9th International Scientific Conference

THE VITAL NATURE SIGN May 14 – 16, 2015

Kaunas, Lithuania

ABSTRACT BOOK

ISSN 2335-8653

2

Scientific Committee

1. Prof. Habil. Dr. Audrius Maruška, Vytautas Magnus University, Lithuania

2. Prof. Habil. Dr. Algimantas Paulauskas, Vytautas Magnus University,

Lithuania

3. Prof. Stellan Hjerten, Uppsala University, Sweden

4. Prof. Hartmut Frank, University of Bayreuth, Germany

5. Prof. Dr. Jolanta Liesienė. Kaunas University of Technology, Lithuania

6. Prof. Dr. Liudvikas Pranevičius, Vytautas Magnus University, Lithuania

7. Prof. Dr. Vitalis Briedis, Lithuanian University of Health Sciences, Lithuania

8. Prof. Dr. Douglas Westerlund, Uppsala University, Sweden

9. Prof. Dr. Staffan Nilsson, Lund University, Sweden

10. Prof. Olav Rosef, Telemark University College, Norway

11. Prof. Dr. Ute Pyell, University of Marburg, Germany

12. Dr. Akos Vegvari. Lund University, Biochemical center, Sweden

13. Dr. Susanne Wiedmer, University of Helsinki, Finland

14. Dr. Nicola Tiso, Chromatography Institute of the CNR, Italy

Organizing Committee

Chairman: Prof. Habil. Dr. Audrius Maruška, Vytautas Magnus University, Lithuania

1. Dr. Ona Ragažinskienė, Vytautas Magnus university, Kaunas, Lithuania

2. Prof. Dr. Algirdas Raila, Aleksandras Stulginskis University, Kaunas Lithuania

3. Asoc. Prof. Dr. Saulius Šatkauskas, Vytautas Magnus University, Lithuania

4. Prof. Dr. Gintas Saulis, Vytautas Magnus University, Lithuania

5. Dr. Saulius Mickevičius, Vytautas Magnus University, Lithuania

6. Tomas Drevinskas, Vytautas Magnus University, Lithuania

7. Kristina Bimbiraitė-Survilienė, Vytautas Magnus University, Lithuania

8. Mantas Stankevičius, Vytautas Magnus University, Lithuania

9. Jurgita Mikašauskaitė, Vytautas Magnus University, Lithuania

10. Dr. Violeta Bartkuvienė, Vytautas Magnus University, Lithuania

11. Dr. Vilma Kaškonienė, Vytautas Magnus University, Lithuania

12. Dr. Rūta Mickienė, Vytautas Magnus University, Lithuania

13. Gintarė Naujokaitytė, Vytautas Magnus University, Lithuania

14. Academic youth society Modusas, Vytautas Magnus University, Lithuania

Abstract speech of authors were not edited

© Vytautas Magnus University, 2015

BAR CODE 9772335865005

ISSN 2335-8653

3

Tomas Drevinskas, Audrius Maruška Applications and Future Perspectives of Contactless

Impedance Measuring Detectors for Capillary Electrophoresis.........................................................

14

Tautvydas Jakevičius, Audrius Maruška, Tomas Drevinskas Optimization Of Phenolic Compounds

Extraction Procedure From Coal Tar ................................................................................................ 15

Karolina Kalasauskaitė, Vilma Kaškonienė, Gintarė Naujokaitytė The Evaluation of Interaction of

Several Antioxidants by Spectrophotometric Methods Karolina Kalasauskaitė, Vilma Kaškonienė,

Gintarė Naujokaitytė.......................................................................................................................... 16

Agnė Katilevičiūtė, Jurgita Mikašauskaitė, Vilma Kaškonienė Comparison Of Antioxidant

Properties In Bee Pollen Fermented By Lactic Acid Bacteria ......................................................... 17

Skaistė Mikulytė, Vilma Kaškonienė The Impact Of Lactic Acid Bacteria Fermentation On

Phytochemical Composition Of Bee Pollen ..................................................................................... 18

Justina Stasiulionytė, Ona Ragažinskienė, Violeta Bartkuvienė Chemical Analysis Of Biologically

Active Compounds Of Ground Ivy (Glechoma Hederacea L.) Using Gas Chromatography/Mass

Spectrometry (Gc/Ms) Method ......................................................................................................... 19

Eurika Sukackaitė, Ona Ragažinskienė, Violeta Bartkuvienė Extraction From The Medicinal Raw

Material Of Glechoma Hederacea L. Optimization By Using Spectrophotometric Methods For

Total Amount Of Phenolic Compounds And For Evaluation Of Antioxidant Activity ................... 20

Rūta Kuleševičiūtė, Ona Ragažinskienė, Violeta Bartkuvienė Determination Of Total Phenolic

Compounds Content In Rhaponticum Carthamoides (DC. Iljin) By Spectrophotometry Method In

Different Vegetation Phases ............................................................................................................. 21

Andrius Aleliūnas, Gintaras Brazauskas Association Of Single Nucleotide Polymorphisms With

Freezing Tolerance Traits In Perennial Ryegrass ............................................................................. 22

S.Bogačiovienė, L.Česonienė, R.Daubaras, A.Paulauskas, J.Žukauskienė DNA Analysis Of 6

Actinidia L. Cultivars Using SSR Method ....................................................................................... 23

J.Dailidavičienė, R.Budreckienė, R.Gružauskas, S.Kerzienė, S.Makauskas The Dynamic Of

Productivity And Somatic Cell Count In Milk Of Lithuanian Black-And-White Cattles On The

Influence Of Probiotic Additives And Multienzyme Composition .................................................. 24

Agnese Huna,Laura Klavina, Diana DudareChemical Composition And Biological Activity Of Bog

Bilberries And Blueberries .............................................................................................................. 25

Laura Klavina, Gunta Springe, Diana Dudare Extraction And Analysis Of Moss Secondary

Metabolites ....................................................................................................................................... 26

Kamila Gajduskova, Ondrej Sedo, Eva Drozdova27Anthropo-Genetical Exploration Of Human

Skeletal Remains From Archeological Site Rousínov – Ferobet.......................................................17

ISSN 2335-8653

4

Matas Galdikas, Jana Radzijevskaja, Algimantas Paulauskas Genetic Characteristic Of

Dermacentor Reticulatus Ticks Using 12S And 16S Rrna Markers ................................................ 28

Nptx2 And Chi3l1 Genes Promoters Methylation Status And Expression Level In Different Grade

Of Gliomas I. Golubickaitė, R. Stakaitis, D. Skiriutė, P. Vaitkienė, A. Kazlauskas, A. Bunevičius,

G. Steponaitis .................................................................................................................................... 29

Hazel Dormouse (Muscardinus Avellanarius) Genetic Variability Research In LithuaniaKamilė

Morkutė, Algimantas Paulauskas, Vaclovas Gedminas .................................................................... 30

Comparison Of Cyclosporine And Erythropoietin In The Experimental Model Of Acute Myocardial

Injury AlesyaV. Korda, VolhaF.Kardash, Natalia G.Tihonova ........................................................ 31

The Yeasts Strains Isolated From The Berries In Lithuania And Belarus Irina Kolesnik, Juliana

Lukša, Živilė Strazdaitė-Žielienė, Ramunė Stanevičienė, Vytautas Melvydas, Elena Serviene ....... 32

Odontological Problem In Ophthalmological Practice Aušra Povilauskienė, Albertas Kriaučiūnas,

Regina Marija Stakaitytė, Rasa Liutkevičienė, Loresa Kriaučiūnienė .............................................. 33

Occurence Of Methicillin-Resistant Staphylococci In Broilers And Wild Birds Lina Vaškevičiūtė,

Modestas Ružauskas, Rita Šiugždinienė, Irena Klimienė, Marius Virgailis, Raimundas Mockeliūnas

Phototropic Responses Of Garden Cress Leaves To Ultraviolet-A And Blue Light In Artificial

Microgravity EnvironmentR. Losinska-Sičiūnienė, R. Stanevičienė, D. Švegždienė, D. Raklevičienė

........................................................................................................................................................... 35

Genetic Diversity In Vaccinium Corymbosum, V. Australe, And V. Angustifolium Based On

Microsatellite Analysis ...................................................................................................................... 36

D. Mardosaitė-Busaitienė1, R. Rugienius3, J.Žukauskienė1, A.Paulauskas1, S.Bogačiovienė1,

L.Česonienė2, R.Daubaras2 ................................................................................................................ 36

Synergistic And Antagonistic Interactions Between Secondary Metabolites In Monarda Didyma L.

And Angelica Archangelica L. .......................................................................................................... 37

Ruta Mickiene1, Ona Ragazinskiene2, Audrius Sigitas Maruska1 ..................................................... 37

Morphological Identification Of Digenean Isthmiophora Melis (Digenea: Echinostomatidae) From

Mustelids In Lithuania ....................................................................................................................... 38

Dovilė Nugaraitė, Vytautas Mažeika, Algimantas Paulauskas ......................................................... 38

Investigation Of Tick-Borne Pathogens In Baltic Countries ............................................................. 39

Algimantas Paulauskas ...................................................................................................................... 39

Staphylococcus Hominis Isolated From Hospital Patient Resistance To Antibiotics And Resistance

To Antimicrobial Genes .................................................................................................................... 40

Alvydas Pavilonis, Rita Plančiūnienė, Žaneta Maželienė, Povilas Kavaliauskas, Modestas

Ružauskas, Marius Virgailis, Irena Klimienė, Rita Šiugždinienė, Raimundas Mockeliūnas ........... 40

ISSN 2335-8653

5

Synthesis And Characterizations Of Silver Nanoparticles Using Black Currant Extract ................. 41

Judita Puišo1, Matas Damonskas1, Paulius Danilovas2 ..................................................................... 41

Copper Effects On The Growth Of Common Duckweed (Lemna Minor L.).................................... 42

Jūratė Žaltauskaitė 1, Giedrė Pėstininkaitė 2 ...................................................................................... 42

Selection Of AP-PCR Markers And Conditions For Hypericum Maculatum Crantz ....................... 43

Gianni Barcaccia1, Giulio Galla1, Lina Zybartaitė2, Indrė Railienė 2, Algimantas Paulauskas2,

Eugenija Kupčinskienė2 ..................................................................................................................... 43

Genes Encoding Antimicrobial Resistance In Methicillin-Resistant Staphylococcus Haemolyticus

Isolated From Humans And Dogs ..................................................................................................... 44

Modestas Ružauskas, Rita Plančiūnienė, Marius Virgailis, Irena Klimienė, Rita Šiugždinienė, Lina

Vaškevičiūtė, Raimundas Mockeliūnas, Alvydas Pavilonis ............................................................. 44

Dirofilaria Repens Infection In Lithuania ......................................................................................... 45

Vytautas Sabūnas1,2, Povilas Sakalauskas1, Algimantas Paulauskas1, Jana Radzijevskaja1 ............. 45

Light As A Tool For Manipulation Of Plant Responses - Morphogenetic Effects (Part I) ............... 46

Giedrė Samuolienė1,2, Akvilė Viršilė1, Aušra Brazaitytė1, Alina Čeidaitė1, Pavelas Duchovskis1,2 . 46

The Prevelence Of Tick Born Pathogens In Small Mammals In Lithuania ...................................... 47

Karolis Sivickis1, Paulauskas Algimantas Paulauskas1, Jana Radzijevskaja1, Vaclovas Gedminas2,

Linas Balčiauskas3 ............................................................................................................................. 47

Analysis Of Bacteria Sensitivity To Encapsulated Nisin .................................................................. 48

Ramunė Stanevičienė1, Juliana Lukša1, Rūta Žiukelytė1,2, Regina Losinska-Sičiūnienė1, Tatjana

Krivorotova2, Jolanta Sereikaitė2, Elena Servienė1,2 ......................................................................... 48

Selection Of Amplified Fragment Length Polymorphism Markers For Investigation Of Genetic

Diversity Of Impatiens Parviflora ..................................................................................................... 49

Kristė Stravinskaitė1, Lina Zybartaitė1, Eugenija Kupčinskienė1, Walter Durka2 ............................ 49

Saccharomyces Cerevisiae K2 Toxin Fusion With GFP................................................................... 50

Živilė Strazdaitė-Žielienė1, Iglė Vepštaitė1, Lukas Birgiola1,2, Elena Servienė1,2............................. 50

Freshwater Bryozoa Study In Lithuania: Past And Present .............................................................. 51

J.Rutkauskaitė- Sucilienė, I. Šatkauskienė ........................................................................................ 51

Effects Of The Urban Environmental Conditions On The Physiology Of Two Biological Indicators

........................................................................................................................................................... 52

ISSN 2335-8653

6

Gintarė Sujetovienė, Vilma Galinytė ................................................................................................ 52

Studies On Green Synthesis, Characterization And Anti Proliferative Potential Of Silver

Nanoparticles Using Medicinal Plants Collected From Yelagiri Hills ............................................. 53

Giridharan.T*1, Chandran. M1, Sindhu. S2, Arumugam. P2 ............................................................... 53

Metrology In Radiotherapy: Tlds In Brachytherapy Case................................................................. 54

Benas G. Urbonavičius1, Diana Adlienė1, Paulius Kaškonas ............................................................ 54

Detection Of Bacteria And Fungi By Multiplex Real-Time PCR And FRET Technique ................ 55

Máté Vadovics, Rita Anyanwu .......................................................................................................... 55

Association Of Genetic Variants In PNPLA3, MERTK, PCSK7 And RNF7 With Liver Cirrhosis .. 56

Irena Valantienė1, Juozas Kupčinskas1, Greta Varkalaitė2*, Gediminas Kiudelis1, Vitalija

Petrenkienė1, Jolanta Šumskienė1, Limas Kupčinskas1 ..................................................................... 56

Current Distribution And The Diversity Of Babesia Canis Strains In Europe ................................. 57

Linas Venslovaitis, Jana Radzijevskaja, Asta Aleksandravičienė, Vytas Sabūnas, Dalytė

Mardosaitė-Busaitienė, Algimantas Paulauskas ................................................................................ 57

Stargardt’s Macular Dystrophy: Clinical Case .................................................................................. 58

Alvita Vilkeviciute², Mantas Banevicius¹, Arvydas Gelzinis¹, Brigita Glebauskiene¹, Loresa

Kriauciuniene¹,², Rasa Liutkeviciene1,2 ............................................................................................. 58

MMP-2 Rs24386 (C→T) Polymorphism And The Phenotype Of Early Age-Related Macular

Degeneration ...................................................................................................................................... 59

Alvita Vilkeviciute², Rasa Liutkeviciene¹,², Vaiva Lesauskaite³, Giedre Sinkunaite-Marsalkiene³,

Loresa Kriauciuniene¹,², Dalia Zaliuniene¹ ........................................................................................ 59

Cadmium Effects To The Growth Of Thymes (Thymus Vulgaris) And Their Extracts Quality ...... 60

Jūratė Žaltauskaitė, Audronė Minelgaitė ........................................................................................... 60

Connexin - Dependent Migration of Cancer Cells ............................................................................ 61

Mindaugas Žukauskas, Lina Rimkutė, Ieva Antanavičiūtė ............................................................... 61

Cellular Response To Ionizing Radiation: Application Of Different Murine Models ...................... 62

Vaidotas Stankevičius1,2, Rimantė Čeponytė1,2, Diana Schveigert1, Jonas Venius1, Konstantinas P.

Valuckas1, Eduardas Aleknavičius1,3, Ričardas Rotomskis1,4 and Kęstutis Sužiedėlis1,2.................. 62

Mutation Identification In Sucrose Synthase 1 Gene And It’s Impact On Cold Acclimation In

Winter Wheat ..................................................................................................................................... 63

ISSN 2335-8653

7

Rita Armonienė, Gintaras Brazauskas ............................................................................................... 63

The Impact Of Supplemental Blue And Green LED And HPS Lamps Lighting Effects On The

Photosynthesis Parameters Of Sweet Pepper Transplants ................................................................. 64

Aistė Bagdonavičienė1, Julė Jankauskienė1, Irena Januškaitienė2, Skirmantė Deksnytė2, Pavelas

Duchovskis1,3, Aušra Brazaitytė1 ....................................................................................................... 64

Separation Of Surfactin From B.Subtilis Suspension And It‘S Antibacterial Effect ........................ 65

Evaldas Bolskis, Lina Ragelienė ....................................................................................................... 65

The Effect Of Crop Load On Pigment And Macro Element Quantity In Malus Domestica With P22

Rootstocks ......................................................................................................................................... 66

Alina Čeidaitė, Darius Kviklys, Pavelas Duchovskis, Giedrė Samuolienė ....................................... 66

Identification and Characterization of NADPH-oxidase Genes in Domestic Apple (Malus ×

domestica Borkh.) .............................................................................................................................. 67

Darius Čepauskas1, Danas Baniulis2, Gražina Stanienė2, Inga Miliūtė2, Vidmantas Stanys2 .......... 67

The Effect of Photosynthetic Photon Flux Density on Cucumber Transplants Growth Indoors ...... 68

Skirmantė Deksnytė1, 2*, Aistė Bagdonavičienė1, Aušra Brazaitytė1, Julė Jankauskienė1, Pavelas

Duchovskis1, Giedrė Samuolienė1 ..................................................................................................... 68

The Influence Of Fermented With Certain Lactic Acid Bacteria Satureja Hortensis On The Quality

And Technological Parameters Of Pork And Beef Loin ................................................................... 69

Erika Mozuriene1*, Elena Bartkiene1, Grazina Juodeikiene2, Daiva Zadeike2, Audrius Maruska3,

Ona Ragazinskiene4 ........................................................................................................................... 69

Removal Of Heavy Metals By Fungal Biomass And Its Polysaccharides ........................................ 70

Emanuela Galli .................................................................................................................................. 70

Pathogen Elicitor Induced ROS Production And Gene Expression In Apple (Malus × Domestica)

Cell Suspension ................................................................................................................................. 71

Rimantė Grencevičiūtė1, Gražina Stanienė2, Inga Miliūtė2, Algirdas Kaupinis3, Mindaugas Valius3,

Danas Baniulis2 ................................................................................................................................. 71

Light Spectral Effects On Alkaloid Contents In Catharanthus Roseus ............................................ 72

Laurita Grigaitytė1, Akvilė Viršilė2, Ramūnas Sirtautas, Aušra Brazaitytė ...................................... 72

The Influence Of Nitrogen Fertilizers On Winter Wheat Quality Indicators .................................... 73

Aistė Juchnevičienė1, Ilona Vagusevičienė1, Aušra Brazaitytė2, Pavelas Duchovskis1,2 .................. 73

ISSN 2335-8653

8

Cloning And Expression Of Transmembrane Domain Segments Of Arabidopsis Thaliana RBOH D

Enzyme .............................................................................................................................................. 74

Andrius Kočevas1, Kristina Druceikaitė2, Danas Baniulis2 ............................................................... 74

Rich By Collagen Recycled Solid Waste Of Leather As Nitrogen Source For Agriculture ............. 75

Ineta Komiciute, Ilona Jonuskiene, Justa Sirvaityte, Virgilijus Valeika ........................................... 75

Nitrogen And Micro-, Macroelement Ratios In Current-Year Needles Of Juniperus Communis L.

Lithuania Populations ........................................................................................................................ 76

Edvina Krokaitė, Ramūnas Vilčinskas, Lina Zybartaitė, Algimantas Paulauskas, Eugenija

Kupčinskienė ..................................................................................................................................... 76

The Effect Of Light-Emitting Diodes Spectra On Mineral Elements Content In Brassicaceae

Microgreens ....................................................................................................................................... 77

Birutė Lekstutytė1, Akvilė Viršilė2, Aušra Brazaitytė2, Viktorija Vaštakaitė2 .................................. 77

Chitin Characterization Of Two Baltic Sea Shrimp Species: Palaemon Elegans And Crangon

Crangon ............................................................................................................................................. 78

Evaldas Lelešius1,2, Murat Kaya2, Vaida Tubelytė 1, Radvilė Nagrockaitė1,2, Vykintas Baublys1 ... 78

Studies Of Lactococcus Lactis Infection By Phage C2 ..................................................................... 79

Vygandas Marozas, Inga Žievytė, Rimantas Daugelavičius ............................................................. 79

Water Pollution By Pharmaceuticals: Assessment Of Ibuprofen Tolerance, Phytometabolisation

And Phytoremediation Potential In Model Plant Species Of The Riparian And Aquatic Ecosystems

........................................................................................................................................................... 80

Fabrizio Pietrini, Valentina Iori, Daniela Di Baccio, Massimo Zacchini.......................................... 80

Effect Of Salinomycin, Antimycin, Sodium Phenylbutyrate And Glucose Deprivation On Cancer

Cell Viability And Mobility .............................................................................................................. 81

Gintarė Milašiūtė1,2, Sandra Puidokaitė1, Ieva Ceslevičienė1, Ieva Antanavičiūtė1, Valeryia

Mikalayeva1 ....................................................................................................................................... 81

A Physicochemical Characterization Of Chitin Extracted From Edible Lithuanian Mushrooms ..... 82

Radvilė Nagrockaitė1,2, Murat Kaya2, Vykintas Baublys1, Evaldas Lelešius1,2, Vaida Tubelytė1 .... 82

HIF-1 Is Indirectly Involved In Hypoxia Dependent Splicing Regulation ....................................... 83

Egle Jakubauskiene1, Inga Pečiulienė1, Laurynas Vilys1, Arvydas Kanopka1 ................................ 83

Characteristics Of Polymorphic Markers For Juniperus Communis L. From Lithuania .................. 84

ISSN 2335-8653

9

Ramūnas Vilčinskas, Lina Zybartaitė, Audrius Petrauskas, Algimantas Paulauskas, Eugenija

Kupčinskienė ..................................................................................................................................... 84

Serum Albumin Corona on ZnO NPs has Opposite Effect in Cellular and Mitochondrial Toxicity

Experimental Models ......................................................................................................................... 85

Karolina Rilskytė1, Zita Naučienė1, Valentinas Snitka2, Rasa Žūkienė1 ........................................... 85

Modified pyridine nucleotides in biosynthesis of DNA .................................................................... 86

Algirdas Mikalkėnas1, Bazilė Ravoitytė1, Daiva Tauraitė2, Rolandas Meškys2, Saulius Serva1,3 .... 86

Investigations Of Resistance To Cold And Hardening In Vitro Of Rosaceae Family Plants ........... 87

Rytis Rugienius1, Lina Šnipaitienė2 .................................................................................................. 87

Amino Acid Impact On Rape (Brassica Napus L.) Germination ...................................................... 88

Kristina Teiserskyte, Ilona Jonuskiene, Justa Sirvaityte, Virgilijus Valeika..................................... 88

The Effect Of Light-Emitting Diodes Photoperiod On Tocopherols Content In Brassicaceae

Microgreens ....................................................................................................................................... 89

Monika Valaitytė1, Akvilė Viršilė2, Aušra Brazaitytė2, Viktorija Vaštakaitė2, Julė Jankauskienė2,

Ramūnas Sirtautas2 ............................................................................................................................ 89

The Impact Of Supplemental UV-A Irradiation On Phytochemical Content Of Microgreens In

Greenhouse ........................................................................................................................................ 90

Viktorija Vaštakaitė, Akvilė Viršilė, Aušra Brazaitytė, Julė Jankauskienė, Ramūnas Sirtautas ...... 90

The Concentration of Non-essential Elements in Lithuania Populations of Juniperus communis L. 91

Edvina Krokaitė, Ramūnas Vilčinskas, Lina Zybartaitė, Algimantas Paulauskas, Eugenija

Kupčinskienė ..................................................................................................................................... 91

Light as a Tool for Manipulation of Plant Responses – Internal and External quality (Part II)........ 92

Akvilė Viršilė1, Giedrė Samuolienė1,2, Aušra Brazaitytė1, Viktorija Vaštakaitė1, Ramūnas Sirtautas1,

Pavelas Duchovskis1,2 ........................................................................................................................ 92

Extraction And Characterization Of Chitins From Coackroach Ootheca ......................................... 93

Murat Kaya1, Mujtaba Muhammad1, Bahar Akyuz1, Esra Bulut1, Karwan Sofi1, Laura Zelencova1,2,*

........................................................................................................................................................... 93

Selection Of Inter-Simple Sequence Repeat Markers For Investigation Of Genetic Diversity Of

Impatiens Spp. Populations ............................................................................................................... 94

