtus glareolus, M. arvalis, M.
oeconomus, M. agrestis, Arvicola terrestris, Muscardinus avellanarius, Sorex araneus, S.
minutus. For analysis were used spleen samples. Identification of Bartonella spp. was done using
gltA gene molecular markers and ITS regione, and for Babesia spp. - 18S RNA gene molecular
markers. Bartonella spp. was detected in 26 % (102 of 388) of examined mammals, Babesia spp.
was detected in 6% (25 of 388) of examined mammals.
Keywords: small mammals, Bartonella, Babesia, Lithuania
References: [1] Gray, J.S., Dautel, H., Estrada-Pe˜na, A.,Kahl,O.,Lindgren,E.,2009.Effectsofclimete change onticksandtick-
bornediseasesinEurope.Interdiscip.Perspect.Infect. Dis.,
[2] Beugnet, F., Marie, J.L., 2009. Emerging arthropod-borne diseases of companion ani-mals in Europe. Vet.
Parasitol. 163, 298–305.
[3] Meerburg BG. Rodents are a risk factor for the spreading of pathogenson farms, 2010. Veterinary
Microbiology;142:464–5.
ISSN 2335-8653
49
Analysis Of Bacteria Sensitivity To Encapsulated Nisin
Ramunė Stanevičienė1, Juliana Lukša1, Rūta Žiukelytė1,2, Regina Losinska-Sičiūnienė1,
Tatjana Krivorotova2, Jolanta Sereikaitė2, Elena Servienė1,2
1Laboratory of Genetics, Institute of Botany, Nature Research Centre, Vilnius, Akademijos St. 2, LT-08412 Vilnius,
Lithuania. E-mail: ramunes2000@yahoo.com
Lithuania, 2 Department of Chemistry and Bioengineering, Vilnius Gediminas Technical University, Vilnius,
Lithuania. E-mail:elena.serviene@botanika.lt
Lactococcus lactis bacteria produce a small cationic peptide nisin, which exhibits a wide spectrum
antimicrobial activity and is suitable for food preservation. In order to protect nisin from the
interaction with food components, ensure its stability and functionality during food processing and
storage nisin-loaded pectin nanoparticles were formed by complexation method and their
antibacterial features were evaluated.
By performing agar-diffusion assay, the most pronounced antibacterial activity of
encapsulated nisin was detected against Gram-positive bacteria Arthrobacter sp. and twice lower
activity - against Bacillus subtilis. By applying the agar plate count method, it was determined that
about 1 x 109 cells of Arthrobacter sp. and about 8 x 108 cells of B. subtilis were killed following
the overnight incubation with microcapsules.
The Gram-negative bacteria Esherichia coli and Klebsiella sp. are resistant to nisin
treatment. In order to increase the permeability of both bacteria to the antibacterial peptide,
chelating agent EDTA and redox agent DTT were applied. It was observed that the activity of
nisin-loaded nanoparticles against permeabilised bacteria was still weak and barely detectable by
the growth inhibition zones. However, the viability test allowed detection of 100 to 1000 fold
decrease in Esherichia coli and Klebsiella sp. cell survival.
We determined that nisin-loaded pectin nanoparticles decreased the number of CFU
of all microorganisms tested in a dose-dependent and pectin-dependent manner. With all
microorganisms tested nisin-loaded high methoxyl pectin (HMP) nanoparticles demonstrated the
lowest antibacterial activity. In contrary, nisin-loaded pectic acid (PecA) and dodecyl pectin
(DoPecA) nanoparticles showed the greatest ability to inhibit growth of indicative Gram-negative
and Gram-positive microorganisms. The value of pH of encapsulation buffer slightly affects the
biological activity of nisin-bearing microcapsules.
In summary, in this study we established that nisin maintains its antimicrobial activity
after encapsulation, therefore could be effectively applied for food preservation.
Keywords: nisin, nanoparticles, antibacterial activity.
Acknowledgement: This research was funded by a grant (No. SVE-03/2014) from the Research
Council of Lithuania.
ISSN 2335-8653
50
Selection Of Amplified Fragment Length Polymorphism Markers For
Investigation Of Genetic Diversity Of Impatiens Parviflora
Kristė Stravinskaitė1, Lina Zybartaitė1, Eugenija Kupčinskienė1, Walter Durka2 1Department of Biology, Vytautas Magnus University, Vileikos Str. 8, LT-44404 Kaunas, Lithuania
* Corresponding author. E-mail: kriste.stravinskaite@gmail.com 2Department of Community Ecology, Helmholtz Centre for Environmental Research – UFZ, Theodor-Lieser-Str. 4,
06120 Halle, Germany
Abstract
Small Balsam (Impatiens parviflora) is an invasive annual usually 30-60 cm height plant with pale
yellow flowers, which has red spots on the inside. Impatiens parviflora is a native of Central Asia,
this species is widely distributed in eastern, central and northern European countries and it is one
of the most invasive species in the continent [1]. The objective of this study was to select
amplified fragment length polymorphism (AFLP) markers for investigation of genetic diversity of
Impatiens parviflora. Four individuals were chosen randomly from European populations and
were used to screen AFLP primer combinations. Fragment analysis was performed on an ABI
3130 genetic analyser using GeneScan LIZ 500 as internal size standard. Peaks were scored
manually in the range of 50-500 bp using GeneMapper version 3.7. In total 32 primer
combinations were screened. Eight fluorescent labelled primers (FAM-AAC/CTC, VIC-
ACG/CAC, NED-ACC/CAC, PET-AGG/CAC and FAM-AAC/CTG, VIC-ACG/CAT, NED-
AAG/CAG, PET-AGC/CAC) were selected according to generated peak height and their distance
from each other. We eliminated primers, which composed low peaks or generated peaks were too
close to each other or too distant from each other, as it was described by Kloss et al., 2011 [2].
Results revealed that chosen AFLP markers are valuable for estimation of genetic diversity of
Impatiens parviflora populations.
Keywords: Small Balsam, invasion, alien plants, molecular markers, population genetics
References:
[1] D. Chmura, Biology and ecology of an invasion of Impatiens parviflora DC in natural and semi-natural habitats,
Bialsko-Biala, 2014, Poland, 216 p.
[2] L. Kloss, M. Fischer, W. Durka, Land-use effects on genetic structure of a common grassland herb: A matter of
scale, Basic and Applied Ecology, 2011, 12(5): 440-448.
ISSN 2335-8653
51
Saccharomyces Cerevisiae K2 Toxin Fusion With GFP
Živilė Strazdaitė-Žielienė1, Iglė Vepštaitė1, Lukas Birgiola1,2, Elena Servienė1,2
1Laboratory of Genetics, Institute of Botany, Nature Research Centre, Vilnius, Akademijos St. 2, LT-08412 Vilnius,
Lithuania. E-mail: genetike@gmail.com Lithuania, 2 Department of Chemistry and Bioengineering, Vilnius
Gediminas Technical University, Vilnius, Lithuania
Killer yeasts are considered as potential biocontrol agents to avoid or reduce wine spoilage by undesirable
species. One of the biological mechanisms for the regulation of population dynamics in complex microbial
ecosystems is the production of toxins capable to kill or inhibit other microorganisms. The toxins
synthesized by yeasts, known as killer factor, are proteins, whose action is mediated by specific receptors
in the cell wall of the sensitive microorganism. K2 killer protein of Saccharomyces cerevisiae is the most
frequent toxin among yeast dominating in the vineyard-winery ecosystem. This protein is produced at
negligible levels in yeast, making difficult to detect and isolate it in amounts sufficient for investigation.
In the course of our research, the S. cerevisae K2 toxin encoding gene was tagged at its
carboxyl terminus by GFP, and the chimeric construct was subcloned into the yeast episomal
vector. The hybrid protein-possesing plasmid was introduced into E. coli and S. cerevisiae cells.
Based on the fluorescence, expression of the GFP was observed in both bacteria and yeast cells.
However, following the killer activity and immunity tests we found that the chimeric protein K2-
GFP did not show killer activity and demonstrated only partial immunity to K2. This can be
explained by the fact, that C-terminus of killer protein is highly sensitive for interruption and
affect the functionality of the toxin.
Keywords: Saccharomyces cerevisiae killer yeasts, K2 toxin, GFP.
ISSN 2335-8653
52
Freshwater Bryozoa Study In Lithuania: Past And Present
J.Rutkauskaitė- Sucilienė, I. Šatkauskienė
Vytautas Magnus university,
E-mail address: i.satkauskiene@gmf.vdu.lt
Abstract
Bryozoans (Bryozoa) are among the most fascinating invertebrate animals, which lead a hidden
existence under water. The most species of bryozoans lives in the marine water, some in
freshwater.
Freshwater bryozoans are among the most important filter feeders, along with sponges and
mussels. Thus, they perform water cleaning and protection functions. The colonies of bryozoa
serve as food or habitats for other invertebrates. Several species of moss animals are as a host of
fish parasites for example microscopic myxozoans that can to cause of proliferative kidney disease
in salmon and for that reason fishermen are experiencing significant loss. Sometimes bryozoans
can cause problems in a human’s life as can clog pipes of water, treatment facilities of sewages or
the cooling pipes of power stations.
According to Fauna European (2013) there are 21 freshwater bryozoan’s species in Europe, with a
number of these species being recorded in neighbouring countries (Latvia, Estonia, Poland, and
Belarus). Little is known about bryozoans in Lithuania, other than one thesis conducted during
1931-1933 by B. Pajiedaitė, who found 7 freshwater bryozoans species and described it.
Unfortunately from 1933 and onwards no further studies in Lithuania have been conducted on
these invertebrates for the past 82 years. Our study has two main aims: (1) to collect and review all
available information related to the Lithuanian bryozoans, emphasizing the importance of the
bryozoans in ecosystems and human life; and (2) to declare that bryozoans’ research Lithuania has
been restarted.
Key-words: bryozoan, statoblasts, diversity, Lithuania
ISSN 2335-8653
53
Effects Of The Urban Environmental Conditions On The Physiology Of Two
Biological Indicators
Gintarė Sujetovienė, Vilma Galinytė
Vytautas Magnus university,
E-mail address: g.sujetoviene@gmf.vdu.lt
Abstract
Response to air pollution was assessed for lichen Evernia prunastri (L.) Ach. and the moss
Ptilium crista-castrensis (Hedw.) DeNot. Samples were collected from a relatively clean remote
area (Birštonas) and transplanted to a control site and three areas reflecting the different
urbanization levels: urban, suburban and residential areas. Transplants were exposed for 1- and 2-
month periods. Concentrations of gaseous pollutants (NO, NO2, SO2) were monitored by air
monitoring stations. Differences in response of fluorescence, chlorophylls contents, MDA and
injuries of cell membranes were observed among the two species and between the sites.
Transplants of P.crista-castrensis from urban sites showed a decrease in chlorophyll a
fluorescence. The integrity of cell membranes was also more damaged in the transplanted moss
samples than in lichen. Significantly higher oxidative stress was induced in the transplants at
urban and residential sites in the beginning of transplantation period (after 1 month) but such trend
was not characteristic after 2 months. Since SO2 concentrations were relatively low but they were
negatively correlated with chlorophyll content in moss samples. There was a linear relationship
between SO2 concentration and MDA content of lichen and moss samples exposed in urban
environmental conditions. Chlorophyll a and b content in mosses was positively related with
nitrogen oxides while lichen showed the opposite trend. Results fit with the known ecological
requirements of the studied species: E.prunastri being characteristic to relatively dry and warm
sites, P.crista-castrensis being typical to moister and cooler sites. The results on transplants
vitality showed that lichen is more suitable for bioindication studies with changes physiological
parameters while moss was more sensitive to pollutants and site condition.
Keywords: air quality, lichen, moss, physiological response.
ISSN 2335-8653
54
Studies On Green Synthesis, Characterization And Anti Proliferative Potential
Of Silver Nanoparticles Using Medicinal Plants Collected From Yelagiri Hills
Giridharan.T*1, Chandran. M1, Sindhu. S2, Arumugam. P2
1 Department of Biotechnology, Vel tech High tech Dr. RR Dr. SR Engineering College, Avadi,
Chennai - 600 062 2 Armats Biotek Pvt Ltd, Guindy, Chennai - 600 032 *giridharan.biotech@gmail.com, 9677048614
ABSTRACT
Cancer is abnormal growth of cells which is caused due to smoking, alcohol consumption
and genital disorders. The aim of the study is to evaluate the anti-proliferative activity of silver
nanoparticles synthesized using 4 medicinal plants collected from yelagiri hills. The leaves of the
plants were used for optimization of silver nanoparticles by varying the time exposure of the
reaction mixture to sunlight (5, 10, 15 minutes). The anti-oxidant potential of samples was studied
by DPPH, phosphomolybdenum, metal chelating and HRSA assays. Also, the synthesized
nanoparticles were characterized by UV, SEM, XRD and FTIR techniques. The results suggest
that nanoparticles synthesis was significant at exposure time of 5 and 10minutes. The synthesized
particles were confirmed by UV spectroscopy which showed characteristic peak at 427, 418, 421,
421nm for the 4 samples respectively. The synthesized nanoparticles were found to be in the size
range of 60-90nm with characteristic XRD peaks at 2θ values of 37.87 and 45.86 and 37.74 and
45.85 for two plants. The results of the study revealed that the synthesized silver nanoparticles
possessed significant antioxidant, anti inflammatory, anti-proliferative and antimicrobial
properties.
Keywords: Silver nanoparticles, Antioxidant activity, Antimicrobial potential, UV-Vis, SEM,
XRD, FTIR, MCF7 cells.
ISSN 2335-8653
55
Metrology In Radiotherapy: Tlds In Brachytherapy Case
Benas G. Urbonavičius1, Diana Adlienė1, Paulius Kaškonas
1Kaunas University of Technology, Studentų str. 50-253, Kaunas, Lithuania, benas.urbonavicius@ktu.lt
Abstract
Routine in vivo dosimetry (IVD) is well established in external beam radiotherapy however it is
restricted mainly to detection of gross errors in high dose rate brachytherapy (HDR) due to
complicated measurements in the field of steep dose gradients in the vicinity of radioactive source
and due to high uncertainties. Metrological parameters of the measuring systems regarding
radiotherapy are rarely discussed, mostly due to the nature of ionizing radiation. Out of many
dosimetry methods, integrating ones are the most difficult to evaluate. Proper calibration of
detectors before their application for IVD is essential. For this reason the uncertainty evaluation
for TLD dosimetry system was performed. Dose measurements were performed and verified with
the doses calculated by corresponding standard treatment planning system for 5 cancer patients. In
vivo dose measurements performed during HDR brachytherapy treatment procedures have shown
a good agreement between dose variation tendencies.
Keywords: Metrology, Radiation, Radiotherapy, Brachytherapy, Dosimetry
ISSN 2335-8653
56
Detection Of Bacteria And Fungi By Multiplex Real-Time PCR And FRET
Technique
Máté Vadovics, Rita Anyanwu
1. Department of Medical Microbiology and Immunbiology, Faculty of Medicine,
University of Szeged, Hungary
vadovicsmate@gmail.com
Identification of fungal and bacterial causative agents of sepsis with the conventional blood
culturing techniques is time consuming therefore a more rapid and sensitive PCR based technique
were introduced. The newly developed prototype system provides a new tool to identify these
microbes’ specifically.
Our previous study focused on the differentiation of the most common bacterial [1] and fungal [2,
3] causative pathogens of bloodstream infections. The last developed, multiplex system [1] can
distinguish the Gram-negative, Gram-positive bacteria and fungi in the same reaction vessels of
LightCycler capillary Real-time PCR. The 7 most frequent Candida species were identified with
the melting peaks of amplicons. The G+ and G- bacterial subgroups were identified through a joint
consideration of the melting points of the Gram specific probes and the melting point of the
overall PCR product. The prototype system could be faster with the neglect of the DNA
purification. Hot-Start (inhibitor tolerant) polymerases allow using the direct blood to the PCR
without DNA purification. In this case the hemoglobin of the blood covers the fluorescence signal
therefore the pathogens can be discriminated only by the size of the amplicons. Our further aim is
the identification of the fungal and bacterial species without DNA purification and also merging
the two techniques.
Keywords: Clinically relevant bacteria; Candida; Melting point analysis; Fluorescence Resonance Energy Transfer (FRET);
Multiplex real-time PCR; Bloodstream infections
References:
1. Ádám Horváth, Zoltán Pető, Edi t Urbán, Csaba Vágvölgyi and Ferenc Somogyvári
(2013) A novel, multiplex, real-time PCR–based approach for the detection of the commonly
occurring pathogenic fungi and bacteria BMC Microbiol. 13-300.
2. Somogyvari F, Serly J, Doczi I, Nagy E (2005) Molecular differentiation of most
frequent Candida species causing blood-stream infection. Mycoses 2:S198.
3. Somogyvari F, Horvath A, Serly J, Majoros H, Vagvolgyi C, Peto Z.(2012) Detection of
invasive fungal pathogens by real-time PCR and high-resolution melting analysis. In vivo. 26(6):979-83.
ISSN 2335-8653
57
Association Of Genetic Variants In PNPLA3, MERTK, PCSK7 And RNF7 With
Liver Cirrhosis
Irena Valantienė1, Juozas Kupčinskas1, Greta Varkalaitė2*, Gediminas Kiudelis1, Vitalija
Petrenkienė1, Jolanta Šumskienė1, Limas Kupčinskas1 1Department of Gastroenterology , Medical Academy, Lithuanian University of Health Sciences, Eivenių St. 2, LT-
50009 Kaunas, Lithuania; 2Institute for Digestive Research Medical Academy, Lithuanian University of Health
Sciences, Eivenių St. 2, LT-50009 Kaunas, Lithuania;
*grevark@gmail.com
Background: Liver cirrhosis (LC) is a progressing disease commonly caused by alcohol
consumption, infections of chronic hepatitis B and C and other. The search for genetic factors that
could help to select patients at higher risk of developing LC is necessary. Current data indicate
role of PNPLA3 gene product in lipid homeostasis and genome-wide association studies (GWAS)
revealed PNPLA3 (rs738409) single-nucleotide polymorphism (SNP) association with liver
diseases and fibrosis risk [3]. A recent GWAS suggest a possible relationship between the
clearance of apoptotic cells and liver fibrosis, revealing genetic polymorphisms of MERTK
(rs4374383) and RNF7 (rs16851720) importance [1]. Other GWAS demonstrated that PSCK7
(rs236918) is a risk factor of LC in hereditary hemochromatosis (HH) patients [2,4]. Correlation
of these SNPs with LC has not been studied well. The aim was to perform genotyping for
PNPLA3 (rs738409), MERTK (rs4374383), PCSK7 (rs236918) and RNF7 (rs16851720) in LC
patients and healthy individuals groups and determine the potential link between these SNPs and
the risk of developing LC.
Materials and Methods: In total 244 patients with LC and 498 healthy control individuals were
genotyped. Genotyping was performed for 4 genetic variants in PNPLA3, MERTK, PCSK7, RNF7
genes using real-time PCR TaqMan® assay. Statistical analysis were performed using PLINK:
Whole genome data analysis toolset.
Results: MERTK and PCSK7 SNPs was not associated with the risk of developing LC (adjusted
odds ratio (ODa)-1,2, 95% confidence interval (CI95) 0,96-1,52, P-0,109; ODa-0,79, CI95 (0,56-
1,11), P-1,69 respectively). RNF7 SNP showed no significant association in allelic association
analysis (ODa-0,75, CI95 (0,56-1,28), P-0,074) and showed lower risk of developing LC when
compared with CC genotype (ODa-0,18, CI95 (0,04-0,79), P-0,023). PNPLA3 SNP showed allelic
association with higher risk of developing LC (ODa -1,91, CI95 (1,47-2,50), P-1,812*10-8),
genotypic association analysis revealed higher risk of developing LC when compared to GG
genotype (ORa-5,01, CI95 (2,52-9,94), P-4,158*10-6) and CG genotype (ORa-1,61, CI95 1,13-2,29,
P-0,09). Odds ratio was adjusted for age and sex.
Conclusion: PNPLA3 (rs738409) showed strong allelic and genotypic (GG, CG) association with
higher risk of developing LC (P-1,812*10-6, P-4,158*10-6 respectively). RNF7 (rs16851720)
showed lower risk of developing LC when compared with CC genotype (P-0,023).
Keywords: Single nucleotide polymorphisms (SNP), PNPLA3, MERTK, PCSK7, RNF7, liver
cirrhosis.
References: [1] E. Patin, Z. Kutalik, J. Guergnon, S. Bibert, B. Nalpas, E. Jouanguy et al. Genome-Wide Association Study
Identifies Variants Associated with Progression of Liver Fibrosis from HCV Infection. Gastroenterology. 2012,
143(5), 1244-1252
ISSN 2335-8653
58
Current Distribution And The Diversity Of Babesia Canis Strains In Europe
Linas Venslovaitis, Jana Radzijevskaja, Asta Aleksandravičienė, Vytas Sabūnas, Dalytė
Mardosaitė-Busaitienė, Algimantas Paulauskas
Faculty of Natural Sciences, Vytautas Magnus University, Vileikos 8, LT-44404 Kaunas, Lithuania
Abstract
Babesia canis is intraerythrocytic protozoan blood parasites that are transmitted by the main vector
– Dermacentor reticulatus ticks to dogs and cause canine babesiosis. Canine babesiosis is an
infectious disease circulating worldwide. Due to expansion of D. reticulatus ticks to the new,
earlier non-endemic areas, canine babesiosis have spread and clinical cases have been reported from
central and northern parts of Europe. Canine babesiosis is clinically classified into uncomplicated
and complicated forms. Clinical symptoms range from transient anorexia to a complex syndrome in
which multiple organ systems could be affected. It was suggested, that differences in the clinical
manifestations of disease may reflect different Babesia strains. Statistically significant
differences in clinical signs between genetically diverse groups of B. canis have been detected, and
functional antigenic differences between B. canis strains have been indicated. The first cases of
canine babesiosis in Lithuania were recorded and confirmed by microscopic analysis in the
beginning of 21th century. During the past decade canine babesiosis has become quite frequent in
Lithuania. We have analyzed blood samples from dogs showing clinical signs of babesiosis and D.
reticulatus ticks for the presence of babesial parasites. Sequence analysis showed that B. canis
isolates from dogs and ticks were heterogenic. Based on observed two nucleotides substitution
(GA→AG) in 18S rRNA gene sequences of B. canis isolates, two genotypes were distinguished in
dogs and three genotypes in D. reticulatus ticks. Our study demonstrates the presence of genetically
diverse B.canis strains in Lithuania and show the necessity to use a molecular analysis for an
accurate diagnosis of canine babesiosis. Such information will help to ensure an effective therapy,
and to promote disease control program in Lithuania.
This work was partly supported by project "Promotion of Student Scientific Activities" (VP1-3.1-
ŠMM-01-V-02-003) from the Research Council of Lithuania (L.V.). This project is funded by the
Republic of Lithuania and European Social Fund under the 2007-2013 Human Resources
Development Operational Programme’s priority 3.
Keywords: Babesia canis, genotypes, distribution, Dermacentor reticulatus, Lithuania
Article should be sent to specified journal* editorial office directly with footnotes: “Authors
report was presented in the 9th International Scientific Conference The Vital Nature Sign 2015”
ISSN 2335-8653
59
Stargardt’s Macular Dystrophy: Clinical Case
Alvita Vilkeviciute², Mantas Banevicius¹, Arvydas Gelzinis¹, Brigita Glebauskiene¹, Loresa
Kriauciuniene¹,², Rasa Liutkeviciene1,2
¹Department of Ophthalmology, Lithuanian University of Health Sciences, Medical Academy, Eiveniu 4, Kaunas,
Lithuania, LT-50009, ²Neuroscience Institute, Lithuanian University of Health Sciences, Medical Academy, Eiveniu 4,
Kaunas, Lithuania, LT-50009,
E-mail: alvitavilkeviciute@gmail.com
Abstract
Stargardt's Macular Dystrophy was described in 1909 by Karl Stargardt, a German
ophthalmologist. It is the most common autosomal recessive macular dystrophy, it’s prevalence
1:10000. It is characterized by central visual loss, atrophy of the retinal pigment epithelium.
In this clinical case, we are presenting 13-year-old boy complaining of reduced visual acuity in
both eyes for several months. His best-corrected visual acuity in the right eye was 0.1, and 0.1 in
the left eye. Ophthalmoscopy of the both eyes revealed the onset of disease, and showed a mild
scattering of pigment and loss of macular reflex. Colour vision test showed the damage of red and
green colours vision. Severe patern ERG abnormality with normal photopic and scotopic a- and b-
waves, during Ganzfeld ERG and loss of photopic a- and b-waves were found.
Fluorescein angiography revealed a dark/masked choroid.
As Stargardt’s macular dystrophy is the most common autosomal recessive heriditary macular
dystrophy, but it takes very long time till true diagnosis, that‘s why we are presenting a case
report with a mild changes of the eyes fundus, which will be helpful for early recognizing of
Stargardt’s macular dystrophy.
Keywords: Stargardt's disease, fluorescein angiography, macular dystrophy
References: [1] Bagdonienė R., Sirtautienė R. Akių ligų atlasas II dalis. Vilnius 2001; 475-483.
[2] Aaberg T.M. Stargardt's disease and fundus flavimaculatus: evaluation of morphologic progression and
intrafamilial co-existence. Trans Am Ophthalmol Soc. 1986; 84:453–487.
[3] Allikmets R., Singh N., Sun H., et al. A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is
mutated in recessive Stargardt macular dystrophy. Nature Genet. 1997; 15:236-246.
ISSN 2335-8653
60
MMP-2 Rs24386 (C→T) Polymorphism And The Phenotype Of Early Age-
Related Macular Degeneration
Alvita Vilkeviciute², Rasa Liutkeviciene¹,², Vaiva Lesauskaite³, Giedre Sinkunaite-
Marsalkiene³, Loresa Kriauciuniene¹,², Dalia Zaliuniene¹
¹Department of Ophthalmology, Lithuanian University of Health Sciences, Medical Academy, Eiveniu 4, Kaunas,
Lithuania, LT-50009, ²Neuroscience Institute, Lithuanian University of Health Sciences, Medical Academy, Eiveniu 4,
Kaunas, Lithuania, LT-50009, ³Intitute of Cardiology, Lithuanian University of Health Sciences, Medical Academy,
Sukileliu 17, Kaunas, Lithuania, LT-50161
E-mail: alvitavilkeviciute@gmail.com
Abstract
We examined MMP-2 (-1306 C/T) gene polymorphism and the phenotype characterized by soft
and hard drusen of early age-related macular degeneration (AMD).
Methods: The study enrolled n=673 investigative (147 patients with AMD and a random sample
of the population n=526). The genotyping test of MMP-2 rs243865 (C→T) was carried out using
the real-time polymerase chain reaction method. Early AMD was classified according to the
International Classification and Grading System. The potential association with single nucleotide
polymorphisms on rs243865 was evaluated for all patients, adjusted for age, sex.
Results: Analysis of MMP-2 rs24386 (C→T) polymorphism has not revealed any differences in
the genotype (T/T, C/T and C/C) distribution between the patients with soft drusen, hard drusen
and the reference group (as follows, 7.41%, 39.5%, and 53.09% in AMD with soft drusen; 4.55%,
30.3%, and 65.15% in AMD with hard drusen; 7.41%, 37.64% and 54.94%, in the reference
group).
Conclusion: The MMP-2 rs24386 (C→T) polymorphism was not associated with AMD
phenotype, characterized by hard and soft drusen.
Keywords: age-related macular degeneration, gene polymorphism, matrix metalloproteinases,
polymorphism, MMP-2
References:
[1] Chau KY, Sivprasad S, Patel N, Donaldson TA, Luthert PJ, Chong NV. Plasma levels of matrix
metalloproteinases-2 and -9 in age-related macular degeneration. Eye (Lond) 2007; 21(12): 1511–5.
ISSN 2335-8653
61
Cadmium Effects To The Growth Of Thymes (Thymus Vulgaris) And Their
Extracts Quality
Jūratė Žaltauskaitė, Audronė Minelgaitė
Department of Environmental Sciences, Vytautas Magnus University, Vileikos st. 8-223, LT-44404 Kaunas, Lithuania
j.zaltauskaite@gmf.vdu.lt
Abstract
Heavy metal pollution is considered as one of the most serious problems worldwide and has
significant environmental and human health impact. The aim of this study was to evaluate the
effects of soil cadmium pollution to the growth and quality of medicinal herbs plant thyme
(Thymus vulgaris) and their extracts. The plants were grown in soils contaminated with Cd (10 –
800 mg Cd kg-1) for seven weeks. The morphological (shoot height and root length, dry weight),
physiological (content of photosynthetic pigments), biochemical (content of malondialdehyde)
parameters and the content of Cd in thyme root, shoot and herbal extracts were determined. All the
endpoints were measured after three, five and seven weeks of exposure. The results of this study
showed that soil contamination with Cd had no adverse acute effects to the growth of thyme.
Adverse effects on the growth were determined only after 7 weeks of exposure and at the highest
levels of Cd in the soil. Cd amendments had no significant adverse effect on the content of
photosynthetic pigments. Cd induced lipid peroxidation and slight increase in MDA content was
recorded. Cadmium concentrations in the plant tissues and extracts increased along with Cd
concentration in the soil and the time of exposure. It was found that Cd concentrations in thyme
shoots and extracts were above the WHO limits (0.3 mg Cd kg-1). This study demonstrated that the
use of thyme products may pose a risk to human health even if thymes are growing at
environmentally relevant Cd soil concentration.
Keywords: cadmium, extract quality, growth, soil pollution, Thymus vulgaris.
ISSN 2335-8653
62
Connexin - Dependent Migration of Cancer Cells
Mindaugas Žukauskas, Lina Rimkutė, Ieva Antanavičiūtė
Institute of Cardiology, Lithuanian University of Health Sciences, Kaunas, Lithuania
Increased motility and invasiveness are the major factors for the cancer cell metastasis from the primary
tumour. These factors are associated with poor survival prognosis of cancer patients. A better
understanding of molecular mechanisms responsible for the cell motility could indicate new potential drug
targets.