Lina Zybartaite, Edita Sajonaite, Rasa Janulioniene, Eugenija Kupcinskiene, Algimantas Paulauskas

........................................................................................................................................................... 94

ISSN 2335-8653

10

A Research of a Behaviour of Saccharomyces Family Yeast in Contact with PAHs ....................... 95

VioletaVaitkeviciene1, Mantas Vaitkevicius2, Neringa Venslauskaite1 ............................................ 95

Antibiotic-Resistant Bacteria Isolated From Dairy Cattle With Endometritis .................................. 96

Mindaugas Levickis1*, Vytuolis Žilaitis1, Anita Rokaitytė2, Irmantas Rokaitis2 .............................. 96

Evaluation of cannabidiol and plant antioxidant activity dynamics in Lithuania cultivated Cannabis

sativa L. ............................................................................................................................................. 97

Ignas Popa1, Vidmantas Dirsė2, Guoda Kiliuvienė3 .......................................................................... 97

Determination Of Changes Of Common Lungwort (Pulmonaria Officinalis L.) Composition Of

Biologically Active Substances During Different Phenological Phases Using Instrumental Analysis

Methods ............................................................................................................................................. 98

Simonas Juodis1, Audrius Maruška1, Ona Ragažinskienė2 ................................................................ 98

Platinum Group Metals Measurement In Used Automobile Catalyst With Two Pulse LIBS Method

........................................................................................................................................................... 99

Deivydas Kiznys1, Karolis Gedvilas1, Valdas Girdauskas1,2 ............................................................. 99

Influencing factors of chemical element accumulation in peat and ................................................ 100

peat humic substances ..................................................................................................................... 100

Diana Dudare1, Maris Klavins1 ....................................................................................................... 100

Ectoparasites From Nests And Burrows Of Swallow (Hirundinidae) In Lithuania ........................ 101

I. Lipatova1, E. Šukauskaitė1, V. Matulaitytė1, A. Paulauskas1, J. Radzijevskaja1, A. Petraitis ..... 101

Stable Isotope Method For Tracing The Poultry Farm Environment .............................................. 102

Raminta Skipitytė1, Agnė Mašalaitė1, Andrius Garbaras1, Rūta Mickienė2, Ona Ragažinskienė3,

Bronius Bakutis4, Jūratė Šiugždaitė4, Violeta Baliukonienė4, Saulius Petkevičius4, Audrius Sigitas

Maruška2 ir Vidmantas Remeikis1 ................................................................................................... 102

Formation Of Nanoclusters On Pre-Expanded Polystyrene Beads ................................................. 103

Šarūnas Varnagiris, Darius Milčius ................................................................................................. 103

High Precision Parallel Implementation Of Four-Particle Harmonic Oscillator Transformation

Brackets For Nuclear Calculations .................................................................................................. 104

Augustinas Stepšys1 , Saulius Mickevičius2 , Darius Germanas3 , Ramutis K Kalinauskas3 ......... 104

Ab Initio Calculations Of Six-Body Systems .................................................................................. 105

Augustinas Stepšys1 , Saulius Mickevičius2 , Darius Germanas3 , Ramutis K Kalinauskas3 ......... 105

ISSN 2335-8653

11

Plasma Based Ex-Situ And In-Situ Hydrogenation Of Mg Films ................................................... 106

Dalius Girdzevicius, Darius Milcius, Marius Urbonavicius............................................................ 106

The Effect Of Foliar Spray Fertilizers On Hordeum Vulgare Resistance To Combined UV-B

Radiation And Drought Stress Effect .............................................................................................. 107

Irena Januškaitienė1, Inga Ivankova1 ............................................................................................... 107

Species Composition And Distribution Of Terrestrial Isopods (Isopoda) In Region Alytus Of

Lithuania .......................................................................................................................................... 108

Karolina Kvašnauskaitė1, Ingrida Šatkauskienė2............................................................................. 108

Characterization of low flux neutron sources by using neutron activation analysis, MCNP6

modeling and solid state nuclear track detectors ............................................................................. 109

Elena Lagzdina, Danielius Lingis, Artūras Plukis, Rita Plukienė, Darius Germanas, Jevgenij

Garankin .......................................................................................................................................... 109

The Effect Of Equal Cd And Cu Exposure In Peat Substrate On Growth And Bioaccumulation Of

Hordeum Vulgare ............................................................................................................................ 110

Irena Januškaitienė1, Martynas Klepeckas1 ..................................................................................... 110

Radiation Interaction Impact On Environment And Technology ................................................... 111

S. Mickevičius1 D. Adlienė2 ............................................................................................................ 111

Hydrogen Production By Reacting Activated Aluminum Metal With Water ................................. 112

Marius Urbonavičius, Darius Milčius ............................................................................................. 112

Safety Aspects of Higher Value Wheat Bread ................................................................................ 113

Elena Bartkiene1, Vadims Bartkevics2,3 Iveta Pugajeva2,3, Ida Jakobsone2, Vita Krungleviciute1,

Grazina Juodeikiene4, Daiva Vidmantiene4, Loreta Basinskiene4, Gerhard Schleining5 ................ 113

Optimization of Extraction of Linden Flowers Phenolics with Water Using Response Surface

Method ............................................................................................................................................. 114

Agnė Birštonaitė, Vytenis Venclovavičius, Raimondas Raudonis ................................................. 114

Growth Parameters Of Centaurium Erythraea Cell Culture In Relation To Its Chemical

Composition And Antiradical Activity ........................................................................................... 115

Anete Boroduske1, Ilva Nakurte1, Agneta Lindmane2, Madara Lazdane3, Signe Tomsone3 .......... 115

Characterization Of Plant Extracts In Cell And Tissue Culture-Based In Vitro Test Systems For

Development Of New Cosmetic Compositions For Skin Renewal And Whitening ..................... 116

ISSN 2335-8653

12

Martins Boroduskis1,2, Anna R-Stunda1,2, Elza Kaktina1, Anete Boroduske1, Ilva Nakurte1, Janis

Ancans1,2 .......................................................................................................................................... 116

Express test for honey quality ......................................................................................................... 117

Violeta Krasevič1, Bogumila Kurtinaitiene2, Justinas Kretavičius2, Violeta Čeksterytė3 ............... 117

Blueberry Genotypes for the Selection of New Cultivars with Higher Contents of Biologically

Active Compounds .......................................................................................................................... 118

Vilma Kraujalytė1, Petras Rimantas Venskutonis1, Audrius Pukalskas1, Laima Česonienė2,

Remigijus Daubaras2 ....................................................................................................................... 118

Determination Of Total Anthocyanin Content In Cranberry (Vaccinium OxycoccoL.) Fruit Using

UV Spectrophotometry .................................................................................................................... 119

Eglė Ignatavičiūtė, Asta Kubilienė1 , Guoda Kiliuvienė1 , Kristina Gaivelytė2 .............................. 119

Isotope Ratio Mass Spectrometry Application in Food Authenticity Studies ................................. 120

Andrius Garbaras, Raminta Skipitytė, Matas Pocevičius and Vidmantas Remeikis ...................... 120

Investigation of Antioxidant Activity in Medicinal Plants and Their Mixtures, Identical to

Commercial Teas, by Spectrophotometric and Chromatographic Methods.................................... 121

Liudvika Juškaitė1, Vilma Kaškonienė1, Ona Ragažinskienė2 ........................................................ 121

Formulation And Quality Evaluation Of Protective Lipstick With Oenothera Biennis L. Oil ....... 122

Ieva Kaminskienė, Zenona Kalvėnienė, Giedrė Kasparavičienė, Jurga Bernatonienė, Arūnas

Savickas ........................................................................................................................................... 122

The Application Of Chemometric Techniques For The Classification Of Bee Products: A Review

......................................................................................................................................................... 123

Vilma Kaškonienė ........................................................................................................................... 123

Variation Of Phenolic Compounds In Buckwheat Grain At Different Growth Stages ................... 124

Ilona Kerienė1, Audronė Mankevičenė1, Saulius Bliznikas2, Rūta Česnulevičienė1 ....................... 124

Impact Of L. Sakei On Dairy Cattle Production And Ruminal Processes ....................................... 125

Vita Krungleviciute1, Elena Bartkiene1, Rasa Zelvyte1, Igrida Monkeviciene1, Jone Kantautaite1,

Rolandas Stankevicius1, Grazina Juodeikiene2 ............................................................................... 125

Development And Evaluation Of Herbal Cosmeceutical For Skin Care ........................................ 126

Akash S Mali1, P Karekar*, Y Gurav*, Dr Yadav A* ..................................................................... 126

Antioxidant Activity Of Solidago L. Using HPLC- Cupric Reducing Antioxidant Capacity

(CUPRAC) Assay With Post-Column Detection ............................................................................ 127

ISSN 2335-8653

13

Mindaugas Marksa1, Justas Mačinskas1, Jolita Radušienė2, Liudas Ivanauskas1, Valdas Jakštas3 . 127

Moisture And Short-Term UV-B Radiation Effect On Nitrate And Photosynthesis In Spinacia

Oleracea .......................................................................................................................................... 128

Ingrida Odminytė1, Akvilė Viršilė2, Sandra Sakalauskienė2 ........................................................... 128

Effect Of Commercial Starter Cultures On Physicochemical ......................................................... 129

Characteristics, Microbial And Biogenic Amines Counts Composition ......................................... 129

Of Fresh Pork Sausage .................................................................................................................... 129

Anita Rokaityte1*, Gintare Zaborskiene1 ......................................................................................... 129

Analysis Of Micro- And Macro- Elements Of Lupine Seeds Bred In Lithaunia By Using Inductively

Coupled Plasma Mass Spectrometry (ICP-MS) .............................................................................. 130

Vytaute Starkute1, Elena Bartkiene1, Vadims Bartkevic2, Zita Maknickiene3, Grazina Juodeikiene4

......................................................................................................................................................... 130

Food Supplement Legislation In The Eurasian Economic Union ................................................... 131

Natalia Tsemborevitch1, Ekaterina Fedorenko ................................................................................ 131

Optimisation of Supercritical CO2 Extraction of Lycopene from Red Tomato .............................. 132

D. Urbonavičienė1,2, R. Bobinaitė1, J. Viškelis1, Č. Bobinas1, P. Viškelis1 .................................... 132

Hop as an Important Source of Phytomedicinally Active Compounds ........................................... 133

Eva Ürgeová, Natália Fehérová, Ivana Pšenáková .......................................................................... 133

Optimisation of Water Extraction of Medicinal Herbal Tea of Birch Leaves Using Response

Surface Method ............................................................................................................................... 134

Vytenis Venclovavičius, Agnė Birštonaitė, Raimondas Raudonis.................................................. 134

Phytochemical Analysis Of Bidens Tripartita L. Using Spectrophotometric And Liquid

Chromatographic Methods .............................................................................................................. 135

Gintarė Naujokaitytė1, Audrius Sigitas Maruška1, Ona Ragažinskienė2 ......................................... 135

Influence Of Different Extraction Methods Of Rosmarinic Acids Yield From Origanum Vulgare L.

Herb ................................................................................................................................................. 136

Justė Baranauskaitė*a, Jurga Bernatonienėa, Rūta Marksienėb ....................................................... 136

Comparison of Different Extraction Methods and Influence of Extraction Conditions on the Total

Phenolic Content and Antioxidant Activity of Rosemary Extracts ................................................. 137

Ugnė Čižauskaitė1, Jurga Bernatonienė1 ......................................................................................... 137

ISSN 2335-8653

14

Impact of production chemical hazard on element status of welders .............................................. 138

Tatyana M. Rybina, Victor A. Zaitsev, Liudmila S. Ivashkevich, VolhaF.Kardash ....................... 138

ISSN 2335-8653

15

Applications and Future Perspectives of Contactless Impedance Measuring Detectors

for Capillary Electrophoresis

Tomas Drevinskas, Audrius Maruška

Vytautas Magnus University, Faculty of Natural Sciences, Dept. of Biology, Vileikos str. 8 LT44404 Kaunas,

tomas.drevinskas@gmail.com

Abstract

The science of today focuses on miniaturized techniques. Contactless conductivity detectors offer

following advantages: cost effectiveness, high performance, simple integration, low energy

consumption and possibility to miniaturize. Many of applications for capillary electrophoresis and

ion chromatography coupled to first generation contactless conductivity detectors are described in

literature [1]. Recently, the advances in electronics allowed of upgrading contactless conductivity

detectors to second generation miniaturized single-chip based Capacitance-to-Digital detectors [2].

High performance, battery powered, portable wireless version of the Capacitance-to-Digital

detector is described in literature as well [3]. Hardware improvements allows second generation

Capacitance-to-Digital detectors to be used with portable capillary format instrumentation or

stand-alone robotic rover. Third generation of impedance measuring detectors for capillary format

separation includes Impedance-to-Digital systems, where spectra can be recorded during

separation process. Hardware and design aspects will be discussed during the conference.

Keywords: Capacitance-to-Digital, Contactless conductivity detector, capillary electrophoresis,

Impedance-to-Digital.

References: [1] T. Drevinskas, V. Bartkuvienė, A. Maruška, Chemija 2014, 4, 25, 206–212

[2] T. Drevinskas, M. Kaljurand, A. Maruška, Electrophoresis 2014, 16, 35, 2401–2407

[3] T. Drevinskas, A. Maruška, V. Briedis, Electrophoresis 2015, 2, 36, 292–297

ISSN 2335-8653

16

Optimization Of Phenolic Compounds Extraction Procedure From Coal Tar

Tautvydas Jakevičius, Audrius Maruška, Tomas Drevinskas

Dep. Of Biology, Vytautas Magnus University, Vileikos 8, LT-44404 Kaunas, Lithuania

Abstract

Coal tar is one of the fractions of petroleum distillation process that contains polycyclic aromatic

hydrocarbons and phenolic compounds. The aim of this work was to extract only phenolic

compounds and some heterocyclic compounds like Antraquinone from coal tar without PAH.

The majority of phenols have negative effect on human’s health because of chemical structure that

leads to low metabolic degradation level and high harmful effect. Enormous amount of phenols

and PAH contain railway sleepers impregnated with creosote.

Developing extraction method with sodium hydroxide solution makes easier the whole extraction

process from many solid or liquid matrices. This extraction method can be widely used to extract

phenols from coal tar, railway sleepers and soil as well. The extraction procedure was performed

in several steps: (I) solvent extraction of phenols using sodium hydroxide solution and (II)

cleaning of the obtained extract using solid phase extraction.

This presentation discusses the optimization of phenolic compounds extraction procedure and the

quality of this process using different concentration of sodium hydroxide as well as the importance

of this process improving quality of oil’s products.

Keywords: Phenolic compounds, HPLC, coal tar, solvent extraction, solid-phase extraction.

Acknowledgement: Tautvydas Jakevičius acknowledge support by project "Promotion of Student

Scientific Activities" (VP1-3.1-ŠMM-01-V-02-003) from the Research Council of Lithuania. This

project is funded by the Republic of Lithuania and European Social Fund under the 2007-2013

Human Resources Development Operational Programme’s priority 3. Also this project was

financed by EUSFA, Nr.(VP1-3.1-ŠMM-10-V-02-010 (BIOREM).

ISSN 2335-8653

17

The Evaluation of Interaction of Several Antioxidants by Spectrophotometric

Methods

Karolina Kalasauskaitė, Vilma Kaškonienė, Gintarė Naujokaitytė

Faculty of Natural Sciences, Vytautas Magnus University, Vileikos 8, LT- 44404 Kaunas, Lithuania

Nowadays, the demand of natural antioxidants has increased, because antioxidants can reduce or

even stop the progression of many chronic diseases and can restore damaged structures of the

human body. Antioxidants are found in various plants and are used for production of food

supplements or can be used as natural food additives. People often use different plant extracts in

order to get a stronger effect, considering only biological characteristics of a single plant.

However, the question do biologically active substances of plants inhibit or promote each other is

not answered yet.

The general purpose of this work was to evaluate the interaction between several potential

antioxidants by spectrophotometric methods. Four flavonoids (kaempherol, rutin, naringenin,

myricetin) and three phenolic acids (ferulic, caffeic and salicylic acids) were selected for the

analysis.

The total amount of phenolic compounds was evaluated by the Folin–Ciocalteu method; the total

content of flavonoids was determined by aluminium trichloride assay. There were used different

combinations of methanolic (75%) solutions of flavonoids or phenolic acids, including 2 or 3

components. The mixture of two components was mixed in three different ratios (1:1, 1:2, 2:1),

mixture of three components in 1:1:1 ratio. The absorbance of all mixtures were compared with

standard solutions absorbances.

Keywords: flavonoids, phenolic compounds, interaction between antioxidants,

spectrophotometric methods

Acknowledgements

The study was financially supported by the Research Council of Lithuania. Project „Promotion of Students’

Scientific Activities“ (grant No. PS-15-07).

ISSN 2335-8653

18

Comparison Of Antioxidant Properties In Bee Pollen Fermented By Lactic

Acid Bacteria

Agnė Katilevičiūtė, Jurgita Mikašauskaitė, Vilma Kaškonienė

Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, LT-44404 Kaunas, Lithuania

In the recent years most of research were done about the bee pollen and bee bread components and

their useful properties. Bee collected pollen is very valuable natural product. It contains a large

amount of polyphenolic compounds. Pollen consist mainly of flavonoids which may act as

potential antioxidants. According to the published data, bee bread possess higher antioxidant

activity than bee pollen. However the production of bee bread by the bees is longer process than

collection of bee pollen. This study was focused on the production of artificial bee bread. There

are no data about artificially fermented bee pollen. The main task of this analysis was to perform

the fermentation of bee pollen using lactic acid bacteria and compare its antioxidant activity with

natural bee pollen. Phenolic compounds were analysed using spectrophotometric methods with

Folin-Ciocalteau reagent and results were expressed using rutin equivalents. Flavonoids analysis

was carried out by colorimetric reaction with aluminium trichloride, results were also expressed

using rutin equivalents. 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay was used for the evaluation

of radical scavenging activity in the samples. Bee pollen fermentation process was performed by

Lactobacillus rhamnosus and Lactobacillus delbruleckii lactic acid bacteria. Fermentation lasted

from 8 to 12 days, first 2 days at 37 degrees the remaining days at 22 degrees.

Keywords: Bee pollen, fermentation, antioxidant activity, lactic acid bacteria.

ISSN 2335-8653

19

The Impact Of Lactic Acid Bacteria Fermentation On Phytochemical

Composition Of Bee Pollen

Skaistė Mikulytė, Vilma Kaškonienė

Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, Kaunas, Lithuania,

skaiste.mikulyte@gmail.com

Abstract

Bee bread is the bee pollen with added honey and bee secretions and stored in the comb. Natural

fermentation of pollen in beehive lasts for a few months. The biological value of some medicinal

plants increases after lactic acid fermentation, but there is no literature data about the artificially

fermented pollen collected by bees. The aim of this study was to get product similar to the bee

bread, which has higher biological value compared to the natural bee pollen. Fermentation of bee

pollen was performed by lactic acid bacteria, namely Lactobacillus rhamnosus and Lactobacillus

delbruleckii. The influence of different parameters (medium composition, pH, temperature,

duration) to fermentation process was determined. Free radical 2,2-diphenyl-1-picrylhydrazyl

(DPPH) scavenging activity and total amounts of phenolic compounds and flavonoids were

evaluated using spectrophotometric methods.

Keywords: Bee pollen, fermentation, lactic acid bacteria, flavonoids, antiradical activity

Acknowledgements

The study was financially supported by the Research Council of Lithuania. Project „Promotion of Students’ Scientific

Activities“ (grant No. PS-15-08).

ISSN 2335-8653

20

Chemical Analysis Of Biologically Active Compounds Of Ground Ivy

(Glechoma Hederacea L.) Using Gas Chromatography/Mass Spectrometry

(Gc/Ms) Method

Justina Stasiulionytė1, Ona Ragažinskienė1, Violeta Bartkuvienė1

1Vytautas Magnus University, Faculty of Natural Sciences, Dept. of Biology, Vileikos 8, LT44404 Kaunas

Abstract

The present study deals with the composition of Glechoma hederacea L. six species from Kaunas

Botanical Garden of Vytautas Magnus University of different vegetation periods: buddying 2013,

buddying 2014, start of blossoming, massive blossoming, end of blossoming and frudification.

Essential oils produced by hydrodistillation were analysed using GC and GC / MS methods.The

most predominant compound was germacrene D (3.73-3.99%) and eucalyptol (3.67-4.11%). The

other major constituents were myrcene (3.07%), γ-pinene (2.83%), menthol (3.68-3.72%),

germacrene B (3.86-4.52%), estragole (5.05-5.30%), thymol (3.92-4.91%), β-elemene (3.56-

4.16%), carvacrol (5.42-5.83%), hexanol (3.32%), methyl- eugenol (4.50%). Germacrenes A, B

and C are less stable than germacrene D and they may be sometimes converted into β-, γ- and δ-

elemenes under GC conditions. Glechoma hederacea is known in traditional medicine. Its dried

leaves, flowers, stems contains more than 20 different essential oils.

Keywords: Gas chromatography, Glechoma hederacea L.

ISSN 2335-8653

21

Extraction From The Medicinal Raw Material Of Glechoma Hederacea L.

Optimization By Using Spectrophotometric Methods For Total Amount Of

Phenolic Compounds And For Evaluation Of Antioxidant Activity

Eurika Sukackaitė1, Ona Ragažinskienė1, Violeta Bartkuvienė1

1Vytautas Magnus University, Faculty of Natural Sciences, Dept. of Biology, Vileikos 8, LT44404 Kaunas

Lots of studies with medical raw material are being done because the need of herbal

medical products is rapidly increasing. Scientists are trying to find the most efficient technological

solutions. There is a great interest in herbal raw antioxidant activity. Antioxidants counteract

againts the progression of many chronic diseases. Phenolic compounds are natural antioxidants

and they can improve blood circulation, inhibit fat peroxidation and have anti-inflammatory effect.

Phenolic compounds are found in plants as secondary metabolites.

Glechoma hederacea L. is a potential, not fully known herb what gives an

inspiration to work harder with this plant. Besides, this herb is not mentioned in pharmacopoeial

articles although there is a huge amount of information that Glechoma hederacea L. could be very

useful in pharmacy. Glechoma hederacea L. is a widespread herb of the Nepetoideae subfamily

which is also known as ground ivy. It grows widely in Europe, southwestern Asia and has been

introduced to North America.

Spectrophotometric method enables to detect and evaluate phenolic compounds in

Glechoma hederacea L. This method is based on sample solution’s chemicals ability to absorb the

light. Extraction optimization must be done to obtain the best results. It allows to find out how to

get maximum of phenols. Two types of solvents were used in this study: methanol and ethanol.

0,2 g of five different plant life stages medical raw was filled up with 20 ml of different solvent.

After 24 hours of shaking they were filtered and analyzed spectrophotometrically. 100 of a

sample was mixed with 3 ml of 20% sodium carbonate solution and 100 of Folin – Ciocalteu

reagent (2N). Sample was incubated in room temperature for 30 min and then measured at 760

nm. Quantification was done with respect to the standard calibration curve of rutin. The biggest

amount of phenolic compounds was found in butonization phase, in phase when plant started

flowering and when Glechoma hederacea L. ripened it’s fruit. Many other researches need to be

done using different extraction conditions to get the biggest quantity of phenols.

Keywords: extraction optimization, Glechoma hederacea L., antioxidant activity.

References should be listed as below: [1] A. Matkowski, Adv Clin Exp Med, 2008, 17, 615-624, ISSN 1230-025X. Antioxidant Activity of Extracts and

Different Solvent Fractions of Glechoma hederacea L. and Orthosiphon stamineus (Benth.) Kudo.

ISSN 2335-8653

22

Determination Of Total Phenolic Compounds Content In Rhaponticum

Carthamoides (DC. Iljin) By Spectrophotometry Method In Different

Vegetation Phases.

Rūta Kuleševičiūtė1, Ona Ragažinskienė1, Violeta Bartkuvienė1

1Vytautas Magnus University, Faculty of Natural Sciences, Dept. of Biology, Vileikos 8, LT44404 Kaunas

Since ancient times people were using various herbs to heal illnesses, regain strenght

and improve health. One of many valuable herbs is Rhaponticum carthamoides (DC. Iljin) (also

known as Maral root). Rhaponticum carthamoides is poorly examined. For our experiment we use

Rhaponticum carthamoides (DC. Iljin) (rootstock, blossom and leafs) collected and prepared in

Vytautas Magnus University botanic garden. There was analysed these 5 phases: intensive growth

(2012-05-21), budding (2012-05-28), blossoming (2012-06-01), massive blossoming (2012-06-

05), ending of blossoming and frudification(2012-06-18). We made methanol extract and then

started the determination. The results showed that the biggest amount of phenolic compounds

were found in massive blossoming phase. Phenols determine plant colours, smell, affects growth.

ISSN 2335-8653

23

Association Of Single Nucleotide Polymorphisms With Freezing Tolerance

Traits In Perennial Ryegrass

Andrius Aleliūnas, Gintaras Brazauskas

Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, Instituto a. 1, Akademija, LT-

58344 Kėdainiai distr., Lithuania

e-mail: andrius.aleliunas@lzi.lt

Perennial ryegrass is a species of paramount economic importance used both for turf and forage.

However, it‘s poor winter survival limits the cultivation at northern latitudes. As freezing injury is

caused primarily by ice formation, LpIRI1 protein has the potential to minimize the damage as ice

recrystallization inhibitor. An association study was conducted using single nucleotide

polymorphisms obtained through allele sequencing of the LpIRI1 gene, while phenotypic data

were collected in a perennial ryegrass association mapping population of 76 diverse genotypes.

Tiller survival and electrolyte leakage at -8 °C and -12 °C were determined under controlled-

environment conditions, as well as proline content in cold-acclimated plants was measured prior to

the freezing test. Significant variation in all examined traits was observed among genotypes in this

panel. Electrolyte leakage and percentage of tiller survival revealed significant negative

correlations at -8 °C and -12 °C (rs = -0.40 and -0.49, repectively). Cold-acclimated plant proline

content, however, did not show significant correlations with any of the measured traits. The

association analysis of the LpIRI1 gene revealed two non-synonymous SNPs being associated with

increased electrolyte leakage at the freezing temperatures, both being located in the LpIRI1

leucine-rich repeat. The results indicate that allelic variation in the LpIRI1 gene has an important

role in the cell membrane integrity during freezing. Further population-wise testing of the freezing

tolerance in 155 diverse perennial ryegrass populations under controlled-environment conditions

will enable evaluation of freezing tolerance in populations which will be extended to the

identification of causal SNP markers confering higher freezing tolerance in populations combining

with population-wise GWAFF genotyping.

Keywords: Association mapping, electrolyte leakage, proline

ISSN 2335-8653

24

DNA Analysis Of 6 Actinidia L. Cultivars Using SSR Method

S.Bogačiovienė1, L.Česonienė2, R.Daubaras2, A.Paulauskas1, J.Žukauskienė1

1Department of Biology, Vytautas Magnus University, Vileikos str.8, LT-44404 Kaunas

2Kaunas Botanical Garden of Vytautas Magnus University, Ž. E. Žilibero 6, LT-46324 Kaunas

Email: s.bogacioviene@gmf.vdu.lt

Abstract

The genus Actinidia Lindl. is large, containing between 50 and 70 species of

climbing plants originating mainly in southern China [1]. Actinidia L. genus plants accumulate

large quantities of biologically active substances: vitamins, phenolic compounds, various organic

acids. These climbing Actinidia Lindl. genus plants are not only decorative, but the berries also

accumulate a lot of ascorbic acid [2]. Until now most research is dedicated to A. deliciosa and A.

chinensis species. Therefore A. kolomikta, A. arguta, A. melanandra, A. purpurea and A.callosa

species and varieties genetic and chemical studies will be new not only in Lithuania, but also

internationally.

For genetic analysis were used young Actinidia L. leaves, which were collected in

Vytautas Magnus University Kaunas Botanical Garden. The DNA was extracted of 6 cultivars

young leaves with a DNA-silica columns. Amplification was carried out on a Master Gradient

(Eppendorf, Germany) thermal cycler using the following temperature profile by Man et al. (2011)

: 95 ° C for 5 min; then 6 cycles of 94 ° C for 50 s, 61 ° C for 50 s, and 72 ° C for 1 min; followed

by 30 cycles of 94 ° C for 50 s, 56 ° C for 50 s, and 72 ° C for 1 min; finishing with 72 ° C for 8

min. The amplification products were separated on 8% denaturing polyacrylamide gel and

visualized by silver staining.

For analysis were selected A. melanandra, A. arguta and A. kolomikta cultivars. Six

microsatellite primers were selected for actinidia: EST24, EST64, EST147, GB-AA-393, GB-AA-

370, GB-AA-369. The primers were optimized and suitable for Actinidia L. genus plants genetic

diversity analysis. The total number of fragments was ranged from 1 to 8, and the size - from 100

bp to 250 bp. The most – 8 alleles detected with the primer GB-AA-393 at A. melanandra

cultivars “E2b” and “E1a”.

Keywords: Actinidia L., SSR method, Microsatellite Markers.

References: [1] Ferguson AR: The need for characterisation and evaluation of germplasm: kiwifruit as an example. Euphytica

2007, 154(3):371-382.

[2] Latocha, P. Aktinidia roślina ozdobna i owocowa. Warszawa 2006, 80 p. ISBN83-89211-77-7.

ISSN 2335-8653

25

The Dynamic Of Productivity And Somatic Cell Count In Milk Of Lithuanian

Black-And-White Cattles On The Influence Of Probiotic Additives And

Multienzyme Composition

J.Dailidavičienė1, R.Budreckienė2, R.Gružauskas3, S.Kerzienė4, S.Makauskas3

1Department of Animal Anatomy and Physiology, Lithuanian University of Health Science, Tilzes str. 18, Kaunas,

Lithuania, 2Department of Biochemistry, Lithuanian University of Health Science, 3Institute of Animal Rearing Technologies, Lithuanian University of Health Science, 4Department of Physics, Mathematics and Biophysics, Lithuanian University of Health Science.

Main author email address: Jurgita.Dailidaviciene@lsmuni.lt

Abstract

The probiotic additives of live yeast cultures (Saccharomyces cerevisiae) with organic selenium

have been added to diets for lactating dairy cows to attempt to improve ruminal fermentation,

potentially increasing dry matter intake and milk yield. Selenium plays a crucial and ubiquitous

role in the organism. The health benefits of selenium supplementation in ruminants are well

recognized. In dairy cows, this is directly reflected by the potential of selenium supplementation to

reduce somatic cell count (SCC) in milk and prevent sub-clinical mastitis. A universal

multienzyme composition increases productivity, feed energy exchange and digestibility of protein

and amino acids, improves feed conversion, reduces viscosity of the digestive tract and the

incidence of diarrhea.The effects of Saccharomyces cerevisiae and multienzyme composition

supplementation of 28 diary cows were investigated. Animals were divided into three

experimental groups (A, B, C) and Control group containing of 7 cows in each group. The cattle

had a standard, commonly balanced ration with the 40 g supplement of additive Biogrom® SC for

the Group A, 40 g supplement of additive Biogrom® Lux for the Group B and 0.2 g supplement of

additive Vilzim® for the Group C daily. Milk samples were analysed every 30 days during the 90

days period for milk yield, fat, protein, urea and SCC.

In this study live yeast and multienzyme composition supplementation to dairy cows significantly

increased milk production in all milking periods. Milk yield was 2.64 %, 1.75 % and 1.4 % higher

in Group A, B and C respectively comparing with the Control group. The SCC in milk in all

experimental groups were lower comparing to the Control group. The lowest SCC values were

evaluated in the B group after 60 days of experiment as well as there were the highest values of

SCC in the Control group after the 60 days of experiment. There were minimal dynamics of SCC

values in all other groups. The results indicate that probiotic additives and multienzyme

composition supplementation to dairy cows improved rumen environment in a way that increased

dry matter intake and stabilised rumen pH and in consequence enhanced the productivity and

decreased the SCC in milk.

ISSN 2335-8653

26

Chemical Composition And Biological Activity Of Bog Bilberries And

Blueberries

Agnese Huna, Laura Klavina, Diana Dudare

University of Latvia, Geography and Earth science faculty, email: agnese.huna@gmail.com

Abstract

One of the biggest values in Latvia are woods which provides resources such as berries. Bog

bilberry Vaccinium uliginosum L. is higher plant belonging to Eric family. In Latvian conditions

bog bilberry are very common species it is because of the damp forest and marsh habitats –

especially moss and nearby wet forests, which are suitable for the growth of bilberries and

blueberries. In forests this naturally-growing berries (blueberries Vaccinium corymbosum and

bilberries Vaccinium uliginosum L.) often are mixed with each other that is why bog bilberries are

rarely used in food and poorly studied.

Optimal growing conditions of bilberries and best growing areas are not completely studied, but

what is more important – there are very little studies about bog bilberries chemical composition

and biologically active substances. That is why researches about bog bilberry extraction,

extraction condition optimization, chemical composition and biologically active substances are

very important. For the further research of berries while maintaining maximal diversity of

chemical compounds, bilberries and blueberries were dried in liofilizator. For optimization of

extraction conditions and berry biological active indicator determination several extracts were

prepared and used different extraction methods. As extrahents were used: methanol, ethanol,

acetone, DMSO, dioxane, followed by after-treatment: ultrasonic bath, microwave apparatus, and

supercritical CO2 extraction. Extraction efficency was evaluated based on number of parameters.

In research were analyzed compound group indicators –total amount of polyphenols, flavonoids,

carbohydrates and radical scavenging activity as well as dry matter content.

Results showed that increase of solvent dilution with water (ethanol, DMSO, acetons) reduce

amount of polyphenols, while methanol extracts showed higher results with presence of water.

The optimum extrahent in Vaccinium uliginosum L. extraction are 96% ethanol and 100% acetone,

in the meantime duration of treatment with ultrasound does not cause significant differences in

contentrations of extracted substances. Results shows that one of the most optimal treatment is

microwave, but the most effective results shows treatment with supercritical CO2. Obtained results

indicate that there are a relationship between the total amount of polyphenols and antiradical

activity. Especially high correlation between these indicators shows enthanol, acetone, DMSO

extracts. However antiradical activity in bog bilberry extracts determines not only amount of

polyphenols, but also presence of other compounds – as evidence the high correlations between

other indicators (carbohydrate-flavonoids, dry matter-flavonoids, carbohydrate-dry matter).

ISSN 2335-8653

27

Extraction And Analysis Of Moss Secondary Metabolites

Laura Klavina, Gunta Springe, Diana Dudare

Department of Environmental science, University of Latvia, Raina Blvd. 19, Riga, Latvia, corresponding author:

laura.klavina@lu.lv

Abstract

Secondary metabolites in plants are responsible for such functions as adaptation and defense

against herbivores and diseases. Plant secondary metabolites are often used as flavorings, food

additives and for bioprospecting of new pharmaceuticals, at first, studying secondary metabolites

of higher plants. Nevertheless research has shown many new secondary metabolites with

biological activity can also be found in lower plants, such as mosses. This study aimed to extract

and analyse secondary metabolites of mosses characteristic for Northern Europe. In order to better

evaluate amount and diversity of secondary metabolites in mosses 2 types of extracts were

prepared. 15 moss species from Northern Europe forest and bog ecosystems were chosen.

Extraction was done using two types of methods and solvents- microwave extraction with 60%

ethanol and ultrasound extraction using chloroform. To better evaluate approximate amount of

secondary metabolites in mosses 13C NMR analysis was done before and after exhaustive

extraction. Ethanol extracts were tested using LC-TOF analysis for more hydrophilic substances

such as amino acids and polyphenols. Standard for LC-MS analysis was gallic acid. Chloroform

extracts were analysed using GC-MS analysis for hydrophobic substances. Hydrophobic extracts

prior to analysis were silylated using BSTFA+TMS for higher volatility of some substances. For

GC-MS analysis two standards were used – palmitic acid and progesterone, substance

identification was done using NIST MS search 2.0 databases. No major differences were seen in

comparison between 13C NMR before and after exhaustive extraction. Obtained results suggest

that secondary metabolite content in mosses is lower than initially expected. In ethanol extracts a

range of polyphenols and amino acids were identified and quantified, but as expected the amounts

of these substances were not high. The differences between different moss species were seen, but

no characteristic substances for moss species were detected. Approximately 100 substances were

identified using GC-MS analysis. High number of different substances has been identified in the

extracts of mosses, as well as there can be found many unidentified peeks, which allows further

investigation.

Acknowledgments: This work was supported by the ESF project Nr. 2014/0009/1DP/

1.1.1.2.0/13/APIA/VIAA/044.

ISSN 2335-8653

28

Anthropo-Genetical Exploration Of Human Skeletal Remains From

Archeological Site Rousínov – Ferobet

Kamila Gajduskova1, Ondrej Sedo2, Eva Drozdova3 1, Laboratory of Biological and Molecular Anthropology, Masaryk University, Brno

2The Institute of Archaeology of the Academy of Sciences of the Czech Republic, Brno 3 Laboratory of Biological and Molecular Anthropology, Masaryk University, Brno

k.gajduskova@email.cz

Abstract

The most interesting archaeological findings are usually discovered during rescue excavations.

During rescue excavation in Rousínov archeologists found crouched skeleton provisionally dated

to the period of the Moravian painted pottery ware culture or to the Roman period. Discovery of

such an old skeletal material presents a rare opportunity to study a member of historical

populations. Significantly damaged skeletal remains have for an anthropological research

relatively little value. In such cases comes the genetic analysis, which allows to obtain biological

information from ancient DNA extracted from damaged skeletal material where anthropology with

morphological analysis can not succeed. The aim of this paper is to propose an anthropological

and genetic processing of skeletal material with regard to dating, circumstances of skeleton

finding and archaeological theory. It includes mechanical processing, next it is described the

anthropological analysis mainly age, which is necessary for further research. The last part is

connected with genetic analysis, which deals with the determination of gender, population

genetics, determination of blood groups and pigmentation.

Keywords: anthropology, aDNA, genotypization, sex determination, age determination,

population genetics, ABO System, pigmentation

References:

[1] Adler C. J., Haak W., Donlon D., Cooper A., The Genographic Consortium. 2011. Survival and recovery of DNA

from ancient teeth and bones. Journal of Archaeological Science 38: 956–964

[2] Bass W. M. 2005. Human Osteology. A Laboratory Field Manual. Columbia, Special Publication of the Missouri

Archaeological Society. 5th Edition.

[3] Cappellini E., Chiarellia B., Sineob L., Casolic A., Di Gioiac A., Vernesid C., Biellae M. C., Caramelli D. 2004.

Biomolecular study of the human remains from tomb 5859 in the Etruscan necropolis of Monterozzi, Tarquinia

(Viterbo, Italy). Journal of Archaeological Science 31: 603–612

[4] Walsh S., Chaitanya L., Clarisse L., Wirken L., Draus-Barini J., Kovatsi L., Maeda H., Ishikawa T. 2014.

Developmental validation of the HIrisPlex system: DNA-based eye and hair colour prediction for forensic and

anthropological usage. Forensic Science International: Genetics 9: 150–161

ISSN 2335-8653

29

Genetic Characteristic Of Dermacentor Reticulatus Ticks Using 12S And 16S

Rrna Markers

Matas Galdikas, Jana Radzijevskaja, Algimantas Paulauskas1

1Vytautas Magnus University

E-mail address to the main (corresponding) author (Times New Roman 10, Italic, and Centered)

Abstract

Dermacentor spp. ticks are obligate hematophagous ectoparasites of wide range of mammals.

Over past few decades these ticks have been spreading rapidly through Europe. Molecular

phylogeny of this species is not yet properly described. In this study we analyzed genetic diversity

of D. reticulatus using 12S and 16S ribosomal RNA sequences. D. reticulatus were collected from

six different locations in Lithuania. DNA from ticks was extracted by lyses in 2.5% ammonium

hydroxide solution. We successfully amplified and sequenced 380 bp fragments of 12S rRNA

derived from D. reticulatus ticks and compared obtained sequences with those previously

published in Gene Bank. The sequences of the 12S rRNA obtained from ticks collected in

Lithuania were identical to each other and 100–99.9% were similar to the corresponding D.

reticulatus 12S rRNA sequences from Gene Bank. Investigation of 12S rRNA gene of

mitochondrial DNA showed that this marker is not very suitable for D. reticulatus intraspecific

diversity. However it could be useful for taxonomical identification of Dermacentor species, and

investigation of interspecific diversity.

Keywords: Dermacentor reticulatus ticks, 12S rRNA, 16S rRNA, genetic diversity

ISSN 2335-8653

30

Nptx2 And Chi3l1 Genes Promoters Methylation Status And Expression Level

In Different Grade Of Gliomas

I. Golubickaitė, R. Stakaitis, D. Skiriutė, P. Vaitkienė, A. Kazlauskas, A. Bunevičius, G.

Steponaitis

Laboratoty of Neurooncology and genetics, Neuroscience Institute, Lithuanian University of Health Sciences, Eiveniu

str. 4, Kaunas, LT 50009, Lithuania; E-mail: r.stakaicio@gmail.com

Background. Gliomas are the most common malignancies in central nervous system classified by

whether they are low-grade (I or II) or high-grade (III or IV). It is hard to accurately characterize

gliomas only by its morphological appearance. That is why molecular examination is needed to

improve accuracy and efficiency of diagnostics, prognostics and treatment. Unfortunately there is

not enough systematic information about genetic and epigenetic factors in glioma which could be

used as a potential biomarkers. The purpose of this research was to investigate how methylation

and expression levels of NPTX2 and CHI3L1 genes reflects on glioma malignancy and patients’

clinical outcome. NPTX2 gene over-expression induces apoptosis, prevents proliferation and

independent growth, makes glioma cells chemosensitive. CHI3L1 gene is involved in anti-

apoptotic pathways, promoting angiogenesis and remodeling of extracellular matrix. Thus making

NPTX2 gene an oncosuppressor and CHI3L1 gene – oncogene.

Material and methods. 150 astrocytomas with different grade of malignancy were used for this

study: 13 grade I, 43 grade II, 27 grade III, 67 grade IV. Brain tumor tissue specimens after

dissection were snap-frozen in liquid nitrogen and stored until analysis. Tumor DNA and RNA

was purified from 50-100mg of frozen tissue using salting-out and TRIzol methods respectively.

Methylation status of gene promoter was detected by MS-PCR followed by DNA bisulfite

treatment. PCR products were analyzed by 2% agarose gel electrophoresis. mRNA expression

level was detected by two step quantitative RT-PCR using TaqMan probes for target genes and

SybrGreen I for endogenous control – B-actin.

Results. Consistently increased NPTX2 gene promoter methylation frequency was typical for

higher malignant tumor: 0% (0 out of 13) of I grade, 30,43% (9 out of 43) of II grade, 39% (11 out

of 27) of III grade and 63,01% (51 out of 67) of IV (GBM) glioma patients. These data were in

line with tendency of decreased mRNA expression in higher degree of malignancy. Survival

analysis revealed strong association between patient survival and NPTX2 gene methylation

(Mantel-Cox p<0.001). Log Rank (Mantel-Cox) test did not reveal significant (p=0.411)

differences between NPTX2 mRNA expression groups and patient survival. mRNA expression of

CHI3L1 was found to be upregulated in higher malignancy tumors, while promoter methylation of

this gene did not show relation between glioma grades. Survival analysis showed that patients

with higher CHI3L1 mRNA expression had significant poorer survival prognosis than patients

with medium or low expression (Mantel-Cox p<0.001). Pilot study data indicates that both of

analyzed targets are related with gliomagenesis process and after further research could potentially

be used as a diagnostic and/or prognostic biomarkers for glial tumor.

Keywords. Glioma, NPTX2, CHI3L1, epigenetics, mRNA, expression, methylation, CNS

ISSN 2335-8653

31

Hazel Dormouse (Muscardinus Avellanarius) Genetic Variability Research In

Lithuania

Kamilė Morkutė1, Algimantas Paulauskas1, Vaclovas Gedminas2

1-Faculty of Natural Science, Vytautas Magnus University, Vileikos 8, LT - 44404 Kaunas, Lithuania,

2 –Kaunas Tadas Ivanauskas Zoological Museum, Laisvės 106, LT – 44253 Kaunas, Lithuania

e-mail: a.paulauskas@gmf.vdu.lt

Abstract

A preliminary genetic analysis of common dormouse was conducted on 17 samples (13 were

taken from 9 different Lithuania locations and 4 samples from Latvia) collected in 2013-2014.

DNA was extracted from hair using the DNeasy Tissue kit (Qiagen Inc., Valencia, CA, USA)

following the manufacturer‘s instructions. In order to assess the genetic diversity of the common

dormouse 5 microsatellite loci were used (Mav002, Mav005, Mav011, Mav023 and Mav028).

PAAG electrophoresis results showed 41 polymorphic loci with fragment size - from 120 to 300

base pairs. Data genetic variability were evaluated using GenAlEx and MEGA 6.06 software.

Neither's genetic distance between dormouse populations studied ranged from 0.291 to 1.219.

Keywords: dormouse, Muscardinus avellanarius, non-invasive, microsatellite

References: [1] Mills C. A. Conservation Genet Resour, 2013, 5, 687–692.

ISSN 2335-8653

32

Comparison Of Cyclosporine And Erythropoietin In The Experimental Model

Of Acute Myocardial Injury

AlesyaV. Korda, VolhaF.Kardash, Natalia G.Tihonova

Scientific Practical Centre Of Hygiene

E-mail: Kordo18@mail.ru

Abstract

Recent experimental evidence suggests that cyclosporine (C) and erythropoietin (EPO) has been

shown to exert cytoprotective effects. However there are few studies which compare cyclosporine

and erythropoietin cardioprotective effects.

Aim of the study was to compare cyclosporine and erythropoietin cardioprotective effects.

Materials and Methods. All the animals used in this study received human care in compliance with the “Principles of

Laboratory Animal Care” formulated by the National Society for Medical Research and the

“Guide for the Care and Use of Laboratory Animals”. Acute myocardial injury in Wistar rats

(n=6, DG) induced by dopamine (D) (3 mg/kg) intravenous (iv) injection. Wistar rats in C group

(CG, n=6) were treated with C (10 mg/kg) and then the same dose of D. Wistar rats in EPO group

(EG, n=6) were treated with EPO-β (2000 U/kg) and then the same dose of D. Six Wistar rats with

0.9% NaCl solution iv injection saved as a control (KG). Protective effects were assessed by

electrocardiogram (ECG) and creatine kinase (CK) assay. Bioelectric activity of the rat

myocardium was recorded under anesthesia (10% thiopental sodium) in II standard lead by the

computer electrocardiographs ‘Poly-Spectrum 8/B’(‘Neurosoft’, Russia) at base and during 30

minutes after D injection.Amplitude and time parameters, cardiac arrhythmias(VTA) (in

accordance with the international agreement Lambeth Conventions)were estimated. Blood

samples were obtained by carotid artery puncture at 31st minute. The CK levels in the blood serum

were determined with biochemical commercial sets Cormay-Diana (Belarus) in the semi-

automatical photometer «DialabAutolyzer» (Austria). Statistical analysis was conducted with the

use of nonparametric Mann- Whitney test for independent samples in the application package

STATISTICA 6.0.

Results.

VTAarrhythmias afterinjection of D were observed in 6, 2 and 3 animals from DG, CG and EG,

respectively (p<0.05).RS-T segment elevation after drugs injection was more pronounced

(p<0.02) in DG (0.10[0.07;0.12]mV) and EG (0.10[0.09;0.011]mV) than in CG (0.02[0.02;0.03]

mV). CK level increased up to 5642.5 [4151.5-7154.0] U/l in DG. There were no differences in

CK level between CG and KG, EG and KG. However CK level in EG (2621.0 [1855.0-

3633.0]U/l) was elevated compared with CG (1644.0 [1512.0-2299.0]U/l, p=0.043).

Conclusions. It can be concluded that cyclosporine significantly reduces ischemic damage in

myocardial experimental animals and so has a more pronounced cardioprotective effect compared

with erythropoietin-β.

Keywords: Cyclosporine, Erythropoietin, Dopamine, Cardioprotection.