Connexins (Cxs) are family of membrane proteins, which form gap junction (GJ) channels by docking two
hemichannels from apposed cells. GJ channels provide a direct pathway for electrical and metabolic
signaling between adjacent cells. Cxs are named according to their molecular mass, which varies from 26
kDa to 57 kDa. Cxs are expressed in various tissues and play a channel-independent role in cell
proliferation, differentiation, migration, adhesion and cancer progression. For example, Cx43 reduces cell
proliferation rate in human gliomas, while Cx32 expression increases the self-renewal of stem cells. The
major mechanisms of these channel-independent functions still remain to be elucidated.
The aim of this study was to evaluate the impact of different connexin expression in the Hela cells on their
migration properties. Wound healing assay was used to determine motility differences between non-
transfected Hela wt cells and Cx47, Cx45, Cx43-EGFP, Cx40-CFP, Cx36-EGFP expressing cells. Time
lapse images were taken for 12 h hours at 37C° in a humidified atmosphere of 5 % CO2 using an
incubation system INUBG2EONICS (Tokai Hit, Shizuoka-ken, Japan) with an incubator mounted on the
stage of motorized Olympus IX81 microscope (Olympus Europe holding Gmbh, Hamburg, Germany)
equipped with x 20 DIC oil-immersion objective.
In summary, our study indicated that mobility rate of Cx43-EGFP, Cx45 and Cx47 expressing cells did not
differ from HeLa wt. HeLa Cx36-EGFP and Cx40-CFP cells showed an increased motility (p< 0.05) with
26.8% and 25.5% higher values, respectively, compared with HeLa wt. We observed
no significant differences in proliferation rates between Hela wt and the cells transfected with different
connexins.
Our results suggest that Cx36 and Cx40 may be involved in cell migration processes.
Keywords: connexin, migration, cancer cells
References: M. Račkauskas, V. Neverauskas, V. A. Skeberdis, Medicina (2010); 46(1):1-12.
M. Kotini, R. Mayor, Dev. Biol. (2015); 1; 401(1):143-51.
J. Z. Zhou, J. X. Jiang, FEBS Letters, (2014); 588(8): 1186–1192.
ISSN 2335-8653
63
Cellular Response To Ionizing Radiation: Application Of Different Murine
Models
Vaidotas Stankevičius1,2, Rimantė Čeponytė1,2, Diana Schveigert1, Jonas Venius1,
Konstantinas P. Valuckas1, Eduardas Aleknavičius1,3, Ričardas Rotomskis1,4 and Kęstutis
Sužiedėlis1,2
1National Cancer Institute, Santariskiu 1, 08660 Vilnius, 2Vilnius University, Faculty of Natural Sciences, Department
of Biochemistry and Molecular Biology, M.K. Ciurlionio 21, 03101 Vilnius, 3Vilnius University, Faculty of Medicine,
M.K. Ciurlionio 21, 03101 Vilnius, 4Vilnius University, Faculty of Physics, Sauletekio 9, 10222 Vilnius,
For correspondence: kestutis.suziedelis@gf.vu.lt
Abstract
Cultivation of cell cultures in microenvironment, partially resembling extracellular matrix (ECM),
is expected to result in better reflection of in vivo cell biology by the model system. Investigations
using such 3D cell culture models are expected to result in more successful oncology clinical trials
which based on 2D models not representing complexity of tumors currently fail up to 90%.
We have employed 3D cell culture model to investigate cellular response to ionizing radiation.
Single dose or fractionated irradiation of 2Gy and 5x2Gy have been used. Global gene expression
changes after irradiation have been analyzed by transcriptomic analysis in Lewis lung carcinoma
(LLC1) cell line cells cultured in 2D or 3D.
Cell survival analysis indicates decreased cellular sensitivity to ionizing radiation (IR) when
cultivated in 3D, ECM resembling microenvironment.
In order to define which cell culture model better reflects cell radiobiology in vivo, cellular
response to irradiation is investigated in an animal model as well.
Keywords: Ionizing radiation, Tumor microenvironment, Extracellular matrix, Global
transcriptomic analysis, Cell culture and animal models.
Acknowledgement: This work was funded by the European Social Fund under National
Integrated Programme Biotechnology & Biopharmacy, grant VP1-3.1-SMM- 08-K01-005.
ISSN 2335-8653
64
Mutation Identification In Sucrose Synthase 1 Gene And It’s Impact On Cold
Acclimation In Winter Wheat
Rita Armonienė, Gintaras Brazauskas
Institute of Agriculture,
Lithuanian Research Centre for Agriculture and Forestry,
Instituto a. 1, LT58344 Akademija, Kėdainiai distr., Lithuania
E-mail: rita.armoniene@lzi.lt
Freezing tolerance is one of the main factors governing plant winter survival. Exposure of
temperate plants to low, nonfreezing temperatures lead to increased freezing tolerance levels and it
is called cold acclimation. The genetic basis of the freezing tolerance induction mechanism is still
poorly understood. Targeting Induced Local Lesions in Genomes (TILLING) population of the
two winter wheat lines (‘5899-16’ and ‘5450-1’) was developed using mutagen EMS in order to
create mutant forms of the candidate genes to verify their role in freezing-tolerance formation.
Exon 8 of the identified differentially expressed Sucrose synthase 1 (Ss1) gene was chosen for
mutation detection by High Resolution Melting (HRM) analysis in wheat TILLING M2
population. A total of 75.7 kb of DNA was screened resulting in an overall mutation density of
one mutation per 37.8 Kb in the population. Two novel alleles of Ss1 gene were identified, of
which 1 was silent and 1 premature stop codon mutation. qPCR analyses were performed to
estimate how these mutations affect the expression level of Ss1 gene in crown and leaf tissue
during cold acclimation. Putative knock-out mutant M631 had significantly lower relative
expression of Ss1 gene in non-acclimated leaves as well as in crowns and leaves collected at 2, 4
and 6 weeks of cold acclimation compared with the wild type winter wheat line. Freezing
tolerance test of the wild type and M631 winter wheat was performed to determine the effect of
premature stop codon mutation in Ss1 gene on the freezing tolerance development during cold
acclimation and to confirm the role of Ss1 in wheat cold acclimation process. Wild type plants
acclimated at 4 ºC for four weeks have higher freezing tolerance compared with the M631 plants
(LT50 difference of –3.2 °C). This suggests that the Ss1 gene is involved in the process of cold
acclimation and is a putative target for molecular breeding in winter wheat for increased freezing
tolerance.
Keywords: High-resolution melting analysis, Ss1, TILLING, Triticum aestivum L.
ISSN 2335-8653
65
The Impact Of Supplemental Blue And Green LED And HPS Lamps Lighting
Effects On The Photosynthesis Parameters Of Sweet Pepper Transplants
Aistė Bagdonavičienė1, Julė Jankauskienė1, Irena Januškaitienė2, Skirmantė Deksnytė2,
Pavelas Duchovskis1,3, Aušra Brazaitytė1
1Lietuvos agrarinių ir miškų mokslų centro filialas Sodininkystės ir daržininkystės institutas, Kauno g. 30, LT-54333
Babtai, Kauno r., el. paštas a.kasiuleviciute@lsdi.lt
2Vytauto Didžiojo universitetas, K. Donelaičio 58, LT- 44244 Kaunas
3Aleksanro Stulginskio universitetas, Studentų g. 11, LT-53361 Akademija, Kauno r.)
Abstract
The objective of studies was to compare photosynthesis parameters of sweet pepper transplants
‘Reda’ under emission of short-wavelength single-monochromatic solid-state lamps developed for
supplementation of high-pressure sodium (HPS) lamps used winter time in greenhouses. Four
types of solid-state lamps were made using advanced light-emitting diodes (LEDs) with peak
emissions at blue 455, 470, cyan 505, and green 530 nm, and were installed in a greenhouse. The
generated photosynthetic photon flux density (PPFD) of each type of solid-state lamps was 15
μmol m-2 s-1 and of HPS lamps PPFD was 100 μmol m-2 s-1. Transplants were grown in
greenhouse of phytotron complex under illumination of HPS lamps and with supplementation
LED lamps. The reference transplants were grown under illumination of HPS lamps (PPFD 110
μmol m-2 s-1). Our investigations revealed that the effect of supplemental green 530 nm LED
illumination with HPS lamps increased photosynthetic pigments content. Meanwhile,
supplemental 530 nm light had negative effect on photosynthetic rates (Pn), intercellular CO2
concentration (Ci), transpiration rate (Tn) and stomatal conductance (gs). Supplemental cyan 505
nm and blue 470 nm LED light had great positive effect on the photosynthesis parameters of sweet
pepper transplants.
Keywords: photosynthetic rate, intercellular CO2, stomatal conductance, pigments, biomass,
transpiration rate.
ISSN 2335-8653
66
Separation Of Surfactin From B.Subtilis Suspension And It‘S Antibacterial
Effect
Evaldas Bolskis, Lina Ragelienė
Department of Biochemistry, Vytautas Magnus University, Vileikos 8, Kaunas, Lithuania
Abstract
Lipopeptides represent a unique class of cyclic peptides with either a net positive (e.g. polymyxin)
or net negative charge (e.g. surfactin, daptomycin). Surfactin as metabolites exhibits remarkable
therapeutic and biotechnological properties and are suitable as alternatives to antimicrobial agents.
This is of particular importance at this point in time, when increasing numbers of drug-resistant
pathogenic bacteria impose a constant threat and there is a need for some other lines of therapy
against other pathogenic bacteria. Surfactin, one of the principal representatives of the
antimicrobial lipopeptide family, is produced by B. subtilis and displays an astonishing array of
actions.
The high cost of surfactin and low yields have limited its use in various commercial applications.
Various strategies have been implemented to achieve improved biosurfactant production such as
strain improvement, bioreactor design medium optimization or cheaper growing conditions.
It was estimated that the production of surfactin depends by B. subtilis on various conditions. The
results of this study identify the importance of manganese in influencing the growth of B. subtilis
868. The additive production of manganase salt in bacteria grow media increases the rate of
bacteria growth. To evaluate the effect of adding Mn2+ on surfactin production behavior, shows
that increases the concentration of Mn2+ increased the surfactin concentration, from 0,6µM to 2,3
µM by adding 0,2 mM Mn2+. The higher then 0,3µM concentration of Mn2+ virtually no effect on
surfactin production. The effect of stirrer speed on the surfactin production was estimated also.
The data show, that the highest value of surfactin was obtained when the stirrer speed was
400rpm.
Surfactin was separated, concentrated and his concentration was valuated by the quantitative
HPLC-UV/vis method. Antibacterial tests were carried out against E. coli and S. aureus using
surfactin suspension. The antibacterial activity was perfarmed by the potentiometric analysis.
Results data show that 0,0046µM surfactin suspension working against E. coli.
Keywords: surfactin production, B. subtilis, antibacterial activity.
ISSN 2335-8653
67
The Effect Of Crop Load On Pigment And Macro Element Quantity In Malus
Domestica With P22 Rootstocks
Alina Čeidaitė, Darius Kviklys, Pavelas Duchovskis, Giedrė Samuolienė
Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry Kaunas str. 30, Babtai, LT-54333,
Kaunas distr., Lithuania alina.ceidaite@lsdi.lt1
Abstract
The objective of the study was to evaluate the variation of pigments and mineral elements
in apple tree (Malus domestica Borkh.) ‘Auksis’ and ‘Ligol’ on P22 rootstock leaves depending
on crop load. Crop load was adjusted to 75, 113 and 150 apples in cv. ‘Auksis’ and 60, 105 and
150 apples in cv. ‘Ligol’. Contents of photosynthetic pigments (chlorophyll a, b and carotenoids)
were determined spectrophotometrically. Chlorophyll and UV-absorbing pigments (flavonols)
ratio was determined with a non-destructive method. Contents of mineral elements were
determined by inductively coupled plasma optical emission spectroscopy from dry leaves after
microwave digestion.
According to our results, crop load had significant influence on photosynthetic pigments
(chlorophyll a, b and carotenoids) and mineral elements (K and Mg) content in ‘Auksis’ leaves.
With the average crop load in 'Ligol' apple tree, the leaves had higher photosynthetic pigments and
Mg levels, also chlorophyll and flavonols ratio was higher, but K and P content and chlorophyll a
and b ratio was lower. In comparison between evaluated varieties, K and P contents were higher in
‘Ligol’ apple tree leaves.
Acknowledgements: MIP-036/2014
Keywords: Macro element, photosynthetic pigments, chlorophyll.
ISSN 2335-8653
68
Identification and Characterization of NADPH-oxidase Genes in Domestic
Apple (Malus × domestica Borkh.)
Darius Čepauskas1, Danas Baniulis2, Gražina Stanienė2, Inga Miliūtė2,
Vidmantas Stanys2
1Faculty of Natural Sciences, Vytautas Magnus University, Vileikos st. 8-212, LT-44404 Kaunas, 2Institute of
Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas st. 30, LT-54333 Babtai, Kaunas
distr., Email: cepauskas.darius@gmail.com
Abstract
Many economically important plants used in horticulture, such as apple, pear, cherry, peach and
strawberry, belongs to Rosaceae family. Apple is one of three model species of the Rosaceae
family, therefore extensive genome information and knowledge on biology and genetics of apple
became available recently. Plant cells contain superoxide anion producing NADPH oxidase
enzyme, also known as respiratory burst oxidase (RBOH), of NOX protein family that is located
in plasma membrane and contributes to generation of reactive oxygen species (ROS) that plays
important role in cell signaling involved in plant development, abiotic stress response and
pathogen defense. RBOH genes have been described in different plant species during last two
decades. Arabidopsis thaliana genome contains ten AtRBOH genes (A-J) that demonstrate
different expression levels and function in different plant tissues. A number of RBOH homologous
genes has been identified in other plants. However, number and function of RBOH homologs in
plants of Rosaceae family still remains unknown. Therefore this study was aimed to identify
RBOH genes in apple (Malus × domestica Borkh.) and to characterize their expression in shoots
grown under in vitro conditions. For identification and phylogenetic analysis of genes of apple
RBOHs, protein sequences were retrieved by a similarity search. Query of the Apple predicted
peptide database with the ten Arabidopsis RBOH orthologous protein sequences identified eight
unique full-length sequence matches. Two genes that were annotated to code transcripts with only
partial sequence coverage of RBOH protein were identified in apple genomic database. However,
additional analysis using Fgenesh gene prediction algorithm resulted in assembly of single ninth
sequence of MdRBOH gene. Phylogenetic analysis using conservative N-terminal half region of
RBOH protein sequence revealed four groups of the apple RBOH genes that were linked to
AtRBOH D, E, F and H. One of the MdRBOH genes was not closely related to any of the AtRBOH
orthologs and was annotated as a new MdRBOH K ortholog in apple. Analysis of exon/intron
structures of predicted genes revealed differences in structure of apple RBOH genes that included
from 11 to 15 exons. Primer pairs, specific to nine identified apple MdRBOH genes, were
developed and expression of the genes was assessed in apple shoots grown under in vitro
conditions.
Keywords: apple (Malus x domestica), NADPH oxidase, phylogenetic analysis, gene expression.
ISSN 2335-8653
69
The Effect of Photosynthetic Photon Flux Density on Cucumber Transplants
Growth Indoors
Skirmantė Deksnytė1, 2*, Aistė Bagdonavičienė1, Aušra Brazaitytė1, Julė Jankauskienė1,
Pavelas Duchovskis1, Giedrė Samuolienė1
1 Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas str. 30,LT- 54333
Babtai, Kaunas distr.,Lithuania, 2 Vytautas Magnus University, Department of Biology, Vileikos str. 8, Kaunas LT-
44404, Lithuania,
*E-mail address: skirmante.deksnyte@gmail.com
Abstract
The light, quality and intensity of light are the key elements to optimize of high quality vegetable
transplants. The objective of our studies was to evaluate the growth of cucumber (Cucumis sativus
L. ‘Pasalimo F1’) transplants, cultivated under various photosynthetic photon flux densities
(PPFD) were provided by light-emitting diodes (LEDs). Experiment was performed in phytotron
complex of Institute of Horticulture, LCAFS. A system of high-power, solid-state lighting
modules with 92% 638 nm (red) + 665 nm (red) + 731 nm (far red) and 8% 447 nm (blue) was
used in the experiments. The generated PPFD of each type of five solid-state modules was - ~100,
~200, ~300, ~400, ~500 µmol m-2 s-1. Our experiment revealed that increased shoot and root
fresh/dry weight dependet on increased PPFD. 400 µmol m-2 s-1 LED illumination had positive
effect on shoot height, hypocotyl diameter and leaf number. Cucumbers which were grown under
100 µmol m-2 s-1 had longer hypocotyl than other modules, but their development has been slower
as compared to other plants. 400 µmol m-2 s-1 LED illumination had positive effect on
photosynthetic rate. It is determined that PPFD had no impact for content of photosynthetic
pigments in leaves of all modules cucumber hybrid transplants.
Keywords: LED, PPFD, photosynthetic pigments.
ISSN 2335-8653
70
The Influence Of Fermented With Certain Lactic Acid Bacteria Satureja
Hortensis On The Quality And Technological Parameters Of Pork And Beef
Loin
Erika Mozuriene1*, Elena Bartkiene1, Grazina Juodeikiene2, Daiva Zadeike2, Audrius
Maruska3, Ona Ragazinskiene4
1 Lithuanian University of Health Sciences, Tilzes st. 18, 47181 Kaunas, Lithuania
2Kaunas University of Technology, Radvilenu pl. 19, 50254 Kaunas, Lithuania 3Vytautas Magnus University, Vileikos st. 8-, LT-44404 Kaunas, Lithuania 4Kaunas Botanical Garden, Vytautas Magnus University, Z. E. Zilibero st. 6, LT-46324 Kaunas, Lithuania
Abstract
The aim of this study was to evaluate the effects of the fermented with different lactic acid
bacteria (LAB) Satureja hortensis (Sh) on the quality and technological parameters of the pork
and beef loin.
For the Sh solid state (SSF) and submerged fermentation (SMF) Pediococcus acidilactici
KTU05-7, Pediococcus pentosaceus KTU05-8 and Lactobacillus sakei KTU05-6 were used. Pork
and beef loin surface was treated with fermented Sh plants.
The concentrations of L-(+) and D-(-) lactic acid in with different LAB fermented Sh plants
were determined by an enzyme test kit (R – biopharm AG – Roche, Damstadt, Germany)
according Yun et. al. (2003). Biogenic amines (BAs) analysis was carried out according Ben
Gigirey et al. (1999). Water holding capacity was determined by using compression method,
described by Grau and Hamm (1959). Tenderness of meat samples was measured as shear force
by using a texture analyzer (TA-XT2i; Texture Technologies, Scarsdale, NY, USA). The amount
of intramuscular fat was evaluated by the Soxhlet method according to Folch et al. (1957).
Acceptability of treated with Sh pork and beef loin was evaluated according to ISO 8586-1
method by fifteen judges for preliminary sensory acceptability using a 6 scores hedonic line scale
ranging from 6 (extremely like) to 1 (extremely dislike).
It was found that in Sh substrate used LAB produce more L-(+) (from 4.95 g/kg-1 P.
acidilactici SMF to 6.69 g/kg-1 P. pentosaceus SSF) than D-(-) (from 2.86 g/kg-1 P. pentosaceus
SSF to 4.76 g/kg-1 P. acidilactici SMF) lactate. BAs concentration of all analysed pork and beef
loin samples were ranged from 1.36 mg/kg to 87.64 mg/kg (in control samples and in beef loin
treated with P. acidilactici SMF Sh). A dominant BA in pork and beef loin samples was
putrescine, except, pork loin treated with P. pentosaceus SMF Sh and pork loin control samples,
where a dominant BA was cadaverine. Fermented savory plants had a positive impact on the
sensory properties of the pork and beef loin. The highest acceptability were found beef loin
samples treated with L. sakei SSF Sh.
Fermented Sh plants increased dry matter content, decreased water holding capacity,
tenderness, intramuscular fat and cooking loss of the pork and beef loin.
We conclude that pork and beef loin treatment with LAB Sh could be used as natural and
safe way to increase the organoleptic and technological parameters of meat.
Keywords: pork and beef loin, quality, lactic acid bacteria, Satureja hortensis
ISSN 2335-8653
71
Removal Of Heavy Metals By Fungal Biomass And Its Polysaccharides
Emanuela Galli
Institute of Agroenvironmental and Forest Biology (IBAF)
CNR – Area della Ricerca di Roma 1; Via Salaria km 29,300; 00015 Monterotondo (Roma ) Italy
Corresponding author email: emanuela.galli@ibaf.cnr.it
Abstract Heavy metal pollution is one of the most serious environmental problems. Many methods are used
to remove them from wastewaters: chemical precipitation, ion-exchange, adsorption, membrane
filtration, electrochemical treatment technologies, each method showing both advantages and
limitations. Adsorption is an effective and economic method, that is also reversible with the
regeneration of the adsorbent by desorption process. Biosorption utilizes natural materials of
biological origin, including bacteria, fungi, yeast, algae, etc.
Many authors reported the removal of heavy metal ions by filamentous fungi, such as Penicillium
spp. and Aspergillus spp. Also mushrooms ability has been reported, both by live and dead
biomass. The white-rot fungi Trametes versicolor and Lentinus sajor-caju are reported to be able
to adsorb about 120 mg Cd(II) g-1 when entrapped in Ca-alginate beads. Their binding capacity
has been related to functional groups present in polysaccharides of cell wall.
To evaluate the different ability of these polysaccharides and to use the most active one as a
biofilter for wastewater cleaning, β-glucans, chitin and chitosan were extracted from the mycelium
and fruit bodies of Pleurotus ostreatus (SMR 684). Their adsorbing capacity was evaluated using
increasing quantities (100 – 500 mg) of mycelium, fruit bodies, glucans, chitin or chitosan from P.
ostreatus in the presence of 10 mg L-1 Cd. Among the different fractions, chitosan showed the
greatest adsorbing capacity. Following experiments were performed with chitosan in the presence
of other metals (Ni, Zn, Pb, Cu). The best adsorption was obtained with Cu(II), with an adsorbing
capacity of 170 mg Cu(II) g-1 of chitosan.
For a practical application, chitosan was used as a biofilter in a column, eluting 25 ml of a solution
containing 500 mg L-1 Cu (II). Three cycles of adsorption-elution-regeneration were performed,
with positive results.
Chitosan extracted from fungi presents the characteristics requested to adsorbent materials. It has a
good efficiency for the removal of a wide variety of pollutants, with a high capacity and rate of
adsorption for metals and contaminants.
Keywords: Biosorption, chitosan, Cadmium, Copper, Pleurotus ostreatus
ISSN 2335-8653
72
Pathogen Elicitor Induced ROS Production And Gene Expression In Apple
(Malus × Domestica) Cell Suspension
Rimantė Grencevičiūtė1, Gražina Stanienė2, Inga Miliūtė2, Algirdas Kaupinis3, Mindaugas
Valius3, Danas Baniulis2 1Faculty of Chemical Technology, Kaunas University of Technology, Radvilėnų rd. 19, Kaunas.,
2 Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry Kaunas 30, Babtai, Kaunas
distr., 3 Proteomics Centre, Vilnius University Institute of Biochemistry, Mokslininkų st. 12, Vilnius. E-mail:
r.grenceviciute@gmail.com.
Apple scab (Venturia inaequalis) causes one of the most damaging diseases of domestic apple
(Malus x domestica) worldwide. The disease results in reduced tree productivity, lower fruit
quality and storage properties. Qualitative and quantitative resistance traits are characteristic to
plants of genus Malus, and characterization of apple scab resistance genes is important for
efficient introduction of the disease resistance traits to cultivated apple varieties. Previous research
on interaction of Malus sp. and V. inaequalis presents a comprehensive knowledge on biology of
resistance to the fungal pathogen in apple, however understanding of mechanistic basis of the
resistance remains scarce. Fungal pathogens are able to penetrate the intact surfaces of host plants,
rapidly establishing infection. Disease resistance results when the corresponding product of a
dominant resistance gene R recognizes a dominant Avr gene product (effector) from the pathogen
leading to effector-triggered immunity (ETI). In addition, plants have constitutive and inducible
defences that do not require R genes for their presence or activation. Non-host resistance to fungi
has been shown to be under complex genetic control and can involve a mutiplicity of defense
factors. The defense response is initiated by pathogen-associated molecular patterns (PAMP) and
is called PAMP-triggered immunity (PTI). Although the characteristics of defence related to PTI
and ETI are very different, however these two types of resistance share common downstream
immune responses, including accumulation of reactive oxygen species (ROS), hormone signalling,
transcriptional reprogramming of defence-related genes and cell death. Aim of this study was to
establish ROS production characteristics and proteomic dissection of gene expression patterns
associated with disease resistance response induced by pathogen effectors in apple cells. Apple cv.
Gala and Golden delicious cell suspension was incubated with V. inaequalis culture extract (ViE),
chitin, yeast effector protein fraction and bacterial flagellin protein fragment (flg 22).
Fluorescence assay using H2DCFDA dye established that incubation with all of the elicitors
resulted in concentration and time dependent increase in ROS production. Further, proteomic
analysis using gel free LC-MS/MS approach established that expression of 56 and 114 proteins
was upregulated by incubation with flg22 and ViE elicitors, respectively. Meanwhile the treatment
resulted in downregulation of 55 and 104 proteins, respectively. An association of the protein
function with cell metabolic and defence response process was established using gene ontology
analysis.
Keywords: Apple, cell suspension, disease resistance, apple scab, reactive oxygen species,
proteomics.
ISSN 2335-8653
73
Light Spectral Effects On Alkaloid Contents In Catharanthus Roseus
Laurita Grigaitytė1, Akvilė Viršilė2, Ramūnas Sirtautas, Aušra Brazaitytė
1Kaunas University of Technology, Faculty of Chemical Technology, Radvilėnų Rd. 19, LT-50254 Kaunas, Lithuania, 2Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333 Babtai,
Kaunas distr., Lithuania
E-mail: laurita.grigaityte@gmail.com
We aimed to evaluate the effects of light spectral components on the alkaloid compounds
in different anatomical parts of Catharanthus roseus plants.
Plants were cultivated in phytotron (21/17°C) under experimental light emitting diode
(LED) based lighting (18h, 300 µmol m-2s-1) 30 days growth cycle. Experimental lighting spectra
consisted of sole red 640nm LED light (300µmol m-2s-1) or the combination of red with 50µmol
m-2s-1 of blue 455, yellow 595, green 520nm or 15µmol m-2s-1 of UV-A 385nm light (total PPFD
of 300µmol m-2s-1 maintained). Vincristine and vinblastine contents were determined by High
performance chromatographic method.
The results of analysis of selected pharmaceuticaly important alkaloids show, that the
highest contents of vincristine and vinblastine were determined in Catharanthus roseus leaves and
blossoms, and lower contents in stems. Red light supplemented with UV-A light promoted
accumulation of vincristine compounds in different anatomical parts of Catharanthus roseus
plants, when supplemental blue light had significant effect only in blossoms. This indicates the
importance of supplemental UV light seeking to cultivate medicinal plants with high contents of
selected phytochemicals.
Keywords: light emitting diodes, vincristine, vinblastine, red light, UV-A
Acknowledgment: This research was supplementary funded by the Research Council of Lithuania
under the project “Promotion of Students’ Scientific Activities”
ISSN 2335-8653
74
The Influence Of Nitrogen Fertilizers On Winter Wheat Quality Indicators
Aistė Juchnevičienė1, Ilona Vagusevičienė1, Aušra Brazaitytė2, Pavelas Duchovskis1,2
1 Institute of Agricultural and Food Science, Faculty of Agronomy, Aleksandras Stulginskis University, Studentų str.
11, LT-53361 Akademija, Kaunas distr., Lithuania
E-mail: aiste.zuzaviciute@inbox.lt 2 Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333
Babtai, Kaunas distr., Lithuania
The paper analyse the influence of nitrogen fertilisers on quality indicators of winter wheat. Field
experiments were carried out in the period 2011 and 2013 at the Experimental Station of
Aleksandras Stulginskis University. The object of assessment was cultivar of winter wheat with
good baking properties ‘Kovas’ (country of origin – Lithuania). The soil: carbonate shallow gleyic
leached (IDg8-k), Calc(ar)i-Epihypogleyic Luvisol (LVg-p-w-cc). Its plow layer is neutral and low
level alkalinity (pHKCl 7.0–7.2), with medium humus content (2.48–2.70 %), very high levels of
phosphorus (271.0–296.8 mg kg–1 P2O5) and high levels of potassium (178.0–184.0 mg kg–1 K2O).
During the sowing time wheat were fertilized by single-element phosphorus and potassium
(P60K60) and in early spring during the tillering time (BBCH 23–25) ammonium nitrate (N60) was
applied. Additionally foliar fertilizer urea solution N30, N40 was used during the booting stage
(BBCH 34–36) and N15, N30 was applied during milk ripening stage (BBCH 71–74). Average
findings of the two years of research showed that investigated nitrogen fertiliser application rates
essentially (P < 0.01) improved quality indicators of wheat grain. Due to the influence of
fertilisers, protein content in the grain increased by 1.50–2.70 percentage units, the amount of wet
gluten by 4.00–6.37 percentage units and sedimentation values by 9.95–18.30 ml. The greatest
protein, wet gluten contents and the highest sedimentation values were found in wheat grain that
were fertilized with the highest nitrogen application rates N40 + N30 during the booting and milk
ripening stages. Correlative regressive analysis of the data revealed that there is a very strong (r =
0,993–0,997**) linear dependency between the application rates of nitrogen fertilisers and grain
quality indicators. This dependency is statistically significant at the 99 percent probability level.