ISSN 2335-8653

33

The Yeasts Strains Isolated From The Berries In Lithuania And Belarus

Irina Kolesnik1, Juliana Lukša2, Živilė Strazdaitė-Žielienė2, Ramunė Stanevičienė2, Vytautas

Melvydas2, Elena Serviene2

1 Yanka Kupala State University of Grodno, Ozheshko str. 22, 230023, Grodno, Belarus.

E-mail: i.kolesnik@grsu.by 2 Laboratory of Genetics, Institute of Botany, Nature Research Centre, Akademijos St. 2, LT-08412 Vilnius, Lithuania.

E-mail: elena.serviene@botanika.lt

Abstract

The biodiversity of the yeast is widely investigated in all winemaking subareas, therefore the

strains of the autochthonous starter cultures are of interest for regional wine production. The most

important isolates are selected by conventional molecular and growth tests and applied for further

analysis.

The aim of our research was to analyze the yeast strains isolated from spontaneous plums,

strawberry, currants, cherries, strawberries, blueberries and grape fermentations, to compare their

morphological and physiological features and perform molecular identification. The material for

the study was collected during 2014 summer period in Vilnius and Grodno regions. Yeasts were

cultivated on solid medium YEPD with chloramphenicol and analyzed by applying

microbiological and molecular biology methods.

Based on the growth in liquid media, the yeast strains divided into 2 groups, independently

on the place of the gathering and sort of the berries. The first group formed sediment on the third

day of growth; the second group was distinguished by the ring on the surface of the liquid growth

medium and at the same time formed sediment. The yeast colonies varied in size (from 2 to 4

mm), surface (smooth, folded and grained) and consistency (oleaginous, paste-like).

Some differences in cell parameters of yeast spread in different regions were observed

microscopically. In liquid nutrient medium, strains have formed the cells of various shapes -

round, oval, elongated. In the yeast isolated from Belarus berries, the length of the cells varied

from 5.03 ± 0.31 µm to 7.91 ± 0.33 µm, and the width ranged from 3.69 ± 0.19 µm to 4.92 ± 0.15

µm. In strains isolated from Lithuania plants, the length of the cells varied from 6.04 ± 0,33 µm to

9.32 ± 0.31 µm, and the width ranged from 4.08 ± 0.12 µm to 4.13 ±0.16 µm.

Molecular approaches have been used for genotyping of yeast strains. Genomic DNA was

isolated and internal transcribed spacer of regions 1 and 4 of the rRNA gene operon have been

amplified by PCR. Based on ITS fragment length polymorphism and restriction fragment length

polymorphism as well as phenotypic characteristics, several yeast strains were assigned to

Saccharomyces, Metschnikowia, Hanseniaspora, Pichia and Zygosaccharomyces species.

Keywords: yeast, spontaneous fermentations.

Acknowledgement: This research work was financially supported by the Education Exchanges

Support Foundation Higher education Programmes Unit (Lithuanian state scholarships No. AM-

2014-LT-1311).

ISSN 2335-8653

34

Odontological Problem In Ophthalmological Practice

Aušra Povilauskienė2, Albertas Kriaučiūnas1, Regina Marija Stakaitytė3, Rasa

Liutkevičienė1,2, Loresa Kriaučiūnienė1,2 1Lithuanian University of Health Sciences; 2Ophthalmological department; 3Oral and Maxillofacial surgery

department

E-mail address of the main (corresponding) author: loresa@takas.lt

Abstract

Aim: In this case we want to show, what influence odontological problems have (in this case -

periodontitis) to eye structures pathological processes (in this case - scleritis).

Methods and materials: 55 years old female was investigated in Kaunas Eye Clinic. She had

severe pain in left eye. We could see hard irritation of the left eye. The movements of the eyeball

were very painfull. Ultrasonic eye examination of the left eye revealed increased posterior wall

thickness to 1,26mm. Objective ophthalmological examination showed diagnosis of acute scleritis

(posterior wall inflammation).

Results: After full ophthalmological examination and precise anamnesis we detected

odontological problem. Patient undergo odontological examination. Orthopantomogram revealed

multiple periodontal and periapical inflammations in maxilla and mandibula. Most intensive

periodontitis was in the left side of maxilla and mandibulla, in the same side as pathology of the

left eye (scleritis). The problem of periodontitis patient had for about two years and it hasn’t been

treated. In ophthalmological treatment we used hormone-therapy. But final results can only be

received after full treatment of periodontitis.

Conclusion: 1. Odontological problem can be the background of an ophthalmological problem. 2.

During ohpthalmological examination, much more attention must be paid to odontological

treatment of infection.

Keywords: odontology, ophthalmology, periodontitis, scleritis.

ISSN 2335-8653

35

Occurence Of Methicillin-Resistant Staphylococci In Broilers And Wild Birds

Lina Vaškevičiūtė, Modestas Ružauskas, Rita Šiugždinienė, Irena Klimienė, Marius

Virgailis, Raimundas Mockeliūnas

Microbiology and Virology Institute, Lithuanian University of Health Sciences

lina.vaskeviciute@lsmuni.lt

Abstract

The resistance of bacteria to antimicrobials becomes a rising health problem in the world. The aim

of the study was to investigate the presence and frequency of methicillin- resistant staphyloccoci

prevalent in broilers and wild birds.

For this purpose faecal samples of slaughtered broilers from three large poultry farms (n=357) as

well as feaces from wild birds (n=270) were collected at Kaunas city dump. For Staphylococcus

isolation Mannitol Salt Agar (Oxoid) was used. Species identification was performed using

MicrobactTM12S (Oxoid) biochemical identification system. Minimum inhibitory concentrations

of oxacillin were determined using “Sensititre” plates and ARIS 2X (Thermo Fisher) incubator.

Interpretation of results was based on EUCAST recommendations. Detection of mec genes in

resistant isolates was performed by PCR.

The rate of Staphylococcus spp. isolation was 56.3% from broilers and 65.6% from wild birds.

Phenotypical resistance to oxacillin was 9.9% and 9.6% in broiler and wild birds isolates

respectively. The mecA gene was detected in 30% of the isolates from broilers and in 42.3% of the

isolates from wild birds. The mecC gene was not detected. Fourteen species of Staphylococcus

were found to be methicillin-resistant. The most prevalent methicillin-resistant species from

broilers was S. hyicus 25%, whereas S. xylosus was the most prevalent species in wild birds

19.2%. Among methicillin-resistant staphylococci S. aureus (MRSA) was identified in 10% from

the total number of broilers isolates and in 15.4% of the wild birds isolates. Another most

frequently detected methicillin-resistant species included S. warneri, S. haemolyticus, S. caprae

and S. cohnii.

Conclusions. Methicillin-resistant staphylococci including MRSA are prevalent both in broilers

and in wild birds. Large variety of methicillin-resistant Staphylococcus species were detected

during this study. The results obtained indicate that safety measures according to the protection of

domestic birds from contact with wild birds (and vice versa) should be implemented.

Keywords: staphyloccoci, antimicrobial resistance, poultry, wild birds, genes.

Acknowledgements: this research was funded by a grant SVE-05/2014 from the

Research Council of Lithuania and by a grant for L. Vaškevičiūtė PhD studies supported by

LUHS.

ISSN 2335-8653

36

Phototropic Responses Of Garden Cress Leaves To Ultraviolet-A And Blue

Light In Artificial Microgravity Environment

R. Losinska-Sičiūnienė, R. Stanevičienė, D. Švegždienė, D. Raklevičienė

Nature Research Centre, Institute of Botany, Akademijos 2, Vilnius LT-08412, Lithuanian,

E-mail: regina.ska@gmail.com

Abstract

Light and Earth’s gravity (1g) are used by plant to orient body parts to more suitable environments. It is

well established that phototropism is predominantly a blue-light effect; however, blue light is not the only

wavelength that can elicit alike effect. Only microgravity (weightlessness) environment provide an

opportunity to distinguish the effects of light from those of gravity. The aim of this research was to reveal

the growth responses of garden cress (Lepidium sativum L.) leaves to separate or simultaneous irradiation

with ultraviolet-A (UV-A) and blue light in microgravity environment simulated by slow horizontal

clinostat (3 rpm). The illumination was performed by an original autonomous lighting system which had

been made using UV-A (370 nm) and blue (450 nm) light emitting diodes. Before the test, the plants were

grown for 8 days under a 12 h white light/12 h dark cycle vertically and then divided in two groups. The

first group has been transferred to the clinostat while the other one – remained to grow vertically. After 24

hours in the darkness, the appropriate irradiation has been applied laterally to the base of leaves. The

response of cotyledons and true leaves in degrees was measured during the 3-h period. It was determined

that the leaves of both types showed a comparable movement towards the UV-A source. After 3 hours,

their response reached the angle of 25° in microgravity, while it was two times smaller under the natural

gravity. Blue light effect on the response of true leaves was found to be more pronounced than that of

cotyledons throughout whole lighting period. After 3 hours in microgravity, the curvature of true leaves

equaled to the angle of 34° and that of cotyledons – 29°. Under the gravity, true leaves and cotyledons

curved by the angle of 25° and 19°, respectively. There the simultaneous illumination by blue light and

UV-A provoked any phototropic response of cotyledons though a slight bending of true leaves has been

observed after two hours. In microgravity, that illumination induced active curving up to 32-36 degrees in

both type leaves. In summary, the leaves show phototropic responses to UV-A irradiation as well as to blue

light. The phototropic movement is more evident in microgravity than under Earth’s gravity. Obtained data

allow a supposition about a being of interactions between signaling pathways of both spectral components

which are integrated with gravity signaling pathway.

Keywords: microgravity, clinostat, UV-A, blue light, leaf, phototropism

ISSN 2335-8653

37

Genetic Diversity In Vaccinium Corymbosum, V. Australe, And V.

Angustifolium Based On Microsatellite Analysis

D. Mardosaitė-Busaitienė1, R. Rugienius3, J.Žukauskienė1, A.Paulauskas1, S.Bogačiovienė1,

L.Česonienė2, R.Daubaras2

1Faculty of Natural Sciences, Vytautas Magnus University, Vileikos 8, LT- 44404 Kaunas, Lithuania,2Kaunas

Botanical Garden of Vytautas Magnus University, Ž.E. Žilibero 6, LT-46324, Kaunas, Lithuania, 3Institute of

Horticulture LRCAF, Kaunas st. 30, Babtai, LT-54333, Kaunas dist., Lithuania dalytemardosaite@gmail.com

Abstract

Poland research center for cultivar testing (COBORU) certified two Lithuanian cultivars 'Freda'

and 'Danutė' of blueberry at the end of 2011. These two cultivars have passed the international

expertise and satisfied all the requirements for varieties distinctness, uniformity and stability.

According to that we decided to accomplish genetic analysis using microsatelite markers and

compare 54 genotypes of highbush, lowbush and half-highbush blueberry, that is new Lithuanian

cultivars, up-and-coming New Zelandand German genotypes (cultivars and selected clones) and

variuos certified cultivars. Using eight of thirty microsatellite markers (SSRs) to determine genetic

diversity between blueberry gentotypes. Total amount of 195 alleles were detected with eight

primers. They ranged from 4 to 37 per primer. The most unique alleles were determined for

genotypes of high bush blueberry. The genotypes of New Zealand and German breeding were

characteristic of 8 unique allele sand Lithuanian cultivars contained 9 unique alleles. Cluster

analysis was performed by the UPGMA classified 54 genotypes into two clusters, Lithuanian

cultivars ‘Danutė’ and ‘Freda’ was in one cluster with N. Zeland varieties.

This work was partly supported by project "Promotion of Student Scientific Activities" (VP1-3.1-

ŠMM-01-V-02-003) from the Research Council of Lithuania (D.M.-B.). This project is funded by

the Republic of Lithuania and European Social Fund under the 2007-2013 Human Resources

Development Operational Programme’s priority 3.

Keywords: blueberry, Vaccinium corymbosum L., SSR, molecular markers

ISSN 2335-8653

38

Synergistic And Antagonistic Interactions Between Secondary Metabolites In

Monarda Didyma L. And Angelica Archangelica L.

Ruta Mickiene1, Ona Ragazinskiene2, Audrius Sigitas Maruska1

1Vytautas Magnus University, Faculty of Natural Sciences, Vileikos st. 8-204, LT-44404 Kaunas, Lithuania 2 Kaunas Botanical Garden of Vytautas Magnus University, Z.E. Zilibero st., LT-46324 Kaunas, Lithuania

mickiene@lva.lt

Abstract

This research focuses on synergistic and antagonistic interactions between secondary

metabolites in Monarda didyma L., Angelica archangelica L. and antimicrobial activities of

compounds isolated and identified from these species. The compounds pinene-α, terpinene-α,

terpinene-γ, borneol, terpinen-4-ol, terpineol-α, estragole, methyl thymol, thymoquinone,

caryophyllene, murolene-γ, germacrene, cadinene-δ, thymohydroquinone, phytone, hexadecanol,

limonene, α-pinene, phellandrene-d-α, carophyllene-β, linalool, borneol, four macrocyclic

lactones, various coumarins and other compounds were tested for their ability to compose the

synergistic and antagonistic interactions. The antimicrobial activity of combinations secondary

metabolites in Monarda didyma L. and Angelica archangelica L. originated from the sector of

medicinal plants, Kaunas botanical garden of Vytautas Magnus University Lithuania, were tested

by the method of series dilutions, against different bacteria species. This is a novel study of

synergistic and antagonistic interactions between combinations plant secondary metabolites.

Investigated microorganisms were Escherichia coli, Proteus vulgaris and Staphylococcus aureus

with and without antibiotic resistances originating from livestock. The antimicrobial activities of

extracts were described by determination of the minimal inhibitory concentration. The total

amounts of phenolic compounds and total amounts of flavonoids were tested in the methanolic

extracts of the plants. Identification of the phenolic compounds and evaluation of the radical

scavenging activity of the compounds were performed by means of high performance liquid

chromatography coupled with on-line 2.2-diphenyl-1-picrylhydrazyl radical scavenging reaction

detection (HPLC-DPPH) analysis. The essential oils were analyzed by gas chromatography – mass

spectrometry (GC-MS). Strong synergy of phenolic fraction and essential oils of the plants was

determined against the tested bacteria.

Keywords: synergism, antagonism, secondary metabolites, antimicrobial activities, plant,

essential oils, phenols.

ISSN 2335-8653

39

Morphological Identification Of Digenean Isthmiophora Melis (Digenea:

Echinostomatidae) From Mustelids In Lithuania

Dovilė Nugaraitė, Vytautas Mažeika, Algimantas Paulauskas

Vytautas Magnus University, Department of Biology, Vileikos str. 8, Kaunas LT-44404, Lithuania,

E-mail address to (corresponding) author: d.nugaraite@gmf.vdu.lt

Isthmiophora melis belongs to the family Echinostomatidae and had one of the most complicated

and richest history. This species parasitize in small intestine of order Carnivora in Europe, Asia

and North America. I. melis is important in veterinary and medicine as it can parasitize more than

thirty species of vertebrates including humans (Radev et al., 2009). Family Echinostomatidae is

characterized by high morphological diversity. The aim of recent study was to identify flukes from

mustelids by morphological features.

The flukes were collected from American mink (Neovison vison) and European polecat (Mustela

putorius). Mustelids were hunted from different localities of Lithuania in the period 2011–2014.

Specimens were processed for morphological studies following standard procedures of temporary

and permanent preparations. Measurements were made using temporary preparations. Digeneans

were characterized by 34 features described by Kostadinova and Gibson (2002).

Digeneans from both species of mustelids have short forebody (16.6% of body length), dorsal

aboral collar (61×13) spines are shorter than dorsal oral ones (67×14), post-testicular region is

very long (38.8%), very long armed cirrus, short (1-15%) uterus, large eggs (134×85) and small

collar and large 27 collar spines. On bases of these features flukes were identified as Isthmiophora

melis.

Keywords: Isthmiophora melis, Neovison vison, Mustela putorius

References

[1] A. Kostadinova, D.I Gibson, Systematic Parasitology. 2002, 52(3), 205-217

[2] V. Radev, I. Kanev, D. Khrusanov, B. Fried. Parazitologiia. 2009, 43(6), 445-453

ISSN 2335-8653

40

Investigation Of Tick-Borne Pathogens In Baltic Countries

Algimantas Paulauskas

Vytautas Magnus University, Vileikos 8, Kaunas, Lithuania E-mail address a.paulauskas@gmf.vdu.lt

Abstract

Tick-borne diseases are of major importance on human and animal health in the world. Tick-borne

diseases are increasingly recognized as important threats to public health in Baltic countires. The

ecology and epidemiology of tick-borne diseases are complex and diverse, and affected by the

relationship between the pathogen, the host (vector or vertebrate host) and the environment. For

today tick-borne encephalitis (TBE), Lyme borreliosis are widely distributed and well recognized

tick-borne diseases in Baltic States. The geographical and spatial distributions of some European

tick vectors have been changing in the last few decades, and new viral, bacterial and protozoan

tick-borne pathogens have been detected in former non-endemic areas. During the past two

decades D. reticulatus has expanded its range in the Baltic countries, and new localities with D.

reticulatus occurrence have been found in Latvia. Canine babesiosis has emerged in Latvia and

become widely distributed and quite frequent in Lithuania. Climatic changes, the significant

increase of tourism and travel of dogs across Europe have caused an increase in the geographical

range of different infections. In recent years Baltic countries have witnessed the introduction of

previously unknown human and animal pathogen. In recent years the variability of ticks and tick-

borne pathogens in Baltic countries has been investigated. The advances in molecular biology

during the last two decades and using of molecular diagnostic techniques have allowed researchers

in Baltic countries to better diagnose, trace and characterize pathogens, and have led to the

discovery of new vector-borne pathogenic organisms.

Keywords: Tick-borne diseases, Baltic countries.

ISSN 2335-8653

41

Staphylococcus Hominis Isolated From Hospital Patient Resistance To

Antibiotics And Resistance To Antimicrobial Genes

Alvydas Pavilonis, Rita Plančiūnienė, Žaneta Maželienė, Povilas Kavaliauskas, Modestas

Ružauskas, Marius Virgailis, Irena Klimienė, Rita Šiugždinienė, Raimundas Mockeliūnas

Microbiology and Virology Institute, Lithuanian University of Health Sciences

alvydas.pavilonis@lsmuni.lt

Abstract

The aim of this study was to determine antimicrobial resistance to antibiotics level Staphylococcus

hominis isolated from hospital patients.

One hundred twenty-five samples were tested for isolated Staphylococcus hominis (S. hominis).

Isolation of staphylococci was performed using Mannitol Salt Agar and Plasmacoagulase test was

performed as well. Species identification was performed using Microgen Staph ID (Microgen

Bioproducts) as well as 16S rRNR gene sequencing. Antimicrobial susceptibility was performed

using “Sensititre” (Trek Diagnostic Systems) plates. Interpretation of results were evaluated

according to EUCAST recommendations. Genes encoding resistance to separate classes of

antimicrobials were detected by PCR.

125 hospital patients were investigate. Thirty one isolates of Staphylococcus hominis was obtained

from humans patients (24.8%). 26 (83.9%) S. hominis strains were obtained from 31 demonstrated

resistance to one or more antibiotcs. The resistance of S. hominis isolates was detected to

penicillin (77.41%) and ampicillin (61.2%), erythromycin (80.6%), tetracycline (48.3%),

trimethoprim/sulfamethoxazole (25.8%), ciprofloxacin (25.8%), clindamycin (29.0%),

gatifloxacin (22.5%), levofloxacin (19.3%), rifampin (9.6%) and gentamicin (6.4%). 11 (35.5%)

isolated from S. hominis strains were resistant to methicillin, all strains were susceptible to

vancomycin, quinupristin/dalfopristin, ceftriaxone, daptomycin and linezolid. All methicillin

resistance S. hominis strains carried the mecA as well as blaZ genes. S. hominis strains resistant to

tetracycline carried the tetK gene (32%), to macrolides - msrAB gene (19.4%). ermC gene was

also prevalent in 9.6% isolates. Gentamicin resistant genes aac(6′)-Ie-aph(2")-Ia and aph(3′)-IIIa

were detected in 3.2% S. hominis strains. Resistance to trimethoprim in S. hominis strains was

encoded by dfrG (6.5%).

The results suggest that clinical S. hominis strains are resistant to antibiotics. In spite that S.

hominis is known as a human pathogen, the variety of the genes encoding resistance to different

classes of antimicrobials was more expressed. It should take protective measures to prevent

antibiotic-resistant and methicillin-resistant spread in hospitals.

The study was funded by grant (MIP-075/2013) from the Research Council of Lithuania.

Keywords: Staphylococcus hominis, Antibiotics, Biosafety, Genes.

ISSN 2335-8653

42

Synthesis And Characterizations Of Silver Nanoparticles Using Black Currant

Extract

Judita Puišo1, Matas Damonskas1, Paulius Danilovas2

1Department of Physics, Kaunas University of Technology, Studentų str. 50, LT-51368 Kaunas, Lithuania, 2Department of Polymer Chemistry and Technology, Kaunas University of Technology, Radvilenu pl. 19, LT-50254

Kaunas, Lithuania

judita.puiso@ktu.edu

Abstract

Biogenic synthesis of silver nanoparticles is based on the reduction of silver ions by enzymes of

some microorganisms or by natural substances and plant extracts. Preparation of silver

nanoparticles in aqueous solution using reducing agents from berries, fruits vegetables, plant

opened possibilities of their „green synthesis“. These silver nanoparticles preparation methods are

environmentally friendly. In the present study, we have synthesized silver nanoparticles using

dried black currant (Ribes nigrum) extract by photoreduction method. The silver nanoparticles

formation was confirmed by the color change of extract of black currant and further confirmed by

UV-Vis spectroscopy. The size and size distribution of colloids of silver nanoparticles were

studied using dynamic light scattering (DLS). Effect of silver nanoparticles on the wettability of

colloid solutions was evaluated by contact angle measurements. We have elaborated the new

method of direct formation of silver nanoparticles in black currant extract for antibacterial,

wound's healing and other applications in medicine.

Keywords: silver nanoparticles, black currant, surface plasmon resonance, UV-VIS, DLS.

ISSN 2335-8653

43

Copper Effects On The Growth Of Common Duckweed (Lemna Minor L.)

Jūratė Žaltauskaitė 1, Giedrė Pėstininkaitė 2

1, 2 Vytautas Magnus University, Vileikos st. 8-223, LT-44404 Kaunas, Lithuania.

Emails: 1 j.zaltauskaite@gmf.vdu.lt; 2 giedre.pestininkaite@fc.vdu.lt

Abstract

Heavy metals pollution is one of the main environmental problem, which is mainly caused by

anthropogenic impact. Even low concentrations of heavy metals can have a negative impact to

biota. The aim of this work was to investigate the impact of copper (Cu) to the growth of common

duckweed (Lemna minor L.). The plants were affected by 1-1000 µl/l concentrations of Cu in their

growth medium for 10 days and the effects on Lemna minor morphometric (fresh and dry weight,

growth rate), physiological (chlorophyll a, chlorophyll b, carotenoids) and biochemical (lipid

peroxidation) parameters were examined. The results showed that copper Cu inhibited the

production of new fronds of Lemna minor and growth rate inhibition increased linearly along with

the metal concentration in the medium. The metal had a significant negative impact on the amount

of photosynthetic pigments in Lemna minor. The application Cu provoked an oxidative stress. The

content of malondialdehyde in the tissue of duckweeds exposed to 1000 μg/l of Cu was by 65.5%

higher than in control plants.

Keywords: Copper, common duckweed (Lemna minor L.), growth rate, oxidative stress

ISSN 2335-8653

44

Selection Of AP-PCR Markers And Conditions For Hypericum Maculatum

Crantz

Gianni Barcaccia1, Giulio Galla1, Lina Zybartaitė2, Indrė Railienė 2, Algimantas

Paulauskas2, Eugenija Kupčinskienė2

1University of Padova, Campus of Agripolis, Viale dell'Università, 16, 35020 Legnaro (Italy)

gianni.barcaccia@unipd.it 2Vytautas Magnus University, Viliekos g 8-212, LT-44404, Kaunas, (Lithuania),

e.kupcinskiene@gmail.com

Abstract

Species belonging to Hypericum L. genus are rich in flavonoids and essential oils and have been

widely used in pharmacology. DNA markers as a standard approach to relate these molecular

systems nowadays are widely used. Hypericum perforatum and Hypericum maculatum are two

widely spread species in Lithuania. Throughout the world various aspects of biology of H.

perforatum including molecular genetics has got much bigger attention in comparison to H.

maculatum. Present study is aimed at development and specialization of arbitrarily chosen primers

and conditions of the polymerase chain reaction (PCR) for H. maculatum. Five different sequences

containing universal primer M13 (GACGGCCAGT) were chosen for investigation: APPCR_KA2

(GACGGCCAGTCGTGTCCGAG); APPCR_KB2 (GACGGCCAGTCGTATACTCC);

APPCR_KX2 (GACGGCCAGTTTGTACATGAC); APPCR_KM2 (ACGGCCAGTT ACGCACAAC);

APPCR_KR2 (TTGTAAAACGACGGCCAGTRTGTATACATAYGTAAC), hereafter used in

abbreviated form – KA2, KB2, KX2, KM2, KR2. Polymerase Chain Reaction mixture consisted

of 3 µl genomic DNA, 0.5 µl of each primer (100 µM/µL), 0.2 µl Taq polimerase (5 U/µl), 2 µl

10xNH4 Taq buffer, 0.8 µl dNTP (25nM), 12.2 µl H2O. Requirements of MgCl2 were not equal

and ranged between 0.8-1.2 µl (50 nM). Only KR2_KA2 primer combination required addition of

5 µl (4 µl +1 µl) of CES (2.7 M betaine, 6.7 mM DTT, 6.7% DMSO, 55 mg/ml BSA) in order to

avoid potential inhibitory affect on PCR caused by secondary metabolites. Separated subsequent

addition of universal labeled primer M13 provided better PCR results in comparison to

simultaneous application of all markers. Universal primer M13 (GACGGCCAGT) end was

conjugated with fluorescent tags 6FAM (blue), TAMRA (black) and HEX (green). Amplification

cycles were divided into three stages differently to two stages applied by Welsh, McClelland

(1990). Additional stage of amplification was added in behalf of extension of cycle numbers from

42 (Welsh) to 52 cycles and in the main amplification elongation period was specified for each

primer and ranged between 20 s to 300 s. Obtained PCR products were analysed by capillary

electrophoresis. Three (KA2; KX2; KM2) out of 5 primers in pairs with KR2 have generated

reproductive and scorable DNA fragments for all 8 selected populations of H. maculatum of

Lithuania. Each primer set was generating fragment numbers ranging for each individual of

population from 110 up to 250 and polymorphic at the species level.

Keywords: medicinal plants, herbs, Hypericaceae, Imperforate St. John's-wort, population,

genetic diversity, primers

ISSN 2335-8653

45

Genes Encoding Antimicrobial Resistance In Methicillin-Resistant

Staphylococcus Haemolyticus Isolated From Humans And Dogs

Modestas Ružauskas, Rita Plančiūnienė, Marius Virgailis, Irena Klimienė, Rita

Šiugždinienė, Lina Vaškevičiūtė, Raimundas Mockeliūnas, Alvydas Pavilonis

Microbiology and Virology Institute, Lithuanian University of Health Sciences

modestas.ruzauskas@lsmuni.lt

Abstract

The aim of this study was to compare antimicrobial resistance profile of methicillin-resistant

Staphylococcus haeamolyticus (MRSH) prevalent in humans and dogs.

Three hundred and thirty six samples of human clinical material as well as 470 samples of

diseased dogs were screened for isolation of MRSH using oxacillin- and cefoxitin-based selective

media. Identification of the isolates was performed using biochemical testing (Microbact 12S;

Oxoid, UK) as well as 16S rRNR gene sequencing. Genes encoding resistance to separate classes

of antimicrobials were detected by PCR.

Twenty isolates of methicillin-resistant Staphylococcus haemolyticus were obtained from humans

(6.0%) and 11 isolates from dogs (2.3%). All MRSH strains carried the mecA as well as blaZ

genes. Resistance to tetracycline was found in 12 human isloates (11 of them carried the tetK

gene) and 7 dog isolates (6 of them carried the tetK gene and one isolate – the tetM gene).

Resistance to macrolides was detected in 18 human and 10 dog isolates. msrAB genes were

prevalent both in human (10) and dog (7) isolates. ermC gene was also prevalent in human (7) and

dog (2) isolates however, ermA was found only in the isolates (2) from dogs. Resistance to

gentamicin was detected in 13 human and 9 dog isolates. Two genes aac(6′)-Ie-aph(2")-Ia and

aph(3′)-IIIa were found in human (13 and 7 respectively) and dog isolates (8 and 6 respectively)

encoding resistance toward aminoglycosides. Resistance to trimethoprim in 10 human isolates was

encoded by dfrG gene whereas 3 isolates from dogs carried the dfrG and 2 – dfrK gene.

According to the results obtained it could be outlined that S. haemolyticus and particularly MRSH

might be treated as zoonotic pathogen with similar antimicrobial resistance profile both in humans

and dogs. In spite that S. haemolyticus is known as a human pathogen the variety of the genes

encoding resistance to different classes of antimicrobials was more expressed in dog isolates.

Safeguard measures should be taken in order to avoid cross-spreading of MRSH between dogs and

their owners.

The study was funded by grant (MIP-075/2013) from the Research Council of Lithuania.

Keywords: Antibiotics, Biosafety, Dogs, Genes.

ISSN 2335-8653

46

Dirofilaria Repens Infection In Lithuania

Vytautas Sabūnas1,2, Povilas Sakalauskas1, Algimantas Paulauskas1, Jana Radzijevskaja1

1Vytautas Magnus University, Department of Biology, Vileikos str. 8, Kaunas LT-44404, Lithuania, 2 “Siaurio Snauceris” Small Animal Clinic, Chemijos av. 31A, LT-44001 Kaunas, Lithuania

E-mail: povilas.sakalausk@gmail.com

Abstract

Dirofilaria repens is a filarial nematode, which can cause subcutaneous disease in dogs, cats

and other carnivores and can also accidentally infect humans by the bites of mosquitoes. Canine

dirofilariasis in the last 50 years have become recognized worldwide as an emerging parasitic

disease. The climate change, extensive movement of dogs across countries and continents has

contributed to the expanding of distribution range of Dirofilaria spp. to areas they had never found

before. Accurate identification of filarial species is clinically important, because of the zoonotic

concerns and therapeutic implications. In Lithuania, the first cases of canine dirofilariasis caused by

D. repens have been reported from Department of Infectious Diseases, Veterinary Academy

(Kaunas, Lithuania) in 2010–2011. Six human cases of D. repens infection was recorded in

Lithuania during 2011-2014. In this study we have investigated 1280 blood samples of randomly

selected dogs presented in Kaunas small animal clinic (UAB “Siaurio Šnauceris”) during 2014.

Blood samples were stained in Diff-quick stains and analyzed by blood smear microscopic

technique. The species of the microfilariae were determined on the basis of their morphometrical

characteristics. All positive samples additionally were investigated using Modified Knott’s test. Ten

samples (0.78%) were positive for the presence of microfilariae. We also used PCR-based method

for differentiation and accurate identification of the filarial species.

This work was partly supported by project "Promotion of Student Scientific Activities" (VP1-3.1-

ŠMM-01-V-02-003) from the Research Council of Lithuania (P.S.). This project is funded by the

Republic of Lithuania and European Social Fund under the 2007-2013 Human Resources

Development Operational Programme’s priority 3.

Keywords: Dirofilaria repens, canine dirofilariasis, Lithuania.

ISSN 2335-8653

47

Light As A Tool For Manipulation Of Plant Responses - Morphogenetic Effects

(Part I)

Giedrė Samuolienė1,2, Akvilė Viršilė1, Aušra Brazaitytė1, Alina Čeidaitė1, Pavelas

Duchovskis1,2

1 Lithuanian Research Centre for Agriculture and Forestry, Institute of Horticulture, Kaunas str. 30, Babtai, LT-

54333, Lithuania 2Aleksandro Stulginskio Universitetas, Studentų g. 11 LT – 53361, Akademija, Kauno raj.,

g.samuoliene@lsdi.lt

Abstract

Plant respond to light stimulus by growing, differentiating, sensing the intensity, the time of day

duration, and seasons. Light is the energy source for plant growth, plants have evolved highly

sensitive mechanisms for perceiving light and using that information for regulating development

changes to help maximize light utilization for photosynthesis. Plants grow and develop using light

in a process known as photomorphogenesis. Thus, light affects plant development in many ways

throughout all stages of development. Photoreceptors are able to detect and react to light changes

and activate metabolic reactions, which evokes specific morphogenetic responses. In order to

optimize the formation of generative elements during different development stages, to improve

effectiveness of selection it is very important to know plant morphogenetic mechanisms, to control

processes of growth and development and their ratio. Photoperiodic changes are very important

for biannual and perennial plant flowering initiation. Spectral composition and light intensity also

enables to control plant morphogenetic responses in different levels, such as reaction of

photosynthetic system, primary and secondary metabolite changes in photomorphogenetic

processes. Some morphogenetic effects, which might be controlled by light, are presented in this

work

Keywords: carbohydrates, intensity, light-emitting diodes, pigments, photoperiod,

phytohormones.

ISSN 2335-8653

48

The Prevelence Of Tick Born Pathogens In Small Mammals In Lithuania

Karolis Sivickis1, Paulauskas Algimantas Paulauskas1, Jana Radzijevskaja1, Vaclovas

Gedminas2, Linas Balčiauskas3 1

Faculty of Natural Sciences, Vytautas Magnus University, Lithuania, 2Kaunas Tadas Ivanauskas Zoological

Museum, Lithuania, 3 Nature Research Centre, Lithuania

Karolis.siv@gmail.com

Abstract

Ticks born disease are important problem in the European countries (Gray et al., 2009). Ticks now

are second most important pathogens vector after mosquito, which cause people and animals

illness (Beugnet and Marie, 2009). Small mammals are vectors in ticks born diseases life cycle.

Rodents are recognized as main reservoir host for tick born disease (Meerburg, 2010). This study

aim was to evaluate Babesia spp., Bartonella spp. pathogens prevalence in Lithuanian small

mammals. Mammals were collected from three different biotopes: woodland, grassland, beaver

lodge, and great cormorant colony. Small mammals were captured from 2013 to 2014. A total of

388 small rodents representing 8 species were trapped. Captured rodents were identified as

Apodemus flavicollis, A. sylvaticus, Micromys minutus, Microtus glareolus, M. arvalis, M.

oeconomus, M. agrestis, Arvicola terrestris, Muscardinus avellanarius, Sorex araneus, S.

minutus. For analysis were used spleen samples. Identification of Bartonella spp. was done using

gltA gene molecular markers and ITS regione, and for Babesia spp. - 18S RNA gene molecular

markers. Bartonella spp. was detected in 26 % (102 of 388) of examined mammals, Babesia spp.

was detected in 6% (25 of 388) of examined mammals.

Keywords: small mammals, Bartonella, Babesia, Lithuania

References: [1] Gray, J.S., Dautel, H., Estrada-Pe˜na, A.,Kahl,O.,Lindgren,E.,2009.Effectsofclimete change onticksandtick-

bornediseasesinEurope.Interdiscip.Perspect.Infect. Dis.,

[2] Beugnet, F., Marie, J.L., 2009. Emerging arthropod-borne diseases of companion ani-mals in Europe. Vet.

Parasitol. 163, 298–305.

[3] Meerburg BG. Rodents are a risk factor for the spreading of pathogenson farms, 2010. Veterinary

Microbiology;142:464–5.

ISSN 2335-8653

49

Analysis Of Bacteria Sensitivity To Encapsulated Nisin

Ramunė Stanevičienė1, Juliana Lukša1, Rūta Žiukelytė1,2, Regina Losinska-Sičiūnienė1,

Tatjana Krivorotova2, Jolanta Sereikaitė2, Elena Servienė1,2

1Laboratory of Genetics, Institute of Botany, Nature Research Centre, Vilnius, Akademijos St. 2, LT-08412 Vilnius,

Lithuania. E-mail: ramunes2000@yahoo.com

Lithuania, 2 Department of Chemistry and Bioengineering, Vilnius Gediminas Technical University, Vilnius,

Lithuania. E-mail:elena.serviene@botanika.lt

Lactococcus lactis bacteria produce a small cationic peptide nisin, which exhibits a wide spectrum

antimicrobial activity and is suitable for food preservation. In order to protect nisin from the

interaction with food components, ensure its stability and functionality during food processing and

storage nisin-loaded pectin nanoparticles were formed by complexation method and their

antibacterial features were evaluated.

By performing agar-diffusion assay, the most pronounced antibacterial activity of

encapsulated nisin was detected against Gram-positive bacteria Arthrobacter sp. and twice lower

activity - against Bacillus subtilis. By applying the agar plate count method, it was determined that

about 1 x 109 cells of Arthrobacter sp. and about 8 x 108 cells of B. subtilis were killed following

the overnight incubation with microcapsules.

The Gram-negative bacteria Esherichia coli and Klebsiella sp. are resistant to nisin

treatment. In order to increase the permeability of both bacteria to the antibacterial peptide,

chelating agent EDTA and redox agent DTT were applied. It was observed that the activity of

nisin-loaded nanoparticles against permeabilised bacteria was still weak and barely detectable by

the growth inhibition zones. However, the viability test allowed detection of 100 to 1000 fold

decrease in Esherichia coli and Klebsiella sp. cell survival.

We determined that nisin-loaded pectin nanoparticles decreased the number of CFU

of all microorganisms tested in a dose-dependent and pectin-dependent manner. With all

microorganisms tested nisin-loaded high methoxyl pectin (HMP) nanoparticles demonstrated the

lowest antibacterial activity. In contrary, nisin-loaded pectic acid (PecA) and dodecyl pectin

(DoPecA) nanoparticles showed the greatest ability to inhibit growth of indicative Gram-negative

and Gram-positive microorganisms. The value of pH of encapsulation buffer slightly affects the

biological activity of nisin-bearing microcapsules.

In summary, in this study we established that nisin maintains its antimicrobial activity

after encapsulation, therefore could be effectively applied for food preservation.

Keywords: nisin, nanoparticles, antibacterial activity.

Acknowledgement: This research was funded by a grant (No. SVE-03/2014) from the Research

Council of Lithuania.

ISSN 2335-8653

50

Selection Of Amplified Fragment Length Polymorphism Markers For

Investigation Of Genetic Diversity Of Impatiens Parviflora

Kristė Stravinskaitė1, Lina Zybartaitė1, Eugenija Kupčinskienė1, Walter Durka2 1Department of Biology, Vytautas Magnus University, Vileikos Str. 8, LT-44404 Kaunas, Lithuania

* Corresponding author. E-mail: kriste.stravinskaite@gmail.com 2Department of Community Ecology, Helmholtz Centre for Environmental Research – UFZ, Theodor-Lieser-Str. 4,

06120 Halle, Germany

Abstract

Small Balsam (Impatiens parviflora) is an invasive annual usually 30-60 cm height plant with pale

yellow flowers, which has red spots on the inside. Impatiens parviflora is a native of Central Asia,

this species is widely distributed in eastern, central and northern European countries and it is one

of the most invasive species in the continent [1]. The objective of this study was to select

amplified fragment length polymorphism (AFLP) markers for investigation of genetic diversity of

Impatiens parviflora. Four individuals were chosen randomly from European populations and

were used to screen AFLP primer combinations. Fragment analysis was performed on an ABI

3130 genetic analyser using GeneScan LIZ 500 as internal size standard. Peaks were scored

manually in the range of 50-500 bp using GeneMapper version 3.7. In total 32 primer

combinations were screened. Eight fluorescent labelled primers (FAM-AAC/CTC, VIC-

ACG/CAC, NED-ACC/CAC, PET-AGG/CAC and FAM-AAC/CTG, VIC-ACG/CAT, NED-

AAG/CAG, PET-AGC/CAC) were selected according to generated peak height and their distance

from each other. We eliminated primers, which composed low peaks or generated peaks were too

close to each other or too distant from each other, as it was described by Kloss et al., 2011 [2].

Results revealed that chosen AFLP markers are valuable for estimation of genetic diversity of

Impatiens parviflora populations.

Keywords: Small Balsam, invasion, alien plants, molecular markers, population genetics

References:

[1] D. Chmura, Biology and ecology of an invasion of Impatiens parviflora DC in natural and semi-natural habitats,

Bialsko-Biala, 2014, Poland, 216 p.

[2] L. Kloss, M. Fischer, W. Durka, Land-use effects on genetic structure of a common grassland herb: A matter of

scale, Basic and Applied Ecology, 2011, 12(5): 440-448.

ISSN 2335-8653

51

Saccharomyces Cerevisiae K2 Toxin Fusion With GFP

Živilė Strazdaitė-Žielienė1, Iglė Vepštaitė1, Lukas Birgiola1,2, Elena Servienė1,2

1Laboratory of Genetics, Institute of Botany, Nature Research Centre, Vilnius, Akademijos St. 2, LT-08412 Vilnius,

Lithuania. E-mail: genetike@gmail.com Lithuania, 2 Department of Chemistry and Bioengineering, Vilnius

Gediminas Technical University, Vilnius, Lithuania

Killer yeasts are considered as potential biocontrol agents to avoid or reduce wine spoilage by undesirable

species. One of the biological mechanisms for the regulation of population dynamics in complex microbial

ecosystems is the production of toxins capable to kill or inhibit other microorganisms. The toxins

synthesized by yeasts, known as killer factor, are proteins, whose action is mediated by specific receptors

in the cell wall of the sensitive microorganism. K2 killer protein of Saccharomyces cerevisiae is the most

frequent toxin among yeast dominating in the vineyard-winery ecosystem. This protein is produced at

negligible levels in yeast, making difficult to detect and isolate it in amounts sufficient for investigation.

In the course of our research, the S. cerevisae K2 toxin encoding gene was tagged at its

carboxyl terminus by GFP, and the chimeric construct was subcloned into the yeast episomal

vector. The hybrid protein-possesing plasmid was introduced into E. coli and S. cerevisiae cells.

Based on the fluorescence, expression of the GFP was observed in both bacteria and yeast cells.

However, following the killer activity and immunity tests we found that the chimeric protein K2-

GFP did not show killer activity and demonstrated only partial immunity to K2. This can be

explained by the fact, that C-terminus of killer protein is highly sensitive for interruption and

affect the functionality of the toxin.

Keywords: Saccharomyces cerevisiae killer yeasts, K2 toxin, GFP.

ISSN 2335-8653

52

Freshwater Bryozoa Study In Lithuania: Past And Present

J.Rutkauskaitė- Sucilienė, I. Šatkauskienė

Vytautas Magnus university,

E-mail address: i.satkauskiene@gmf.vdu.lt

Abstract

Bryozoans (Bryozoa) are among the most fascinating invertebrate animals, which lead a hidden

existence under water. The most species of bryozoans lives in the marine water, some in

freshwater.

Freshwater bryozoans are among the most important filter feeders, along with sponges and

mussels. Thus, they perform water cleaning and protection functions. The colonies of bryozoa

serve as food or habitats for other invertebrates. Several species of moss animals are as a host of

fish parasites for example microscopic myxozoans that can to cause of proliferative kidney disease

in salmon and for that reason fishermen are experiencing significant loss. Sometimes bryozoans

can cause problems in a human’s life as can clog pipes of water, treatment facilities of sewages or

the cooling pipes of power stations.

According to Fauna European (2013) there are 21 freshwater bryozoan’s species in Europe, with a

number of these species being recorded in neighbouring countries (Latvia, Estonia, Poland, and

Belarus). Little is known about bryozoans in Lithuania, other than one thesis conducted during

1931-1933 by B. Pajiedaitė, who found 7 freshwater bryozoans species and described it.

Unfortunately from 1933 and onwards no further studies in Lithuania have been conducted on

these invertebrates for the past 82 years. Our study has two main aims: (1) to collect and review all

available information related to the Lithuanian bryozoans, emphasizing the importance of the

bryozoans in ecosystems and human life; and (2) to declare that bryozoans’ research Lithuania has

been restarted.

Key-words: bryozoan, statoblasts, diversity, Lithuania

ISSN 2335-8653

53

Effects Of The Urban Environmental Conditions On The Physiology Of Two

Biological Indicators

Gintarė Sujetovienė, Vilma Galinytė

Vytautas Magnus university,

E-mail address: g.sujetoviene@gmf.vdu.lt

Abstract

Response to air pollution was assessed for lichen Evernia prunastri (L.) Ach. and the moss

Ptilium crista-castrensis (Hedw.) DeNot. Samples were collected from a relatively clean remote

area (Birštonas) and transplanted to a control site and three areas reflecting the different

urbanization levels: urban, suburban and residential areas. Transplants were exposed for 1- and 2-

month periods. Concentrations of gaseous pollutants (NO, NO2, SO2) were monitored by air

monitoring stations. Differences in response of fluorescence, chlorophylls contents, MDA and

injuries of cell membranes were observed among the two species and between the sites.

Transplants of P.crista-castrensis from urban sites showed a decrease in chlorophyll a

fluorescence. The integrity of cell membranes was also more damaged in the transplanted moss

samples than in lichen. Significantly higher oxidative stress was induced in the transplants at

urban and residential sites in the beginning of transplantation period (after 1 month) but such trend

was not characteristic after 2 months. Since SO2 concentrations were relatively low but they were

negatively correlated with chlorophyll content in moss samples. There was a linear relationship

between SO2 concentration and MDA content of lichen and moss samples exposed in urban

environmental conditions. Chlorophyll a and b content in mosses was positively related with

nitrogen oxides while lichen showed the opposite trend. Results fit with the known ecological

requirements of the studied species: E.prunastri being characteristic to relatively dry and warm

sites, P.crista-castrensis being typical to moister and cooler sites. The results on transplants

vitality showed that lichen is more suitable for bioindication studies with changes physiological

parameters while moss was more sensitive to pollutants and site condition.

Keywords: air quality, lichen, moss, physiological response.

ISSN 2335-8653

54

Studies On Green Synthesis, Characterization And Anti Proliferative Potential

Of Silver Nanoparticles Using Medicinal Plants Collected From Yelagiri Hills

Giridharan.T*1, Chandran. M1, Sindhu. S2, Arumugam. P2

1 Department of Biotechnology, Vel tech High tech Dr. RR Dr. SR Engineering College, Avadi,

Chennai - 600 062 2 Armats Biotek Pvt Ltd, Guindy, Chennai - 600 032 *giridharan.biotech@gmail.com, 9677048614

ABSTRACT

Cancer is abnormal growth of cells which is caused due to smoking, alcohol consumption

and genital disorders. The aim of the study is to evaluate the anti-proliferative activity of silver

nanoparticles synthesized using 4 medicinal plants collected from yelagiri hills. The leaves of the

plants were used for optimization of silver nanoparticles by varying the time exposure of the

reaction mixture to sunlight (5, 10, 15 minutes). The anti-oxidant potential of samples was studied

by DPPH, phosphomolybdenum, metal chelating and HRSA assays. Also, the synthesized

nanoparticles were characterized by UV, SEM, XRD and FTIR techniques. The results suggest

that nanoparticles synthesis was significant at exposure time of 5 and 10minutes. The synthesized

particles were confirmed by UV spectroscopy which showed characteristic peak at 427, 418, 421,

421nm for the 4 samples respectively. The synthesized nanoparticles were found to be in the size

range of 60-90nm with characteristic XRD peaks at 2θ values of 37.87 and 45.86 and 37.74 and

45.85 for two plants. The results of the study revealed that the synthesized silver nanoparticles

possessed significant antioxidant, anti inflammatory, anti-proliferative and antimicrobial

properties.

Keywords: Silver nanoparticles, Antioxidant activity, Antimicrobial potential, UV-Vis, SEM,

XRD, FTIR, MCF7 cells.

ISSN 2335-8653

55

Metrology In Radiotherapy: Tlds In Brachytherapy Case

Benas G. Urbonavičius1, Diana Adlienė1, Paulius Kaškonas

1Kaunas University of Technology, Studentų str. 50-253, Kaunas, Lithuania, benas.urbonavicius@ktu.lt

Abstract

Routine in vivo dosimetry (IVD) is well established in external beam radiotherapy however it is

restricted mainly to detection of gross errors in high dose rate brachytherapy (HDR) due to

complicated measurements in the field of steep dose gradients in the vicinity of radioactive source

and due to high uncertainties. Metrological parameters of the measuring systems regarding

radiotherapy are rarely discussed, mostly due to the nature of ionizing radiation. Out of many

dosimetry methods, integrating ones are the most difficult to evaluate. Proper calibration of

detectors before their application for IVD is essential. For this reason the uncertainty evaluation

for TLD dosimetry system was performed. Dose measurements were performed and verified with

the doses calculated by corresponding standard treatment planning system for 5 cancer patients. In

vivo dose measurements performed during HDR brachytherapy treatment procedures have shown

a good agreement between dose variation tendencies.