Keywords: grain quality, nitrogen fertiliser, winter wheat
ISSN 2335-8653
75
Cloning And Expression Of Transmembrane Domain Segments Of Arabidopsis
Thaliana RBOH D Enzyme
Andrius Kočevas1, Kristina Druceikaitė2, Danas Baniulis2
1Vytautas Magnus University, Faculty of Natural Sciences, Vileikos st. 8, Kaunas, LT-44404,
2Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas st. 30, Babtai, LT-
54333, Kaunas distr., E-mail: An.kocevas@gmail.com
Abstract
Production of reactive oxygen species (ROS) is important cell signaling component involved in plant
response to stress. NADPH-oxidase, also known as respiratory burst oxidase homologue (RBOH) in plants,
is a superoxide producing NOX family protein that is located in plasma membrane and contributes to ROS
generation outside the plasma membrane in the apoplast. A. thaliana has ten RBOH genes (RBOH A-J).
RBOH D is expressed in all plant tissues and takes part in regulation of response to pathogen and abiotic
stress. Plant RBOH proteins show unique structural and regulation features that include calcium binding
and different cytosolic component role in regulation of the enzyme activity. Meanwhile, structure of small
N-terminal cytosolic domain of plant RBOH was studied so far, further structural and functional studies of
plant RBOH homologues could help to understand the role of these enzymes in cell signaling.
Heterologous expression and purification of transmembrane proteins is challenging due to their
hydrophobic membrane domain. However, valuable information about transmembrane protein structure
and function may be obtained by expression and characterization of separate membrane domain fragments.
Aim of this study was to identify, clone and optimize the production of segments of A. thaliana RBOH D
protein membrane domain in E. coli expression system. To identify transmembrane domain of RBOH D,
bioinformatics analysis of amino acid sequence hydrophobicity profile, transmembrane protein domain
modeling and assessment of previously predicted structures of other NOX family proteins, such as NOX2,
was used. Six transmembrane helices were identified and the third and fifth helices each contained two
conserved His residues, which are considered to coordinate the two hemes involved in superoxide
production. Primers were designed and six different segments that include 3 to 6 helices of the
transmembrane domain were amplified by PCR from cDNA library of A. thaliana. The segments were
cloned into pLATE52 vector using ligation independent cloning technology. For the peptide purification,
the construct included N-terminal 6xHis-tag that could be removed using protease. The construct was
transformed into E.coli strain Lemo21(DE3). High hydrophobic protein concentrations in bacterial cells
might lead to formation of inclusion bodies and toxicity to cells. Rhamnose regulated protein expression in
the Lemo System provided means for tuning protein production. Cell growth and protein induction
conditions were optimized to ensure maximum yields of the protein production.
Keywords: Arabidopsis, respiratory burst oxidase homologue, transmembrane domain, protein production,
heterologous expression.
ISSN 2335-8653
76
Rich By Collagen Recycled Solid Waste Of Leather As Nitrogen Source For
Agriculture
Ineta Komiciute, Ilona Jonuskiene, Justa Sirvaityte, Virgilijus Valeika
Kaunas University of Technology, Faculty of Chemical Technology, Radvilenu pl. 19, Kaunas, LT- 50254, Lithuania
E-mail: justa.sirvaityte@ktu.lt
Abstract
The predominant oil crop for food, industry, and renewable energy needs in Lithuania is oilseed
rape (Brassica napus). Seed yield and fat concentration are the primary parameters in crop
cultivation for both nutritional and industrial uses. High seed yield double-low rapeseed varieties
developed in other countries (Sweden, Germany, Denmark) are cultivated in Lithuania, but they
often cannot fully realize the productivity potential encoded in the variety genome because of
unfavourable climatic and soil conditions [1]. Nitrogen nutrition remains the factor that
significantly restricts plant also and rape productivity.
Leather industry is one of oldest branch of industry. But, environmental pollution is the main
problem in leather making. It generates a significant quantity of solid wastes (0.7 kg / kg of hides
or skins processed) [2]. The management of solid wastes, especially tanned leather waste, is a
challenging problem faced by tanners. The leather tanning process generates substantial quantities
of solid waste as shaving, trimmings, buffing dust, hair and sludge. In constitutes protein as the
main component. The use of such wastes as fertilizers represents an interesting alternative for their
disposal, with less potential impact to the environment. The goal of research was to transform the
leather industry by-products to a qualitative organic fertilizers rich by nitrogen for rape (Brassica
napus).
Keywords: leather, collagen, hydrolysate, Brassica napus, fertilizer.
References:
[1] G. Siaudinis, B. Butkute. Communications in Soil Science and Plant Analysis. 2013, 44, 145–157.
[2] G. Sekaran, S. Swarnalatha, T. Srinivasulu. Journal on Design and Manufacturing Technologies. 2007, 1(1), 47-
52.
ISSN 2335-8653
77
Nitrogen And Micro-, Macroelement Ratios In Current-Year Needles Of
Juniperus Communis L. Lithuania Populations
Edvina Krokaitė, Ramūnas Vilčinskas, Lina Zybartaitė, Algimantas Paulauskas, Eugenija
Kupčinskienė
Vytautas Magnus University, Vileikos g 8-212, LT-44404, Kaunas, Lithuania, edvina.krokaite@gmail.com
Abstract
Juniperus communis L. is cosmopolitan conifer species growing in unpolluted areas and nitrogen
poor soils. Both, plant growth and health are tightly related to composition of essential elements in
the needles and soil. Evaluating nutrition among the most important aspects are ratios between
nitrogen and other macro- and microelements. This ratio has been employed as an indicator to
estimate a plant nutritional level and the balance of physiological optimum for plant growth. This
type of analysis is not widely applied to investigate characteristics of needles elements of common
juniper. The main purpose of the study was to assess ratios of the elements composition of the
needles collected from populations which differ in geographic position and habitat type.
Nutritional elements concentrations were examined in 14 populations of Juniperus communis L.
Nitrogen concentration were estimated by Kjeldhal method. Other elements: macro- (P, K, Ca,
Mg), microelements (Mn, Fe, Zn, Cu), were analysed by atomic absorption spectrometry except
phosphorus analysed spectrophotometrically. Our results demonstrate ratios between N:P ranged
from 8.83 (Panevezys) to 12.74 (Kelme I), N:K – 3.89 (Ignalina II) – 6.00 (Trakai), N:Ca – 0.76
(Ignalina II) – 2.17 (Alytus), N:Mg – 18.66 (Ignalina II) – 31.76 (Ignalina I), N:Fe – 128.69
(Neringa) – 795.30 (Kaunas), N:Zn – 610.21 (Kelme II) – 1176.63 (Trakai), N:Cu – 2387.40
(Alytus) – 10133.64 (Ignalina II), N:Mn – 14.06 (Kelme II) – 493.28 (Jurbarkas). Ratios of
nitrogen to macro-, microelements in the needles could be used to assess the effective predictors
of nutrient limitation, management and monitoring purposes in considering the nutritional status
of J. communis in various habitats.
Keywords: conifers, common juniper, nutrition, Kjeldhal method
ISSN 2335-8653
78
The Effect Of Light-Emitting Diodes Spectra On Mineral Elements
Content In Brassicaceae Microgreens
Birutė Lekstutytė1, Akvilė Viršilė2, Aušra Brazaitytė2, Viktorija Vaštakaitė2
1Kaunas University of Technology, Faculty of Chemical Technology, Radvilėnų Rd. 19, LT-50254 Kaunas, Lithuania 2Institute of Horticulture, Lithuanian Reasearch Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333
Babtai, Kaunas distr., Lithuania
E-mail: birute.lekstutyte@gmail.com
Abstract
The aim of this study was to investigate the effect of light-emitting diodes (LEDs) light spectra on
mineral elements content in Brassicaceae microgreens. Microgreens are seven-ten days old
individual plant seedlings with emerged first true leaf, recently recommended to be used as
‘functional food’ in daily nutrition. Red pak choi (Brassica rapa var. chinensis ‘Rubi F1’) and
mustard (Brassica juncea ‘Red Lion’) microgreens, due to be known as widely used for intense
flavor and high nutritional properties, were investigated. Plants were grown in controlled-
environment growth chamber at the Institute of Horticulture, Lithuanian Research Centre of
Agriculture and Forestry. Day/night temperatures of 21±2/17±2ºC and the relative air humidity at
55±5% were maintained. Four lighting treatments using a combination of blue 447 nm, red 638
nm, red 665 nm and far red 731 nm LEDs as a main spectra (1- control) to supplemental green 520
nm (2) or yellow 595 nm (3) or orange 622 nm (4) LEDs were performed. The total
photosynthetic photon flux density (PPFD) at 300 μmol m-2 s-1 with 16 h photoperiod of each
treatment was set. The mineral elements – Na I, K I, Mg II, Fe II, Zn II, P I, Ca II – contents were
determined quantitatively by inductively coupled plasma optical emission spectrometry (ICP-
OES) (Spectro Genesis, Germany). The data obtained showed that mineral elements contents
depended on LEDs light spectra and differed among both microgreens species. Significantly lower
(P<0.05) contents of all elements were determined in red pak choi grown under supplemented
green 520 nm or yellow 595 nm diodes to main LEDs spectra. Only Na I significantly increased
(~18.9%) in red pak choi grown under supplemental orange 622 nm diodes. Otherwise, the
supplementation of green 520 nm diodes led to significantly increased contents of K I (~1.7%),
Mg II (~21.1%), P I (~22.9%), Ca II (~14.0%), Fe II (~48.4%), Zn II (~16.7%) in mustard
microgreens. Supplemental yellow 595 nm and orange 622 nm components also led to
significantly enhanced accumulation of Fe II (~35.1% and ~36.7%, respectively) in mustard. In
conclusion, the spectra effect is Brassicaceae species dependent; however, a target management of
LEDs light spectra can improve mineral elements contents in microgreens.
Keywords: Brassicaceae, controlled-environment, ICP-OES, light spectra, microgreens, minerals
Acknowledgement: This research was supplementary funded by the Research Council of
Lithuanian under the project “Promotion of Students’ Scientific Activities”
ISSN 2335-8653
79
Chitin Characterization Of Two Baltic Sea Shrimp Species:
Palaemon Elegans And Crangon Crangon
Evaldas Lelešius1,2, Murat Kaya2, Vaida Tubelytė 1, Radvilė Nagrockaitė1,2, Vykintas
Baublys1
1Department of Natural Sciences, Vytautas Magnus University, Lithuania, LT-44248 2Department of Biotechnology and Molecular Biology, Aksaray University, Turkey, TR-68100
E-mail: v.baublys@gmf.vdu.lt
Abstract
Chitin is a biopolymer, which can be found in a plenty amount in marine environments and is the
secondly most abundant in nature, after cellulose. Mostly chitin is found in crustaceans, insects or
other arthropods, also in mushrooms [1]. Chitin and chitin-derived products are attracting great
interest because of their wide range of potential applications within biotechnology, medicine and
pharmacology, agriculture, cosmetics, and wastewater treatment [2, 3, 4, 5]. In this study we
investigated differences in the chitin content, physicochemical properties and surface morphology
of chitins extracted from two common Baltic Sea shrimp species: Paleomon elegans and Crangon
crangon. Both shrimp species are widely distributed along European coast and across the Atlantic
east coast. The dry weight chitin contents P. elegans and C. crangon were determined as 7.1% and
6.7%, respectively. Fourier transform infrared spectroscopy (FT-IR) and thermogravimetric
analysis (TGA) analysis were used to characterize physicochemical properties of obtained chitins.
As expected, FT-IR and TGA results showed that the isolated chitins were in α form. The main
difference between examined chitins extracted from two shrimp species was noticed after TGA.
The first mass loss step for P. elegans was observed at 5.09% and the second mass loss step at
81.92%. For C. crangon the first mass loss was observed at 2.75% and the second mass loss at
65.39%. However, the highest decomposition temperature DTGmax were found to be the same for
both species, 382.8 °C for P. elegans and 382.4 °C for C. crangon. The surface morphology of
chitins yielded from two shrimp species were examined with scanning electron microscopy (SEM)
and it revealed that these structures consists of nanofibers and nanopores, however chitin surface
of C. crangon was rougher than P. elegans. According to our results the extracted chitin was
thermally stable and can be found widely applicable in many industrial processing. Also, fibril
structure of chitins suggested that it is suitable for using in textile industry and biomedicine.
Furthermore, we believe that the Baltic Sea is a new and unexploited source of chitin in Northern
Europe.
Keywords: chitin, crustacean, marine, FTIR, TGA, SEM.
References: [1] F.A. Al-Sagheer, M.A. Al-Sughayer, S. Muslim, M.Z. Elsabee. Carbohydr Polym. 2009, 77, 410–419.
[2] B.K. Park, M.M. Kim. Int J Mol Sci. 2010, 11(12), 5152-5164.
[3] J. Synowiecki, N.A. Al-Khateeb. Crit Rev. Food Sci Nutr. 2003, 43, 145–171.
[4] P.A. Felse, T. Panda (1999) Bioprocess Eng. 1999, 20, 505–12.
[5] S. Hajjia, I. Younesa, O. Ghorbel-Bellaaja, R. Hajjib, M. Rinaudoc et al. Int J Biol Macromol. 2014, 65, 298–306.
ISSN 2335-8653
80
Studies Of Lactococcus Lactis Infection By Phage C2
Vygandas Marozas, Inga Žievytė, Rimantas Daugelavičius
Department of Biochemistry, Vytautas Magnus University. E-mail address: v.marozas@gmf.vdu.lt
Bacteria Lactococcus lactis is one of the most commonly used lactic acid bacteria in
the dairy industry [1]. It is used in the production of cheese, sour cream, yogurt, buttermilk, and
other dairy products. L. lactis is usually infected by bacteriophages belonging to the Siphoviridae
family and are divided into three main groups: 936, c2, and P335. Due to bacteriophage-caused
infections the dairy industry experiences substantial loss of income [2]. The infection inhibits
lactose fermentation to lactic acid. Therefore, quality of the product changes, in some cases the
production is stopped. The aim of this study was to determine the influence of incubation
conditions on L. lactis viral infection.
It is usual in the dairy industry to inactivate bacteriophages by heat [3], but higher
the temperature is, more taste and presentation of the final product is affected. In order to explore
the bacteriophage inactivation by heat, not the infected bacterial culture but the bacteriophage
suspension was heated. Bacteriophage c2 suspension was heated at 63°C for various time periods.
It was observed that heating affects the course of infection: the phage remained infective, but the
infection process took longer. Multiplicity of infection (MOI) examination has shown that MOI
has a significant influence on the course of infection: the increase of MOI 10 times (from 5 to 50)
leaves less unlysed virus-resistant cells. It is known [4] that the supplement of a medium with
calcium ions is required for a efficient infection. Our results also indicated that the productive
infection did not occur if the growth medium was not supplemented with calcium ions.
L. lactis bacteria are unable to synthesise heme. The bacterial culture grows longer
and produces more biomass afer the addition of hemin to the medium Studies of the infection have
shown that bacterial lysis progress faster in the medium with hemin. However, after examination
of the medium aeration effects on the infection, it was discovered that the infection progress worse
at high aeration. At strong aeration conditions and MOI 5 bacterial lysis started very quickly but
ineffeciantly and the growth of bacteriophage-resistant cells immediately started. Under the same
aeration conditions but MOI 50, infection was significantly more effective. These results show
that strong aeration prevents virus adsorption on L. lactis cells.
Examination of the respiration process have shown that if cells are uninfected, they
actively respire and use all the oxygen from the medium. Once the bacteriophage begins to disrupt
cells, the dissolved oxygen concentration in medium gradually increases.
Keywords: Lactococcus lactis, lactic acid bacteria, bacteriophages.
ISSN 2335-8653
81
Water Pollution By Pharmaceuticals: Assessment Of Ibuprofen Tolerance,
Phytometabolisation And Phytoremediation Potential In Model Plant Species
Of The Riparian And Aquatic Ecosystems
Fabrizio Pietrini, Valentina Iori, Daniela Di Baccio, Massimo Zacchini
Institute of Agro-environmental and Forest Biology (IBAF)
CNR - Research Area of Rome1, Via Salaria Km. 29,300 - 00015 Monterotondo (Rome) Italy
The contamination of the aquatic ecosystem by organic xenobiotics is currently recognised as one
of the emerging problem at global environmental scale. In the last few years, particular attention
has been devoted to the presence and diffusion of pharmaceutical compounds and personal care
products (PPCPs), and their residues, in surface water, groundwater, wastewater effluents, and,
consequently, their potential toxic effects on ecosystems. Among these so-called emerging
contaminants, ibuprofen (IBU), one of the most used non-steroidal anti-inflammatory drug
(NSAID) worldwide, is considered a great concern for the aquatic environment, being one of the
most frequently detected pharmaceuticals in freshwater. In this regard, the presence of IBU has
been proposed as a marker of surface water contamination by wastewater. Beside IBU, its major
human metabolites (carboxyl-IBU and both 1-hydroxy and 2-hydroxy-IBU isomers) are
commonly detected in the water bodies, representing a potential environmental hazard. Scarce
information about the effects of IBU and its metabolites on plants are present in literature. In
particular, very few works are dealing with the evaluation of plant physiological responses in
order to appreciate tolerance/sensitivity thresholds to IBU presence in the growth medium.
Moreover, up to now no evidences of IBU phytometabolisation activity in plants were produced.
The assessment of such plant responses represents a key point to evaluate the biomonitoring and
phytoremediation potential of plants towards IBU. In this regard, efforts were made by our
research group to study the effects of IBU exposure on plants at growth, physiological and
biochemical level. Different experimental setups were used, ranging from tissue culture to
hydroponic culture, focusing on model plant species of the riparian and aquatic ecosystems. In
particular, a notable tolerance, accompanied by an amelioration of the oxidative stress condition,
was observed on poplar cell cultures exposed to high IBU concentrations (0.3 to 30 mg/L).
Further, a differential growth, physiological and biochemical activity, in terms of photosynthetic
performance and antioxidative defence activation, in response to different IBU levels (3 to 30
mg/L) in the growth medium was put in evidence in two willow clones under hydroponics.
Finally, in a static 8-day test, duckweed plants (Lemna gibba L.) were treated with 1 mg/L IBU to
evaluate the effects on growth, phytotoxic indicators, pigment content and photosynthetic
performance, and the fate of IBU both in the plant tissues and in the growth medium. Results
showed a growth stimulation exerted in L. gibba by IBU and a remarkable phytometabolic activity
of this plant species, resulting in several IBU metabolic products detected within plant and in the
growth medium. Implications of these findings in order to evaluate the contribution of floating
plant such as duckweed for the biomonitoring of aquatic ecosystems and the phytoremediation of
IBU residues in wastewater are currently under discussion.
ISSN 2335-8653
82
Effect Of Salinomycin, Antimycin, Sodium Phenylbutyrate And Glucose
Deprivation On Cancer Cell Viability And Mobility
Gintarė Milašiūtė1,2, Sandra Puidokaitė1, Ieva Ceslevičienė1, Ieva Antanavičiūtė1, Valeryia
Mikalayeva1 1 Institute of Cardiology, Lithuanian University of Health Sciences, Kaunas, Lithuania,
2 Faculty of Natural Sciences, Vytautas Magnus University, Kaunas, Lithuania
Gintare.Milasiute@lsmuni.lt
Abstract
One of the major problems in the clinical applications is the cancer cell property to become
resistant to multiple drugs. A number of new and already known inhibitors or their combinations
are being tested for obtaining the most efficient impact on treatment of various types of cancer. In
this study the effect of different concentrations of salinomycin (Sal), antimycin A (AntA), sodium
phenylbutyrate (PBA) and also glucose (Glc) deprivation was investigated on laryngeal squamous
cell carcinoma (LSCC, isolated from the primary tumor) cell and breast cancer cell (commercially
available: MDA-MB-231) viability. Furthermore, cancer cell capability to invade other tissues is
important feature that indicates malignancy of tumor [1, 2]. We investigated how the compounds
mentioned above affect mobility of the MDA-MB-231 cell line. Cell migration analysis was
performed by wound healing assay. Cell-free area remaining in the wound was measured after 5
and 10 h. Cell viability of LSCC and MDA-MB-231 was evaluated by Trypan blue staining and
Hoechst 33342 fluorimetric assay in 96-well plate.
Cells treated with 100 nM of Sal demonstrated slightly lower proliferation rates after 48 h
compared with control, whereas a 2-fold and a 3-fold decrease in the number of cells was
observed after application of 10 and 20 µM of AntA, respectively. Similar results were obtained
while examining the effect of Glc deprivation. The concentration of 100 µM of PBA caused a
greater decrease in proliferation of MDA-MB-231 compared with LSCC cells. Fluorescence of
both cell lines stained with Hoechst 33342 decreased ~5-fold after 48 h treatment with 10 nM Sal,
10µM AntA and 100 µM PBA. Less decrease in fluorescence intensity was observed after 72 h
compared with the effect after 48 h in both cell lines. It might be due to adaptation of cells to the
presence of drugs. Unaffected MDA-MB-231 cells occupied approximately 45% of scrape area
after 5 h, which is 3 times as much compared to cells treated with 1 µM of AntA or 100 nM of Sal.
Glc deprivation as well as treatment with 100 µM of PBA resulted in a 2-fold decrease of area
occupied. After 10 h control cells occupied ~74% of the scrape area, while Sal- and Glc-treated
cells occupied 50 and 43 %, respectively. Treatment with 1 µM AntA and 100 µM PBA had
similar effect, as cells occupied ~38% of area.
Keywords: MDA-MB-231, LSCC, viability, mobility.
References
[1] F. Kopp, A. Hermawan, P.S. Oak, A. Herrmann, E. Wagner, A. Roidl, Molecular Cancer, 2014, 13:16
[2] Y. Al Dhaheri, S. Attoub, K. Arafat, S. AbuQamar, A. Eid, N. Al Faresi, R. Iratni, Biochim Biophys Acta, 2013,
1830, 3121–3135
ISSN 2335-8653
83
A Physicochemical Characterization Of Chitin Extracted From Edible
Lithuanian Mushrooms
Radvilė Nagrockaitė1,2, Murat Kaya2, Vykintas Baublys1, Evaldas Lelešius1,2, Vaida
Tubelytė1
1Department of Biology, Vytautas Magnus University, 44404 Kaunas, Lithuania 2Department of Biotechnology and Molecular Biology, Aksaray University, 68100, Aksaray, Turkey
E-mail: v.tubelyte@gmf.vdu.lt
Abstract
Chitin is a biopolymer made from (1→4)-linked N-acetyl-β-D-glucosamine. It can be found in
exoskeleton of crustacean, insect and in the cell wall of mushrooms [1]. Chitin is very important
biomaterial these days, because of its biodegradable, biocompatible, nontoxicity, antitumor,
antioxidant and antimicrobial properties. Chitin has many applications in medicine, cosmetic,
biotechnology and other fields [2]. More than 100 000 mushrooms species are known in the
World. More than 6000 mushrooms species are described in Lithuania [3]. Till now no studies has
been done with Lithuanian mushrooms chitin. In this study the Lithuanian mushrooms chitin was
investigated for the first time. The aims of this study were: a) to extract chitin from five edible
mushrooms species belonging to four families; b) to evaluate and compare chitin physicochemical
properties between these five mushrooms, c) to compare chitin contents of mushroom pileus and
stipes.
Chitin was extracted from five (Boletus edulis, Leccinum auranticum, Russula vesca, Cantharellus
cibarius and Paxillus involtus) edible Lithuanian mushrooms by using a chemical method. Four
steps was used to isolate chitin from mushrooms: mushrooms dust bleaching (NaClO),
deproteinization (NaOH), demineralization (HCl) and second deproteinization (NaOH). Obtained
chitin was characterized by Fourier transform infrared spectroscopy (FTIR) and by scanning
electron microscopy (SEM). The results of FTIR showed that all mushrooms chitin are in alpha
form and can be used as a potential raw material for chitin production. SEM analysis showed that
mushrooms chitin surface was clumped and has no clearly visible nanoporous and nanofibers
structure. The chitin contents of pileus and stipes of mushroom bodies were determined and
compared. Three mushrooms species (Leccinum auranticum, Cantharellus cibarius, Paxillus
involtus) out of total five had higher chitin content in pileus (2,9%, 1,2%, 1,52% respectively) than
in stipes (1,95%, 1%, 1% respectively), while chitin content of Russula vesca was almost the same
in pileus (1,2%) and stipe (1,3%). Only in Boletus edulis species chitin content was higher in stipe
(6%) than in pileus (1,3%). The highest chitin content among all investigated species was
observed in Boletus edulis stipe (6%) and the lowest in Cantharellus cibarius and Paxillus
involtus stipes (1%).
Keywords: Mushrooms, Fungi, Chitin, FTIR.
References: [1] M.K. Jang, K. Byeong-Gi, J. Young-Il, H.L. Chang, N. Jae-Woon, J. Polym. Sci. 2004, 42, 3423-3432.
[2] M. Rinaudo, Prog. Polym. Sci. 2006, 3, 603-632.
[3] V. Sasnauskas, Šviesa, 2008, 288p.
ISSN 2335-8653
84
HIF-1 Is Indirectly Involved In Hypoxia Dependent Splicing Regulation
Egle Jakubauskiene1, Inga Pečiulienė1, Laurynas Vilys1, Arvydas Kanopka1
1 Department of Immunology and Cell Biology, Vilnius University, Institute of Biotechnology, Vilnius, 02241
Lithuania, peciulien@ibt.lt
Abstract
Eukaryotic cells sense oxygen and adapt to hypoxia by strict regulation of a number
of genes. The removal of introns from mRNA precursors (pre-mRNAs) is an essential step in
eukaryotic gene expression. The splicing machinery heavily contributes to biological complexity
and especially to the ability of cells to adapt to altered cellular conditions.
A dominant negative regulator of hypoxia-inducible gene expression, IPAS, is
generated from HIF-3α pre-mRNA by an alternative splicing mechanism. Inactivation of the IPAS
transcript in mice leads to the neovascularization of the cornea, suggesting that IPAS is an
important regulator of anti-angiogenesis in this tissue. Using mouse HIF-3 pre-mRNA as a
model system we demonstrate for the first time that SR proteins are involved in oxygen tension-
dependent changes in pre-mRNA splicing. SR proteins isolated from hypoxic cells possess
differential ability to activate hypoxia-dependent splice sites and they are more phosphorylated
than those isolated from normoxic cells. We also show that expression of SR protein kinases
(CLK1, SRPK1, SRPK2) in hypoxic cells is elevated at mRNA and protein levels and that
increased expression of CLK1 kinase is regulated by HIFs. We demonstrate that reduction of
cellular CLK1 level affects hypoxia-dependant CAIX gene pre-mRNA splicing.
Keywords: pre-mRNA splicing, hypoxia, SR proteins, phosphorylation, SR kinases, CKL1, SRPK1,
SRPK2.
ISSN 2335-8653
85
Characteristics Of Polymorphic Markers For Juniperus Communis L. From
Lithuania
Ramūnas Vilčinskas, Lina Zybartaitė, Audrius Petrauskas, Algimantas Paulauskas,
Eugenija Kupčinskienė
Vytautas Magnus University, Vileikos 8, LT-44404 Kaunas, Lithuania, ramvil26@gmail.com
Abstract
Application of molecular markers has been developed rapidly over the last two decades. DNA
based markers, such as microsatellites (SSR) are very powerful tools for the analysis of genetic
biodiversity due to their high level of polymorphism, frequency distribution in the eukaryotic
genome, co-dominant patterns of inheritance and have a high discrimination power. Studies of
common juniper based on the molecular markers included analysis of plants growing in Southern
and Western parts of Europe. However, not enough attention has been paid consider the
importance of genetic diversity of common juniper in more Eastern and Northern parts of Europe.
J. communis is the third common species among conifers naturally growing in Lithuania. In this
country J. communis is important component of forest ecosystems also is widely used in the
pharmaceutical, spicy, ornamental and fragrant plant. Our study aimed at evaluation of
polymorphic SSR loci of Lithuania populations of common juniper from different geographic
regions and habitat types. Samples were collected from 14 population (140 juniper individuals in
total) of J. communis belonging to 5 different habitat types: coastal brown dunes covered with
natural coniferous forest (Pinus sylvestris); Juniperus communis scrubs; subcontinental moss;
scots pine forests; transition mires and quaking bogs, xero-thermophile fringes. Genomic DNA
was extracted from current-year needles using CTAB method. Five pairs of SSR primers were
tested: Jc016 (forward − F: CAAAATGATGCTTATGATGA; reverse − R:
TGAAAATCATTGTTGTTTTCTT), Jc031 (F: CCTAATGTTGTAATCACGTATATCT; R:
TGACCTTGGGCGTATAGATT), Jc032 (F: ACATTGCAAATATGGGGTAA; R:
TTGATGAGTTGTTGAGTTATTAAG), Jc035 (F: TGTGTTT ATTCTCCCCATCT; R:
CCCCCAGTTATTCTAAACATT); Jc037 (F: GGCAATTAGTAA GGCACAAG; R:
TAAGGTGGATATCACCAAGG). All primers have generated DNA fragments of J. communis
after optimization PCR. For primers Jc031 and Jc037 annealing temperature was 53 C°, while for
primers Jc016, Jc032 and Jc035 − 52 C°. Polymorphic DNA fragments length ranged from 114 to
220 bp. Number of alleles ranged from 10 to 20. At the species level all generated alleles were
polymorphic.
Keywords: microsatellite markers, SSR loci, common juniper
ISSN 2335-8653
86
Serum Albumin Corona on ZnO NPs has Opposite Effect in Cellular and
Mitochondrial Toxicity Experimental Models
Karolina Rilskytė1, Zita Naučienė1, Valentinas Snitka2, Rasa Žūkienė1
1Department of Biochemistry, Vytautas Magnus University, K. Donelaicio 58, LT-44248, Kaunas, Lithuania 2Research Centre for Microsystems and Nanotechnology, Kaunas University of Technology, Studentu 65, LT-51369,
Kaunas, Lithuania
Abstract
Zinc oxide nanoparticles (ZnO NPs) are increasingly applied in a diverse array of industrial and
commercial products. In the biological milieu a protein corona is formed on the surface of NPs.
The protein corona changes the mode of NPs interaction with cells, organelles and molecules
resulting in a different biological effect of NPs as compared to plain NPs. Bovine serum albumin
(BSA) and zinc oxide nanoparticles (ZnO NPs) were chosen in this study as a model system to
investigate NPs-protein corona complex toxicity to cells and isolated mitochondria.