Keywords: Metrology, Radiation, Radiotherapy, Brachytherapy, Dosimetry

ISSN 2335-8653

56

Detection Of Bacteria And Fungi By Multiplex Real-Time PCR And FRET

Technique

Máté Vadovics, Rita Anyanwu

1. Department of Medical Microbiology and Immunbiology, Faculty of Medicine,

University of Szeged, Hungary

vadovicsmate@gmail.com

Identification of fungal and bacterial causative agents of sepsis with the conventional blood

culturing techniques is time consuming therefore a more rapid and sensitive PCR based technique

were introduced. The newly developed prototype system provides a new tool to identify these

microbes’ specifically.

Our previous study focused on the differentiation of the most common bacterial [1] and fungal [2,

3] causative pathogens of bloodstream infections. The last developed, multiplex system [1] can

distinguish the Gram-negative, Gram-positive bacteria and fungi in the same reaction vessels of

LightCycler capillary Real-time PCR. The 7 most frequent Candida species were identified with

the melting peaks of amplicons. The G+ and G- bacterial subgroups were identified through a joint

consideration of the melting points of the Gram specific probes and the melting point of the

overall PCR product. The prototype system could be faster with the neglect of the DNA

purification. Hot-Start (inhibitor tolerant) polymerases allow using the direct blood to the PCR

without DNA purification. In this case the hemoglobin of the blood covers the fluorescence signal

therefore the pathogens can be discriminated only by the size of the amplicons. Our further aim is

the identification of the fungal and bacterial species without DNA purification and also merging

the two techniques.

Keywords: Clinically relevant bacteria; Candida; Melting point analysis; Fluorescence Resonance Energy Transfer (FRET);

Multiplex real-time PCR; Bloodstream infections

References:

1. Ádám Horváth, Zoltán Pető, Edi t Urbán, Csaba Vágvölgyi and Ferenc Somogyvári

(2013) A novel, multiplex, real-time PCR–based approach for the detection of the commonly

occurring pathogenic fungi and bacteria BMC Microbiol. 13-300.

2. Somogyvari F, Serly J, Doczi I, Nagy E (2005) Molecular differentiation of most

frequent Candida species causing blood-stream infection. Mycoses 2:S198.

3. Somogyvari F, Horvath A, Serly J, Majoros H, Vagvolgyi C, Peto Z.(2012) Detection of

invasive fungal pathogens by real-time PCR and high-resolution melting analysis. In vivo. 26(6):979-83.

ISSN 2335-8653

57

Association Of Genetic Variants In PNPLA3, MERTK, PCSK7 And RNF7 With

Liver Cirrhosis

Irena Valantienė1, Juozas Kupčinskas1, Greta Varkalaitė2*, Gediminas Kiudelis1, Vitalija

Petrenkienė1, Jolanta Šumskienė1, Limas Kupčinskas1 1Department of Gastroenterology , Medical Academy, Lithuanian University of Health Sciences, Eivenių St. 2, LT-

50009 Kaunas, Lithuania; 2Institute for Digestive Research Medical Academy, Lithuanian University of Health

Sciences, Eivenių St. 2, LT-50009 Kaunas, Lithuania;

*grevark@gmail.com

Background: Liver cirrhosis (LC) is a progressing disease commonly caused by alcohol

consumption, infections of chronic hepatitis B and C and other. The search for genetic factors that

could help to select patients at higher risk of developing LC is necessary. Current data indicate

role of PNPLA3 gene product in lipid homeostasis and genome-wide association studies (GWAS)

revealed PNPLA3 (rs738409) single-nucleotide polymorphism (SNP) association with liver

diseases and fibrosis risk [3]. A recent GWAS suggest a possible relationship between the

clearance of apoptotic cells and liver fibrosis, revealing genetic polymorphisms of MERTK

(rs4374383) and RNF7 (rs16851720) importance [1]. Other GWAS demonstrated that PSCK7

(rs236918) is a risk factor of LC in hereditary hemochromatosis (HH) patients [2,4]. Correlation

of these SNPs with LC has not been studied well. The aim was to perform genotyping for

PNPLA3 (rs738409), MERTK (rs4374383), PCSK7 (rs236918) and RNF7 (rs16851720) in LC

patients and healthy individuals groups and determine the potential link between these SNPs and

the risk of developing LC.

Materials and Methods: In total 244 patients with LC and 498 healthy control individuals were

genotyped. Genotyping was performed for 4 genetic variants in PNPLA3, MERTK, PCSK7, RNF7

genes using real-time PCR TaqMan® assay. Statistical analysis were performed using PLINK:

Whole genome data analysis toolset.

Results: MERTK and PCSK7 SNPs was not associated with the risk of developing LC (adjusted

odds ratio (ODa)-1,2, 95% confidence interval (CI95) 0,96-1,52, P-0,109; ODa-0,79, CI95 (0,56-

1,11), P-1,69 respectively). RNF7 SNP showed no significant association in allelic association

analysis (ODa-0,75, CI95 (0,56-1,28), P-0,074) and showed lower risk of developing LC when

compared with CC genotype (ODa-0,18, CI95 (0,04-0,79), P-0,023). PNPLA3 SNP showed allelic

association with higher risk of developing LC (ODa -1,91, CI95 (1,47-2,50), P-1,812*10-8),

genotypic association analysis revealed higher risk of developing LC when compared to GG

genotype (ORa-5,01, CI95 (2,52-9,94), P-4,158*10-6) and CG genotype (ORa-1,61, CI95 1,13-2,29,

P-0,09). Odds ratio was adjusted for age and sex.

Conclusion: PNPLA3 (rs738409) showed strong allelic and genotypic (GG, CG) association with

higher risk of developing LC (P-1,812*10-6, P-4,158*10-6 respectively). RNF7 (rs16851720)

showed lower risk of developing LC when compared with CC genotype (P-0,023).

Keywords: Single nucleotide polymorphisms (SNP), PNPLA3, MERTK, PCSK7, RNF7, liver

cirrhosis.

References: [1] E. Patin, Z. Kutalik, J. Guergnon, S. Bibert, B. Nalpas, E. Jouanguy et al. Genome-Wide Association Study

Identifies Variants Associated with Progression of Liver Fibrosis from HCV Infection. Gastroenterology. 2012,

143(5), 1244-1252

ISSN 2335-8653

58

Current Distribution And The Diversity Of Babesia Canis Strains In Europe

Linas Venslovaitis, Jana Radzijevskaja, Asta Aleksandravičienė, Vytas Sabūnas, Dalytė

Mardosaitė-Busaitienė, Algimantas Paulauskas

Faculty of Natural Sciences, Vytautas Magnus University, Vileikos 8, LT-44404 Kaunas, Lithuania

Abstract

Babesia canis is intraerythrocytic protozoan blood parasites that are transmitted by the main vector

– Dermacentor reticulatus ticks to dogs and cause canine babesiosis. Canine babesiosis is an

infectious disease circulating worldwide. Due to expansion of D. reticulatus ticks to the new,

earlier non-endemic areas, canine babesiosis have spread and clinical cases have been reported from

central and northern parts of Europe. Canine babesiosis is clinically classified into uncomplicated

and complicated forms. Clinical symptoms range from transient anorexia to a complex syndrome in

which multiple organ systems could be affected. It was suggested, that differences in the clinical

manifestations of disease may reflect different Babesia strains. Statistically significant

differences in clinical signs between genetically diverse groups of B. canis have been detected, and

functional antigenic differences between B. canis strains have been indicated. The first cases of

canine babesiosis in Lithuania were recorded and confirmed by microscopic analysis in the

beginning of 21th century. During the past decade canine babesiosis has become quite frequent in

Lithuania. We have analyzed blood samples from dogs showing clinical signs of babesiosis and D.

reticulatus ticks for the presence of babesial parasites. Sequence analysis showed that B. canis

isolates from dogs and ticks were heterogenic. Based on observed two nucleotides substitution

(GA→AG) in 18S rRNA gene sequences of B. canis isolates, two genotypes were distinguished in

dogs and three genotypes in D. reticulatus ticks. Our study demonstrates the presence of genetically

diverse B.canis strains in Lithuania and show the necessity to use a molecular analysis for an

accurate diagnosis of canine babesiosis. Such information will help to ensure an effective therapy,

and to promote disease control program in Lithuania.

This work was partly supported by project "Promotion of Student Scientific Activities" (VP1-3.1-

ŠMM-01-V-02-003) from the Research Council of Lithuania (L.V.). This project is funded by the

Republic of Lithuania and European Social Fund under the 2007-2013 Human Resources

Development Operational Programme’s priority 3.

Keywords: Babesia canis, genotypes, distribution, Dermacentor reticulatus, Lithuania

Article should be sent to specified journal* editorial office directly with footnotes: “Authors

report was presented in the 9th International Scientific Conference The Vital Nature Sign 2015”

ISSN 2335-8653

59

Stargardt’s Macular Dystrophy: Clinical Case

Alvita Vilkeviciute², Mantas Banevicius¹, Arvydas Gelzinis¹, Brigita Glebauskiene¹, Loresa

Kriauciuniene¹,², Rasa Liutkeviciene1,2

¹Department of Ophthalmology, Lithuanian University of Health Sciences, Medical Academy, Eiveniu 4, Kaunas,

Lithuania, LT-50009, ²Neuroscience Institute, Lithuanian University of Health Sciences, Medical Academy, Eiveniu 4,

Kaunas, Lithuania, LT-50009,

E-mail: alvitavilkeviciute@gmail.com

Abstract

Stargardt's Macular Dystrophy was described in 1909 by Karl Stargardt, a German

ophthalmologist. It is the most common autosomal recessive macular dystrophy, it’s prevalence

1:10000. It is characterized by central visual loss, atrophy of the retinal pigment epithelium.

In this clinical case, we are presenting 13-year-old boy complaining of reduced visual acuity in

both eyes for several months. His best-corrected visual acuity in the right eye was 0.1, and 0.1 in

the left eye. Ophthalmoscopy of the both eyes revealed the onset of disease, and showed a mild

scattering of pigment and loss of macular reflex. Colour vision test showed the damage of red and

green colours vision. Severe patern ERG abnormality with normal photopic and scotopic a- and b-

waves, during Ganzfeld ERG and loss of photopic a- and b-waves were found.

Fluorescein angiography revealed a dark/masked choroid.

As Stargardt’s macular dystrophy is the most common autosomal recessive heriditary macular

dystrophy, but it takes very long time till true diagnosis, that‘s why we are presenting a case

report with a mild changes of the eyes fundus, which will be helpful for early recognizing of

Stargardt’s macular dystrophy.

Keywords: Stargardt's disease, fluorescein angiography, macular dystrophy

References: [1] Bagdonienė R., Sirtautienė R. Akių ligų atlasas II dalis. Vilnius 2001; 475-483.

[2] Aaberg T.M. Stargardt's disease and fundus flavimaculatus: evaluation of morphologic progression and

intrafamilial co-existence. Trans Am Ophthalmol Soc. 1986; 84:453–487.

[3] Allikmets R., Singh N., Sun H., et al. A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is

mutated in recessive Stargardt macular dystrophy. Nature Genet. 1997; 15:236-246.

ISSN 2335-8653

60

MMP-2 Rs24386 (C→T) Polymorphism And The Phenotype Of Early Age-

Related Macular Degeneration

Alvita Vilkeviciute², Rasa Liutkeviciene¹,², Vaiva Lesauskaite³, Giedre Sinkunaite-

Marsalkiene³, Loresa Kriauciuniene¹,², Dalia Zaliuniene¹

¹Department of Ophthalmology, Lithuanian University of Health Sciences, Medical Academy, Eiveniu 4, Kaunas,

Lithuania, LT-50009, ²Neuroscience Institute, Lithuanian University of Health Sciences, Medical Academy, Eiveniu 4,

Kaunas, Lithuania, LT-50009, ³Intitute of Cardiology, Lithuanian University of Health Sciences, Medical Academy,

Sukileliu 17, Kaunas, Lithuania, LT-50161

E-mail: alvitavilkeviciute@gmail.com

Abstract

We examined MMP-2 (-1306 C/T) gene polymorphism and the phenotype characterized by soft

and hard drusen of early age-related macular degeneration (AMD).

Methods: The study enrolled n=673 investigative (147 patients with AMD and a random sample

of the population n=526). The genotyping test of MMP-2 rs243865 (C→T) was carried out using

the real-time polymerase chain reaction method. Early AMD was classified according to the

International Classification and Grading System. The potential association with single nucleotide

polymorphisms on rs243865 was evaluated for all patients, adjusted for age, sex.

Results: Analysis of MMP-2 rs24386 (C→T) polymorphism has not revealed any differences in

the genotype (T/T, C/T and C/C) distribution between the patients with soft drusen, hard drusen

and the reference group (as follows, 7.41%, 39.5%, and 53.09% in AMD with soft drusen; 4.55%,

30.3%, and 65.15% in AMD with hard drusen; 7.41%, 37.64% and 54.94%, in the reference

group).

Conclusion: The MMP-2 rs24386 (C→T) polymorphism was not associated with AMD

phenotype, characterized by hard and soft drusen.

Keywords: age-related macular degeneration, gene polymorphism, matrix metalloproteinases,

polymorphism, MMP-2

References:

[1] Chau KY, Sivprasad S, Patel N, Donaldson TA, Luthert PJ, Chong NV. Plasma levels of matrix

metalloproteinases-2 and -9 in age-related macular degeneration. Eye (Lond) 2007; 21(12): 1511–5.

ISSN 2335-8653

61

Cadmium Effects To The Growth Of Thymes (Thymus Vulgaris) And Their

Extracts Quality

Jūratė Žaltauskaitė, Audronė Minelgaitė

Department of Environmental Sciences, Vytautas Magnus University, Vileikos st. 8-223, LT-44404 Kaunas, Lithuania

j.zaltauskaite@gmf.vdu.lt

Abstract

Heavy metal pollution is considered as one of the most serious problems worldwide and has

significant environmental and human health impact. The aim of this study was to evaluate the

effects of soil cadmium pollution to the growth and quality of medicinal herbs plant thyme

(Thymus vulgaris) and their extracts. The plants were grown in soils contaminated with Cd (10 –

800 mg Cd kg-1) for seven weeks. The morphological (shoot height and root length, dry weight),

physiological (content of photosynthetic pigments), biochemical (content of malondialdehyde)

parameters and the content of Cd in thyme root, shoot and herbal extracts were determined. All the

endpoints were measured after three, five and seven weeks of exposure. The results of this study

showed that soil contamination with Cd had no adverse acute effects to the growth of thyme.

Adverse effects on the growth were determined only after 7 weeks of exposure and at the highest

levels of Cd in the soil. Cd amendments had no significant adverse effect on the content of

photosynthetic pigments. Cd induced lipid peroxidation and slight increase in MDA content was

recorded. Cadmium concentrations in the plant tissues and extracts increased along with Cd

concentration in the soil and the time of exposure. It was found that Cd concentrations in thyme

shoots and extracts were above the WHO limits (0.3 mg Cd kg-1). This study demonstrated that the

use of thyme products may pose a risk to human health even if thymes are growing at

environmentally relevant Cd soil concentration.

Keywords: cadmium, extract quality, growth, soil pollution, Thymus vulgaris.

ISSN 2335-8653

62

Connexin - Dependent Migration of Cancer Cells

Mindaugas Žukauskas, Lina Rimkutė, Ieva Antanavičiūtė

Institute of Cardiology, Lithuanian University of Health Sciences, Kaunas, Lithuania

Increased motility and invasiveness are the major factors for the cancer cell metastasis from the primary

tumour. These factors are associated with poor survival prognosis of cancer patients. A better

understanding of molecular mechanisms responsible for the cell motility could indicate new potential drug

targets.

Connexins (Cxs) are family of membrane proteins, which form gap junction (GJ) channels by docking two

hemichannels from apposed cells. GJ channels provide a direct pathway for electrical and metabolic

signaling between adjacent cells. Cxs are named according to their molecular mass, which varies from 26

kDa to 57 kDa. Cxs are expressed in various tissues and play a channel-independent role in cell

proliferation, differentiation, migration, adhesion and cancer progression. For example, Cx43 reduces cell

proliferation rate in human gliomas, while Cx32 expression increases the self-renewal of stem cells. The

major mechanisms of these channel-independent functions still remain to be elucidated.

The aim of this study was to evaluate the impact of different connexin expression in the Hela cells on their

migration properties. Wound healing assay was used to determine motility differences between non-

transfected Hela wt cells and Cx47, Cx45, Cx43-EGFP, Cx40-CFP, Cx36-EGFP expressing cells. Time

lapse images were taken for 12 h hours at 37C° in a humidified atmosphere of 5 % CO2 using an

incubation system INUBG2EONICS (Tokai Hit, Shizuoka-ken, Japan) with an incubator mounted on the

stage of motorized Olympus IX81 microscope (Olympus Europe holding Gmbh, Hamburg, Germany)

equipped with x 20 DIC oil-immersion objective.

In summary, our study indicated that mobility rate of Cx43-EGFP, Cx45 and Cx47 expressing cells did not

differ from HeLa wt. HeLa Cx36-EGFP and Cx40-CFP cells showed an increased motility (p< 0.05) with

26.8% and 25.5% higher values, respectively, compared with HeLa wt. We observed

no significant differences in proliferation rates between Hela wt and the cells transfected with different

connexins.

Our results suggest that Cx36 and Cx40 may be involved in cell migration processes.

Keywords: connexin, migration, cancer cells

References: M. Račkauskas, V. Neverauskas, V. A. Skeberdis, Medicina (2010); 46(1):1-12.

M. Kotini, R. Mayor, Dev. Biol. (2015); 1; 401(1):143-51.

J. Z. Zhou, J. X. Jiang, FEBS Letters, (2014); 588(8): 1186–1192.

ISSN 2335-8653

63

Cellular Response To Ionizing Radiation: Application Of Different Murine

Models

Vaidotas Stankevičius1,2, Rimantė Čeponytė1,2, Diana Schveigert1, Jonas Venius1,

Konstantinas P. Valuckas1, Eduardas Aleknavičius1,3, Ričardas Rotomskis1,4 and Kęstutis

Sužiedėlis1,2

1National Cancer Institute, Santariskiu 1, 08660 Vilnius, 2Vilnius University, Faculty of Natural Sciences, Department

of Biochemistry and Molecular Biology, M.K. Ciurlionio 21, 03101 Vilnius, 3Vilnius University, Faculty of Medicine,

M.K. Ciurlionio 21, 03101 Vilnius, 4Vilnius University, Faculty of Physics, Sauletekio 9, 10222 Vilnius,

For correspondence: kestutis.suziedelis@gf.vu.lt

Abstract

Cultivation of cell cultures in microenvironment, partially resembling extracellular matrix (ECM),

is expected to result in better reflection of in vivo cell biology by the model system. Investigations

using such 3D cell culture models are expected to result in more successful oncology clinical trials

which based on 2D models not representing complexity of tumors currently fail up to 90%.

We have employed 3D cell culture model to investigate cellular response to ionizing radiation.

Single dose or fractionated irradiation of 2Gy and 5x2Gy have been used. Global gene expression

changes after irradiation have been analyzed by transcriptomic analysis in Lewis lung carcinoma

(LLC1) cell line cells cultured in 2D or 3D.

Cell survival analysis indicates decreased cellular sensitivity to ionizing radiation (IR) when

cultivated in 3D, ECM resembling microenvironment.

In order to define which cell culture model better reflects cell radiobiology in vivo, cellular

response to irradiation is investigated in an animal model as well.

Keywords: Ionizing radiation, Tumor microenvironment, Extracellular matrix, Global

transcriptomic analysis, Cell culture and animal models.

Acknowledgement: This work was funded by the European Social Fund under National

Integrated Programme Biotechnology & Biopharmacy, grant VP1-3.1-SMM- 08-K01-005.

ISSN 2335-8653

64

Mutation Identification In Sucrose Synthase 1 Gene And It’s Impact On Cold

Acclimation In Winter Wheat

Rita Armonienė, Gintaras Brazauskas

Institute of Agriculture,

Lithuanian Research Centre for Agriculture and Forestry,

Instituto a. 1, LT58344 Akademija, Kėdainiai distr., Lithuania

E-mail: rita.armoniene@lzi.lt

Freezing tolerance is one of the main factors governing plant winter survival. Exposure of

temperate plants to low, nonfreezing temperatures lead to increased freezing tolerance levels and it

is called cold acclimation. The genetic basis of the freezing tolerance induction mechanism is still

poorly understood. Targeting Induced Local Lesions in Genomes (TILLING) population of the

two winter wheat lines (‘5899-16’ and ‘5450-1’) was developed using mutagen EMS in order to

create mutant forms of the candidate genes to verify their role in freezing-tolerance formation.

Exon 8 of the identified differentially expressed Sucrose synthase 1 (Ss1) gene was chosen for

mutation detection by High Resolution Melting (HRM) analysis in wheat TILLING M2

population. A total of 75.7 kb of DNA was screened resulting in an overall mutation density of

one mutation per 37.8 Kb in the population. Two novel alleles of Ss1 gene were identified, of

which 1 was silent and 1 premature stop codon mutation. qPCR analyses were performed to

estimate how these mutations affect the expression level of Ss1 gene in crown and leaf tissue

during cold acclimation. Putative knock-out mutant M631 had significantly lower relative

expression of Ss1 gene in non-acclimated leaves as well as in crowns and leaves collected at 2, 4

and 6 weeks of cold acclimation compared with the wild type winter wheat line. Freezing

tolerance test of the wild type and M631 winter wheat was performed to determine the effect of

premature stop codon mutation in Ss1 gene on the freezing tolerance development during cold

acclimation and to confirm the role of Ss1 in wheat cold acclimation process. Wild type plants

acclimated at 4 ºC for four weeks have higher freezing tolerance compared with the M631 plants

(LT50 difference of –3.2 °C). This suggests that the Ss1 gene is involved in the process of cold

acclimation and is a putative target for molecular breeding in winter wheat for increased freezing

tolerance.

Keywords: High-resolution melting analysis, Ss1, TILLING, Triticum aestivum L.

ISSN 2335-8653

65

The Impact Of Supplemental Blue And Green LED And HPS Lamps Lighting

Effects On The Photosynthesis Parameters Of Sweet Pepper Transplants

Aistė Bagdonavičienė1, Julė Jankauskienė1, Irena Januškaitienė2, Skirmantė Deksnytė2,

Pavelas Duchovskis1,3, Aušra Brazaitytė1

1Lietuvos agrarinių ir miškų mokslų centro filialas Sodininkystės ir daržininkystės institutas, Kauno g. 30, LT-54333

Babtai, Kauno r., el. paštas a.kasiuleviciute@lsdi.lt

2Vytauto Didžiojo universitetas, K. Donelaičio 58, LT- 44244 Kaunas

3Aleksanro Stulginskio universitetas, Studentų g. 11, LT-53361 Akademija, Kauno r.)

Abstract

The objective of studies was to compare photosynthesis parameters of sweet pepper transplants

‘Reda’ under emission of short-wavelength single-monochromatic solid-state lamps developed for

supplementation of high-pressure sodium (HPS) lamps used winter time in greenhouses. Four

types of solid-state lamps were made using advanced light-emitting diodes (LEDs) with peak

emissions at blue 455, 470, cyan 505, and green 530 nm, and were installed in a greenhouse. The

generated photosynthetic photon flux density (PPFD) of each type of solid-state lamps was 15

μmol m-2 s-1 and of HPS lamps PPFD was 100 μmol m-2 s-1. Transplants were grown in

greenhouse of phytotron complex under illumination of HPS lamps and with supplementation

LED lamps. The reference transplants were grown under illumination of HPS lamps (PPFD 110

μmol m-2 s-1). Our investigations revealed that the effect of supplemental green 530 nm LED

illumination with HPS lamps increased photosynthetic pigments content. Meanwhile,

supplemental 530 nm light had negative effect on photosynthetic rates (Pn), intercellular CO2

concentration (Ci), transpiration rate (Tn) and stomatal conductance (gs). Supplemental cyan 505

nm and blue 470 nm LED light had great positive effect on the photosynthesis parameters of sweet

pepper transplants.