In the cellular experimental model plain 20 nm ZnO NPs (ZnO) and ZnO NPs coated with bovine
serum albumin (ZnO-BSA) were tested for citotoxicity and ROS generation in rabbit myoblast
(Fr2) and human breast carcinoma (MX-1) cell lines. Both NPs types were cytotoxic with similar
dependency on concentration, however, NPs were appr. 10% less toxic to Fr2 at high
concentration (200 μg/ml) as compared to MX-1 and ZnO-BSAwere less toxic than ZnO NPs in
the concentration range of 150-200 μg/ml. ZnO-BSA NPs haven’t induced ROS generation in
none of cell line. The minimum ZnO concentration that induced ROS generation in MX-1 was
lower as compared to Fr2 – 20 and 50 μg/ml, respectively.
The treatment of mitochondria with ZnO NPs had an unexpected effect: ZnO-BSA NPs impaired
stronger the mitochondrial respiration in metabolic state 3 and uncoupled state and induced more
pronounced mitochondrial swelling than ZnO NPs meaning the opening of the permeability
transition pore. ZnO-BSA NPs inhibited state 3 respiration rate by 50% at the concentration of
0.25 μg/ml, whereas ZnO NPs – at 0.40 μg/ml. Moreover, the site of inhibition in oxidative
phosphorylation system was different for plain and BSA-coated NPs: the main effect of ZnO NPs
was on phosphorylation subsystem whereas the main effect of ZnO-BSA NPs was on respiratory
subsystem. It could be speculated that opposite effect of protein corona in isolated mitochondria as
compared to cells can arise from absence of cytosolic NPs trafficking and endosomal detoxication
mechanisms which were shown to be crutial for NPs cytotoxicity.
This research is funded by the European Social Fund under the Global Grant measure (Grant No.
VP1-3.1-SMM-07-K-03-044).
Keywords: ZnO nanoparticles, BSA, protein corona, mitochondria, cytotoxicity, ROS.
ISSN 2335-8653
87
Modified pyridine nucleotides in biosynthesis of DNA
Algirdas Mikalkėnas1, Bazilė Ravoitytė1, Daiva Tauraitė2, Rolandas Meškys2, Saulius
Serva1,3
1Department of Biochemistry and Molecular Biology, Faculty of Natural Sciences, Vilnius University, M.K. Čiurlionio
21/27, LT-03101 Vilnius, Lithuania, 2Department of Molecular Microbiology and Biotechnology, Institute of
Biochemistry, Vilnius University, Mokslininkų str. 12, LT-08662 Vilnius, Lithuania, 3 Department of Chemistry and
Bioengineering, Vilnius Gediminas Technical University, Saulėtekio al. 11, LT-10223 Vilnius, Lithuania. E-mail:
saulius.serva@gf.vu.lt
Pyridine is a heterocyclic organic compound, structurally related to benzene bearing
one methine group (=CH-) replaced by a nitrogen atom. The pyridine ring occurs in many
important compounds, including vitamins B3 (niacin) and B6 (pyridoxal). It is closely related to
pyrimidine ring, one of two common nucleobase precursors; however, pyridine is unspotted in
structure of natural nucleic acids. Close chemical and structural relation of pyridine to natural
analogue prompted for investigation of pyridine-based artificial deoxyribonucleotides as effectors
of DNA biosynthesis, evaluating the presumed inhibitory potential toward this process.
We employ several DNA biosynthesis approaches, capable to address incorporation
of compounds of interest at single nucleotide resolution. In general, they involve well-controlled
in vitro procedures, relying on primer extension by polymerase of choice. The full control on
composition of reaction components allows to address both incorporation and/or resistance for it
of nucleotide of interest. Most importantly, alterations in structure of primer-template duplex
direct programmable incorporation of nucleotides of interest, so enabling experiments on
selectivity of enzymes regarding the compounds to be involved in biosynthesis of DNA.
To address the properties of five pyridine-based deoxyribonucleotide triphosphates,
we investigated these compounds in direct DNA biosynthesis approach. Since nucleobase
structures in all instances were clearly different from any of natural pyrimidine-based moieties, it
comes as big surprise the incorporation of three of five compounds tested into the structure of
DNA. Importantly, incorporation was sequence-specific, confirming the elongation of DNA to
obey hybridization rules. The observed incorporation is valid for representatives of at least two
different families of DNA polymerases, main cellular replicative polymerase including. Watson-
Crick base pairing is barely possible for the encountered partners, as well as Hoogstein
hybridization. We continue our efforts to further characterize the stereo- and charge-specific
determinants of the observed phenomenon.
Keywords: pyridine nucleotides, DNA biosynthesis, DNA polymerase.
Acknowledgement: This research was funded by a grant MIP-035/2014 from the Research
Council of Lithuania.
ISSN 2335-8653
88
Investigations Of Resistance To Cold And Hardening In Vitro Of Rosaceae
Family Plants
Rytis Rugienius1, Lina Šnipaitienė2 1 The Institute of Horticulture of the Lithuanian Research Center for Agriculture and Forestry, Kauno g. 30, Babtai,
LT-54333, 2 Vytautas Magnus University, The Faculty for Natural Science, Vileikos g. 8, 44404 Kaunas,
linute@doctor.com
Abstract
Dehydrin-like proteins, which are responsible for resistance to cold, were investigated in model
plants, the genes of dehydrins were identified in many herbaceous and woody plants, however we
know very little about the hardening and the specificity of the resistance to cold of the most part of
the garden plants - the Rosaceae family plants. Therefore, the study of dehydrins of the Rosaceae
family plants was performed in The Institute of Horticulture of the Lithuanian Research Center for
Agriculture and Forestry. The efficacy of the hardening of strawberry (Fragaria ananassa) , wild
strawberry (F. vesca), cherry (Prunus cerasus), sweet cherry (P. avium), apple (Malus domestica)
and pear (Pyrus communis) cultivars was investigated under controled cooling conditions in vitro,
the ion yield of cells was measured and critical temperature of the tissue damage was calculated. It
was found that the maximum hardening is reached in 4 weeks and the critical temperature of the
hardened microshoots has increased approximately 1,2°C, compared to non-hardened
microshoots. Protein electrophoresis and immunochemical analysis showed that the expression of
the two to five dehydrin-like proteins of the different molecular mass is characteristic to
investigated cultivars and the significant increase of the amount of dehydrins in hardened
microshoots.
Keywords: Rosaceae, dehydrins, cold resistance, hardening.
ISSN 2335-8653
89
Amino Acid Impact On Rape (Brassica Napus L.) Germination
Kristina Teiserskyte, Ilona Jonuskiene, Justa Sirvaityte, Virgilijus Valeika
Kaunas University of Technology, Faculty of Chemical Technology, Radvilenu pl. 19, Kaunas, LT- 50254, Lithuania
E-mail: justa.sirvaityte@ktu.lt
Abstract
The predominant oil crop for food, industry, and renewable energy needs in Lithuania is oilseed
rape (Brassica napus). Seed yield and fat concentration are the primary parameters in crop
cultivation for both nutritional and industrial uses. High seed yield double-low rapeseed varieties
developed in other countries (Sweden, Germany, Denmark) are cultivated in Lithuania, but they
often cannot fully realize the productivity potential encoded in the variety genome because of
unfavourable climatic and soil conditions [1]. Rapeseed requires a greater level of nitrogen (N)
and other nutrients than cereal crops. Nitrogen nutrition remains the factor that significantly
restricts plant also and rape productivity. Amino acids as organic nitrogenous compounds
stimulated cell growth [2]. It was apllied Humiforte to stimulate shoot growth of Norway spruce
[3]. Humiforte is a high-tech soluble liquid nutrient, w5ith rapidly absorption via leaves or roots,
and a high concentration of free amino acids and biologically active oligopeptides, especially
recommended for shock treatments. It was also studied role of biologically active amino acid
formulations such as Humiforte on quality and productivity of tea crop [4]. Mostafa et al studied
effect of Arginine on growth and yield of late sowing wheat [4]. Some of biological stimuli, such
as Humiforte have been introduced to the market in order to deal with environmental stresses.
Collagen hydrolysate prepared from leather industry waste approx. contain: glycine 30-40%,
alanine 10-15%, proline 10-15%, glutamic acid 5-10%, hydroxyproline 5-10%, acid aspargic 4-
6%, arginine 4-6 %, serine 3-5%, threonine 1-3%, lysine 2-4%, valine 2-4%, leucine 2-3%,
phenylalanine 1.5-2%, isoleucine 1-1.5%, histidine 0.7-1.5%, methionine 0.2-0.5% [5].
The aim of the research was to investigate the influence of some amino acids, which presence in
collagen hydrolysate prepared from leather industry solid wastes, on rapeseed (Brassica napus)
germination.
Keywords: amino acid, rapeseed, germination, collagen hydrolysate.
References:
[1] G. Siaudinis, B. Butkute. Communications in Soil Science and Plant Analysis. 2013, 44, 145–157.
[2] J.A. Goss. Physiology of Planta and their Cells. 1973. Pergamon Press, Inc., New York.
[3] M. Slavik. J FOR SCI., 2005, 51(1), 15-23.
[4] J. Thomas, A.K.A. Mandal, R. R. Kumar, A. Chordia. Int. J. Agric. Res., 2009, 4(7), 228- 236.
[5] C. Sirbu, T. Cioroianu, M. Dumitrascu. Lucrari Stiintifice, seria Agronomie, 52, 473-478.
ISSN 2335-8653
90
The Effect Of Light-Emitting Diodes Photoperiod On Tocopherols Content In
Brassicaceae Microgreens
Monika Valaitytė1, Akvilė Viršilė2, Aušra Brazaitytė2, Viktorija Vaštakaitė2, Julė
Jankauskienė2, Ramūnas Sirtautas2
1Vytautas Magnus University, The Faculty of Natural Sciences, Vileikos str. 8, LT-44404, Kaunas, Lithuania
2Institute of Horticulture, Lithuanian Reasearch Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333
Babtai, Kaunas distr., Lithuania
E-mail: mvalaityte@yahoo.com
Abstract
The objective of our study was to evaluate the effect of light-emitting diodes (LEDs) light
photoperiod on tocopherols content of Brassicaceae microgreens. Tocopherols as primary
antioxidants are considered to protect lipids from oxidation; however, their antioxidant activities
may differ greatly. Our previous studies revealed that the content of tocopherols may be affected
by LEDs light spectra or intensity, and hypothesized to be photoperiod dependent. Red pak choi
(Brassica rapa var. chinensis ‘Rubi F1’), tatsoi (Brassica rapa var. rosularis) and mustard
(Brassica juncea L. ‘Red Lion’) microgreens were cultivated in controlled-environment growth
chamber for 10 days under five photoperiods (8-, 12-, 16-, 20-, 24 h) created by high-power solid-
state lighting modules with blue 447-, red 638-, red 665-, far red 731 nm LEDs light. Total
photosynthetic photon flux density (PPFD) was ~300 µmol m-2 s-1. The day/ night temperatures at
21±2/17±2 °C and the relative air humidity at 55±5 % were maintained. Tocopherols (α-, β-, γ-, δ-
) contents in hexane extracts were evaluated using high-performance liquid chromatography
(HPLC) method. Based on the data obtained, the accumulation of tocopherols homologies
depended on LEDs light duration; moreover it varied among Brassicaceae species. The
significantly higher (P<0.05) contents of all determined tocopherols were evaluated in mustard
microgreens grown under 8-, 12-, 16 h LEDs photoperiods. The significantly higher content of α-
tocopherol was determined in red pak choi during 8- and 12 h photoperiods, while β- and δ-
tocopherols significantly accumulated under 16-, 24 h, and under 20 h photoperiods, respectively.
The duration of 24 h photoperiod led to the highest content of α-tocopherol in tatsoi, while under
8- and 12 h photoperiod plants accumulated more β-, γ- and δ-tocopherols. Finally, higher
tocopherols concentrations in Brassicaceae microgreens tissues may be achieved through their
photophysiological response evoked by LEDs light photoperiod, which is species dependent.
Keywords: antioxidant, tocopherols, microgreens, light photoperiod
Acknowledgement: This research was funded by a grant (No. SVE-03/2011) from the Research
Council of Lithuania
ISSN 2335-8653
91
The Impact Of Supplemental UV-A Irradiation On Phytochemical Content Of
Microgreens In Greenhouse
Viktorija Vaštakaitė, Akvilė Viršilė, Aušra Brazaitytė, Julė Jankauskienė, Ramūnas
Sirtautas
Institute of Horticulture, Lithuanian Reasearch Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333
Babtai, Kaunas distr., Lithuania
E-mail: v.vastakaite@lsdi.lt
Abstract
It is well known that plants sensitive to UV light may respond by accumulating various
phytochemical products to protect them from UV damage; moreover, the same metabolites play an
important role to human health. UV-A (320-400 nm) light is known to be the least hazardous part
of UV radiation. Furthermore, it is thought, that a low level of UV-A may increase antioxidant
properties of edible plants without disturbing their growth and development. In this study, the
impact of UV-A light-emitting diodes (LEDs) irradiation on phytochemical content of
microgreens was investigated. Experiments were performed at the Institute of Horticulture,
Lithuanian Research Centre for Agriculture and Forestry. Mustard (Brassica juncea L., ‘Red
Lion’), red pak choi (Brassica rapa var. chinensis, ‘Rubi F1’), tatsoi (Brassica rapa var.
rosularis), basil (Ocimum basilicum L., ‘Sweet Genovese’), beet (Beta vulgaris L., ‘Bulls Blood’)
and parsley (Petroselinum crispum, ‘Plain Leaved or French’) were grown for 10-14 days within
a greenhouse (21±2/ 16±2 °C day/ night) under daylight and artificial light provided by high
pressure sodium (HPS) lamps (SON-T Agro, Philips). For lighting treatment, HPS lamps were
supplemented by ~13-16 µmol m-2 s-1 UV-A 390 nm LEDs; and total photosynthetic photon flux
density (PPFD) was ~115-135 µmol m-2 s-1. The data obtained showed that the influence of UV-A
varied among microgreens species. In comparison with HPS lamps, after UV-A light treatment
some changes in primary metabolites (soluble carbohydrates) syntheses were revealed. The
significantly (P<0.05) higher contents of sucrose (red pak choi, tatsoi, beet, parsley), glucose
(mustard, red pak choi, basil) and fructose (tatsoi, basil, red pak choi) were determined. Also, UV-
A led to higher anthocyanins accumulation in all of investigated microgreens, except in basil and
parsley in which these compounds are not specific. The ability to synthesize significantly more
ascorbic acid during UV-A light treatment showed beet and parsley microgreens. The significantly
higher contents of total phenols and DPPH• scavenging activity were also determined in parsley.
Finally, although microgreens response to UV-A irradiation differed among species, the small
level of UV-A in main greenhouse lighting system may lead to higher contents of phytochemicals.
More studies should be carried out in order to determine the optimal UV-A irradiation level for
maximized production of phytochemicals rich microgreens.
Keywords: UV-A, metabolites, microgreens, phytochemicals, greenhouse
Acknowledgement: This research was funded by a grant (No. SVE-03/2011) from the Research
Council of Lithuania
ISSN 2335-8653
92
The Concentration of Non-essential Elements in Lithuania Populations of
Juniperus communis L.
Edvina Krokaitė, Ramūnas Vilčinskas, Lina Zybartaitė, Algimantas Paulauskas, Eugenija
Kupčinskienė
Vytautas Magnus University, Vileikos g 8-212, LT-44404, Kaunas, Lithuania, edvina.krokaite@gmail.com
Abstract
Juniperus communis L. is one out of three naturally growing conifer species of Lithuania. This
conifer is characterized as valuable species for medicine, pharmacology, culinary or ornamental
purposes. Processes of secondary metabolite formation and changes in some vital functions of the
plants could be influenced by concentration of non-essential elements. Concentration of heavy
metals in the needles of common juniper sampled near industrial pollution sources have been
documented [1], but information about these element concentrations depending on habitat type is
still missing. J. communis is widely spread in non-polluted areas of Lithuania, so it could be useful
indicator of areas with elevated level of contamination. In our study plant material was collected
from 14 populations (140 juniper individuals) from different geographic regions of Lithuania
distributed in 5 habitat types. Elements (Cr, Ni, Cd, Pb) from J. communis needles were analysed
using atomic absorption spectrometry. Our results showed that mean (per population)
concentration of Cr ranged from 0.238 to 0.531 µg/g dry mass (d. m.), Ni – 0.180–1.520 µg/g d.
m., Cd – 0.004–0.105 µg/g d. m., Pb – 0.126–0.537 µg/g d. m. The highest concentration of Cr
and Cd was found in coastal brown dunes covered with natural Scots pine forest in Curonian spit.
The lowest concentration of Cr was found in xero-thermophile fringe near Kaunas. The highest
concentration of Ni was found in subcontinental moss Scots pine forest besides Kelme, while the
lowest concentration was characteristic for transition mires quaking bog of Ignalina. The lowest
concentration of Cd was common for xero-thermophile fringe in Jurbarkas. The highest Pb was
found in transition mires quaking bog site near Kelme, the lowest – subcontinental moss Scots
pine forest in Ignalina district. This data set provides valuable information about concentration of
heavy metals of the needle differences among populations originating from various habitats.
Keywords: heavy metals, lead, cadmium, chromium, nickel, conifers, common juniper, needles
References [1] D. Ceburnis, E. Steinnes, Atmos. Environ. 2000, 34, 4265−4271.
ISSN 2335-8653
93
Light as a Tool for Manipulation of Plant Responses – Internal and External
quality (Part II)
Akvilė Viršilė1, Giedrė Samuolienė1,2, Aušra Brazaitytė1, Viktorija Vaštakaitė1, Ramūnas
Sirtautas1, Pavelas Duchovskis1,2 1 Lithuanian Research Centre for Agriculture and Forestry, Institute of Horticulture, Kaunas str. 30, Babtai, LT-
54333, Lithuania. 2Aleksandro Stulginskio Universitetas, Studentų g. 11 LT – 53361, Akademija, Kauno raj.
E-mail: a. virsile@lsdi.lt
Abstract
Light is one of the main environmental factors, determining plant growth and
development processes. It is of the high importance in greenhouse horticulture, where lighting
strategies determines productivity and production costs. Light emitting diodes – the progressive
lighting source and also a handy tool for plant investigations that provided new objectives for
photophysiological researches. Light parameters were proved to be limiting factors for plant
growth and photosynthesis. Recent investigations show, that light also directly and indirectly
affects plant metabolism and thus determines internal phytochemical contents in plant. It decides
nutritional value of vegetable food (vitamin, antioxidant contents), as well as external quality and
taste. In this study we present the overview, how to employ light parameters as a tool for
manipulations of plant metabolic processes, seeking to improve nutritional quality of green
vegetables and how to apply light for medicinal plant cultivation with enhanced selected
phytochemical contents.
Keywords: green vegetables, light-emitting diodes, light spectra, medicinal plants, secondary
metabolites.
ISSN 2335-8653
94
Extraction And Characterization Of Chitins From Coackroach Ootheca
Murat Kaya1, Mujtaba Muhammad1, Bahar Akyuz1, Esra Bulut1, Karwan Sofi1, Laura
Zelencova1,2,*
1 Department of Biotechnology and Molecular Biology, Faculty of Science and Letters Aksaray University, 68100,
Aksaray, Turkey. 2 Department of Biology, Vytautas Magnus University, 44404 Kaunas, Lithuania.
*Corresponding author: Laura Zelencova, E-mail: lzelencova@gmail.com
Abstract
Currently researchers are isolating chitins from fungal cell walls [1], crustaceans shells [2],
insect cuticles [3], sponges [4] and crabs [5] because of its high biomass (chitin value) and large
availability. But still there are many organisms which need a thorough examination for their chitin
value. Until now none of the studies are reported on physiochemical properties of cockroach egg
shells. For the first time egg shells of three notable and abundantly available species of coackroach
(Blatta orientalis, Blatella germanica, Periplaneta americana) were physicochemically
investigated for its chitin values using FTIR, chitin content %, SEM. For said study selection of
these species was made because of its worldwide distribution and large availibility. Periplaneta
americana can be easily found in buildings, restaurants, bakeries, basements, sewers, steam
tunnels and drainage systems [6]. Blattella germanica is also a widely distributed urban pest.
Adult B.germanica is 1/2 to 5/8 inch long and tan to light brown and can found in houses,
apartments, restaurants, hotels. Blatta orientalis is often called water bugs because of their damp
and cool habitats such as under sinks, washing machines and in damp basements. Adult
B.orientalis is about one inch in length. The egg capsule color and size of B.orientalis is dark
reddish-brown and 8 to 10 mm respectively.
The dry weight chitin content of Blatta orientalis was determined as 0.66%, Blatella
germanica 1.4%, Periplaneta americana 6.61%. The SEM analysis showed that in chitins of
coackroach egg shells were found highly fibrous, various crumblier clumpy zones and some
highly porous zones were detected. After overall results of SEM we can say that surface
morphology of coackroach egg shell’s chitin is highly fibrous along with some highly and rarely
porous zones. In this study we observed FTIR bands at 1651, 1621 and 1555 cm-1 for Blatta
orientalis, 1656, 1621, 1542 cm-1 for Blatella germanica and 1574, 1623, 1537 cm-1 for
Periplaneta americana. These results are very similar to the theoretical FTIR bands (1650, 1620
and 1550 cm-1) [10, 11]. For commercial chitin, these three characteristic FTIR bands were
measured between 1654 and 1662, 1620 and 1630 and 1556 and 1560 cm-1 in some studies [14,
15, 16]. All these results revealed that the chitin extracted from three different species of
coakroach (Blatta orientalis, Blatella germanica, Periplaneta americana) is in the α form.
Key words: coakroach, Blatta orientalis, Blatella germanica, Periplaneta americana, chitin
ISSN 2335-8653
95
Selection Of Inter-Simple Sequence Repeat Markers For Investigation Of
Genetic Diversity Of Impatiens Spp. Populations
Lina Zybartaite, Edita Sajonaite, Rasa Janulioniene, Eugenija Kupcinskiene, Algimantas
Paulauskas
Vytautas Magnus University, Department of Biology, Vileikos 8, LT-44404 Kaunas, Lithuania,
lina.zybartaite@gmail.com
Abstract
More than 1000 species are in family Balsaminaceae, among them only five species: Impatiens noli-
tangere, I. parviflora, I. glandulifera, I. balfourii and I. balsamina are present in Europe. Impatiens
balfourii is not often met and I. balsamina is known only as introduced and grown ornamental plant.
Europe’s Impatiens represents a unique opportunity to study invasion process due to very special set of the
species: I. noli-tangere is growing naturally, I. parviflora is widely spread alien with a very high degree of
naturalization and I. glandulifera is an alien very actively spreading nowadays. The objective of our study
was to select inter-simple sequence repeat (ISSR) markers appropriate for genetic assessment of Impatiens
spp. growing in Lithuania and Czech Republic. For this purpose 6 ISSR primers (twelve nucleotide length
each) were tested [1]. Conditions of polymerase chain reaction were the same for all examined plant
species. In total 5 primers were suitable for Impatiens studies. The primer ISSR1 has not generated
amplification of any Impatiens species DNA, ISSR4 was not applicable for I. noli-tangere and I.
parviflora, the primer ISSR6 did not generate clear, reproducible DNA fragments for I. glandulifera. Three
(ISSR2, ISSR3 and ISSR5) out of six primers were useful for all three species. Examination of 12
Lithuania and 12 Czech Republic populations of I. noli-tangere, I. parviflora and I. glandulifera shown that
the number of DNA fragments was ranged from 23 to 55, the length was 150–2100 bp. The mean number
of polymorphic ISSR fragments per population for I. noli-tangere was 45, for I. parviflora 41.1 and for I.
glandulifera 40.5. The mean percentage of polymorphic DNA fragments per population was 48 % for I.
noli-tangere, 26.5 % for I. parviflora and 22 % for I. glandulifera. Mean Nei’s genetic diversity and
Shannon’s information index for I. noli-tangere respectively was 0.125 and 0.199, for I. parviflora 0.075
and 0.117, for I. glandulifera 0.074 and 0.112. Obtained results revealed that chosen ISSR markers are
valuable for evaluation of molecular diversity between Impatiens spp. populations.
Keywords: ISSR, Touch-me-not Balsam, Small Balsam, Himalayan balsam
1. J. Provan, H.M. Love, C.A. Maggs. Mol Ecol Notes 2007, 7:451-453
ISSN 2335-8653
96
A Research of a Behaviour of Saccharomyces Family Yeast in Contact with
PAHs
VioletaVaitkeviciene1, Mantas Vaitkevicius2, Neringa Venslauskaite1
1VDU GMF Biochemijos katedra, Vileikos g.8, Kaunas, 2Kauno moksleivių aplinkotyros centras, Šeštokų g. 30, LT-
46430, Kaunas
v.vaitkeviciene@gmf.vdu.lt
Abstract
Friendly ways to decompose organic polutants in an environment is being studied by scientists in
all the world [1]. Determining the behaviour of natural microorganisms in contact with organics is
important to understand their application possibilities for environmental protection. The aim of
this study was to analyse impact of Polycyclic Aromatic Compounds (PAHs) on Saccharomyces
family yeast. The yeast behaviour under the influence of different concentration of carbazole and
its compounds [2] solutions have been investigated using usual biochemical technics. It was found
that cells remained undisturbed and had tendency to grow. Microorganisms growth kinetics in 0.1
mg/mL solutions was analysed as well.
Keywords: Yeast, PAHs, organic polutants.
References: [1] A. Mrozik, Pol. J. Environ. Stud. 2003, 12(1), 15-25
[2] J. Jwo-Huei, J. Mater. Chem. C. 2014, 2, 8707-8714
ISSN 2335-8653
97
Antibiotic-Resistant Bacteria Isolated From Dairy Cattle With Endometritis
Mindaugas Levickis1*, Vytuolis Žilaitis1, Anita Rokaitytė2, Irmantas Rokaitis2
1Department of Non-infectious Diseases of the Veterinary Faculty of Lithuanian University of Health Sciences, Tilžės
st. 18, Kaunas, LT-47181, Lithuania 2Department of Food Safety and Quality of the Veterinary Faculty of Lithuanian University of Health Sciences, Tilžės
st. 18, Kaunas, LT-47181, Lithuania
*Mindaugaslva@gmail.com
World wide there is growing concern about the increased prevalence of antibiotic
resistance. It is now generally accepted that the main risk factor for this increase in resistance in
pathogenic bacteria is the increased use of antibiotics. Resistant commensal bacteria of food
animals might contaminate meat and reach the intestinal tract of humans. Monitoring the
prevalence of resistance in indicator bacteria such as faecal Escherichia coli and enterococci in
different populations, animals, patients and healthy humans, makes it feasible to compare the
prevalence of resistance and to detect transfer of resistant bacteria or resistance genes from
animals to humans and vice versa. Resistance genes against antibiotics, that are or have only been
used in animals were found soon after their introduction, not only in animal bacteria but also in the
commensal flora of humans, in zoonotic pathogens. This makes it clear that not only clonal spread
of resistant strains occurs, but also transfer of resistance genes between human and animal
bacteria.
The objective of this study was to isolate bacteria from samples of dairy cattle with
endometritis and to determine their antibiotic susceptibility patterns.
Escherichia coli, Enterococcus faecalis, Staphylococcus aureus, Streptococcus spp.,
Bacillus spp. and Arcanobacterium pyogenes was isolated from dairy cattle with endometritis.
Almost all strains were resistant to Penicillin G (PG) (10 μg), Ampicillin (AP) (10 μg),
Amoxicillin-Clavulanic acid (AC) (30 μg), Ciprofloxacin (CIP) (5 μg), Erythromycin (E) (15 μg),
Ceftriaxone (CRO) (30 μg), Gentamicin (G) (10 μg), Trimethoprime-Sulfamethoxazole (TMP-
SMZ) (25 μg), Oxacillin (Ox) (1 μg), Oxytetracycline (OX) (30 μg), Neomycin (NM) (10 μg) and
Vancomycin (V) (30 μg). But all strains were sensitive to Cefapirin (CF) (10 μg).
Based on our results, we can assert that to safeguard public health, the selection and
dissemination of resistant bacteria from animals should be controlled. This can only be achieved
by reducing the amounts and type of antibiotics used in animals.
Keywords: Cattle, antibiotic, resistant, bacteria.
ISSN 2335-8653
98
Evaluation of cannabidiol and plant antioxidant activity dynamics in Lithuania
cultivated Cannabis sativa L.
Ignas Popa1, Vidmantas Dirsė2, Guoda Kiliuvienė3 1Faculty of pharmacy, Medical academy, Lithuanian university of health sciences, Eivenių str.4 Kaunas, Lithuania
2,3Department of analytical and toxicological chemistry, Faculty of pharmacy, Medical academy, Lithuanian
university of health sciences; Eivenių str.4 Kaunas, Lithuania
Corresponding author’s e-mail address: ignaspopa@yahoo.com
Abstract
Cannabis sativa, depending on its breed and growth conditions may be used as a source of fiber,
cannabis oil or as a medicinal plant [1]. The aim of this study was to determine cannabidiol
(CBD) concentration and antioxidant activity dynamics of Cannabis sativa L. cultivated in
Lithuania. The object of the study was Cannabis sativa L., Finola breed, female aerial plant parts
(leaves, stems, flowers), which were collected in three different regions of Lithuania during four
vegetation periods. Main biological substances in C. sativa L., which have attracted the most
attention in science, are cannabinoids. Cannabidiol is neutral, non-psychotropic cannabinoid that
distinguishes wide spectra of biological activities like: anticonvulsive, sedative, hypnotic,
antipsychotic, anti-inflammatory and neuroprotective properties [2]. Beside cannabinoids, C.sativa
L. contains plenty of terpenoids: monoterpenoids of which main are: β-myrcene, α-pinene,
terpinolene and sesquiterpenoids of which main are: β-caryophyllene, caryophyllene oxide and
humulene. [3] The latter substances are potential oxidative stress damage reducers [4].
Cannabidiol identification and concentration dynamics was determined using high-performance
liquid chromatography method. Validation of quantitative assay of cannabidiol was performed.