Keywords: photosynthetic rate, intercellular CO2, stomatal conductance, pigments, biomass,

transpiration rate.

ISSN 2335-8653

66

Separation Of Surfactin From B.Subtilis Suspension And It‘S Antibacterial

Effect

Evaldas Bolskis, Lina Ragelienė

Department of Biochemistry, Vytautas Magnus University, Vileikos 8, Kaunas, Lithuania

Abstract

Lipopeptides represent a unique class of cyclic peptides with either a net positive (e.g. polymyxin)

or net negative charge (e.g. surfactin, daptomycin). Surfactin as metabolites exhibits remarkable

therapeutic and biotechnological properties and are suitable as alternatives to antimicrobial agents.

This is of particular importance at this point in time, when increasing numbers of drug-resistant

pathogenic bacteria impose a constant threat and there is a need for some other lines of therapy

against other pathogenic bacteria. Surfactin, one of the principal representatives of the

antimicrobial lipopeptide family, is produced by B. subtilis and displays an astonishing array of

actions.

The high cost of surfactin and low yields have limited its use in various commercial applications.

Various strategies have been implemented to achieve improved biosurfactant production such as

strain improvement, bioreactor design medium optimization or cheaper growing conditions.

It was estimated that the production of surfactin depends by B. subtilis on various conditions. The

results of this study identify the importance of manganese in influencing the growth of B. subtilis

868. The additive production of manganase salt in bacteria grow media increases the rate of

bacteria growth. To evaluate the effect of adding Mn2+ on surfactin production behavior, shows

that increases the concentration of Mn2+ increased the surfactin concentration, from 0,6µM to 2,3

µM by adding 0,2 mM Mn2+. The higher then 0,3µM concentration of Mn2+ virtually no effect on

surfactin production. The effect of stirrer speed on the surfactin production was estimated also.

The data show, that the highest value of surfactin was obtained when the stirrer speed was

400rpm.

Surfactin was separated, concentrated and his concentration was valuated by the quantitative

HPLC-UV/vis method. Antibacterial tests were carried out against E. coli and S. aureus using

surfactin suspension. The antibacterial activity was perfarmed by the potentiometric analysis.

Results data show that 0,0046µM surfactin suspension working against E. coli.

Keywords: surfactin production, B. subtilis, antibacterial activity.

ISSN 2335-8653

67

The Effect Of Crop Load On Pigment And Macro Element Quantity In Malus

Domestica With P22 Rootstocks

Alina Čeidaitė, Darius Kviklys, Pavelas Duchovskis, Giedrė Samuolienė

Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry Kaunas str. 30, Babtai, LT-54333,

Kaunas distr., Lithuania alina.ceidaite@lsdi.lt1

Abstract

The objective of the study was to evaluate the variation of pigments and mineral elements

in apple tree (Malus domestica Borkh.) ‘Auksis’ and ‘Ligol’ on P22 rootstock leaves depending

on crop load. Crop load was adjusted to 75, 113 and 150 apples in cv. ‘Auksis’ and 60, 105 and

150 apples in cv. ‘Ligol’. Contents of photosynthetic pigments (chlorophyll a, b and carotenoids)

were determined spectrophotometrically. Chlorophyll and UV-absorbing pigments (flavonols)

ratio was determined with a non-destructive method. Contents of mineral elements were

determined by inductively coupled plasma optical emission spectroscopy from dry leaves after

microwave digestion.

According to our results, crop load had significant influence on photosynthetic pigments

(chlorophyll a, b and carotenoids) and mineral elements (K and Mg) content in ‘Auksis’ leaves.

With the average crop load in 'Ligol' apple tree, the leaves had higher photosynthetic pigments and

Mg levels, also chlorophyll and flavonols ratio was higher, but K and P content and chlorophyll a

and b ratio was lower. In comparison between evaluated varieties, K and P contents were higher in

‘Ligol’ apple tree leaves.

Acknowledgements: MIP-036/2014

Keywords: Macro element, photosynthetic pigments, chlorophyll.

ISSN 2335-8653

68

Identification and Characterization of NADPH-oxidase Genes in Domestic

Apple (Malus × domestica Borkh.)

Darius Čepauskas1, Danas Baniulis2, Gražina Stanienė2, Inga Miliūtė2,

Vidmantas Stanys2

1Faculty of Natural Sciences, Vytautas Magnus University, Vileikos st. 8-212, LT-44404 Kaunas, 2Institute of

Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas st. 30, LT-54333 Babtai, Kaunas

distr., Email: cepauskas.darius@gmail.com

Abstract

Many economically important plants used in horticulture, such as apple, pear, cherry, peach and

strawberry, belongs to Rosaceae family. Apple is one of three model species of the Rosaceae

family, therefore extensive genome information and knowledge on biology and genetics of apple

became available recently. Plant cells contain superoxide anion producing NADPH oxidase

enzyme, also known as respiratory burst oxidase (RBOH), of NOX protein family that is located

in plasma membrane and contributes to generation of reactive oxygen species (ROS) that plays

important role in cell signaling involved in plant development, abiotic stress response and

pathogen defense. RBOH genes have been described in different plant species during last two

decades. Arabidopsis thaliana genome contains ten AtRBOH genes (A-J) that demonstrate

different expression levels and function in different plant tissues. A number of RBOH homologous

genes has been identified in other plants. However, number and function of RBOH homologs in

plants of Rosaceae family still remains unknown. Therefore this study was aimed to identify

RBOH genes in apple (Malus × domestica Borkh.) and to characterize their expression in shoots

grown under in vitro conditions. For identification and phylogenetic analysis of genes of apple

RBOHs, protein sequences were retrieved by a similarity search. Query of the Apple predicted

peptide database with the ten Arabidopsis RBOH orthologous protein sequences identified eight

unique full-length sequence matches. Two genes that were annotated to code transcripts with only

partial sequence coverage of RBOH protein were identified in apple genomic database. However,

additional analysis using Fgenesh gene prediction algorithm resulted in assembly of single ninth

sequence of MdRBOH gene. Phylogenetic analysis using conservative N-terminal half region of

RBOH protein sequence revealed four groups of the apple RBOH genes that were linked to

AtRBOH D, E, F and H. One of the MdRBOH genes was not closely related to any of the AtRBOH

orthologs and was annotated as a new MdRBOH K ortholog in apple. Analysis of exon/intron

structures of predicted genes revealed differences in structure of apple RBOH genes that included

from 11 to 15 exons. Primer pairs, specific to nine identified apple MdRBOH genes, were

developed and expression of the genes was assessed in apple shoots grown under in vitro

conditions.

Keywords: apple (Malus x domestica), NADPH oxidase, phylogenetic analysis, gene expression.

ISSN 2335-8653

69

The Effect of Photosynthetic Photon Flux Density on Cucumber Transplants

Growth Indoors

Skirmantė Deksnytė1, 2*, Aistė Bagdonavičienė1, Aušra Brazaitytė1, Julė Jankauskienė1,

Pavelas Duchovskis1, Giedrė Samuolienė1

1 Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas str. 30,LT- 54333

Babtai, Kaunas distr.,Lithuania, 2 Vytautas Magnus University, Department of Biology, Vileikos str. 8, Kaunas LT-

44404, Lithuania,

*E-mail address: skirmante.deksnyte@gmail.com

Abstract

The light, quality and intensity of light are the key elements to optimize of high quality vegetable

transplants. The objective of our studies was to evaluate the growth of cucumber (Cucumis sativus

L. ‘Pasalimo F1’) transplants, cultivated under various photosynthetic photon flux densities

(PPFD) were provided by light-emitting diodes (LEDs). Experiment was performed in phytotron

complex of Institute of Horticulture, LCAFS. A system of high-power, solid-state lighting

modules with 92% 638 nm (red) + 665 nm (red) + 731 nm (far red) and 8% 447 nm (blue) was

used in the experiments. The generated PPFD of each type of five solid-state modules was - ~100,

~200, ~300, ~400, ~500 µmol m-2 s-1. Our experiment revealed that increased shoot and root

fresh/dry weight dependet on increased PPFD. 400 µmol m-2 s-1 LED illumination had positive

effect on shoot height, hypocotyl diameter and leaf number. Cucumbers which were grown under

100 µmol m-2 s-1 had longer hypocotyl than other modules, but their development has been slower

as compared to other plants. 400 µmol m-2 s-1 LED illumination had positive effect on

photosynthetic rate. It is determined that PPFD had no impact for content of photosynthetic

pigments in leaves of all modules cucumber hybrid transplants.

Keywords: LED, PPFD, photosynthetic pigments.

ISSN 2335-8653

70

The Influence Of Fermented With Certain Lactic Acid Bacteria Satureja

Hortensis On The Quality And Technological Parameters Of Pork And Beef

Loin

Erika Mozuriene1*, Elena Bartkiene1, Grazina Juodeikiene2, Daiva Zadeike2, Audrius

Maruska3, Ona Ragazinskiene4

1 Lithuanian University of Health Sciences, Tilzes st. 18, 47181 Kaunas, Lithuania

2Kaunas University of Technology, Radvilenu pl. 19, 50254 Kaunas, Lithuania 3Vytautas Magnus University, Vileikos st. 8-, LT-44404 Kaunas, Lithuania 4Kaunas Botanical Garden, Vytautas Magnus University, Z. E. Zilibero st. 6, LT-46324 Kaunas, Lithuania

Abstract

The aim of this study was to evaluate the effects of the fermented with different lactic acid

bacteria (LAB) Satureja hortensis (Sh) on the quality and technological parameters of the pork

and beef loin.

For the Sh solid state (SSF) and submerged fermentation (SMF) Pediococcus acidilactici

KTU05-7, Pediococcus pentosaceus KTU05-8 and Lactobacillus sakei KTU05-6 were used. Pork

and beef loin surface was treated with fermented Sh plants.

The concentrations of L-(+) and D-(-) lactic acid in with different LAB fermented Sh plants

were determined by an enzyme test kit (R – biopharm AG – Roche, Damstadt, Germany)

according Yun et. al. (2003). Biogenic amines (BAs) analysis was carried out according Ben

Gigirey et al. (1999). Water holding capacity was determined by using compression method,

described by Grau and Hamm (1959). Tenderness of meat samples was measured as shear force

by using a texture analyzer (TA-XT2i; Texture Technologies, Scarsdale, NY, USA). The amount

of intramuscular fat was evaluated by the Soxhlet method according to Folch et al. (1957).

Acceptability of treated with Sh pork and beef loin was evaluated according to ISO 8586-1

method by fifteen judges for preliminary sensory acceptability using a 6 scores hedonic line scale

ranging from 6 (extremely like) to 1 (extremely dislike).

It was found that in Sh substrate used LAB produce more L-(+) (from 4.95 g/kg-1 P.

acidilactici SMF to 6.69 g/kg-1 P. pentosaceus SSF) than D-(-) (from 2.86 g/kg-1 P. pentosaceus

SSF to 4.76 g/kg-1 P. acidilactici SMF) lactate. BAs concentration of all analysed pork and beef

loin samples were ranged from 1.36 mg/kg to 87.64 mg/kg (in control samples and in beef loin

treated with P. acidilactici SMF Sh). A dominant BA in pork and beef loin samples was

putrescine, except, pork loin treated with P. pentosaceus SMF Sh and pork loin control samples,

where a dominant BA was cadaverine. Fermented savory plants had a positive impact on the

sensory properties of the pork and beef loin. The highest acceptability were found beef loin

samples treated with L. sakei SSF Sh.

Fermented Sh plants increased dry matter content, decreased water holding capacity,

tenderness, intramuscular fat and cooking loss of the pork and beef loin.

We conclude that pork and beef loin treatment with LAB Sh could be used as natural and

safe way to increase the organoleptic and technological parameters of meat.

Keywords: pork and beef loin, quality, lactic acid bacteria, Satureja hortensis

ISSN 2335-8653

71

Removal Of Heavy Metals By Fungal Biomass And Its Polysaccharides

Emanuela Galli

Institute of Agroenvironmental and Forest Biology (IBAF)

CNR – Area della Ricerca di Roma 1; Via Salaria km 29,300; 00015 Monterotondo (Roma ) Italy

Corresponding author email: emanuela.galli@ibaf.cnr.it

Abstract Heavy metal pollution is one of the most serious environmental problems. Many methods are used

to remove them from wastewaters: chemical precipitation, ion-exchange, adsorption, membrane

filtration, electrochemical treatment technologies, each method showing both advantages and

limitations. Adsorption is an effective and economic method, that is also reversible with the

regeneration of the adsorbent by desorption process. Biosorption utilizes natural materials of

biological origin, including bacteria, fungi, yeast, algae, etc.

Many authors reported the removal of heavy metal ions by filamentous fungi, such as Penicillium

spp. and Aspergillus spp. Also mushrooms ability has been reported, both by live and dead

biomass. The white-rot fungi Trametes versicolor and Lentinus sajor-caju are reported to be able

to adsorb about 120 mg Cd(II) g-1 when entrapped in Ca-alginate beads. Their binding capacity

has been related to functional groups present in polysaccharides of cell wall.

To evaluate the different ability of these polysaccharides and to use the most active one as a

biofilter for wastewater cleaning, β-glucans, chitin and chitosan were extracted from the mycelium

and fruit bodies of Pleurotus ostreatus (SMR 684). Their adsorbing capacity was evaluated using

increasing quantities (100 – 500 mg) of mycelium, fruit bodies, glucans, chitin or chitosan from P.

ostreatus in the presence of 10 mg L-1 Cd. Among the different fractions, chitosan showed the

greatest adsorbing capacity. Following experiments were performed with chitosan in the presence

of other metals (Ni, Zn, Pb, Cu). The best adsorption was obtained with Cu(II), with an adsorbing

capacity of 170 mg Cu(II) g-1 of chitosan.

For a practical application, chitosan was used as a biofilter in a column, eluting 25 ml of a solution

containing 500 mg L-1 Cu (II). Three cycles of adsorption-elution-regeneration were performed,

with positive results.

Chitosan extracted from fungi presents the characteristics requested to adsorbent materials. It has a

good efficiency for the removal of a wide variety of pollutants, with a high capacity and rate of

adsorption for metals and contaminants.

Keywords: Biosorption, chitosan, Cadmium, Copper, Pleurotus ostreatus

ISSN 2335-8653

72

Pathogen Elicitor Induced ROS Production And Gene Expression In Apple

(Malus × Domestica) Cell Suspension

Rimantė Grencevičiūtė1, Gražina Stanienė2, Inga Miliūtė2, Algirdas Kaupinis3, Mindaugas

Valius3, Danas Baniulis2 1Faculty of Chemical Technology, Kaunas University of Technology, Radvilėnų rd. 19, Kaunas.,

2 Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry Kaunas 30, Babtai, Kaunas

distr., 3 Proteomics Centre, Vilnius University Institute of Biochemistry, Mokslininkų st. 12, Vilnius. E-mail:

r.grenceviciute@gmail.com.

Apple scab (Venturia inaequalis) causes one of the most damaging diseases of domestic apple

(Malus x domestica) worldwide. The disease results in reduced tree productivity, lower fruit

quality and storage properties. Qualitative and quantitative resistance traits are characteristic to

plants of genus Malus, and characterization of apple scab resistance genes is important for

efficient introduction of the disease resistance traits to cultivated apple varieties. Previous research

on interaction of Malus sp. and V. inaequalis presents a comprehensive knowledge on biology of

resistance to the fungal pathogen in apple, however understanding of mechanistic basis of the

resistance remains scarce. Fungal pathogens are able to penetrate the intact surfaces of host plants,

rapidly establishing infection. Disease resistance results when the corresponding product of a

dominant resistance gene R recognizes a dominant Avr gene product (effector) from the pathogen

leading to effector-triggered immunity (ETI). In addition, plants have constitutive and inducible

defences that do not require R genes for their presence or activation. Non-host resistance to fungi

has been shown to be under complex genetic control and can involve a mutiplicity of defense

factors. The defense response is initiated by pathogen-associated molecular patterns (PAMP) and

is called PAMP-triggered immunity (PTI). Although the characteristics of defence related to PTI

and ETI are very different, however these two types of resistance share common downstream

immune responses, including accumulation of reactive oxygen species (ROS), hormone signalling,

transcriptional reprogramming of defence-related genes and cell death. Aim of this study was to

establish ROS production characteristics and proteomic dissection of gene expression patterns

associated with disease resistance response induced by pathogen effectors in apple cells. Apple cv.

Gala and Golden delicious cell suspension was incubated with V. inaequalis culture extract (ViE),

chitin, yeast effector protein fraction and bacterial flagellin protein fragment (flg 22).

Fluorescence assay using H2DCFDA dye established that incubation with all of the elicitors

resulted in concentration and time dependent increase in ROS production. Further, proteomic

analysis using gel free LC-MS/MS approach established that expression of 56 and 114 proteins

was upregulated by incubation with flg22 and ViE elicitors, respectively. Meanwhile the treatment

resulted in downregulation of 55 and 104 proteins, respectively. An association of the protein

function with cell metabolic and defence response process was established using gene ontology

analysis.

Keywords: Apple, cell suspension, disease resistance, apple scab, reactive oxygen species,

proteomics.

ISSN 2335-8653

73

Light Spectral Effects On Alkaloid Contents In Catharanthus Roseus

Laurita Grigaitytė1, Akvilė Viršilė2, Ramūnas Sirtautas, Aušra Brazaitytė

1Kaunas University of Technology, Faculty of Chemical Technology, Radvilėnų Rd. 19, LT-50254 Kaunas, Lithuania, 2Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333 Babtai,

Kaunas distr., Lithuania

E-mail: laurita.grigaityte@gmail.com

We aimed to evaluate the effects of light spectral components on the alkaloid compounds

in different anatomical parts of Catharanthus roseus plants.

Plants were cultivated in phytotron (21/17°C) under experimental light emitting diode

(LED) based lighting (18h, 300 µmol m-2s-1) 30 days growth cycle. Experimental lighting spectra

consisted of sole red 640nm LED light (300µmol m-2s-1) or the combination of red with 50µmol

m-2s-1 of blue 455, yellow 595, green 520nm or 15µmol m-2s-1 of UV-A 385nm light (total PPFD

of 300µmol m-2s-1 maintained). Vincristine and vinblastine contents were determined by High

performance chromatographic method.

The results of analysis of selected pharmaceuticaly important alkaloids show, that the

highest contents of vincristine and vinblastine were determined in Catharanthus roseus leaves and

blossoms, and lower contents in stems. Red light supplemented with UV-A light promoted

accumulation of vincristine compounds in different anatomical parts of Catharanthus roseus

plants, when supplemental blue light had significant effect only in blossoms. This indicates the

importance of supplemental UV light seeking to cultivate medicinal plants with high contents of

selected phytochemicals.

Keywords: light emitting diodes, vincristine, vinblastine, red light, UV-A

Acknowledgment: This research was supplementary funded by the Research Council of Lithuania

under the project “Promotion of Students’ Scientific Activities”

ISSN 2335-8653

74

The Influence Of Nitrogen Fertilizers On Winter Wheat Quality Indicators

Aistė Juchnevičienė1, Ilona Vagusevičienė1, Aušra Brazaitytė2, Pavelas Duchovskis1,2

1 Institute of Agricultural and Food Science, Faculty of Agronomy, Aleksandras Stulginskis University, Studentų str.

11, LT-53361 Akademija, Kaunas distr., Lithuania

E-mail: aiste.zuzaviciute@inbox.lt 2 Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333

Babtai, Kaunas distr., Lithuania

The paper analyse the influence of nitrogen fertilisers on quality indicators of winter wheat. Field

experiments were carried out in the period 2011 and 2013 at the Experimental Station of

Aleksandras Stulginskis University. The object of assessment was cultivar of winter wheat with

good baking properties ‘Kovas’ (country of origin – Lithuania). The soil: carbonate shallow gleyic

leached (IDg8-k), Calc(ar)i-Epihypogleyic Luvisol (LVg-p-w-cc). Its plow layer is neutral and low

level alkalinity (pHKCl 7.0–7.2), with medium humus content (2.48–2.70 %), very high levels of

phosphorus (271.0–296.8 mg kg–1 P2O5) and high levels of potassium (178.0–184.0 mg kg–1 K2O).

During the sowing time wheat were fertilized by single-element phosphorus and potassium

(P60K60) and in early spring during the tillering time (BBCH 23–25) ammonium nitrate (N60) was

applied. Additionally foliar fertilizer urea solution N30, N40 was used during the booting stage

(BBCH 34–36) and N15, N30 was applied during milk ripening stage (BBCH 71–74). Average

findings of the two years of research showed that investigated nitrogen fertiliser application rates

essentially (P < 0.01) improved quality indicators of wheat grain. Due to the influence of

fertilisers, protein content in the grain increased by 1.50–2.70 percentage units, the amount of wet

gluten by 4.00–6.37 percentage units and sedimentation values by 9.95–18.30 ml. The greatest

protein, wet gluten contents and the highest sedimentation values were found in wheat grain that

were fertilized with the highest nitrogen application rates N40 + N30 during the booting and milk

ripening stages. Correlative regressive analysis of the data revealed that there is a very strong (r =

0,993–0,997**) linear dependency between the application rates of nitrogen fertilisers and grain

quality indicators. This dependency is statistically significant at the 99 percent probability level.

Keywords: grain quality, nitrogen fertiliser, winter wheat

ISSN 2335-8653

75

Cloning And Expression Of Transmembrane Domain Segments Of Arabidopsis

Thaliana RBOH D Enzyme

Andrius Kočevas1, Kristina Druceikaitė2, Danas Baniulis2

1Vytautas Magnus University, Faculty of Natural Sciences, Vileikos st. 8, Kaunas, LT-44404,

2Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas st. 30, Babtai, LT-

54333, Kaunas distr., E-mail: An.kocevas@gmail.com

Abstract

Production of reactive oxygen species (ROS) is important cell signaling component involved in plant

response to stress. NADPH-oxidase, also known as respiratory burst oxidase homologue (RBOH) in plants,

is a superoxide producing NOX family protein that is located in plasma membrane and contributes to ROS

generation outside the plasma membrane in the apoplast. A. thaliana has ten RBOH genes (RBOH A-J).

RBOH D is expressed in all plant tissues and takes part in regulation of response to pathogen and abiotic

stress. Plant RBOH proteins show unique structural and regulation features that include calcium binding

and different cytosolic component role in regulation of the enzyme activity. Meanwhile, structure of small

N-terminal cytosolic domain of plant RBOH was studied so far, further structural and functional studies of

plant RBOH homologues could help to understand the role of these enzymes in cell signaling.

Heterologous expression and purification of transmembrane proteins is challenging due to their

hydrophobic membrane domain. However, valuable information about transmembrane protein structure

and function may be obtained by expression and characterization of separate membrane domain fragments.

Aim of this study was to identify, clone and optimize the production of segments of A. thaliana RBOH D

protein membrane domain in E. coli expression system. To identify transmembrane domain of RBOH D,

bioinformatics analysis of amino acid sequence hydrophobicity profile, transmembrane protein domain

modeling and assessment of previously predicted structures of other NOX family proteins, such as NOX2,

was used. Six transmembrane helices were identified and the third and fifth helices each contained two

conserved His residues, which are considered to coordinate the two hemes involved in superoxide

production. Primers were designed and six different segments that include 3 to 6 helices of the

transmembrane domain were amplified by PCR from cDNA library of A. thaliana. The segments were

cloned into pLATE52 vector using ligation independent cloning technology. For the peptide purification,

the construct included N-terminal 6xHis-tag that could be removed using protease. The construct was

transformed into E.coli strain Lemo21(DE3). High hydrophobic protein concentrations in bacterial cells

might lead to formation of inclusion bodies and toxicity to cells. Rhamnose regulated protein expression in

the Lemo System provided means for tuning protein production. Cell growth and protein induction

conditions were optimized to ensure maximum yields of the protein production.

Keywords: Arabidopsis, respiratory burst oxidase homologue, transmembrane domain, protein production,

heterologous expression.