Antioxidant activity was evaluated using ferric reducing ability of plasma method and
spectrophotometric analysis. Equivalent of antioxidant activity was 6-hydroxy-2,5,7,8-
tetramethylchroman-2-carboxylic acid – otherwise known as trolox. The results have shown that
the highest cannabidiol concentration was observed in flowers. The most high detected CBD
concentration was 2,99 ± 0,22 mg/g which was determined in flowers, at the beginning of the
flowering in Kupiškis region; the lowest cannbidiol amount was 0,024 ± 0,00001 mg/g in stems at
the end of seed maturity in Kupiškis region. Results of antioxidant activity assay of Finola breed
C. sativa L. have shown that highest antioxidant capacity was 0,3784 ± 0,0008 TE mg/g in leaves
during flowering ending in Kupiškis region, the lowest - 0,036 ± 0,0015 TE mg/g in stems during
beginning of flowering in Telšiai region. Conclusion – results have shown that Cannabis sativa L.
cultivated in Lithuania possesses antioxidant activity and certain CBD concentrations. Finola
breed Cannabis sativa L. may be used as a source of cannabidiol for pharmaceutical industry, but
further economical evaluation is required.
Keywords: Cannabis sativa L., antioxidant activity, cannabidiol.
ISSN 2335-8653
99
Determination Of Changes Of Common Lungwort (Pulmonaria Officinalis L.)
Composition Of Biologically Active Substances During Different Phenological
Phases Using Instrumental Analysis Methods
Simonas Juodis1, Audrius Maruška1, Ona Ragažinskienė2
1Faculty of Natural Sciences, Vytautas Magnus University, Vileikos g. 8-212, LT-44404 Kaunas, Lithuania
simonas.juodis@yahoo.com
2Vyatautas Magnus University Kaunas Botanical Garden, Sector of Medicinal Plants, Kaunas, Lithuania
Abstract
One of the Global Strategy for Plant Conservation goals is to secure mankind ability to fully utilize
the potential of plants, thus improving our livelihood and well-being. To optimize the use of
medicinal plants an extensive analysis of their biologically active substances is needed.
Comparative analysis of volatile, phenolic compounds, flavonoids and radical scavenging activity
of different phenophases in medicinal plant common lungwrot (Pulmonaria officinalis L.) was
carried out by means of spectrophotometric and chromatographic methods. 19 volatile compounds
have been identified. The content of phenolic compounds ranged between 110.35 – 118.06 mg of
rutin equivalents (RE)/g of which rutin was found to be the most prevalent. Total flavonoid content
was found to be lower. i.e. 87.33 – 93.81 mg RE/g. Radical scavenging capacity ranged from 97.41
to 114.33 mg RE/g and was found to be the lowest during open the flowering phenophase – 97.41
mg RE/g. Radical scavenging activity reached a maximum during full flowering phenophase, but
there were no statistically significant differences (p < 0.05) between radical scavenging capacity of
full flowering, end of flowering and fruit ripening phenophases, leading to a conclusion that
medicinal plant material can be harvested at any time during the three phenophases to maximize the
effectiveness of its use as a high quality antioxidant medicinal plant raw material.
Keywords: Pulmonaria officinalis L., Volatile compounds, Phenolic compounds, Flavonoids,
Radical Scavenging Activity
References: [1] Kaškonienė V, Stankevičius M., Drevinskas T., Akuneca I., Kaškonas P, Bimbiraitė-Survilienė K,
Maruška A., Ragažinskienė O. Evaluation of phytochemical composition of fresh and dried raw
material of introduced Chamerion angustifolium L. using chromatographic, sprectophotometric and
chemometric techniques. Phytochemistry. Article in press. 2015.
[2] Kaškonienė V, Kaškonas P, Maruška A. Volatile compound composition and antioxdiant activity of
bee pollen collected in Lithuania. Chem Pap. 2015; 69:291-299.
[3] Strategic plant for biodiversity 2011 – 2020 and the Aichi Targets.
ISSN 2335-8653
100
Platinum Group Metals Measurement In Used Automobile Catalyst With Two
Pulse LIBS Method
Deivydas Kiznys1, Karolis Gedvilas1, Valdas Girdauskas1,2 1 Vytautas Magnus University, Faculty of nature science, Vileikos St. 8, LT-44404 Kaunas 2 Center for physical sciences and technology, Savanorių St. 231, 02300 Vilnius
Abstract
Platinum, palladium, rhodium are platinum group of metals (PGM) which are used in automobile
catalyst manufacturing for motor emission control devices. The supply limitation of newly-mined
PGM indicate the needs for catalyst recycling for recovery and re-use. Fast and inexpensive
quantitative determination of the PGM elemental concentration in catalyst scrap it is significant
part of catalyst recycling. Laser-indused breakdown spectroscopy (LIBS) is particularly suitable
for rapid determination of the PGM elemental concentration [1]. In this presentation the results of
Pt and Pd concentrations measurements using two pulse LIBS are presented.
We used 20 samples with known PGM concentrations (Pt 665-5527 ppm; Pd 245-6621 ppm).
Two samples made from Standard Reference Material and 18 from used catalysts. Samples were
in the form of ground powder prepared from catalysts scrap and pressed in tablets.
For LIBS measurements the Nd:YAG lasers with first pulse energy 16 mJ, second – 27 mJ and
pulse duration 5 ns were used for sample ablation.
The laser beam was focused on the sample surface by the lens (f=90mm). Optical emission were
collected by 20 mm diameter and 50 mm focal length quartz lens on the end of the quartz optical
fiber (N.A. = 0.22) connected to a AvaSpec-2048 spectrometer (entrance slit of a 10 µm,
2400 lines/mm grating). 50 LIBS spectra from every sample were collected from 176 to 308 nm
and from 268 to 380 nm.
Detection parameters were gate delay (time between laser pulse emission and optical signal
detection) of 3.92 µs, gate width (time duration for optical signal detection) of 1.1 µs, time delay
between pulses of 400 ns, pulse repetition rate 1 Hz.
Pt spectra examination revealed that the following two interference–free platinum lines can be
used for Pt concentration measurement: 214.42 nm and 224.55 nm. Calibration curve for these two
lines normalized intensities were obtained. The Pt calibration curve has an R2 = 0.966. The
corresponding limit of detection (LOD) is equal to 334 ppm [2]
Pd spectra analysis showed that the following three interference–free palladium lines can be used
for Pd concentration measurement: 340.46 nm, 342.12 nm and 343.35 nm. Calibration curve for
the line 342.12 nm normalized intensity was obtained. The Pd calibration curve has lower R2 value
equal to 0.867. The corresponding limit of detection (LOD) is equal to 947 ppm.
Keywords: Laser-induced breakdown spectroscopy, platinum group metals, automobile catalysts.
References: [1] G. Asimellis, N. Michos, I. Fasaki and M. Kompitsas, "Platinum group metals bulk analysis in automobile catalyst
recycling material by laser-induced breakdown spectroscopy," Spectrochimica Acta Part B, vol. 63, no. 11, pp. 1338-
1343, 2008.
[2] S. Snyder, W. Wickun, J. Mode, B. Gurney and F. Michels, "The Detection of Palladium Particles in Proton
Exchange Membrane Fuel-Cell Water by Laser-Induced Breakdown Spectroscopy (LIBS)," Applied Spectroscopy,
vol. 65, no. 6, pp. 642-647, 2011.
ISSN 2335-8653
101
Influencing factors of chemical element accumulation in peat and
peat humic substances
Diana Dudare1, Maris Klavins1 1Department of Environmental science, University of Latvia, Raina Blvd. 19, Riga, Latvia,
corresponding author: dianadudare@inbox.lv
Abstract
Peatland cores provide us with the potential to research aspects of the atmospheric cycling of
elements, as metal pollutants, on timescales. In general, peatland ecosystems are thereof notable
sources of data about the carbon cycle, as well processes of acid deposition and heavy metal
accumulation.
Our study provides a better understanding of the basic peat properties and their effects on trace
and major element distributions in peat and peat humic substances (HS). Humic substances
isolated from ombrotrophic bogs - Eipurs, Dzelve, Dizpurvs - peat profiles (Latvia) were used as
study objects. Relations among peat depth, properties of peat and its humic substances (elemental
composition), as well as element content were studied. Elemental and functional analysis of the
isolated humic substances were done, using total reflection X-ray fluorescence, atomic absorption
spectrometry, Elemental Analyzer Model EA – 1108, Thermospectronic Helios γ UV (Thermo
Electron Co.) spectrophotometer, Total acidity method.
The distribution and content of chemical elements in bog profiles are influenced by several factors
such as geographical location of studied bogs, the nature of formation and differences of possible
element supply source. The compiled principal component matrix of studied chemical elements,
taking into account a number of variables, gives a better understanding of which processes -
natural or anthropogenic – influence the accumulation of elements in peat bog profiles and humic
substances.
The component analysis show that metal accumulation in peat formation processes depend on the
depth of the bog, the content of carbon, sulfur and carboxylic group, whereas there was observed a
correlation between the content of sulphur in humic substances and concentrations of zinc in peat
and peat HS. The accumulation process of chemical elements, such as As, Ni, Ca, Fe, Cu, Cr, Mn
characterizes a strong resemblance.
Correlation analysis between chemical elements in peat HS from different depth layers of Eipurs,
Dzelve and Dizpurvs bogs mark an essential differences in natural and anthropogenic
accumulation zones. The absolute values of chemical elements, determined in HS of studied bogs,
are similar to values obtained in other countries, like Belgium, Sweden, that reflects the local
distinctions, affecting the accumulation process of elements.
Accomplished correlation pair analysis allow to assess the mutability of interconnection between
chemical elements in HS of studied bogs and depending on the accumulation place of analyzed
element, peat layers can be divided into the upper, medium deep and bottom layers. Factors such
as geographic location of studied bogs, peculiarities of bog formation character and differences of
the possible element supply source are substantial with respect to the content of chemical elements
and their dispersion in peat HS of studied bogs.
Keywords: humic substances, peat, heavy metals, component analysis.
Acknowledgments: This work has been supported by the European Social Fund within the
project “Support for Doctoral Studies at University of Latvia” Nr.2009/0138/ 1DP/1.1.2.1.2.
ISSN 2335-8653
102
Ectoparasites From Nests And Burrows Of Swallow (Hirundinidae) In
Lithuania
I. Lipatova1, E. Šukauskaitė1, V. Matulaitytė1, A. Paulauskas1, J. Radzijevskaja1, A. Petraitis
1Department of Biology, Vytautas Magnus University, Vileikos 8, LT-44404 Kaunas, Lithuania,
E-mail address: a.paulauskas@gmf.vdu.lt
Abstract
The knowledge of ectoparasites fauna in nests and burrows of swallow in Lithuania is not clear.
Various ectoparasites occurring in nests and burrows of swallow can influence condition and
development of swallows. At the same time, huge infestation of ectoparasites can do lower the
reproductive success of their hosts, even can cause birds mortality. A biodiversity of ectoparasites
was performed from burrows of the Sand martin (Riparia riparia) and nests of the Barn swallows
(Hirundo rustica) in Lithuania. During 2013 – 2014 vacated nests and burrows of Swallow were
collected from two districts in Lithuania. A total 42 nests of swallows were examined. We
collected 472 ticks (Ixodida), 530 fleas (Siphonaptera), 2 bugs (Cimicidae), 8 lice (Mallophaga)
and 31 mites (Gamasida) from nests and burrows of swallows. Using microscopic and
morphometric analysis were identified 5 fleas species (Ceratophyllus styx, C. pullatus, C. farreni,
C. rusticus, C. hirundinis) and 1 tick species (Ixodes lividus). Biodiversity of ectoparasites in nests
of Barn swallow was higher then in burrows of Sand martin. A total 76.9 proc. of Barn swallows
nest was infected by ectoparasites. Infestation rate of ectoparasites in Sand martin burrows was 40
proc. This is a first concerning our survey of ectoparasites of swallow in Lithuania.
Keywords: ectoparasites, tick, flea, nests of swallow, Lithuania
ISSN 2335-8653
103
Stable Isotope Method For Tracing The Poultry Farm Environment
Raminta Skipitytė1, Agnė Mašalaitė1, Andrius Garbaras1, Rūta Mickienė2, Ona
Ragažinskienė3, Bronius Bakutis4, Jūratė Šiugždaitė4, Violeta Baliukonienė4, Saulius
Petkevičius4, Audrius Sigitas Maruška2 ir Vidmantas Remeikis1
1Center for Physical Sciences and Technology, Institute of Physics, Savanoriu av. 231, LT-02300, Vilnius, Lithuania,2
Vytautas Magnus University, Faculty of Natural Sciences, Vileikos st. 8-204, LT-44404 Kaunas, Lithuania,3 Kaunas
Botanical Garden of Vytautas Magnus University, Z.E. Zilibero st., LT-463224 Kaunas, Lithuania,4 Lithuanian
University of Health Sciences, Veterinary Academy, Faculty of Veterinary Medicine, Tilzes st. 18; LT-47181 Kaunas,
Lithuania
Correspondence to: agne.masalaite@ftmc.lt; mickiene@lva.lt
Abstract
In this work, we examined the applicability of the stable isotope (δ13C and δ15N) method to
describe the poultry farm environment in terms of source materials and their impact on isotope
distribution. Stable carbon and nitrogen isotope ratios were measured in airborne bacteria and
fungi extracted from the air filters, aerosol particles as well as feed, litter, dust from the ventilation
system, feathers and eggs. The chicken tissues were investigated during the sampling campaign on
3 July, 2014. Great consideration was given to aerosol particles as they can transfer
microorganisms and make a huge impact on health of both animals and their caretakers. Samples
were collected from two poultry farms in southeastern Lithuania. The pilot study showed the
contribution of the main sources – feed and litter ─ to aerosol formation processes as well as the
impact of the feed isotope ratio on chicken and the distribution of stable isotopes in its different
tissues. A separate study was carried out to identify fractionation between microorganisms and
their matrix in order to test the applicability of the stable isotope method in bulk samples for the
source material assimilation. Stable isotope distribution revealed the fates of the source materials
in the poultry farm environment.
These data are of great importance in understanding the poultry farm environment along with their
biology and ecology and serve as a basis for the further studies.
Keywords: stable isotopes, aerosol particles, poultry farm.
ISSN 2335-8653
104
Formation Of Nanoclusters On Pre-Expanded Polystyrene Beads
Šarūnas Varnagiris, Darius Milčius
Lithuanian Energy Institute, Breslaujos st. 3, LT-44403 Kaunas – Lithuania
Sarunas.Varnagiris @lei.lt
Abstract
Expanded polystyrene foam (EPS) is used for wide variety of products. One of the biggest
utilization spheres of EPS is insulation of buildings. The biggest EPS manufacturers are trying to
increase some of EPS characteristics (resistance to fire, antibacterial characteristic). There are
many of different ways how to incorporate additional materials into polystyrene. However, some
of EPS characteristics, such as elasticity, hardness, could be changed.
This work presents the results of nanoclusters formation on pre-expanded polystyrene beads by
using physical vapour deposition. These beads could be expanded and combined into foam after
nanoclusters formation.
Physical vapour deposition was used in order to form TiO2 nanoclusters on pre-expanded
polystyrene beads. Titanium cathode was used as a basic material of nanoclusters. Pressure of
deposition process was P=12 Pa. Plasma was generated by using DC power source (current I=0,25
A, voltage U=370V). Distance between cathode and polystyrene beads was 15 cm. Mixture of
argon and oxygen gas was used in order to form TiO2 nanoclusters (argon – 20 %, oxygen – 80
%).
Polystyrene beads were analysed by using scanning electron microscope (SEM), X-ray energy
dispersive spectroscope (EDS) and X-ray photoelectron spectroscope (XPS). Results showed that
titanium and oxygen particles distributed on the surface of polystyrene beads and form TiO2
nanoclusters.
Keywords: Pre-expanded polystyrene beads, nanoclusters, physical vapour deposition.
ISSN 2335-8653
105
High Precision Parallel Implementation Of Four-Particle Harmonic Oscillator
Transformation Brackets For Nuclear Calculations
Augustinas Stepšys1 , Saulius Mickevičius2 , Darius Germanas3 , Ramutis K Kalinauskas3 1Vilnius University, Faculty of physics, Saulėtekio av. 9, 10222, Vilnius, 2Vytautas Magnus University, K. Donelaičio
58, LT-44248, Kaunas, Lithuania, augustinas.stepsys@ff.vu.lt
Abstract
The microscopic description of nuclear shell model is one of rapidly developing area of modern
physics. While solving the Schrödinger's equation, the basis of harmonic oscillator functions has
proven to be extremely useful and efficient in describing compact quantum systems, such as
nucleons in atomic nuclei and quarks in hadrons. This kind of basis is simple to use, although it
has one major disadvantage- it converges quite slow. For this reason the dimensions of matrices
becomes very big as the values of quantum numbers, which are describing the elements of matrix.
These values are required to find the coefficients for a few particle harmonic oscillator
transformation brackets, which are constructed from Clebsh-Gordan, 6j and 9j coefficients.
Although the analytical expressions of these coefficients are simple,but big problems arise while
doing calculations on the computer. Currently widely used 64 bit (Double) precision is not
sufficient for these type of calculations as doing intermediate evaluation of coefficients requires
very large factorial values. Therefore calculated coefficients are represented not corectly. Another
problem is quite slow calculation, which could be solved by paralleling the computer code and
using large computer clusters. This component of multiparticle problem limits its evaluation, so
the expansion of limits for algorithms for calculating of harmonic oscillator transformation
brackets must be done.
Using external parallelization library and mutable precision we created a pack of numerical codes
based on the methods of compact expressions of the three and four- particle harmonics oscillator
brackets. Program code is written in Fortran 90 programing language. For parallelization of used
algorithm MPI parallel communication standard was used.
Considering that even in small harmonic oscillator energy and angular momentum values Double
Precision is not sufficient, we decided to use higher precission methods in intermediate
calculations, as it increases the stability of algorithms and extends the validity of used algorithms
for larger input values. Thus, we created routines for calculating required coefficients using GNU
Quadruple Precision and arbitrary precision library FMLib. The use of different kind of precision
for calculation allows to balance speed of calculation ( fastest calculation is done using Double
precision, slowest - FMLib) with tolerable margin of error.
Keywords: nuclear shell model, parallel techniques
ISSN 2335-8653
106
Ab Initio Calculations Of Six-Body Systems
Augustinas Stepšys1 , Saulius Mickevičius2 , Darius Germanas3 , Ramutis K Kalinauskas3 1Vilnius University, Faculty of physics, Saulėtekio av. 9, 10222, Vilnius, 2Vytautas Magnus University, K. Donelaičio
58, LT-44248, Kaunas, Lithuania, augustinas.stepsys@ff.vu.lt
Abstract
For description of physical proterties of many-body systems besides the physical part of the
problem, requires efficient mathematical and computational methods. One of the hugest projects
with an emphasis on computational and algorithmic developments in nuclear physics, was
UNEDF project [1,2], carried out in USA from 2006 to 2012. This project revealed the
complexity of many-body systems and the limitations of the models which were used. As an
example calculations of 12C, required supercomputer resources with more than 100,000 cores.
Here for basis antisymmetrisation Slater determinants were employed. The method of Slater
determinants is quite simple method of antisymmetrisation of N fermion systems, but it gives a
huge basis states used in calculations and therefore may require superpowerfull computer
resources.
One of the possible solution of the problem- to create efficient models of many-
body systems which allows to optimize the use of computer resources. For the solution of the
problem, method of binary cluster model can be applied. The approach is based on a simple
enumeration scheme for antisymmetric N particle states, and I suggest an efficient method for
constructing the eigenvectors of two-particle transposition operator PN1;N in a subspace where N1
and N2 = N −N1 nucleons basis states are already antisymmetrized [4]. Using this method we can
distinguish totally asymmetrical N particle states from the other states with lower degree of
antisymmetry. Calculations were performed for systems composed of six nuclei.
Keywords: nuclear physics, Mathematical physics, Ab initio calculations
References should be listed as below: [1] S. Bogner, etc., arXiv:1304.3713v1 [nucl-th] 2013
[1] G. F. Bertsch, D. J. Dean, W. Nazarewicz, SciDAC Rev. 2007, 6, 42
[1] E. Lusk, S. C. Pieper, R. Butler, SciDAC Rev. 2010, 17, 30
[1] S. Mickevičius, etc., Central European Journal of Physics 2013, 11, 5 568-574
ISSN 2335-8653
107
Plasma Based Ex-Situ And In-Situ Hydrogenation Of Mg Films
Dalius Girdzevicius, Darius Milcius, Marius Urbonavicius
Lithuanian Energy Institute, Breslaujos st. 3, LT-44403, Kaunas, Lithuania
Dalius.girdzevicius@lei.lt
Abstract
Magnesium hydride (MgH2) is an attractive material for hydrogen storage applications due to its
high volumetric capacity reaching 7.65 wt%. However, MgH2 demonstrates slow kinetics for
adsorption and desorption of hydrogen and requires high temperatures for decomposition. In order
to enhance hydrogenation process and its thermodynamic properties different additives can be
used. In this consequence, deactivation and degradation of additives can decrease efficiency of
metal hydrides.
In this work Mg films were synthesized using magnetron sputtering in Ar+ atmosphere and then
ex-situ and in-situ hydrogenated in magnetron induced hydrogen plasma. This thechnique enables
to achieve metal hydrides without the use of additional compounds. Therefore, undesired
deactivation and degradation of additves can be avoided.
Current study aims to analyze the main differences between the samples prepared during plasma
based ex-situ and in-situ hydrogenation. SEM, AFM, XRD and XPS techniques are used to
identify formation of magnesium hydrides in this work. Advantages of in-situ hydrogenation of
Mg are identified according to experimental results.
Keywords: Magnesium hydride, Hydrogenation, Magnetron sputtering.
ISSN 2335-8653
108
The Effect Of Foliar Spray Fertilizers On Hordeum Vulgare Resistance To
Combined UV-B Radiation And Drought Stress Effect
Irena Januškaitienė1, Inga Ivankova1
1 Vytautas Magnus Universit; Vileikos 8, LT-44404 Kaunas, Lithuania
E-mail address to I.Januskaitiene@gmf.vdu.lt
Abstract
During the study there was examined the microelement foliar spray fertilizers effect on spring
barley (Hordeum vulgare L.) resistance to combined UV-B radiation doses (1, 3 kJm-2d-1) and
drought effects. Barley seeds were sown in prepared pots with neutral pH peat substrate. 7 days
after germination was carried out in the first spray on the leaves with microelement fertilizers and
free amino acids (Aton Az). Within 2 days after the first fertilizer application, the different
irradiation (1, 3 kJm-2d-1) UV-B doses and drought affected were started. Experiment lasted for 6
days. The second and third fertilizer spray applications were made 3 and 5 days of exposure.
During the experiment (i.e. 2 and 4 days of exposure) were measured physiological indicators,
while the main characteristics of all investigated indicators were carried out at the end of
exposure, i.e. 6th day and after recovery period, i.e. after 7th days after end of exposure. The
strongest effect on barley physiological, morphological, and biochemical parameters were under
single impact of the drought. The highest combined effect on investigated parameters were under
UV-B radiation and fertilizers impact. It was found that the weakest photosynthetic rate of barley
was on the 6th day of exposure. The largest positive effect of fertilizers on photosynthetic rate of
barley were under single impact of the drought, i.e. photosynthetic rate of fertilized barley was
more than 6 times higher than not applied plants (p<0.05). With increasing UV-B radiation dose
the content of chlorophylls in leaves of barley decreased. Fertilizers have helped to overcome the
UV-B radiation induced stress, since in the sprayed barley leaves content of chlorophyll a and b
were higher (p<0.05). The highest carotenoid content and the lowest dry biomass was for barley
exposed to a combined 3 kJm-2d-1 UV-B radiation and drought effects, compared with the control
there was 40,3 more carotenoids (p<0.05) and 36,5 less dry biomass (p<0.05).
Malondialdehyde (MDA) content increased with the strength of stressors compared to controls
(p<0.05). After a recovery period, the maximum positive effect of fertilizers was on the
photosynthetic rate, chlorophyll a/b ratio, MDA content in leaves of barley. The most positive
effect of fertilizers was under weak and average stress intensity.
Keywords: UVB, drought stress, pigments, dry biomass, malondialdehyde, foliar spray fertilizers.
ISSN 2335-8653
109
Species Composition And Distribution Of Terrestrial Isopods (Isopoda) In
Region Alytus Of Lithuania
Karolina Kvašnauskaitė1, Ingrida Šatkauskienė2
1 Department of Biology, Faculty of natural science, Vytautas Magnus University, Kaunas Lithuania
2 Department of Biology, Faculty of natural science, Vytautas Magnus University, Kaunas Lithuania.
i.šatkauskienė@gmf.vdu.lt
Abstract
Terrestrial isopods/woodlice are widespread and fuctions as the dominant component of the soil
arthropod macro decomposer community in many terrestrial habitats [1]. Terrestrial isopods have
morphological advantages, as desiccation protection also respiration, reproduction, nutrition
systems, which allow them distribute in various natural terrestrial biotopes and urbanized areas [2].
The interesting fact, that these organisms are abundant and widespread in Lithuania, but their
research began only in 2004. Till now, known fauna of terrestrial isopods of Lithuania contains 12
species [3]. Isopods were collected in 2014 during summer (VI, VII, VIII) and autumn (IX, X)
from six different habitats in Alytus (54° 23′20″ N, 24° 2′ 50″ E) region: mixed with coniferous
forest, leafy forest, wetland, young mixed with coniferous forest, part of leafy forest located by the
road and anthropogenic area. Sampling of isopods was mostly by hand collection. Basic statistical
parameters were applied to analyze the results: relative abundance (Ds), species richness (S),
Shannon-Wiener diversity index (H), Simpson dominance index (D) and Evenness (EH ) index.
The total 1775 individuals were collected and 8 species of isopods were identified: Trachelipus
rathkii, Hyloniscus riparius, Porcellio scaber, Trichoniscus pusillus, Cylisticus convexus,
Ligidium hypnorum, Oniscus asellus, Porcellionides pruinosus.
The latest species P. pruinosus was found as new species in Lithuania. The highest species
richness (S=5) was found in mixed forest and the lowest (S = 2) was in young mixed forest. The
highest biodiversity (H = 1.41; D = 0.50) of terrestrial isopods was found in mixed forest,
meanwhile the lowest (H = 0.13; D = 0.96) was observed in urban area. T.rathkii, a eurytope
species, was found in all investigated habitats, whereas P. pruinosus spread only at urban area.
Abundance (surface activity) of isopods showed a seasonal pattern. The sample size of T. rathkii,
P.pruinosus allowed calculating the sex ratio of this species; Females dominated in all habitats and
during all period of research.
Keywords: terrestrial isopods, diversity, distribution, decomposers
References [1] Ferenţi S., Cupsa D., Covaciu-Marcov S. D. 2012. Ecological and zoogeographical significance of terrestrial
isopods from Carei Plain natural reserve (Romania). Archives of Biological Sciences, 10291036.
[2] Paoletti M. G., Hassall M. 1999. Woodlice (isopoda: Oniscidea): their potencial for assessing sustainability and
use as bioindicators. Agriculture, Ecosystems and Environment, 157165.
[3] Vilisicsa F., Ivinskis P., Rimšaitė J. 2012. Terrestrial isopods (Crustacea, Oniscidea) at the Baltic Sea coast in
Lithuania. Zoology and Ecology.226- 232.
ISSN 2335-8653
110
Characterization of low flux neutron sources by using neutron activation
analysis, MCNP6 modeling and solid state nuclear track detectors
Elena Lagzdina, Danielius Lingis, Artūras Plukis, Rita Plukienė, Darius Germanas, Jevgenij
Garankin
Center for Physical Sciences and Technology, Savanorių pr. 231, LT-02300 Vilnius, Lithuania
elena.lagzdina@ftmc.lt
Abstract
This study is focused on optimization of low flux neutron sources for radiobiological applications.
Prior to choose optimal conditions for irradiation of biological sample, neutron flux intensity and
energy distribution should be determined. Neutron activation analysis (NAA), solid state nuclear
track detectors (SSNTD) and MCNP6 simulation were used for identification of neutron flux
parameters. Experiments were carried out using isotopic PuBe neutron source at total activity
4.5×107 n/s and neutron generator based on 3H(2H,n)4He reaction resulting monoenergetic 14.7
MeV neutron flux (108 n/s). MCNP6 is used for neutron transport calculation, energy deposition,
assessment of the reaction rates and dose rates in the biological sample [1]. For the experimental
cross-checking of the MCNP6 simulation samples of V, Mn, Fe, Al, Ti as well as TASTRAK
(Track Analysis Systems Ltd.) and MAKROFOL (Bayer) detectors have been irradiated. After
irradiation chemical etching of SSNTD’s was performed. Subsequently, the surface of the samples
was analyzed for tracks identification. The samples of V, Mn, Fe, Al, Ti were measured by the
high purity germanium (HPGe) detector and the activities of neutron induced isotopes were
obtained [2]. According to the experimental results and MCNP6 modeling the characterization of
low flux neutron sources is performed.
Keywords: Neutron activation analysis, MCNP6, solid state nuclear track detectors.
References [1] D.B. Pelowitz, MCNP6 User’s Manual, Version 1.0, Report LA-CP-13-00634, 2013, Los Alamos National
Laboratory, New Mexico.
[2] L. Hamidatou, H. Slamene, T. Akhal, B. Zouranen, 2013, Concepts, Instrumentation and Techniques of Neutron
Activation Analysis, Faycal Kharfi ISBN 978-953-51-1033-0.
ISSN 2335-8653
111
The Effect Of Equal Cd And Cu Exposure In Peat Substrate On Growth And
Bioaccumulation Of Hordeum Vulgare
Irena Januškaitienė1, Martynas Klepeckas1
1 Vytautas Magnus Universit; Vileikos 8, LT-44404 Kaunas, Lithuania
E-mail address to I.Januskaitiene@gmf.vdu.lt
Abstract
Environment pollution with heavy metals is becoming more important these days because of
working industry, agriculture, raising usage of heavy metals and their emissions. In this work there
was investigated the impact of two heavy metals Cd and Cu various concentrations (100; 200;
400; 800 and 1600 mg/kg soil) contaminated soil on barley (Hordeum vulgare) morphological
parameters, content of photosynthetic pigment and malondialdehyde (MDA) concentration.
Investigated plants were sown in vegetative pots with prepared peat and sand substrate (ratio 2:1),
and 4 days after germination plants were watered with appropriate metal concentration solutions.
Experiment lasted for 14 days, until the second true leaf unfolded. At the end of experiment the
content of pigments was measured using spectrophotometer, MDA – using thiobarbituric acid
method and also detected plants height and dry mass. For the quantitative determination of metals
in plant material a Shimadzu AA-6800 atomic absorption spectrometer equipped with deuterium
background correction, and single-element hollow-cathode lamps as radiation sources were used.
Bioaccumulation factors (BAF) of Cu and Cd of barley plants were calculated according Mattina
et al. method. Increasing metal concentrations decreased plant height and biomass, and Cd effect
on morphological parameters were higher than Cu, when correlation between barley height and Cd
concentration was -0.74 (p<0.05), and between height and Cu concentration – -0.39 (p<0.05).
Increasing metal concentrations effect on photosynthetic pigments was different, i.e. under Cu
effect the content of pigments (a+b) increased and correlation was 0.47 (p>0.05), while under Cd
effect it decreased and correlation was -0.13, (p>0.05), but statistically insignificant. Between
MDA concentration in barley leaves and heavy metals concentration in the substrate there was
estimated a strong correlation (p<0.05), which was slightly stronger under copper impact. At
lower concentrations there were detected lower MDA levels, compare to the control plants, when
the concentration increased up to 1600 mg Cu and Cd / kg substrate, the MDA concentrations
increased statistically significant by 68% and 32% respectively. Up to 800 mg/kg concentration in
substrate accumulation of copper was more willing than accumulation of cadmium in barley
leaves (p <0.05), but when concentration rises up to 1600 mg/kg, plant starts to accumulate more
Cd than Cu.
Keywords: Cadmium, copper, malondialdehyde, pigments, dry biomass, bioaccumulation factor.
ISSN 2335-8653
112
Radiation Interaction Impact On Environment And Technology
S. Mickevičius1 D. Adlienė2
1 Faculty of Natural Sciences, Vytautas Magnus University, Vileikos str. 8, LT-44404, Kaunas, Lithuania
2Department of Physics, Kaunas University of Technology, Studentų str. 50, LT-51368, Kaunas, Lithuania
Email: s.mickevicius@gmf.vdu.lt
One of profiles of our group is scientific, technological and medical applications of
ionizing radiation. Currently we are focused on the development of the new methods for patient
dose assessment in radiation therapy and new nanostructured materials for commercial application
in radiation detectors and Pb free radiation protection equipment.
We are pioneering in starting verification of in vivo doses in interstitial catheter based high
dose rate brachytherapy when catheters are preimplanted direct into the cancerous tumor. For this
purpose we are using a complex of (well-known and new developed ) experimental dosimetry
methods: Metal – Oxide Semiconductor Field Effect Transistor detectors, thermoluminescent
dosimeters (special „pin worms“ and rods, having diameter ~1mm or less, to fit into catheter), film
dosimetry (radiographic and Gafchromic films and special method for their evaluation), gel
dosimetry and simple pixel based method for dose evaluation in irradiated gels. It is also to point
out that the reliability of all methods is validated performing uncertainty evaluation tests.
Experimental verification of theoretical patient doses calculated using standard treatment planning
system alow avoiding certain patient irradiation mistakes.
Now we are working on development of new polymeric gels for dosimetry that provide
visual information on radiation induced polymerisation due to irradiation doses applied, are
sensitive to small (0.01 or 0.1 Gy) dose variations, are stable for at least one year. In paralell we
are developing optical methods for dose assessment since gel evaluation in MRI modality, which
is usual for this assessment, is time consuming and expensive.
In line with European Union Directive 2011/65/ on the restriction of the use of certain
hazardous substances in electrical and electronic equipment, which also limitts the use of leaded
equipment for medical applications we are working on development of nanostructured Pb free
materials that might replace currently used leaded radiation protection shields and other adiation
protection equipment. Developed nanocomposites are transparent (86-92%), and provide Pb
equivalent thickness of 0.5- 1.0 mm for scattered radiation in interventional radiology
corresponding to the voltage applied.
ISSN 2335-8653
113
Hydrogen Production By Reacting Activated Aluminum Metal With Water
Marius Urbonavičius, Darius Milčius
Lithuanian Energy Institute, Breslaujos st. 3, LT-44403 Kaunas – Lithuania
E-mail address: Marius.Urbonavicius@lei.lt
Abstract
During the past decade, hydrogen production as regenerative and environmentally friendly fuel
has been an active area of research. There are many methods which could be applied for stationary
hydrogen production (mainly steam reforming; electrolysis, photo-chemical methods and etc.).
However, hydrogen-powered portable devices still remain a challenge because of complex
hydrogen storage systems.
Consequently, aluminum reaction with water can be a solution for hydrogen production on-board
(in-situ). Aluminum is relatively cheap, widespread with high volumetric density metal. Although
Al-water reaction is thermodynamically stable, metal surface is passivated by formation of thin
oxide film which prevents metal surface from direct contact with water.
According to literature a number of aluminum activation and reaction-inducing methods have
been investigated and some of them patented. The easiest way is addition of some promoters to the
reaction which help to disrupt oxide layer. It could be sodium hydroxide (NaOH), metal oxide
additive (Al2O3, TiO2, CuO, ZnO) or salt (NaCl, KCl) promoters. Alkaline is simple and low cost
catalyst. Another method is forming aluminum alloys with other metals which prevent from
surface oxidation. Probably, the best known is aluminum-gallium alloy. Also complex alloys
which include Zn, In, Bi, Mg, Sn, Li, Mn could be used. Moreover, aluminum powder could be
milled with sharp-edge salt particles. Theoretically, 1 gram of Al can produce about 1245 ml of
hydrogen. The production depends on many factors: activation method, aluminum particle size,
al/water ratio, water temperature, pH value.
In this research, the surface layer of aluminum powder was modified under hydrogen gas plasma
treatment. Many various analysis methods (scanning electron microscopy, energy dispersive X-ray
spectroscopy, X-ray diffraction analysis, O/N/H gas analysis) were used to characterize Al powder
before and after plasma treatment. Hydrogen generation was investigated after Al immersion in
water as well.
Keywords: Aluminum activation, alloy, sodium hydroxide, water, hydrogen generation, plasma.
ISSN 2335-8653
114
Safety Aspects of Higher Value Wheat Bread
Elena Bartkiene1, Vadims Bartkevics2,3 Iveta Pugajeva2,3, Ida Jakobsone2, Vita
Krungleviciute1, Grazina Juodeikiene4, Daiva Vidmantiene4, Loreta Basinskiene4, Gerhard
Schleining5
1 Lithuanian University of Health Sciences, Tilzes g. 18, 47181 Kaunas, Lithuania 2 University of Latvia, Centre of Food Chemistry, Kr.Valdemara iela 48, LV-1013 Riga, Latvia 3 Institute of Food Safety, Animal Health and Environment, Lejupes iela 3, LV-1076 Riga, Latvia 4Kaunas University of Technology, Radvilenu pl. 19, 50254 Kaunas, Lithuania 5 University of Natural Resources and Life Sciences, Muthgasse 18, 1190 Wien, Austria
Elena.Bartkiene@lsmuni.lt
Abstract
Consumer awareness of the value of functional foods has greatly increased in the past years, and
the global market for functional foods is expected to increase to €14.7 billion by 2013 [1]. A
variety of ingredients are used during bread making to ensure the development of a continuous
protein network that is essential for bread quality. Attempts at incorporating bioactive ingredients,
for example, dietary fiber and phenolic antioxidants into popular foods such as bread have grown
rapidly, due to the increased consumer health awareness. Functional foods with elevated levels of
antioxidants and dietary fibers are in high demand due to their associated health benefits,
including maintenance of health and protection from diseases, such as cancer, cardiovascular
diseases, and degenerative diseases [2].
Usually studies about the wheat bread value improving are focused on the quality, but not on the
safety parameters evaluation. To ensure safety parameters of wheat bread, for some special
chemical composition functional ingredients (with high protein content, with high reducing
saccharides content etc.) should be adapted special technological steps before using for wheat
bread value improving. Otherwise, the new developed product may be not only not beneficial but
just harmful to consumers health [3; 4; 5; 6; 7].
Keywords: wheat bread, quality, safety.
References [1] The Medical News, 2010
[2] K.P. Scott, S.H. Duncan, H.J. Flint, Nutrition Bulletin, 2008, 33, 201-211
[3] E. Bartkienė, G. Juodeikienė, D. Vidmantienė, G. Zaborskienė, D. Kunkulberga, Agriculture, 2009, 96, 181-196
[4] E. Bartkienė et al., LWT - Food Science and Technology, 2013, 54, 414-420
[5] E. Bartkienė et al., International journal of food sciences and nutrition, 2013, 64, 890-896
[6] E. Bartkienė et al., International journal of food science & technology, 2013, 48, 2613-2620
[7] E. Bartkienė et al., Food control, 2013, 30, 35-40
ISSN 2335-8653
115
Optimization of Extraction of Linden Flowers Phenolics with Water Using
Response Surface Method
Agnė Birštonaitė, Vytenis Venclovavičius, Raimondas Raudonis
Department of Pharmacognosy, Lithuanian University of Health Sciences, Eivenių 4, 50161, Kaunas, Lithuania
agne.birstonaite@gmail.com
Abstract
Linden is a traditional Lithuanian plant which medicinal raw is linden flower. European
pharmacopeia linden raw material is comprised of flowers (or mixes of them) of Tilia cordata
Miller, Tilia platyphyllos Scop., Tilia vulgaris Heyne. Traditionally linden flowers are used for
insomnia, migraine, cold with fever, cardiovascular or digestive tract disorders [1].
Pharmacological effects depends on phenolic compounds, flavonoids, proanthocyanidins,
carbohydrates, essential oil, enzymes, vitamins [2]. There is lack of information in the literature
about the impact of grinding of pharmaceutical raw material on bioactive compounds extraction.
The object of this study was the tea of linden flowers, which has been divided into 7 fractions: >
2.5 mm, 2.0–2.5 mm, 1.6–2.0 mm, 1.4–1.6 mm, 1.12–1.4 mm, 0.9–1.12 mm, < 0.9 mm. The aim
was to optimize the extraction of phenolic compounds with water using response surface method
and quantify the groups of the extracted compounds. The ANOVA analysis was used for the
evaluation of constructed model.
It was determined that the optimal temperature extracting the maximum amounts of phenolic
compounds was (p<0.05) was 100 °C. The amounts of total phenolic compounds, flavonoids,
proanthocyanidins vary significantly in different fractions in the time scale. Fractions containing
particles larger than 1.4 mm were determined with greater amounts of phenolic compounds. The
maximum amount of phenolic compounds has been detected in the 2.0–2.5 mm fraction after 45
min – 72.76 GAE mg/g. This fraction has had the greatest (p<0.05) amount of proanthocyanidins
– 12.75 mg/g. The smallest amount of proanthocyanidins has been accumulated by 0.9–1.12 mm
fraction. The smallest fraction (< 0.9 mm) provides greater extraction of flavonoids, up to 17
mg/g.Selecting method giving the highest yield of target compounds could be preferable for
consumers and producers.
Keywords: Linden flowers, phenolic compounds, Tilia.
Acknowledgment: Agnė Birštonaitė acknowledge support by project "Promotion of Student Scientific
Activities" (VP1-3.1-ŠMM-01-V-02-003) from the Research Council of Lithuania. This project is funded
by the Republic of Lithuania and European Social Fund under the 2007-2013 Human Resources
Development Operational Programme’s priority 3.
References
1. Barnes J, Anderson LA, Phillipson JD. Herbal Medicines. 2th ed. Pharmaceutical Press, London 2007
2. EMA, Community herbal monograph on Tilia cordata Miller, Tilia platyphyllos Scop., Tilia x vulgaris
Heyne or their mixtures, flos, 2012
ISSN 2335-8653
116
Growth Parameters Of Centaurium Erythraea Cell Culture In Relation To Its
Chemical Composition And Antiradical Activity
Anete Boroduske1, Ilva Nakurte1, Agneta Lindmane2, Madara Lazdane3, Signe Tomsone3
1 Laboratory of Bioanalytical and Biodosimetry Methods, 7 Ratsupites str., Riga LV-1069, Latvia 2 Faculty of Medicine of University of Latvia, Raina blvd. 19, Riga, LV – 1586, Latvia
3 Botanical Garden of the University of Latvia, Kandavas 2, LV-1083, Riga
anetekeisa@lu.lv
Abstract
Minimal impact on wild populations, independence of seasonal and environment-related variations,
short time of scale-up and availability on demand are just a few but not all advantages of in vitro culture
derived plant material over cultivated plants or plants harvested in wild. However, many studies have
shown that richness and diversity of chemical composition and biological activity of wild plant derived
extracts usually exceeds that of in vitro plant derived extracts. Therefore, in order to reach commercial
scale of plant derived extract production using in vitro culture techniques correct choice regarding culture
type, growth conditions and timing of sampling has to be made.
Here we report a study on anti-oxidative compound production in Centaurium erythraea (source of
potentially valuable compounds for anti-aging cosmetics) cell suspension culture in relation to culture
growth parameters. In addition, a comparison of analyzed compound content, total phenolic content and
anti-radical activity of extracts derived from different culture types of C.erythraea (cell suspension, callus,
shoot culture and Centaurii herba drug) will be reported.
Keywords: Centaurium erythraea, cell suspension culture
ISSN 2335-8653
117
Characterization Of Plant Extracts In Cell And Tissue Culture-Based In Vitro
Test Systems For Development Of New Cosmetic Compositions For Skin
Renewal And Whitening
Martins Boroduskis1,2, Anna R-Stunda1,2, Elza Kaktina1, Anete Boroduske1, Ilva Nakurte1,
Janis Ancans1,2 1University of Latvia, Laboratory of Bioanalytical and Biodosimetry Methods, Ratsupites str. 7, LV-1067, Riga, Latvia 2InCell Ltd., Ratsupites str. 7, LV-1067, Riga, Latvia
martins.boroduskis@lu.lv
Abstract
Use of natural origin ingredients for cosmetic and personal care products is constantly
increasing and results in demand for ingredient characterization to establish safety profile and
efficacy. Since animal testing of cosmetic ingredients and final compositions is banned in the
European Union since 2013, in vitro cell and tissue culture-based methods have to be developed
and used instead. Furthermore, in vitro micro-propagation techniques of plants provide
opportunity to derive plant extracts without impact on wild plant populations and allow industrial
utilization of extracts also derived from endangered and rare plants. Thus, in vitro technique based
solutions are of increasing interest for cosmetic and personal care industry in order to address
rising demand for natural origin products manufactured according to environmentally friendly
practices.
Our in vitro service platform provides analysis of micro-propagated plant extracts using LC-
MS-TOF for identification of active ingredients of interest for anti-aging, skin whitening and UV-
protecting skin care and cosmetic product formulations. Extract characterization methods include
total phenolic content, anti-radical activity and tyrosinase inhibition assays in case of whitening
ingredients, as well as evaluation of biological effects of candidate ingredients in different cell and
tissue culture-based in vitro test systems. In vitro tests include assessment of cell proliferation and
migration profiles of human fibroblast, HaCaT and melanocyte cell cultures using IncuCyte
ZOOM system, real time PCR expression profiling with custom designed gene sets, quantitative
analysis of growth factor and cytokine secretion, and advanced in vitro test models such as cell co-
cultures and 3D organotypic tissue cultures.
Keywords: plant extracts, cell culture, in vitro tests, cosmetic products, natural ingredients, 3D
tissue culture
ISSN 2335-8653
118
Express test for honey quality
Violeta Krasevič1, Bogumila Kurtinaitiene2, Justinas Kretavičius2, Violeta Čeksterytė3 1Vilnius Gediminas Technical University, Saulėtekio al. 11, 10223, Lithuania 2Vilnius University, Institute of Biochemistry, Mokslininku str. 12, LT-08662, Lithuania 3 Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry Akademija, Kedainiai dist.,
Instituto aleja,1, LT–58344, Lithuania
The following enzymes are found in honey: α- and β-amylase, α- and β-glucosidase, glucose
oxidase, catalase, acid phosphatase, glucose dehydrogenase. The glucose oxidase (GOx), which
oxidizes glucose in honey, produces gluconic acid, one of the main acids found in honey, and
generates hydrogen peroxide, which is an important antimicrobial component of honey. The more
hydrogen peroxide, resulting from higher GOx activity, is found, the higher the value of honey is.
This work was aimed to evaluate the activity of GOx in honey samples collected in different
regions of Lithuania
Hydrogen peroxide is produced in honey in the process of glucose oxidation by GOx, as one of the
reaction’s products. It also acts as a substrate for peroxidase accepting protons. Due to the high
peroxidase selectivity we developed an express test for honey quality evaluation. The test is based
on peroxidase immobilized on a silica gel beads and coloured substrate 2,2'-azino-bis(3-
ethylbenzothiazoline-6-sulphonic acid). The carrier is selected from a number of inorganic and
organic carriers (activated carbon, hydrated alumina, polystyrene). Peroxidase immobilized on this
carrier had a higher enzymatic activity and temperature stability. The developed method was
applied for the measurement of GOx activity in 10-fold dilute samples of honey until 0.01 activity
units/mL. The method is well correlated with the reference method, which is based on the
measurement of GOx activity by an oxygen consumption rate (R=0.978).
The express method is a visual test of honey quality in a set of green colour palette that
corresponds to certain GOx concentration in the examined sample. The method allows us to
produce dry kits and perform honey quality tests without sophisticated analytical techniques at
room temperature. The test is about 10 min, the resulting colour is compared with the colour
palette, which shows enzyme concentration in the sample. The dry kit is stable for up to 4 months
at 4 ° C. This is especially convenient for beekeepers in order to prove the exceptional quality of
the bee products they market. The study found that the GOx activity of Lithuanian honey varied
within 0.03 – 1.49 U/g range. The highest GOx activity was identified in buckwheat and caraway
honeys, while the lowest GOx activity was in oilseed rape and alder buckthorn honeys. The test
could also help detect overheated or adulterated honey.
Keywords: honey, glucose oxidase, express method
ISSN 2335-8653
119
Blueberry Genotypes for the Selection of New Cultivars with Higher Contents
of Biologically Active Compounds
Vilma Kraujalytė1, Petras Rimantas Venskutonis1, Audrius Pukalskas1, Laima Česonienė2,
Remigijus Daubaras2 1Department of Food Science and Technology, Kaunas University of Technology, Radvilėnų pl. 19, Kaunas, LT-
50254, Lithuania, 2Kaunas Botanical Garden of Vytautas Magnus University, Žilibero g. 6, Kaunas LT-46324,
Lithuania, r.daubaras@bs.vdu.lt
Abstract
Blueberries (Vaccinium corymbosum L.) and some closely related species are among the most
popular commercial berry fruits. Continuous breeding programs were focusing on creating higher
commercial value berry plant genotypes with high productivity, large berry size, berry firmness,
and disease resistance factors. Large berry size, waxy coating, light blue color, firmness and long
shelf life are the most important berry characteristics of V. corymbosum cultivars. However, due to
an increasing demand of healthy foods by the consumers, breeding programs of new berry plant
cultivars, which would accumulate higher concentrations of healthy compounds are carried out.
Indigenous species of bog blueberry (Vaccinium uliginosum L.), highbush blueberry (Vaccinium
corymbosum L.) genotypes ‘Aron’, ‘Bluecrop’, ‘Bluegold’, ‘Bluehaven’, ‘Bluejay’, ‘Blueray’,
‘Hardyblue’, ‘Nui’, ‘Patriot’, ‘Puru’, ‘Reka’, ‘Toro’ ‘Weymouth’, and half-highbush blueberry
genotypes ‘Danutė’, ‘Freda’, ‘Northblue’, ‘Northland’, ‘Putte’, No.16 were investigated in this
study.
The juices of bog blueberry and newly bred blueberry genotypes ‘Danutė‘ and ‘Freda‘
demonstrated significantly stronger antioxidant properties than other analyzed genotypes. An
inverse relationship between average berry mass and total phenolic content as well as the
concentration of chlorogenic acid was observed. Moderate negative correlation was found
between the berry mass and ABTS•+, FRAP and ORAC values as well. The correlations between
similar characteristics measured by different methods were quite high. Thus, the genotypes
containing larger amounts of phenolics possessed high values of ABTS•+, FRAP, and ORAC;
positive correlation coefficients were 0.914, 0.917, and 0.903, respectively. The antioxidative
activity measured with ABTS•+, FRAP, and ORAC also had positive correlation with the
concentration of quinic and chlorogenic acids (p≤0.01).
The results of this study suggest that germplasm of half-highbush blueberry V.
corymbosum and V. uliginosum could be used in breeding of new cultivars with enhanced
antioxidant capacity.
Keywords: Vaccinium corymbosum, V. uliginosum, antioxidant activity phenolic compounds
ISSN 2335-8653
120
Determination Of Total Anthocyanin Content In Cranberry (Vaccinium
OxycoccoL.) Fruit Using UV Spectrophotometry
Eglė Ignatavičiūtė, Asta Kubilienė1 , Guoda Kiliuvienė1 , Kristina Gaivelytė2 1Department of Analytical and Toxicological Chemistry, Lithuanian University of Health Sciences, Eivenių 4, 50161,
Kaunas, Lithuania 2Department of Pharmacognosy, Lithuanian University of Health Sciences, Eivenių 4, 50161, Kaunas, Lithuania
E-mail: egle155@gmail.com
Introduction. Vaccinium oxyccocos L. is growing naturally in Lithuania. Cranberries are very
local where is high water tabel. Berries are rich in biologically active substances such as fenolic
compounds, organic acids, vitamins, macro- and microelements. People started using it long time
ago for lower of urinary tract infections. Anthocyanins are importoant for healths benefits for their
antitumour, antiulcer, antioxidant, anti – inflammatory activities [1,2].
Materials and methods.Fruits of V. oxyccocos L. were collected in different regions of
Lithuania(Mažeikiai, Merkinė, Veisiejai, Dubičiai, Joniškis, Jonava, Čepkeliai, Utena, Kėdainiai,
Žuvinto r.). Fresh fruits samples were frozen and stored in freezer at -19±1 °C.
Extraction. 3.0 g of V. oxyccocos L.fruits presscake were extracted with ethanol containing 0.1M
HCl.Extraction was continued with 20 mL portions of solvent until the sample became colorless.
Extracts were dilueted with acidified ethanol until 100 mL [1].
Spectrophotometry.The absorption was measured on spectrophotometer HALO-DB 20 at 544 nm.
Total anthocyanins amount were expressed as cyanidin-3-glucoside. Concentration of
anthocyanins (mmol/mL) was determined from the calibration curve and the concentration of
anthocyaninswas recalculated for 1 g of berries.
Results.In the present studywe evaluated totalanthocyanin content in V. oxycocco L. fruits from
different regions (n=10) of Lithuania. Highest value of total anthocyanin content (67.107 ± 0.103
mmol/g)was estimated in fruits from Veisiejų region, and lowest (33.511 ± 0.031 mmol/g) – from
Čepkelių region. The content of total anthocyanin differ significantly (at p<0.05) in all regions we
studied, except Dubičiai and Joniškis (p˃0.05).
Conclusion. Total anthocyanin content in Vaccinium oxycocco L. vary significantly depending on
the region of Lithuania, which would collect berries.
References: 1. P. Viskelis, M. Rubinskienė, I. Jasutienė, A. Šarkinas, R. Daubaras, L.
Česonienė.Journal of food science, 2009 ,74, C157-C161.
2. S. Zafra-Stone, T. Yasmin, M. Bagchi, A. Chatterjee, J. Vinson, D. Bagchi. Mol. Nutr.
Food Res. 2007, 51, 675 – 683.
ISSN 2335-8653
121
Isotope Ratio Mass Spectrometry Application in Food Authenticity Studies
Andrius Garbaras, Raminta Skipitytė, Matas Pocevičius and Vidmantas Remeikis
Center for Physical Sciences and Technology, Savanorių ave. 231, LT-02300 Lithuania
Correspondence to: garbaras@ar.fi.lt
Abstract
Stable isotope determinations have become valuable tools in authenticity control and origin
determination of food, food ingredients and beverages, especially fruit juices and wine, as well as
for the identification of the natural or synthetic origin of flavorings.
In this study, commercial fruit juices present on the Lithuanian market were investigated by means
of stable isotopes to check their correct labeling. In order to detect the sugar addition to
investigated fruit juices, δ13C values of whole juice, pulp and sugars were determined. Stable
isotope ratio mass spectroscopic measurements were performed on 30 randomly bought packed
juices with a different country origin. Separation of sugar was performed according to the ISO
method “PN-ENV 12140:2004 Fruit and vegetable juices – Determination of the stable carbon
isotope ratio (13C/12C) of sugars from fruit juices – Method using isotope ratio mass
spectrometry”, while pulp was separated from the fruit juice according to the method “PN-ENV
13070:2004 Fruit and vegetable juices – Determination of the stable carbon isotope ratio (13C/12C)
in the pulp of fruit juices – Method using isotope ratio mass spectrometry”.
The applicability of the stable isotope ratio mass spectrometry method and limitations for food
(juices, wine, dairy products) authenticity studies will be report during the presentation.
Keywords: Stable isotope ratio mass spectrometry, food, authenticity.
ISSN 2335-8653
122
Investigation of Antioxidant Activity in Medicinal Plants and Their Mixtures,
Identical to Commercial Teas, by Spectrophotometric and Chromatographic
Methods
Liudvika Juškaitė1, Vilma Kaškonienė1, Ona Ragažinskienė2
1Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, Kaunas, Lithuania; 2Kaunas Botanical
Garden of Vytautas Magnus University, Sector of Medicinal Plants, Ž. E. Žilibero str. 6, Kaunas, Lithuania
Abstract
There is a quite large number of science publications about various medicinal plants, their
antioxidant properties and biological activities, describing plants’ use for human health. These
articles characterize one or a few plants separately, but none of them try to evaluate how these
popular in daily life widely used plants act together. The purpose of this research was to evaluate
the total amounts of secondary metabolites in separate medicinal plants and their mixtures by
spectrophotometric methods and to carry out qualitative analysis by HPLC. Seven medicinal
plants were analysed: leaves of peppermint (Mentha piperita L.), lemon balm (Melissa officinalis
L.) and raspberry (Rubus idaeus L.), thyme (Thymus vulgaris L.) herb, blossoms of chamomile
(Matricaria recutita L.), seeds of caraway (Carum carvi L.) and rose hips (Rosa L.). All these
plants were grown in the Kaunas Botanical Garden of Vytautas Magnus University. The three
mixtures of plants were made parallel to the three Lithuanian commercial ETNO teas (JSC
Švenčionių Vaistažolės). Spectrophotometric assays (evaluating total phenolic compounds
content, total flavonoid content and antiradical activity) with separate medicinal plants showed
that the highest total amount of phenolic compounds was found in peppermint leaves (217.91 mg
rutin equivalents (RE)/g), the lowest – in the seeds of caraway (21.02 mg RE/g). The highest and
lowest total flavonoid contents were detected in peppermint and in rose hips, i.e., 87.65 and 0.77
mg RE/g, respectively. The highest radical scavenging activity was in the leaves of lemon balm
and peppermint (265.32 and 261.91 mg RE/g, respectively), while caraway seeds showed the
lowest activity (17.06 mg RE/g). All of the herbal mixtures showed the synergistic effect of
phenolic compounds, whereas the interaction of flavonoids was rather more antagonistic. The total
amounts of phenolic compounds and flavonoids in the three mixtures were as follows: ‘Nykštukų’
tea (rose hips 30%, caraway seeds 40 %, lemon balm 30%) – 108.34 and 9.06 mg RE/g,
respectively, ‘Aksominis vakaras’ (chamomile 30%, raspberry 10%, peppermint 60%) – 197.75
and 56.20 mg RE/g, respectively, ‘Šiltas prisiminimas’ (chamomile 40%, thyme 40%, peppermint
20%) – 154.79 and 39.53 mg RE/g, respectively.
Keywords: Antioxidant activity, phenolic compounds, flavonoids, radical scavenging activity,
synergism, antagonism
Acknowledgements
The study was financially supported by the Research Council of Lithuania. Project „Promotion of Students’ Scientific
Activities“ (grant No. PS-14-52).
ISSN 2335-8653
123
Formulation And Quality Evaluation Of Protective Lipstick With Oenothera
Biennis L. Oil
Ieva Kaminskienė, Zenona Kalvėnienė, Giedrė Kasparavičienė, Jurga Bernatonienė, Arūnas
Savickas
Department of Drug Technology and Social Pharmacy, Lithuanian University of Health Sciences, Eivenių str. 4,
Kaunas, Lithuania. E-mail address: ieva.paugyte@gmail.com
Abstract
The aim of this work was to design a lipstick with evening primrose oil (EPO) for daily
protection of the lips. The formulated lipsticks contained only natural compounds: evening
primrose oil, yellow beeswax, cacao butter, vitamin E (preservative), Tangerine essential oil
(fragrance), β-carotene (coloring agent). Design-Expert® 6.0 statistical modeling program was
used to design mixtures of ingredients for optimal lipstick composition. The physical properties -
pH value, melting point and hardness (texture analyzer) were evaluated. Water extracts of EPO
and produced lipsticks were tested for antioxidant activity using 2,2-diphenyl-1-picrylhydrazyl
(DPPH) antioxidant assay. Sensory analysis was performed with trained volunteers using
questionnaire survey.
The results of physical properties confirmed that all samples after production meet the
quality requirements. Sensory analysis showed that lipsticks’ qualities, such as spreadability,
hardness, residual layer, etc., were highly dependent on the balance between oils and waxes.
Therefore approximately 45-55% of base should consist of hard waxes in order to maintain
suitable texture. Although sensory analysis and antioxidant assay has shown that composition of
lipstick, containing the biggest amount of evening primrose oil (76.21%) had the best features as
well as the greatest antioxidant activity (24,84 ± 1,37%).
Based on the analysis of the results of textural, organoleptic and other quality
characteristics, the following composition of organic lipstick was chosen: Evening primrose oil
54,0 %, Beeswax 25,0 %, Cacao butter 25,0 %, Vitamin E 1,0 %, β-carotene, Tangerine essential
oil. Physical quality parameters were: pH value 5.94, melting point 59,77 C, hardness – power for
penetration 75,09 g/s. According to the obtained stability test results, the designed lipstick’s
quality remained appropriate at least six month after production at room temperature 252°C
temperature.
ISSN 2335-8653
124
The Application Of Chemometric Techniques For The Classification Of Bee
Products: A Review
Vilma Kaškonienė
Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, Kaunas, Lithuania,
v.kaskoniene@gmf.vdu.lt
Abstract
The chemometric techniques are used for the classification of the samples to the groups. The
classification may be unpredictable (when samples are grouped according to some specific
parameters) and predictable (when the dependence of the sample to some specific (already known)
group is tested). The hierarchical cluster analysis, principal component analysis, linear
discriminant analysis are the most popular in classification of food samples, including bee
products. However other tests, like artificial neural networks, partial least squares or partial least
squares discriminant analysis, canonical variate analysis, soft independent modelling class
analogy, and etc., are applied.
As composition of bee products is enough rich in diversity of chemical compounds, the various
factors are used for the classification of the samples: carbohydrates composition, amino acids
content and composition, volatile compounds composition, phenolic compounds and flavonoids
content and composition, mineral composition. Chemometric classification of bee products can be
based not only chemical composition, but also on other characteristics, like antiradical activity,
DNR composition, electrical conductivity, optical rotation, antibacterial activity, and etc.
Keywords: Bee products, classification, chemometric methods
ISSN 2335-8653
125
Variation Of Phenolic Compounds In Buckwheat Grain At Different Growth
Stages
Ilona Kerienė1, Audronė Mankevičenė1, Saulius Bliznikas2, Rūta Česnulevičienė1
1Lithuanian Research Centre for Agriculture and Forestry, Akademija, Lithuania 2Institute of Animal Science, Lithuanian University of Health Sciences, Baisogala, Lithuania
E-mail: ilona.keriene@gmail.com
Abstract
Buckwheat (Fagopyrum esculentum Moench) is a good source of health-benefiting phenols
whose amount depends on their chemical composition and environmental conditions. The current
research was aimed to quantify and identify the phenolic compounds in buckwheat grain at
different growth stages and to compare the results between the years 2013 and 2014. Lithuania-
grown buckwheat grains were examined for total phenolics, rutin and quercetin contents. Six
phenolic acids (p-hydroxybenzoic, 3,4-dihydroxybenzoic (3,4-DHBA), p-coumaric, ferulic,
vanillic and sinapic) were quantified and identified. The two growth stages were selected
according to the BBCH scale: 87 (ripening of grain) and 99 (harvested product) [1].
Our results showed that the highest concentrations of the total phenolic content, rutin and
quercetin were accumulated in the grain during ripening stage (BBCH 87) in 2013. The
concentrations of the analysed compounds in harvested grain (BBCH 99) were lower: the total
phenolic content by 16 %, the concentration of rutin by 20 % and quercetin content by up to 4-
fold. In 2014, the concentrations of these compounds declined compared with those in 2013
during the same ripening stage (87). The concentrations of phenolic compounds were similar to
those in harvested grain in 2013. Although it is known that the highest concentrations of phenolic
compounds are accumulated by cereals during flowering and ripening stages, the comparative
analysis showed that the concentrations of some phenolic compounds significantly increased in
harvested buckwheat grain in 2014, especially the content of rutin by 36 %. Analysis of phenolic
acids indicates that hydroxibenzoic acids predominated in buckwheat grain and together accounted
for 81 % of the total phenolic acids content, irrespective of the year and growth stage. The lowest
concentration was determined of vanillic acid, while the variation of other phenolic acids was
inconsistent. Among the phenolic acids tested, the highest variation was established for 3,4-
DHBA, whose amounts were 20 % higher in harvested grain than in ripening grain in 2014.
However, the total content of six phenolic acids remained similar ~84.00 µg g-1 during both test
years.
We think that the weather conditions might have affected phenolic compounds accumulation in
buckwheat grain. In 2013, the concentrations of these compounds were higher than in 2014 when
adverse weather conditions (shortage of moisture, especially in July) prevailed during grain
ripening stage, because of which plants grew slowly and inflorescences wilted. In August, the rate
of rainfall was 70 % higher than the long-term mean (180 mm) and the peak of phenolic
compounds synthesis determined higher concentration of phenolic compounds in harvested grain
than in ripening grain.
Keywords: Buckwheat grain, phenolic compounds, ripening stage.
References [1] Meier, U. (Ed.), 2001, Growth stages of mono- and dicotyledonous plants, 2th ed. BBCH Monograph, Federal
Biological Research Centre for Agriculture and Forestry, pp. 14 – 18.
ISSN 2335-8653
126
Impact Of L. Sakei On Dairy Cattle Production And Ruminal
Processes
Vita Krungleviciute1, Elena Bartkiene1, Rasa Zelvyte1, Igrida Monkeviciene1, Jone
Kantautaite1, Rolandas Stankevicius1, Grazina Juodeikiene2
1 Lithuanian University of Health Sciences, Tilzes str. 18, 47181 Kaunas, Lithuania 2 Kaunas University of Technology, Radvilenu str. 19, 50254 Kaunas, Lithuania Corresponding author: vitakrungleviciute@gmail.com
Lactic acid bacteria (LAB) including bacteriocin-like inhibitory substances (BLIS) producing
strains are generally recognized as safe [1]. Because of their antimicrobial effect, BLIS, or their
producing compounds, have a potential to be used as modifiers of the ecosystem in the
gastrointestinal tract [2] and stimulators of animal production [3].
The aim of the study was to evaluate the influence of BLIS producing Lactobacillus sakei
KTU05-6 on production and ruminal processes of dairy cattle. The supplement given to dairy
cattles was tested to determine the milk yield and composition, the activity of ruminal
fermentation and the microorganisms content. The experiment was performed in the winter period
at the farm of Black & White Holstein dairy cattle. Trial and control groups received identical
diet; however, during 65 days, the trial group received additionally 100 g of the supplement per
cow daily (1011 colony-forming units (CFU) of L. sakei/cow/day).
It was found that at the end of the experiment there were no significant differences in milk
yield and content of milk fat, protein, lactose and urea between the trial group and the control
group (p>0.05). At the end of the experiment, ruminal pH, total and individual volatile fatty acids,
total nitrogen, ammonia nitrogen, D(-)-lactic acid, reduction activity of bacteria, glucose
fermentation reaction, protozoa number, total count of lactobacilli and enterobacteria in the trial
group had no significant difference (p>0.05) from those characteristics in the control group. In the
trial group at the beginning of the experiment L(+)-lactic acid and total count of aerobic and
facultative anaerobic microorganisms (TCM) were different (TCM in the trial group increased by
1.25 log CFU/mL (p<0.05) in compare to the control group).
We conclude that 1011 CFU/cow/day of Lactobacillus sakei KTU05-6 may not be beneficial as
probiotic bacteria for dairy cows, as the assumed positive effects on the milk yield and milk
composition, on the activity of the ruminal fermentation and microorganisms of rumen fluid were
not observed in the animals tested.
Keywords dairy cattle, Lactobacillus sakei, milk, ruminal fermentation, rumen microorganisms.
References: [1] Mayo B., Aleksandrzak-Piekarczyk T., Fernandez M., Kowalczyk M., Alvarez-Martin P., Bardowski, J. Updates
in the metabolism of lactic acid bacteria. Biotechnology of lactic acid bacteria: Novel applications. Wiley-Blackwell,
Iowa. 2010. P. 3–33.
[2] Seo J. K., Kim S.-W., Kim M. H., Upadhaya S. D., Kam D. K., Ha J. K. Direct-fed Microbials for Ruminant
Animals. Asian-Australasian Journal of Animal Sciences. 2010. Vol. 23. P. 1657–1667.
[3] Yasuda K., Hashikawa S., Sakamoto H., Tomita Y., Shibata S., Fukata T. A new synbiotic consisting of
Lactobacillus casei subsp. casei and dextran improves milk production in Holstein dairy cows. Journal of Veterinary
Medical Science. 2007. 69. P. 205–208.
ISSN 2335-8653
127
Development And Evaluation Of Herbal Cosmeceutical For Skin
Care
Akash S Mali1, P Karekar*, Y Gurav*, Dr Yadav A*
Akash S Mali
Gourishankar Institute Of Pharmaceuical Education And Research Satara, Maharashtra ,India.
E-mail –Akash-Shivling.Mali@fc.vdu.lt
Abstract
Herbal cosmetics are the preparations used to enhance the human appearance. The aim of the
present research was to formulate the herbal Cream for the purpose of moistening ,nourishing ,
lightening, & treatment of various diseases of the skin. Different crude drugs; Aloe barbadensis
(Aloe vera-leaves), Ocimum sanctum (Tulsi-leaves),Azadirachta indica (Neem-leaves),Curcuma
longa (Turmeric- rhizomes),Cedro oil(Lemon peel),Myristica fragrans(Nutmeg seeds),Olium
rosae(Rose oil), Orange oil,Prunus dulcis(Almond oil)were taken. Accelerated stability testing of
two final sample has been conducted in the environmental chamber with temperature 25 ± 10C
and humidity 60 ± 10% RH. All the products were found to be stable with no sign of phase
separation and no change in the color. The patch test for sensitivity testing has also been done and
no evidence of skin irritation and allergic signs. The concept of beauty and cosmetics is as ancient
as mankind and civilization. Indian herbs and its significance are popular worldwide. An herbal
cosmetic have growing demand in the world market and is an invaluable gift of nature. Herbal
formulations always have attracted considerable attention because of their good activity and
comparatively lesser or nil side effects with synthetic drugs. Herbal cosmetics are defined as the
beauty products which posses desirable physiological activity such as healing, smoothing
appearance, enhancing and conditioning properties because of herbal ingredient. The work mainly
focuses on the assessment of the microbial quality of Formulated cosmetic preparations. To the
surprise, Both formulation was found to comply with the microbial limit tests as per the
international specifications. Thus herbal cosmetics formulation are safe to use was proved.
Keywords: Cosmetics, Herbal Cream, Formulation, API, Microbiological test.
References should be listed as below:
1. Kapoor V.P, Journal of Research in Pharmaceutical Sciences. Natural product
radiance, 4(4): 306-314, (2005).
2. Sahu Alakh N, Jha S B and Dubey S D,Formulation & evaluation of curcuminoid
based herbal face cream. Indo-Global Journal Of Pharmaceutical Sciences, 1: 77-
84, (2011).
ISSN 2335-8653
128
Antioxidant Activity Of Solidago L. Using HPLC- Cupric Reducing
Antioxidant Capacity (CUPRAC) Assay With Post-Column Detection
Mindaugas Marksa1, Justas Mačinskas1, Jolita Radušienė2, Liudas Ivanauskas1, Valdas
Jakštas3
1Department of Analytical and Toxicological Chemistry, Lithuanian University of Health Sciences, Eivenių 4, 50161,
Kaunas, Lithuania
2Nature Research Centre, Institute of Botany, Akademijos 2, 08412 Vilnius, Lithuania
3Medical Academy of Lithuanian University of Health Sciences, Department of Pharmacognosy, Lithuanian
University of Health Sciences, Eivenių 4, 50161, Kaunas, Lithuania
Introduction. Phenolic compounds are natural antioxidants, which are abundant in plants of
Solidago L. Studies have shown that flavonoids in this type of plants are the main phenolic
compounds that determine the pharmacological activity as an antioxidant and free radical
scavenging effects [1,2]. The aim of our study – to evaluate antioxidant activity in leaves and
flowers of Solidago L. by HPLC- cupric reducing antioxidant capacity (CUPRAC) method with
post-column detection.
Materials and methods. Leaves and flowers of Solidago canadensis L., Solidago gigantea L. and
Solidago virgaurea L. were collected in different places of Lithuania and dried at 25 °C.
Extraction. 0.1 g of air-dried S. canadensis, S. gigantea and S. virgaurea leafs and flowers were
extracted with 10 mL of methanol water mixture (70:30 v/v) by ultra-sonication at 25 °C for 50
min. The prepared extracts were passed through a 0.22 µm filter.
HPLC-CUPRAC method. CUPRAC post - column HPLC analysis was performed with Waters
Alliance 2695 separation module system equipped with Waters 996 PDA and Waters 2487
UV/VIS detectors. Chromatographic fractionation of active agents was carried out with 4.6×150
mm, 3 µm YMC column (injection volume – 10 µL, elution flow rate – 1.0 mL/min). The mobile
phase of gradient elution system consisted of 0.05% aqueous trifluoroacetic acid (solvent A) and
acetonitrile (solvent B). The following elution profile was used: 0 min. – 95% of solvent A and
5% of solvent B, 5 min. – 88% A and 12% B, 50 min. – 70% A and 30% B, 51 min. – 10% A and
90% B, 56 min. – 10% A and 90% B, 57 min. – 95% A and 5% B. Best results of Solidago L.
herbal extracts’ antioxidant activity were achieved while using 10 m length PTFE coil (OD 1.58
mm, ID 0.25 mm) with 50 oC temperature maintained (the flow rate of CUPRAC solution was 0.4
ml/min, absorption was measured at 450 nm). Antioxidant activity was expressed as Trolox
equivalent (TEAC).
Results. We evaluated total antioxidant reducing activity of tested compounds in flowers and
leaves of Solidago L. Strongest antioxidant properties showed leaves (37.73 ± 33.05 mg/g) and
flowers (16.39 ± 7.94 mg/g) of S. gigantea. We compared TEAC values of all tested five phenolic
compounds in leaves and in flowers. The largest TEAC of rutin (32.39 ± 12.65 mg/g) were
observed in leaves of S. virgaurea, whereas TEAC of chlorogenic acid (63.38 ± 30.97 mg/g),
quercitrin (83.83 ± 45.19 mg/g), isoquercitrin (7.50 ± 3.60 mg/g) and hyperozide (5.28 ± 3.37
mg/g) – in leaves of S. gigantea. Similar results were seen in samples of flowers. The largest
TEAC of rutin (26.88 ± 19.79 mg/g) and chlorogenic acid (16.22 ± 4.35 mg/g) were observed in
S. canadensis, whereas TEAC of quercitrin (27.86 ± 21.79 mg/g), isoquercitrin (9.09 ± 3.57 mg/g)
and hyperozide (20.75 ± 11.55 mg/g) – in S. gigantea.
Conclusions. Strongest antioxidant properties showed leaves and flowers of S. gigantea.
ISSN 2335-8653
129
Moisture And Short-Term UV-B Radiation Effect On Nitrate And
Photosynthesis In Spinacia Oleracea
Ingrida Odminytė1, Akvilė Viršilė2, Sandra Sakalauskienė2 1Vytautas Magnus University, Vileikos 8-212, Kaunas, Lithuania 2Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry Kauno street 30, LT-54333,
Babtai, Kaunas distr., Lithuania
ingridaodminyte@gmail.com
AbstractThe objective of this study was to evaluate the effects of substrate moisture and short-
term UV-B irradiation on spinach’s (Spinacia oleracea) nitrate ion assimilation and
photosynthesis intensity. Experiment was conducted in growth chambers of controlled
environment at the Institute of Horticulture, Lithuanian Research Centre for Agriculture and
Forestry. Three separate chambers (24 m2each) were used for the study. Seeds of spinach plant
were sown in120 ml vessels (one seed per vessel) in peat substrate (Durpeta, Lithuania). Plants
were placed at 18/13⁰C day/night thermo period and 12/12h day/night photoperiod. High pressure
sodium lamps (SON-T Agro, Philips) were used for illumination (photon flux density 150 µ mol
m-2 s-1). Plants were grown in those conditions 21 days before the experiment started. Plants were
grown in peat substrate at two moisture regimes: well watered (̴ 40 %) and mild water deficiency (̴
25 %) substrate moisture. After 7 days effect of substrate moisture plants were exposed to 0 kJm-
2day-1, 1 kJm-2day-1 and 2 kJm-2 day-1 UV-B for 1 day. The results showed that UV-B radiation,
independently of dosage, resulted in decrease of nitrate ion content in spinaches grown in well-
watered substrate. When spinaches were exposed to1 kJm-2day-1 UV-B radiation, nitrate ion
content determined 1.58 times lower and when plants were exposed to 2 kJm-2day-1 – it was 1.42
times lower as compared to UV-B untreated plants. Statistically reliable effect of UV-B dosage on
nitrate ion content in plants grown in mild water deficiency was not identified. Photosynthesis
intensity also decreases under UV-B exposure in spinaches grown in both moisture conditions.
Plants affected by UV-B radiation and grown in well-watered substrate showed significantly lower
photosynthesis intensity decrease. It was 1.08 times lower in plants exposed to 1 kJm-2day-1 UV-B
radiation and 1.22 times lower in plants exposed to 2 kJm-2 day-1 UV-B radiations. Photosynthesis
intensity in spinaches grown in water deficiency was determined 6.16 times lower in plants
exposed to 1 kJm-2day-1 UV-B radiation. In plants, grown in water deficiency and exposed to 2
kJm-2day-1 UV-B radiation photosynthesis intensity values were negative and respiration processes
occurred. Experiment showed that photosynthesis processes in plants, cultivated under water
deficiency, are more sensitive to UV-B exposure. Nitrate contents in spinach leaves are associated
to measured photosynthesis intensity and managing water regime and UV-B exposure nitrate ion
contents might be significantly reduced in spinach plants, thus promoting its nutritional value.
Keywords: nitrate ion, photosynthesis intensity, UV-B radiation, light flux, moisture
ACKNOWLEDGEMENTS. This research was supplementary funded by the Research Council of
Lithuania under the project “Promotion of Students’ Scientific Activities”.
ISSN 2335-8653
130
Effect Of Commercial Starter Cultures On Physicochemical
Characteristics, Microbial And Biogenic Amines Counts Composition
Of Fresh Pork Sausage
Anita Rokaityte1*, Gintare Zaborskiene1
1 Department of Food Safety and Quality of the Veterinary Faculty of
Lithuanian University of Health Sciences, Tilžės st. 18, Kaunas, LT-47181, Lithuania
*Anita.Rokaityte@lsmuni.lt
The need for high-quality safe products has resulted in the use of starter cultures for the
production of fresh pork sausages. The aim of this work was to evaluate the effect of commercial
starter cultures (Pediococcus pentosaceus, Staphylococcus xylosus, Leuconostoc carnosum) on the
physicochemical properties, microbiological and biogenic amines counts composition during 9
days at a temperature of 4±0.5 °C.
Microbial counts revealed that, although initial counts of Escherichia coli were similar in all
samples with (1.65 log CFU/g), this microbial group exhibited a strong decrease during the
storage of inoculated sausages, and have completely destroyed the count of E. coli after 9 days,
whereas the counts of E. coli in the control sausages were 1.24 log CFU/g at the end of the
storage. In the inoculated sausages with P. pentosaceus, S. xylosus have reduced the count of yeast
and mold from 4.46 log CFU/g to 5.54 log CFU/g (p≤0.05) compared to control sample. In
general, physicochemical parameters were not affected by the use of starter cultures, but by the
storage time, with the exception of pH values, since the inoculation of starter cultures resulted in a
stronger acidification. After 9 days of storage the level of pH in the inoculated sausages with P.
pentosaceus and S. xylosus was lower by 4.57 compared to control sample 5.64 (p≤0.05). Finally,
Pearson’s correlation was established between decreased values of E. coli, yeast and mold count
and pH (p<0.01). Also, statistical analysis revealed that biogenic amines count was not
significantly affected by starter cultures and it was far below the levels causing any health risk.
In conclusion, it seems that the inclusion of starter cultures contributes to improve the
hygienic quality of fresh pork sausages without significant effect on biogenic amines count,
texture and appearance.
Keywords: Sausages, Pediococcus pentosaceus, Staphylococcus xylosus, Leuconostoc
carnosum.
ISSN 2335-8653
131
Analysis Of Micro- And Macro- Elements Of Lupine Seeds Bred In Lithaunia
By Using Inductively Coupled Plasma Mass Spectrometry (ICP-MS)
Vytaute Starkute1, Elena Bartkiene1, Vadims Bartkevic2, Zita Maknickiene3, Grazina
Juodeikiene4
1Lithuanian University of Health Science, Tilzes str. 18, Kaunas, Lithuania , 2Latvia University of Centre Food
Chemistry, Kr. Valdemara str. 48, Riga, Latvia, 3Lithuanian Institute of Agriculture, Voke Branch, Zalioji a. 2,
Vilnius, Lithuania, 4 Kaunas University of Technology, Radvilenu pl. 19, Kaunas, Lithuania
Corresponding author: vytaute.starkute@gmail.com
Abstract
Essential elements are classified as macronutrients (N, P, K, Ca, Mg, S) and micronutrients
(Fe, Cu, Mn, Zn, B, Mo, Ni and Cl) and the classification is based on the relative abundance in
plants. From the knowledge of the concentration of the most important nutrients, it is possible to
define a strategy to correct for deficiencies, if present, that will limit the production and/or the
quality of plant materials (Gomes, 2014). Foliar nutrient analysis is a useful diagnostic tool to
complement soil testing as a best-management practice with plants (Mengel, 2001). Heavy metals
and metalloids represent a series of environmental hazards worldwide (Ehsan, 2015). The
accumulation of heavy metals in plants is related to the concentration and chemical fractions of the
metals in soils (Ehsan, 2007).
The aim of our study was to evaluate micro- and macro- elements of lupine seeds bred in
Lithaunia by using inductively coupled plasma mass spectrometry (ICP-MS).
It was found that the highest content of calcium, natrium, magnesium was found in the
lupine seeds No. 1072 (1.65%; 1.1%; 2.14%, respectively) and No. 1800 (2.04%; 1.1%; 2.44%,
respectively). The highest content of micro- elements (Fe, Mn, Cu, Zn) was found in lupine seeds
Vilciai (73.5%; 147.6%; 8.06%; 59.8%, respectively) and seeds No. 1734 (63.5%; 118.83%; 6.4%;
45.1%, respectively). The lowest content of micro- elements (Al, Ni, Ga, Sn) which has a negative
impact on health was obtained in seeds No. 1734 (6.26%; 1.94%; 0.62%; 28.49%; 4.87%,
respectively), the lowest content of As, Cd, Sb was obatained in lupine seeds Vilciai (0.03%;
0.37%; 0.03%, respectively).
Received results are very important and would complement the database about chemical
composition of new varieties of lupine seeds, and this is the first step of the lupine potential
application.
Keywords: microelements, macroelements, lupin seed, ICP-MS
References:
[1] Gomez M. S., Schenk E. R., Santos D., Krug F. J., Almirall J. R. Laser ablation inductively coupled plasma optical
emission spectrometry for analysis of pellets of plant materials // J. Spectrochimica Acta partB: Atomic Spectroscopy.
2014, Vol. 94-95, P. 27-33.
[2] Mengel K., Kirkby E. A., Kosegarten H., Appel T. Further elements of importance // Principles of plant nutrition.
2001, P, 639-655.
[3] Ehsan M., Viveros L. F. M., Hernandez V. E., Barakat M. A., Ortega A. R., Maza A. V., Monter J. V. Zinc and
cadmium accumulation by Lupinus uncinatus Schldl. grown in nutrient solution // Int. J. Envirion. Sci. Technol. 2015,
Vol. 12, P. 307-316.
ISSN 2335-8653
132
Food Supplement Legislation In The Eurasian Economic Union
Natalia Tsemborevitch1, Ekaterina Fedorenko
Scientific-Practical Center of Hygiene, Minsk, Belarus, 1tse.natasha@yandex.ru
Abstract
Preserving and improving health is among the basic needs of modern society. The past
several decades have been marked by explosive growth in technologies aimed at preventing
ailments, including nutrition-related diseases. Numerous studies in nutrition science, as well as a
better understanding of the role played by biologically active substances in preventing the
development of diseases, have advanced the food supplement industry. The Eurasian Economic
Union member states continue to perfect the joint legislative framework regulating the safety,
market access, and circulation requirements for food supplements. The article discusses these
requirements as compared to equivalent EU legislation.
There is a consensus that food supplements are foods, and that they contain nutrients and
biologically active substances. The EU legislation is clear that food supplements are intended for
supplementing the normal diet, and that they are released into circulation in a variety of dosage
forms. The Eurasian Economic Union legislation does not provide for such a clear definition.
The definition contained in the relevant Eurasian Economic Union technical regulation
indicates the possibility of food supplements containing natural and nature-identical nutrients and
other substances that have nutritional or physiological effects. Also, according to Eurasian
Economic Union requirements, the food supplement category includes substances used in the
manufacture of foods for special use or for enrichment purposes, as well as probiotic
microorganisms.
In the materials is said about the terminology, classification, general approaches to the food
supplement regulation and market access rules in the Eurasian Economic Union, and also the key
requirements for the ingredients used in food supplements.
There are requirements for foods in general and for food supplements in particular both at
the Eurasian Economic Union level and at the national level. The requirements contained in
Eurasian Economic Union technical regulations apply at the market entry stage, while the
national requirements are used when approving specific labelling inscriptions, regulating the
circulation of food supplements, and conducting overall market oversight.
In the materials are considered specific labelling and advertising requirements which are
regulated at the national law of the Eurasian Economic Union member states, supply several
examples of food supplement appraisals, touch upon potential certification problems and their
possible solutions.
Keywords: food supplement, legislation, requirements, biologically active substances, safety,
market access, labelling.
ISSN 2335-8653
133
Optimisation of Supercritical CO2 Extraction of Lycopene from Red Tomato
D. Urbonavičienė1,2, R. Bobinaitė1, J. Viškelis1, Č. Bobinas1, P. Viškelis1
1 Biochemistry and technology laboratory, Institute of Horticulture, Lithuania Research Centre for Agriculture and
Forestry, Kaunas st. 30, Babtai, Kaunas distr., Lithuania 2Department of Food Science and Technology, Faculty of
Chemical technology, Kaunas University of Technology, Radvilenu, Kaunas, Lithuania
dalia.urbonaviciene@ktu.edu
Abstract
The supercritical fluid extraction work on tomato has been driven by the interest and opportunity
to exploit these residues as a source of lycopene. Lycopene is a carotenoid with red color that can
be applied as the food additive, cosmetic and pharmaceutical industries. In addition lycopene
exhibits antioxidant features and some studies suggest this molecule is linked to anti-carcinogenic
and anti-atherogenic effects [1,2].
The aim of this study was to optimize parameters for supercritical CO2 extraction of lycopene
from freeze dried red tomato pulp with skin. Response surface methodology using the central
composite rotatetable design (CCRD) model was used. The total lycopene in the extracts was
analysed by the reversed–phase HPLC method using a C30 column, with photodiode array
detector. The CCRD consisting of three-factored factorial design with two levels was used in this
study. The factors used were temperature of the extraction chamber (40 80 °C), pressure of the
extraction fluid (200 550 bar) and duration (120 240 min). Coefficient of determination and
the standard errors results from the analysis of variance have shown the model to be adequate. The
linear and quadratic were 0.41 and 0.32, respectively. The independent variables have
significantly (p < 0.05) influenced the extraction of total lycopene from tomato. A second-degree
polynomial equation was developed from a response surface analysis for total lycopene yield and
the highest yield was predicted at 60 °C, 55 MPa (550 bar).
Keywords: lycopene, supercritical fluid extraction, optimization.
References: [1] A.F. Silva, de Melo M. M., C.M. Silva, J Supercrit. Fluids, 2014, 95, 618-627.
[2] J. S.J. Shi, Y. Xue, Ye.X. Jiang, S.S.H. Rizvi, 2010, 619-645.
Acknowledgement. This work was partly supported by a grant from the Research Council of
Lithuania, No. MIP-62/2015.
ISSN 2335-8653
134
Hop as an Important Source of Phytomedicinally Active Compounds
Eva Ürgeová, Natália Fehérová, Ivana Pšenáková
Faculty of Natural Sciences, University of SS. Cyril and Methodius, J. Herdu 2, Trnava, SK-917 01, Slovak
Republic, e-mail: eva.urgeova@ucm.sk
Abstract
Common hop is an agricultural crop known primarily for its use in the brewing industry.
Currently, however, chemical compounds with different biological activities have been found in
hops. In the paper, we focused on the determination of biologically active secondary metabolites
in wild hops collected from Slovakia. The objects of research were leaves and female cones of 46
genotypes. The analysis of wild hop confirmed the difference in the total content of polyphenols,
flavonoids between genotypes. The leaves showed concentration of polyphenols from 1.7 to 10.8
mg/g dry weight. Similarly variability was detected in the flavonoids content of leaves, ranging
from 0.6 to 3.9 mg/g dry weight. The polyphenol and flavonoid content in cones was higher than
in leaves reaching 23.7 mg/g dry weight in case of polyphenols and 5.5 mg/g dry weight in case of
flavonoids, respectively.
Keywords: wild hop, polyphenols, flavonoids
Acknowledgement: This work was financially supported within the grants VEGA 1/0635/13
ISSN 2335-8653
135
Optimisation of Water Extraction of Medicinal Herbal Tea of Birch Leaves
Using Response Surface Method
Vytenis Venclovavičius, Agnė Birštonaitė, Raimondas Raudonis
DepartmentofPharmacognosy, Lithuanian University of Health Sciences, Eivenių 4, 50161, Kaunas, Lithuania
vytenislt@gmail.com
Abstract
European Pharmacopoeia defines medicinal raw material of birch trees as dried leaves of Betula
pendula Roth. and Betula pubescens Ehrh. Leaves contain not less than 1.5 % of flavonoids in the
form of hyperoside [1]. Various birch leave preparations are used for urinary tract disorders,
various infections and inflammations, joints’ diseases – arthritis, osteoarthritis due to antioxidant
activity, antihistamine and anti-bacterial characteristics [1, 2]. All these pharmacological effects
depend on phenolic acids and flavonoids [1].
The aim of the research was to determine the optimal extraction temperature, time and degree of
leaves grinding (size of fraction) on yields of bioactive compounds. The tea of birch leaves has
been divided into 7 fractions of different sizes. The aim was to optimize the extraction of phenolic
compounds with water using response surface method and quantify the groups of the extracted
compounds. The ANOVA analysis was used for the evaluation of constructed model.
It was determined that the optimal temperature to extract the maximum amount of phenolic
compounds is 100 ºC and 45 minutes. The amount of extracted total phenolic compounds,
flavonoids, proanthocyanidins has been increasing up to 45 minute. The longer extraction gave no
significant increments (p<0.05).The size of the particles did not influence the amount of phenolic
compounds, flavonoids, proanthocyanidins obtained in the process of extraction.
On the average, the maximum amount of phenolic compounds has been determined after 45 min
in all fractions – 41.72 ± 2.86 GAE mg/g. The smallest amount of flavonoids has been detected in
< 0.9 mm fraction – around 10 mg/g. The amount of flavonoids in other fractions showed no
significant differences and varied from 16 to 22 mg/g. The amount of proanthocyanidins
determined in all fractions– was in arrange of 2.5–4.5 mg/g. Optimal determined conditions for
maximal extraction of phenolics could be relevant to producers and consumers.
Keywords: Birch leaves, phenolic compounds, Betula.
References:
1. EMA, Betula pendula Roth; Betula pubescens Ehrh., folium 2008.
Grundemann C, Gruber CW, Hertrampf A, Zehl M, Kopp B, Huber R.,Anaqueous birch leaf extract of Betula pendula
inhibits the growth and cell division of inflammatory lymphocytes, J Ethnopharmacol. 2011; 136:444–451
ISSN 2335-8653
136
Phytochemical Analysis Of Bidens Tripartita L. Using Spectrophotometric And
Liquid Chromatographic Methods
Gintarė Naujokaitytė1, Audrius Sigitas Maruška1, Ona Ragažinskienė2
1Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, Kaunas, Lithuania; 2Kaunas Botanical
Garden of Vytautas Magnus University, Sector of Medicinal Plants, Ž. E. Žilibero str. 6, Kaunas, Lithuania
Abstract
In medicinal plants are found biologically active chemical compounds: alkaloids, flavonoids,
glycosides, tannins, saponins, phenols, essential oils etc. These compounds are known as
secondary metabolites. that plants accumulate mainly phenolic. Bidens tripartita L. was selected
as phytochemical investigation object. It belongs to the family of Asteraceae, Bidens L. genus. It
accumulates mainly essential oils and phenoloc compounds. In this research work phenolic
compounds present in Bidens tripartita L. were analysed spectrophotometrically and using HPLC.
Radical scavenging activity of rhe extracts of this plant were evaluated. Bidens tripartita L. was
grown in VMU Kaunas Botanical Garden. The raw material was collected at different vegetation
phases, bud formation, flowering, massive flowering and in the end of flowering. The raw material
is dried at 20 – 25 ° C in a well–ventilated and direct sunlight protected place. Loss of weight was
determined according to requirements of the European Pharmacopoeia (2006). Phenolic
compounds (2012 year plant material) was analysed spectrophotometrically using the Folin –
Ciocalteu reagent. The highest amounts of phenolic compounds were determined during the
intensive plant growth phenological phase (162.5 mgRE/g) and the lowest – at the end of
flowering (32.3 mgRE/g). The bigest amounts of flavonoids in the plant was also in phase of
intensive growth (94.5 mgRE/g) and the lowest – in the end of flowering (20.9 mgRE/g). The
highest free radical scavenging activity was in the end of flowering (145.5 mgRE/g) and the
lowest activity in intensive growth phase (93.7 mgRE/g). Plant material, collected in 2014 year
was also analyzed. The content of phenolic compounds was highest during the intensive growth
period (123.1mgRE/g) and the lowest during the intensive flowering (62.7 mgRE/g). Flavonoid
contents in all periods of growth were similar (ca. 34.2 mgRE/g). During the intensive flowering
the highest activity of free radical scavenging was determined (86.1 mgRE/g). Analyzing raw
material of Bidens tripartita L. with liquid chromotography with the reaction detector (HPLC –
RD), severalphenolic compounds have been identified, namely: vanillic acid, trans–2–
hydroxycinammic acid, hesperidin, catechin, chlorogenic acid, epicatechin, ferulic acid, quercetin
dihydrate, rutin.
Keywords: Bidens tripartita L., radical scavenging activity, phenolic compounds, flavonoids,
liquid chromatography
ISSN 2335-8653
137
Influence Of Different Extraction Methods Of Rosmarinic Acids Yield From
Origanum Vulgare L. Herb
Justė Baranauskaitė*a, Jurga Bernatonienėa, Rūta Marksienėb aDepartment of Drugs Technology and Social Pharmacy, Lithuanian University of Health Sciences, Medical academy,
Kaunas LT-50161, Lithuania;
bDepartment of analytical and toxicological chemistry , Lithuanian University of Health Sciences, Medical academy,
Kaunas LT-50161, Lithuania.
*Corresponding author: baranauskaite.juste@gamail.com
Oregano (Origanum vulgare L., fam. Lamiaceae), is perennial, aromatic plant of 20-80 cm height (1).
Rosmarinic acid (RA) has a number of interesting biological activities such as antiviral, antibacterial and
antioxidant (2).
The aim of this study was to evaluate the impacts of different extraction methods of RA yields from
oregano herb.
Ethanolic oregano extracts were made by ultrasound-assisted extraction, heated reflux extraction, stirring
extraction and maceration. The amount of RA was determined by HPLC. HPLC analysis was carried out on
a Waters Alliance 2695 separation module system equipped with Waters 996 PDA detector. For
determination of RA the ACE 5 C18 250×4.6 mm (Advanced Chromatography Technologies, Aberdeen,
Scotland) column was used. The mobile phase consisted of solvent A (methanol) and solvent B (0.5 %
(v/v) acetic acid in water). The linear gradient elution profile was as follows: 95%A/5%B 0 min,
40%A/60%B 40 min, 10%A/90%B 41-55 min, 95%A/5%B 56 min. The flow rate was 1ml/min and
injection volume was 10µl. Absorption was measured at 329 nm. Data analysis was performed using
ANOVA statistical analysis package, using parametric and nonparametric methods for the analysis.
The amount of RA varied depending on different ethanol concentration in extracts prepared by ultrasound
extraction. The highest yield of RA are extracted with 50% - 70% ethanol respectively, 6,442±0,003 mg/g,
6,221±0,002 mg/g, 5,837±0,002 mg/g. The lowest content of RA is determined with 96% ethanol –
1,439±0,004 mg/g (p<0.05 vs 30-90% ethanol concentrations). The most effective extraction method is
heated reflux extraction, yield of RA extracted by this method is – 9,393 ± 0,001 mg/g (p<0.05 vs stirring
extraction and maceration). Unfortunately, long-term extraction method such as maceration gives the
significantly lowest yield of RA.
In order to extract the highest amount of RA of oregano herb is important ethanol concentration and
extraction method. The best results can be achieved using 50 – 70% ethanol concentration and heated
reflux extraction.
Keywords: Oregano herb, rosmarinic acid, HPLC.
ISSN 2335-8653
138
Comparison of Different Extraction Methods and Influence of Extraction
Conditions on the Total Phenolic Content and Antioxidant Activity of
Rosemary Extracts
Ugnė Čižauskaitė1, Jurga Bernatonienė1
1 Department of Drugs Technology and Social Pharmacy, Lithuanian University of Health Sciences, Medical
academy, Kaunas LT-50161, Lithuania;
ugne.cizauskaite@lsmuni.lt
AbstractRosmarinic acid is one of the most important constituents of rosemary, which has strong
antioxidant effect [1]. Previous studies revealed that the antioxidative activity of rosmarinic acid
was higher than that of vitamin E or trolox [2,3]. Also it was determined that antioxidant activity
directly depended on the content of phenolic compounds in the extracts [4]. However, the
influence of different extraction methods on the yield of phenolic compounds and antioxidant
activity has not been investigated yet to our knowledge, so it became the aim of our
study.Extraction of R.officinalis L. leaves was performed by ultrasound-assisted extraction,
percolation, maceration and two-phase extraction. The antioxidant activity was evaluated by
means of the 2,2-diphenyl-1-picrylhydrazil (DPPH) radical scavenging method. The concentration
of phenolics in plant extracts was determined using spectrophotometric method. Statistical
analysis was performed, a value of p < 0.05 was taken as the level of significance.The results
showed that the change in extraction temperature from 30°C to 50°C and decrease in
material:solvent ratio from 1:20 to 1:5 significantly increased content of phenolic compounds and
antioxidant activity in extracts prepared by ultrasound assisted extraction. The extension of
ultrasound-assisted extraction time to 30min resulted in up to 17% higher content of phenolic
compounds (p<0.05 vs 10min,15min). The extraction time change had significant influence on
total phenolic content in extracts prepared by two phase extraction too, it increased up to 366%.
Significantly higher content of phenolic compounds compared to other extracts was obtained
during standard extraction procedures - maceration and percolation. In extracts obtained by
maceration, 2.5 times higher concentration of phenolic compounds was achieved compared to that
by percolation. It was noticed that using lower concentration of ethanol, more phenolic
compounds are extracted, however, their antioxidant activity depended on the conditions of extract
preparation. For example in extracts prepared using 70 % ethanol as a solvent with
material:solvent ratio 1:10 and 1:20, content of phenolic compounds differ insignificantly by 5%,
however, antioxidant activity of extract prepared at material:solvent ratio 1:5 was higher by 53%
(p<0.05). It is noteworthy that surfactant Tween 20, which was used for two-phase extraction,
highly increased antioxidant activity of the tested extracts. Antioxidant activity of extract,
macerated in water bath for 180min with 7.5% of surfactant, was found to be only 20% lower than
that of extract with the highest activity found (maceration) although content of phenolic
compounds differed 8 times in these samples.We can conclude that there was no correlation
observed between content of phenolic compounds and antioxidant activity of the tested rosemary
extracts. Due to the long lasting diffusion of active ingredients, the highest content of phenolic
compounds was determined in the extracts, which were prepared by principal extraction
techniques: maceration (20.34±0.053mg/ml) and percolation (8.08±0.04 mg/ml) (p<0.05). These
extracts were characterized with strong antioxidant activity as well. The optimal ultrasound-
assited extraction conditions for extract with highest antioxidant activity were as follows:
extraction temperature- 50°C, time -10min, material:solvent ratio -1:5, solvent- 70% ethanol.
Keywords: rosmarinus officinalis L., total phenolic content, antioxidant activity
ISSN 2335-8653
139
Impact of production chemical hazard on element status of welders
Tatyana M. Rybina, Victor A. Zaitsev, Liudmila S. Ivashkevich, VolhaF.Kardash
Scientific Practical Centre Of Hygiene
E-mail address:tanya-rybina@list.ru
Abstract
The stability of the chemical composition of the body is one of the most important and mandatory
conditions for its normal functioning. Many chemical elements are essential catalysts of metabolic
processes and play a significant role in the functioning of all body systems. Workers employed in
the foundry and welding production are at increased risk of metabolic disorders of trace elements,
which can lead to pathogenic changes, increased morbidity and reduced professional longevity.
Aim of the study was to investigate the effect of environmental pollution of workplace on element
status of welders
Materials and Methods. Airborne particulate matter sampling was carried out in the breathing zone of welders at 10 typical
operating conditions sites by using high volume air sampler with millipore filter. Human scalp
hair from the occipital part of 80 welders and 29 office workers was collected according to the
recommendation of IAEA for sample collection. The mean age was 36.8±15.6 years for welders
and 36.9±13.4 years for office workers. Welder experience was from 1 to 38 (mediana 7) years.
Determination of metals and metalloids in samplings was done by atomic emission spectrometry
with inductively coupled plasma (Ultima 2, Horiba Jobin Yvon, Japan-France).
Statistical analysis was performed using the software package Microsoft Excel XP (Microsoft
Corp., USA) and Statistica 6.0 (StatSoft Inc., USA).
Results.
The toxic elements in the working area of welders are the following aluminum, copper, iron,
manganese, lead, zinc, titanium, chromium, nickel, silica. The content of all elements except
manganese and iron is below hygienic standards.
Analysis of the element composition of scalp hair shows a high content of phosphorus, iron,
manganese, chromium, nickel, zinc and lead compared to the office workers. The main type of
microelementoses for all welders is elevated manganese content. The amount of manganese in the
hair of the head exceeds the reference values, even for a group of welders who did not have a
higher content of this element in the working area.
A reduced content of calcium, copper and magnesium in the scalp hair was observed compared
with the reference values.
Conclusions. An imbalance of trace elements in welders was observed regardless of the level of
these elements in the working area.
Keywords: copper, iron, manganese, zinc, welder.
ISSN 2335-8653
140
Effect of Smirnov‘s Rhododendron and Black Mulberry Seeds Treatment by
Low Temperature Plasma and Electromagnetic Field to Seed Germination and
Early Plant Development
V. Aleknavičiūtė1, V. Mildažienė2, G.Paužaitė2, A. Malakausikienė2, I. Filatova3, V.
Azharonok3, Veronika Lyushkevich3
1Vytautas Magnus University, 2 VMU Kaunas botanical garden, 3 Stepanov Institute of Physics of National Academy of
Sciences of Belarus
E-mail vesta.aleknavičiūtė@fc.vdu.lt
Abstract
The effects of short term pre-sowing seed treatment by radio frequency electromagnetic field and
cold plasma on two perennial woody plant species Smirnov‘s rhododendron (Rhododendron
Smirnowii Trautv., RS) and black mulberry (Morus nigra L., MN) were estimated in this study. It is
reported more substantial changes induced by pre-sowing seed treatment by physical stressors in
perennial plant germination and plant development than it was reported previously for annual
plants. The effects of stressors were species dependent – vacuum and electromagnetic field
stimulated germination of freshly harvested seeds of RS, but negatively affected germination of
fresh MN seeds; the response to cold plasma treatment was negative for RS, and positive for MN
seeds. The changes induced by treatments in germination dynamics and yield were critically
dependend on seed dormancy state: the same treatments induced positive effects in freshly
harvested but negative effects – in after-ripened seeds. Longer term observations revealed that
initially noticed effects persisted for more than one year, however shift from negative effects on
germination to positive effects on plant morphometric traits took place over time. Some effects,
characterised as distressful by changes in germination and seedling length after 13 months resulted
in remarkable increase in RS growth: induced stem and root branching, increased leave number and
surface area . These findings imply that such commonly used estimates for stressor effects as
germination rate or seedling morphology not always can be regarded as sufficient parameters for
qualifying the response to stressors (eustress or distress). At least for the perennial plants much
longer observations are strongly recommended.
Keywords: cold plasma, electromagnetic field, Rhododendron Smirnowii, Morus nigra, perennials
plants, germination.
ISSN 2335-8653
141
Ligninolytic Activity Of White Rot Fungi And Their Efficiency In
Bioremediation
Jurgita Mikašauskaitė1, Nicola Tiso1, Mantas Stankevičius1, Vilija Snieškienė2, Antanina
Stankevičienė2, Emanuella Galli4, Chiara Polcaro4, Audrius Sigitas Maruška1
1Department of biochemistry and biotechnologies, Vytautas Magnus University, Vileikos 8, LT-44404,
Kaunas, Lithuania 2Kaunas Botanical Garden, Vytautas Magnus University, Z. E. Zilibero st. 6, Kaunas LT-46324
Kaunas, Lithuania 4National Research Council (CNR), Istitute of Agroenvironmental and Forestal Biology (IBAF) & Institute of Chemical
Methodologies (IMC), Area della Ricerca di Roma, Via Salaria Km 29,300, 00015, Monterotondo (Roma), Italy
Abstract
Wooden railway sleepers impregnated with creosote or coal tar are protected from wood-
degrading microorganisms. Coal tars and creosote are complex and variable mixtures of polycyclic
aromatic hydrocarbons (PAH), phenols and heterocyclic compounds.
Bioremediation using various microorganisms is one of the ways to remove PAHs from the
environment. There are three known different pathways of microbial degradation; the basis of these
mechanisms is the oxidation of the aromatic ring. PAH-degrading microorganisms are divided in
three groups: bacteria, non-ligninolytic fungi and ligninolytic fungi. Ligninolytic fungi like
Pleurotus ostreatus, Irpex lacteus, Pleurotus eryngii or others, produce extracellular enzymes with
very low substance specifity. This is supposed to be advantageous for the degradation of PAHs.
Ligninolytic system of white rot basidiomycetes consists of a pool of enzymes, namely laccases,
lignin peroxidase, versatile peroxidase, cellobiose dehydrogenase, H2O2-producing enzymes and
reactive oxygen species produced by such enzymes.
The aim of this research consists in the determination of fungi ligninolytic activity and the
determination of the efficiency of different fungal species for the degradation of PAH.
Five different species of fungi (Pleurotus ostreatus SMR 684, Pleurotus eryngii VMU001,
Bjerkandera adusta VMU004, Irpex lacteus VMU003 and Schizophyllum commune VMU002)
demonstrate degradation activity of different concentrations of treated railway sleepers.
Composition of coal tar in railway wooden sleepers was determined using GC-MS and GC-FID.
Acknowledgement: This project is financed by EUSFA, grant No VP1-3.1-ŠMM-10-V-02-010
(BIOREM).
Keywords: mycoremediation, ligninolytic activity, GC-FID, white rot fungi
ISSN 2335-8653
142
Development and evaluation of ligninolytic fungal consortia for the
bioremediation of wooden railway crossties.
N. Tiso1, J. Mikašauskaitė1, V. Snieškienė2, A. Stankevičienė2, M.Stankevičius1, E. Galli4,
C.Polcaro4, E.Donati4, A. Maruška1
1Department of biochemistry and biotechnologies, Vytautas Magnus University, Vileikos 8, LT-44404,
Kaunas, Lithuania 2Kaunas Botanical Garden, Vytautas Magnus University, Z. E. Zilibero st. 6, Kaunas LT-46324
Kaunas, Lithuania 4National Research Council (CNR), Istitute of Agroenvironmental and Forestal Biology (IBAF) & Institute of
Chemical Methodologies (IMC), Area della Ricerca di Roma, Via Salaria Km 29,300, 00015, Monterotondo
(Roma), Italy
Creosote is widely used as wood preservative due to its efficient properties as biocide, and it is a
complex mixture of several hundreds chemicals obtained from distillation of hard coal tar mainly
composed by aromatic hydrocarbons, including polycyclic aromatic hydrocarbons (PAHs) and
alkylated PAHs (which can constitute up to 90% of it).
The aim of this research is to investigate the potential of selected basidiomycetes and ascomycetes,
in particular white-rot fungi for the bioremediation of creosote in expended wood crossties and to
develop fungal consortia with faster biomass growth rate and/or able to enhance the production of
ligninolytic enzymes in order to increase the efficiency of the mycoremediation process.
Fungal species, previously selected for their resistance to different pollutant concentrations, have
been further investigated to assess their ability to produce ligninolytic enzymes, such as laccase
(E.C. 1.10.3.2), lignin peroxidase (E.C. 1.11.1.14), manganese dependent peroxidase (E.C.
1.11.1.13), as a parameter to determine their potential for mycoremediation.
36 different dual co-culture consortia were investigated to evaluate their ability to improve the
bioremediation effectiveness. Composition of creosote in railway wood sleepers and coal tar
samples was estimated by GC-MS, GC-FID, HPLC, UPLC, while enzymatic activity was
determined by qualitative enzymatic assay in vitro and UV-visible spectroscopy.
Acknowledgement: This project is financed by EUSFA, grant No VP1-3.1-ŠMM-10-V-02-010
(BIOREM).
Keywords: white-rot fungi, fungal consortium, bioremediation, creosote, railway crossties,
ligninolytic enzymes.
ISSN 2335-8653
143
Phytochemical Analysis Of Grindelia Robusta Nutt. Depending On Phenologic
Stades
Clémentine M. Fayol1,2,3, Audrius Maruska2, Ona Ragazinskiene3,
1Angers's University, Institute of Technology (IUT), 4 bld Lavoisier - 49000 Angers, France, 2Sector of Medicinal
Plants, Kaunas Botanical Garden of Vytautas Magnus University, Z.E. Zilibero str. 6, LT- 46324 Kaunas, Lithuania, 3Department of Biology, Vytautas Magnus University, Vileikos str. 8, LT-44404, Kaunas, Lithuania.
clementine.fayol@etud.univ-angers.fr
Abstract
Grindelia robusta Nutt. Is a perennial plant native from western part of North America. It has been
used as a medicinal plant by native american people against cough, asthma and pneumonia. It has
got anti-inflammatory, antimicrobial and antioxidant activities thanks to its phenolic and flavonoid
composition. The aim of this study is to analyse the composition in active principles of G. robusta
depending on its phenologic stades to optimize the harvest period in order to improve the quality of
the row material. Grindelia robusta was collected at four different phenologic stades (bud,
beginning of blooming, massive blooming and end of blooming) and air-dried at “Les quatre
saisons” farm in Chemillé (France). The extracts were analysed with spectrophotometric methods.
References
[1] SLAWOMIRA N. et RYCHLI I., 2012. Phenolic acids in the flowers and leaves of grindelia robusta nutt. and
grindelia squarrosa dun.(asteraceae). Acta Poloniae Pharmaceutica - Drug Research 69 n°4, 693-698.
[2] FERRERES F., GROSSO C., GIL-IZQUIERDOA A., VALENTÃO P., AZEVEDO C., ANDRADE P.B., 2014.
HPLC-DAD-ESI/MSn analysis of phenolic compounds for quality control of Grindelia robusta. Journal of
Pharmaceutical and Biomedical Analysis 94, 163–172.
[3] Grindelia pour préparations hométopatiques. Pharmacopée française.
[4] LA V.D., LAZZARIN F., RICCI D., FRATERNALE D., GENOVESE S., EPIFANO F., GRENIER D., 2010.
Active principles of Grindelia robusta exert antiinflammatory properties in a macrophage model. Phytother Res. 24(11):
1687-92.
ISSN 2335-8653
144
Quantification and comparison of phenolic compounds in leaves of
different types of Solidago L. by thin-layer chromatography
Mindaugas Marksa1, Marius Auglys1, Jolita Radušienė2, Asta Kubilienė1, Liudas
Ivanauskas1
1Department of Analytical and Toxicological Chemistry, Lithuanian University of Health Sciences, Eivenių 4, 50161,
Kaunas, Lithuania
2Nature Research Centre, Institute of Botany, Akademijos 2, 08412 Vilnius, Lithuania
E-mail: mindaugas.m.lsmu@gmail.com
Introduction. Goldenrods have been traditionally used to treat inflammations of the urinary tract
[1]. Preparations from goldenrods have a well-defined diuretic, spasmolytic and hypotensive effect
together with anti-inflammatory, bacteriostatic and analgesic properties [1]. The aim of our study –
to determine and comparison the amounts of phenolic compounds in leaves of different types of
Solidago L. by thin-layer chromatography (TLC).
Materials and methods. Leafs of Solidago canadensis L., Solidago gigantea L. and Solidago
virgaurea L. were collected in different places of Lithuania and dried at 25 °C.
Extraction. 0.5 g of air-dried S. canadensis, S. gigantea and S. virgaurea leafs were extracted with
10 mL of methanol water mixture (70:30 v/v) by ultra-sonication at 25 °C for 10 min. The prepared
extracts were passed through a 0.22 µm filter [2].
Thin-layer chromatography. TLC was performed on silica gel 60 UV254 glass plates. Samples were
applicated using CAMAG Linomat 5. 20.0 µL of every sample were sprayed over 10.0 mm band
length. As solvent systems were used anhydrous formic acid R, glacial acetic acid R, water R, ethyl
acetate R (7.5:7.5:17.5:67.5 V/V/V/V). Detection of the phenolic compounds was carried out by
spraying with a 10 g/L solution of diphenylboric acid aminoethyl ester R in methanol R and then
with a 50 g/L solution of macrogol 400 R in methanol R and observed using CAMAG TLC. Then
dried and visualizer under ultraviolet light (366 nm).
Results. In the present study, four phenolic compounds - chlorogenic acid, rutin, isoquercitrin and
quercitrin - were detected in the leaves of Solidago L. Lowest values of phenolic compounds except
rutin estimated in S. virgaurea. Highest values of rutin (4.862 ± 1.643 mg/g) showed in S.
canadensis, quercitrin (3.673 ± 1.178 mg/g), isoquercitrin (0.919 ± 0.642 mg/g) and chlorogenic
acid (38.847 ± 8.314 mg/g) – in S.gigantea. The content of isoquercitrin did not differ significantly
(at p˃0.05) in all species of Solidago L., while rutine did not differ significantly between S.
gigentea and S. virgaurea, quercitrin – between S. canadensis and S. virgaurea, chlorogenic acid –
between S. canadensis and S. gigantea.
Conclusions. The results of this study demonstrated that higher values of rutin was found in S.
canadensis and quercitrin, isoquercitrin and chlorogenic acid – in S. gigantea.
ISSN 2335-8653
145
The Effect of UV-B Exposure in Spinach Plants: Study of Nitrate and Ascorbic
Acid Accumulation
Justina Kiseliauskaitė1,2, *, Sandra Sakalauskienė1, Pavelas Duchovskis1
1Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333, Babtai,
Kaunas distr., Lithuania, 2Vytautas Magnus University, Department of Biology, Vileikos str. 8, LT-44404, Kaunas,
Lithuania
*E-mail address: justinakiseliauskaite@gmail.com
Abstract
Spinach (Spinacia oleracea L.) has a high nutritional value. Nevertheless, leaves accumulate large
amount of nitrate. UV-B radiation exists in natural environment and has a significant impact on
physiology and nutrition of plants. It is important to identify if UV-B light effect can enrich the
nutritional quality of spinach. The aim of this study was to evaluate the impact of supplemental UV-
B of different concentrations and duration of exposure of nitrate and ascorbic acid in Spinach plants
using ‘Andromeda H’ and ‘Matador’. The experiment was conducted on controlled environment at
the Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry. Plants were
placed in different growth chambers at 18/13 °C day/night temperature and 12h photoperiod. High-
pressure sodium lamps were used for illumination (150 μmol m-2 s-1). UV-B radiation (290 – 320
nm) was provided by UV-B fluorescent tubes. Spinach plants were exposed to 0 kJm-2 day-1, 1 kJm-
2 day-1 and 2 kJm-2 day-1, UV-B for 1 or 2 days. ‘Matador’ plants exposed to 1 kJ UV-B dose after 1
day exposure accumulated a larger amount of nitrate. Nevertheless, ascorbic acid content was lower
in these conditions. After 1 kJ and 2 kJ UV-B exposure ‘Andromeda H’ plants showed significantly
larger reduction of nitrate meaning larger amount of ascorbic acid in the leaves. After 2 days
exposure UV-B radiation dose the amount of nitrate increased in ‘Andromeda H’ plants. ,Matador’
showed significant decrease in nitrate content only in 2 day with 2 kJ UV-B radiation dosage
treatment as well as increased amount of ascorbic acid. The results showed that the effect of UV-B
radiation on nitrate and ascorbic acid in spinach leaves depended on spinach species, UV-B dose
and duration of exposure. It is determined that 1 day UV-B exposure in ‘Andromeda’ and 2 days in
‘Matador’ plants have reduced nitrate and increased ascorbic acid which mean supplemental UV-B
light have a positive effect on nutrition of spinach.
Keywords: nitrate, ascorbic acid, UV-B, spinach plants
ISSN 2335-8653
146
Effect of Chitosan on Fruit Storage of Red Kiwifruit Actinidia melanandra
Laima Česonienė1, Remigijus Daubaras1, Daiva Leskauskaitė2, Donata Zabulionė2, Murat Kaya3
1Kaunas Botanical Garden of Vytautas Magnus University, Ž.E. Žilibero 6, LT-46324, Kaunas, Lithuania,
l.cesoniene@bs.vdu.lt, 2Department of Food Science and Technology, Kaunas University of Technology, Radvilėnų pl.
19, LT-50254, Kaunas, Lithuania, 3Aksaray University, 68100, Aksaray, Turkey
Abstract The species A. melanandra Franch. (red kiwifruit) is an attractive dioeciuos climbing plant which
produces reddish green large grape-like berries that are sweeter and more intensely flavored than the
fuzzy kiwi. Commercial production of Actinidia melanandra has been unsuccessful because of short
shelf life of its berries.
The aim of this study was to investigate the effects of chitosan coating on weight loss and firmness as
well as soluble solids, total polyphenols, and ascorbic acid contents of red kiwifruit A. melanandra.
Chitosan used in this study was obtained from Daphnia longispina ephippia.
After 26 days, ascorbic acid content of chitosan coated samples was recorded as 105.9±11.9 mg/100 g
while ascorbic acid content of uncoated samples was observed as 83.6±16.8 mg/100 g. These results
corroborate significant impact of chitosan coating on preservation of ascorbic acid in A. melanandra
fruits during storage. Chitosan coated berries contained on average 102.9±9.04 mg/100 g of total
polyphenols meanwhile uncoated berries were distinguish by significantly lower amount of total
phenolics (60.6±4.62 mg/100g) at the end of storage. Consequently, chitosan coated samples kept higher
antioxidant activity than uncoated samples during the long-lasting storage process.
Changes of soluble solids amounts revealed that chitosan coated samples had slower decomposition
than uncoated samples. It was observed that firmness values of not coated red kiwifruit started to decline
after the first days of storage meanwhile statistically reliable changes of this parameter were did not
detected during the period from 7 to 14 day.
Subsequently, we concluded that chitosan coating can be used to extend the shelf life of red kiwifruit
berries and preserve their value for longer time.
Keywords: red kiwifruit, chitosan, coating, storage.
Recommended