ISSN 2335-8653

76

Rich By Collagen Recycled Solid Waste Of Leather As Nitrogen Source For

Agriculture

Ineta Komiciute, Ilona Jonuskiene, Justa Sirvaityte, Virgilijus Valeika

Kaunas University of Technology, Faculty of Chemical Technology, Radvilenu pl. 19, Kaunas, LT- 50254, Lithuania

E-mail: justa.sirvaityte@ktu.lt

Abstract

The predominant oil crop for food, industry, and renewable energy needs in Lithuania is oilseed

rape (Brassica napus). Seed yield and fat concentration are the primary parameters in crop

cultivation for both nutritional and industrial uses. High seed yield double-low rapeseed varieties

developed in other countries (Sweden, Germany, Denmark) are cultivated in Lithuania, but they

often cannot fully realize the productivity potential encoded in the variety genome because of

unfavourable climatic and soil conditions [1]. Nitrogen nutrition remains the factor that

significantly restricts plant also and rape productivity.

Leather industry is one of oldest branch of industry. But, environmental pollution is the main

problem in leather making. It generates a significant quantity of solid wastes (0.7 kg / kg of hides

or skins processed) [2]. The management of solid wastes, especially tanned leather waste, is a

challenging problem faced by tanners. The leather tanning process generates substantial quantities

of solid waste as shaving, trimmings, buffing dust, hair and sludge. In constitutes protein as the

main component. The use of such wastes as fertilizers represents an interesting alternative for their

disposal, with less potential impact to the environment. The goal of research was to transform the

leather industry by-products to a qualitative organic fertilizers rich by nitrogen for rape (Brassica

napus).

Keywords: leather, collagen, hydrolysate, Brassica napus, fertilizer.

References:

[1] G. Siaudinis, B. Butkute. Communications in Soil Science and Plant Analysis. 2013, 44, 145–157.

[2] G. Sekaran, S. Swarnalatha, T. Srinivasulu. Journal on Design and Manufacturing Technologies. 2007, 1(1), 47-

52.

ISSN 2335-8653

77

Nitrogen And Micro-, Macroelement Ratios In Current-Year Needles Of

Juniperus Communis L. Lithuania Populations

Edvina Krokaitė, Ramūnas Vilčinskas, Lina Zybartaitė, Algimantas Paulauskas, Eugenija

Kupčinskienė

Vytautas Magnus University, Vileikos g 8-212, LT-44404, Kaunas, Lithuania, edvina.krokaite@gmail.com

Abstract

Juniperus communis L. is cosmopolitan conifer species growing in unpolluted areas and nitrogen

poor soils. Both, plant growth and health are tightly related to composition of essential elements in

the needles and soil. Evaluating nutrition among the most important aspects are ratios between

nitrogen and other macro- and microelements. This ratio has been employed as an indicator to

estimate a plant nutritional level and the balance of physiological optimum for plant growth. This

type of analysis is not widely applied to investigate characteristics of needles elements of common

juniper. The main purpose of the study was to assess ratios of the elements composition of the

needles collected from populations which differ in geographic position and habitat type.

Nutritional elements concentrations were examined in 14 populations of Juniperus communis L.

Nitrogen concentration were estimated by Kjeldhal method. Other elements: macro- (P, K, Ca,

Mg), microelements (Mn, Fe, Zn, Cu), were analysed by atomic absorption spectrometry except

phosphorus analysed spectrophotometrically. Our results demonstrate ratios between N:P ranged

from 8.83 (Panevezys) to 12.74 (Kelme I), N:K – 3.89 (Ignalina II) – 6.00 (Trakai), N:Ca – 0.76

(Ignalina II) – 2.17 (Alytus), N:Mg – 18.66 (Ignalina II) – 31.76 (Ignalina I), N:Fe – 128.69

(Neringa) – 795.30 (Kaunas), N:Zn – 610.21 (Kelme II) – 1176.63 (Trakai), N:Cu – 2387.40

(Alytus) – 10133.64 (Ignalina II), N:Mn – 14.06 (Kelme II) – 493.28 (Jurbarkas). Ratios of

nitrogen to macro-, microelements in the needles could be used to assess the effective predictors

of nutrient limitation, management and monitoring purposes in considering the nutritional status

of J. communis in various habitats.

Keywords: conifers, common juniper, nutrition, Kjeldhal method

ISSN 2335-8653

78

The Effect Of Light-Emitting Diodes Spectra On Mineral Elements

Content In Brassicaceae Microgreens

Birutė Lekstutytė1, Akvilė Viršilė2, Aušra Brazaitytė2, Viktorija Vaštakaitė2

1Kaunas University of Technology, Faculty of Chemical Technology, Radvilėnų Rd. 19, LT-50254 Kaunas, Lithuania 2Institute of Horticulture, Lithuanian Reasearch Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333

Babtai, Kaunas distr., Lithuania

E-mail: birute.lekstutyte@gmail.com

Abstract

The aim of this study was to investigate the effect of light-emitting diodes (LEDs) light spectra on

mineral elements content in Brassicaceae microgreens. Microgreens are seven-ten days old

individual plant seedlings with emerged first true leaf, recently recommended to be used as

‘functional food’ in daily nutrition. Red pak choi (Brassica rapa var. chinensis ‘Rubi F1’) and

mustard (Brassica juncea ‘Red Lion’) microgreens, due to be known as widely used for intense

flavor and high nutritional properties, were investigated. Plants were grown in controlled-

environment growth chamber at the Institute of Horticulture, Lithuanian Research Centre of

Agriculture and Forestry. Day/night temperatures of 21±2/17±2ºC and the relative air humidity at

55±5% were maintained. Four lighting treatments using a combination of blue 447 nm, red 638

nm, red 665 nm and far red 731 nm LEDs as a main spectra (1- control) to supplemental green 520

nm (2) or yellow 595 nm (3) or orange 622 nm (4) LEDs were performed. The total

photosynthetic photon flux density (PPFD) at 300 μmol m-2 s-1 with 16 h photoperiod of each

treatment was set. The mineral elements – Na I, K I, Mg II, Fe II, Zn II, P I, Ca II – contents were

determined quantitatively by inductively coupled plasma optical emission spectrometry (ICP-

OES) (Spectro Genesis, Germany). The data obtained showed that mineral elements contents

depended on LEDs light spectra and differed among both microgreens species. Significantly lower

(P<0.05) contents of all elements were determined in red pak choi grown under supplemented

green 520 nm or yellow 595 nm diodes to main LEDs spectra. Only Na I significantly increased

(~18.9%) in red pak choi grown under supplemental orange 622 nm diodes. Otherwise, the

supplementation of green 520 nm diodes led to significantly increased contents of K I (~1.7%),

Mg II (~21.1%), P I (~22.9%), Ca II (~14.0%), Fe II (~48.4%), Zn II (~16.7%) in mustard

microgreens. Supplemental yellow 595 nm and orange 622 nm components also led to

significantly enhanced accumulation of Fe II (~35.1% and ~36.7%, respectively) in mustard. In

conclusion, the spectra effect is Brassicaceae species dependent; however, a target management of

LEDs light spectra can improve mineral elements contents in microgreens.

Keywords: Brassicaceae, controlled-environment, ICP-OES, light spectra, microgreens, minerals

Acknowledgement: This research was supplementary funded by the Research Council of

Lithuanian under the project “Promotion of Students’ Scientific Activities”

ISSN 2335-8653

79

Chitin Characterization Of Two Baltic Sea Shrimp Species:

Palaemon Elegans And Crangon Crangon

Evaldas Lelešius1,2, Murat Kaya2, Vaida Tubelytė 1, Radvilė Nagrockaitė1,2, Vykintas

Baublys1

1Department of Natural Sciences, Vytautas Magnus University, Lithuania, LT-44248 2Department of Biotechnology and Molecular Biology, Aksaray University, Turkey, TR-68100

E-mail: v.baublys@gmf.vdu.lt

Abstract

Chitin is a biopolymer, which can be found in a plenty amount in marine environments and is the

secondly most abundant in nature, after cellulose. Mostly chitin is found in crustaceans, insects or

other arthropods, also in mushrooms [1]. Chitin and chitin-derived products are attracting great

interest because of their wide range of potential applications within biotechnology, medicine and

pharmacology, agriculture, cosmetics, and wastewater treatment [2, 3, 4, 5]. In this study we

investigated differences in the chitin content, physicochemical properties and surface morphology

of chitins extracted from two common Baltic Sea shrimp species: Paleomon elegans and Crangon

crangon. Both shrimp species are widely distributed along European coast and across the Atlantic

east coast. The dry weight chitin contents P. elegans and C. crangon were determined as 7.1% and

6.7%, respectively. Fourier transform infrared spectroscopy (FT-IR) and thermogravimetric

analysis (TGA) analysis were used to characterize physicochemical properties of obtained chitins.

As expected, FT-IR and TGA results showed that the isolated chitins were in α form. The main

difference between examined chitins extracted from two shrimp species was noticed after TGA.

The first mass loss step for P. elegans was observed at 5.09% and the second mass loss step at

81.92%. For C. crangon the first mass loss was observed at 2.75% and the second mass loss at

65.39%. However, the highest decomposition temperature DTGmax were found to be the same for

both species, 382.8 °C for P. elegans and 382.4 °C for C. crangon. The surface morphology of

chitins yielded from two shrimp species were examined with scanning electron microscopy (SEM)

and it revealed that these structures consists of nanofibers and nanopores, however chitin surface

of C. crangon was rougher than P. elegans. According to our results the extracted chitin was

thermally stable and can be found widely applicable in many industrial processing. Also, fibril

structure of chitins suggested that it is suitable for using in textile industry and biomedicine.

Furthermore, we believe that the Baltic Sea is a new and unexploited source of chitin in Northern

Europe.

Keywords: chitin, crustacean, marine, FTIR, TGA, SEM.

References: [1] F.A. Al-Sagheer, M.A. Al-Sughayer, S. Muslim, M.Z. Elsabee. Carbohydr Polym. 2009, 77, 410–419.

[2] B.K. Park, M.M. Kim. Int J Mol Sci. 2010, 11(12), 5152-5164.

[3] J. Synowiecki, N.A. Al-Khateeb. Crit Rev. Food Sci Nutr. 2003, 43, 145–171.

[4] P.A. Felse, T. Panda (1999) Bioprocess Eng. 1999, 20, 505–12.

[5] S. Hajjia, I. Younesa, O. Ghorbel-Bellaaja, R. Hajjib, M. Rinaudoc et al. Int J Biol Macromol. 2014, 65, 298–306.

ISSN 2335-8653

80

Studies Of Lactococcus Lactis Infection By Phage C2

Vygandas Marozas, Inga Žievytė, Rimantas Daugelavičius

Department of Biochemistry, Vytautas Magnus University. E-mail address: v.marozas@gmf.vdu.lt

Bacteria Lactococcus lactis is one of the most commonly used lactic acid bacteria in

the dairy industry [1]. It is used in the production of cheese, sour cream, yogurt, buttermilk, and

other dairy products. L. lactis is usually infected by bacteriophages belonging to the Siphoviridae

family and are divided into three main groups: 936, c2, and P335. Due to bacteriophage-caused

infections the dairy industry experiences substantial loss of income [2]. The infection inhibits

lactose fermentation to lactic acid. Therefore, quality of the product changes, in some cases the

production is stopped. The aim of this study was to determine the influence of incubation

conditions on L. lactis viral infection.

It is usual in the dairy industry to inactivate bacteriophages by heat [3], but higher

the temperature is, more taste and presentation of the final product is affected. In order to explore

the bacteriophage inactivation by heat, not the infected bacterial culture but the bacteriophage

suspension was heated. Bacteriophage c2 suspension was heated at 63°C for various time periods.

It was observed that heating affects the course of infection: the phage remained infective, but the

infection process took longer. Multiplicity of infection (MOI) examination has shown that MOI

has a significant influence on the course of infection: the increase of MOI 10 times (from 5 to 50)

leaves less unlysed virus-resistant cells. It is known [4] that the supplement of a medium with

calcium ions is required for a efficient infection. Our results also indicated that the productive

infection did not occur if the growth medium was not supplemented with calcium ions.

L. lactis bacteria are unable to synthesise heme. The bacterial culture grows longer

and produces more biomass afer the addition of hemin to the medium Studies of the infection have

shown that bacterial lysis progress faster in the medium with hemin. However, after examination

of the medium aeration effects on the infection, it was discovered that the infection progress worse

at high aeration. At strong aeration conditions and MOI 5 bacterial lysis started very quickly but

ineffeciantly and the growth of bacteriophage-resistant cells immediately started. Under the same

aeration conditions but MOI 50, infection was significantly more effective. These results show

that strong aeration prevents virus adsorption on L. lactis cells.

Examination of the respiration process have shown that if cells are uninfected, they

actively respire and use all the oxygen from the medium. Once the bacteriophage begins to disrupt

cells, the dissolved oxygen concentration in medium gradually increases.

Keywords: Lactococcus lactis, lactic acid bacteria, bacteriophages.

ISSN 2335-8653

81

Water Pollution By Pharmaceuticals: Assessment Of Ibuprofen Tolerance,

Phytometabolisation And Phytoremediation Potential In Model Plant Species

Of The Riparian And Aquatic Ecosystems

Fabrizio Pietrini, Valentina Iori, Daniela Di Baccio, Massimo Zacchini

Institute of Agro-environmental and Forest Biology (IBAF)

CNR - Research Area of Rome1, Via Salaria Km. 29,300 - 00015 Monterotondo (Rome) Italy

The contamination of the aquatic ecosystem by organic xenobiotics is currently recognised as one

of the emerging problem at global environmental scale. In the last few years, particular attention

has been devoted to the presence and diffusion of pharmaceutical compounds and personal care

products (PPCPs), and their residues, in surface water, groundwater, wastewater effluents, and,

consequently, their potential toxic effects on ecosystems. Among these so-called emerging

contaminants, ibuprofen (IBU), one of the most used non-steroidal anti-inflammatory drug

(NSAID) worldwide, is considered a great concern for the aquatic environment, being one of the

most frequently detected pharmaceuticals in freshwater. In this regard, the presence of IBU has

been proposed as a marker of surface water contamination by wastewater. Beside IBU, its major

human metabolites (carboxyl-IBU and both 1-hydroxy and 2-hydroxy-IBU isomers) are

commonly detected in the water bodies, representing a potential environmental hazard. Scarce

information about the effects of IBU and its metabolites on plants are present in literature. In

particular, very few works are dealing with the evaluation of plant physiological responses in

order to appreciate tolerance/sensitivity thresholds to IBU presence in the growth medium.

Moreover, up to now no evidences of IBU phytometabolisation activity in plants were produced.

The assessment of such plant responses represents a key point to evaluate the biomonitoring and

phytoremediation potential of plants towards IBU. In this regard, efforts were made by our

research group to study the effects of IBU exposure on plants at growth, physiological and

biochemical level. Different experimental setups were used, ranging from tissue culture to

hydroponic culture, focusing on model plant species of the riparian and aquatic ecosystems. In

particular, a notable tolerance, accompanied by an amelioration of the oxidative stress condition,

was observed on poplar cell cultures exposed to high IBU concentrations (0.3 to 30 mg/L).

Further, a differential growth, physiological and biochemical activity, in terms of photosynthetic

performance and antioxidative defence activation, in response to different IBU levels (3 to 30

mg/L) in the growth medium was put in evidence in two willow clones under hydroponics.

Finally, in a static 8-day test, duckweed plants (Lemna gibba L.) were treated with 1 mg/L IBU to

evaluate the effects on growth, phytotoxic indicators, pigment content and photosynthetic

performance, and the fate of IBU both in the plant tissues and in the growth medium. Results

showed a growth stimulation exerted in L. gibba by IBU and a remarkable phytometabolic activity

of this plant species, resulting in several IBU metabolic products detected within plant and in the

growth medium. Implications of these findings in order to evaluate the contribution of floating

plant such as duckweed for the biomonitoring of aquatic ecosystems and the phytoremediation of

IBU residues in wastewater are currently under discussion.

ISSN 2335-8653

82

Effect Of Salinomycin, Antimycin, Sodium Phenylbutyrate And Glucose

Deprivation On Cancer Cell Viability And Mobility

Gintarė Milašiūtė1,2, Sandra Puidokaitė1, Ieva Ceslevičienė1, Ieva Antanavičiūtė1, Valeryia

Mikalayeva1 1 Institute of Cardiology, Lithuanian University of Health Sciences, Kaunas, Lithuania,

2 Faculty of Natural Sciences, Vytautas Magnus University, Kaunas, Lithuania

Gintare.Milasiute@lsmuni.lt

Abstract

One of the major problems in the clinical applications is the cancer cell property to become

resistant to multiple drugs. A number of new and already known inhibitors or their combinations

are being tested for obtaining the most efficient impact on treatment of various types of cancer. In

this study the effect of different concentrations of salinomycin (Sal), antimycin A (AntA), sodium

phenylbutyrate (PBA) and also glucose (Glc) deprivation was investigated on laryngeal squamous

cell carcinoma (LSCC, isolated from the primary tumor) cell and breast cancer cell (commercially

available: MDA-MB-231) viability. Furthermore, cancer cell capability to invade other tissues is

important feature that indicates malignancy of tumor [1, 2]. We investigated how the compounds

mentioned above affect mobility of the MDA-MB-231 cell line. Cell migration analysis was

performed by wound healing assay. Cell-free area remaining in the wound was measured after 5

and 10 h. Cell viability of LSCC and MDA-MB-231 was evaluated by Trypan blue staining and

Hoechst 33342 fluorimetric assay in 96-well plate.

Cells treated with 100 nM of Sal demonstrated slightly lower proliferation rates after 48 h

compared with control, whereas a 2-fold and a 3-fold decrease in the number of cells was

observed after application of 10 and 20 µM of AntA, respectively. Similar results were obtained

while examining the effect of Glc deprivation. The concentration of 100 µM of PBA caused a

greater decrease in proliferation of MDA-MB-231 compared with LSCC cells. Fluorescence of

both cell lines stained with Hoechst 33342 decreased ~5-fold after 48 h treatment with 10 nM Sal,

10µM AntA and 100 µM PBA. Less decrease in fluorescence intensity was observed after 72 h

compared with the effect after 48 h in both cell lines. It might be due to adaptation of cells to the

presence of drugs. Unaffected MDA-MB-231 cells occupied approximately 45% of scrape area

after 5 h, which is 3 times as much compared to cells treated with 1 µM of AntA or 100 nM of Sal.

Glc deprivation as well as treatment with 100 µM of PBA resulted in a 2-fold decrease of area

occupied. After 10 h control cells occupied ~74% of the scrape area, while Sal- and Glc-treated

cells occupied 50 and 43 %, respectively. Treatment with 1 µM AntA and 100 µM PBA had

similar effect, as cells occupied ~38% of area.

Keywords: MDA-MB-231, LSCC, viability, mobility.

References

[1] F. Kopp, A. Hermawan, P.S. Oak, A. Herrmann, E. Wagner, A. Roidl, Molecular Cancer, 2014, 13:16

[2] Y. Al Dhaheri, S. Attoub, K. Arafat, S. AbuQamar, A. Eid, N. Al Faresi, R. Iratni, Biochim Biophys Acta, 2013,

1830, 3121–3135

ISSN 2335-8653

83

A Physicochemical Characterization Of Chitin Extracted From Edible

Lithuanian Mushrooms

Radvilė Nagrockaitė1,2, Murat Kaya2, Vykintas Baublys1, Evaldas Lelešius1,2, Vaida

Tubelytė1

1Department of Biology, Vytautas Magnus University, 44404 Kaunas, Lithuania 2Department of Biotechnology and Molecular Biology, Aksaray University, 68100, Aksaray, Turkey

E-mail: v.tubelyte@gmf.vdu.lt

Abstract

Chitin is a biopolymer made from (1→4)-linked N-acetyl-β-D-glucosamine. It can be found in

exoskeleton of crustacean, insect and in the cell wall of mushrooms [1]. Chitin is very important

biomaterial these days, because of its biodegradable, biocompatible, nontoxicity, antitumor,

antioxidant and antimicrobial properties. Chitin has many applications in medicine, cosmetic,

biotechnology and other fields [2]. More than 100 000 mushrooms species are known in the

World. More than 6000 mushrooms species are described in Lithuania [3]. Till now no studies has

been done with Lithuanian mushrooms chitin. In this study the Lithuanian mushrooms chitin was

investigated for the first time. The aims of this study were: a) to extract chitin from five edible

mushrooms species belonging to four families; b) to evaluate and compare chitin physicochemical

properties between these five mushrooms, c) to compare chitin contents of mushroom pileus and

stipes.

Chitin was extracted from five (Boletus edulis, Leccinum auranticum, Russula vesca, Cantharellus

cibarius and Paxillus involtus) edible Lithuanian mushrooms by using a chemical method. Four

steps was used to isolate chitin from mushrooms: mushrooms dust bleaching (NaClO),

deproteinization (NaOH), demineralization (HCl) and second deproteinization (NaOH). Obtained

chitin was characterized by Fourier transform infrared spectroscopy (FTIR) and by scanning

electron microscopy (SEM). The results of FTIR showed that all mushrooms chitin are in alpha

form and can be used as a potential raw material for chitin production. SEM analysis showed that

mushrooms chitin surface was clumped and has no clearly visible nanoporous and nanofibers

structure. The chitin contents of pileus and stipes of mushroom bodies were determined and

compared. Three mushrooms species (Leccinum auranticum, Cantharellus cibarius, Paxillus

involtus) out of total five had higher chitin content in pileus (2,9%, 1,2%, 1,52% respectively) than

in stipes (1,95%, 1%, 1% respectively), while chitin content of Russula vesca was almost the same

in pileus (1,2%) and stipe (1,3%). Only in Boletus edulis species chitin content was higher in stipe

(6%) than in pileus (1,3%). The highest chitin content among all investigated species was

observed in Boletus edulis stipe (6%) and the lowest in Cantharellus cibarius and Paxillus

involtus stipes (1%).

Keywords: Mushrooms, Fungi, Chitin, FTIR.

References: [1] M.K. Jang, K. Byeong-Gi, J. Young-Il, H.L. Chang, N. Jae-Woon, J. Polym. Sci. 2004, 42, 3423-3432.

[2] M. Rinaudo, Prog. Polym. Sci. 2006, 3, 603-632.

[3] V. Sasnauskas, Šviesa, 2008, 288p.

ISSN 2335-8653

84

HIF-1 Is Indirectly Involved In Hypoxia Dependent Splicing Regulation

Egle Jakubauskiene1, Inga Pečiulienė1, Laurynas Vilys1, Arvydas Kanopka1

1 Department of Immunology and Cell Biology, Vilnius University, Institute of Biotechnology, Vilnius, 02241

Lithuania, peciulien@ibt.lt

Abstract

Eukaryotic cells sense oxygen and adapt to hypoxia by strict regulation of a number

of genes. The removal of introns from mRNA precursors (pre-mRNAs) is an essential step in

eukaryotic gene expression. The splicing machinery heavily contributes to biological complexity

and especially to the ability of cells to adapt to altered cellular conditions.

A dominant negative regulator of hypoxia-inducible gene expression, IPAS, is

generated from HIF-3α pre-mRNA by an alternative splicing mechanism. Inactivation of the IPAS

transcript in mice leads to the neovascularization of the cornea, suggesting that IPAS is an

important regulator of anti-angiogenesis in this tissue. Using mouse HIF-3 pre-mRNA as a

model system we demonstrate for the first time that SR proteins are involved in oxygen tension-

dependent changes in pre-mRNA splicing. SR proteins isolated from hypoxic cells possess

differential ability to activate hypoxia-dependent splice sites and they are more phosphorylated

than those isolated from normoxic cells. We also show that expression of SR protein kinases

(CLK1, SRPK1, SRPK2) in hypoxic cells is elevated at mRNA and protein levels and that

increased expression of CLK1 kinase is regulated by HIFs. We demonstrate that reduction of

cellular CLK1 level affects hypoxia-dependant CAIX gene pre-mRNA splicing.

Keywords: pre-mRNA splicing, hypoxia, SR proteins, phosphorylation, SR kinases, CKL1, SRPK1,

SRPK2.

ISSN 2335-8653

85

Characteristics Of Polymorphic Markers For Juniperus Communis L. From

Lithuania

Ramūnas Vilčinskas, Lina Zybartaitė, Audrius Petrauskas, Algimantas Paulauskas,

Eugenija Kupčinskienė

Vytautas Magnus University, Vileikos 8, LT-44404 Kaunas, Lithuania, ramvil26@gmail.com

Abstract

Application of molecular markers has been developed rapidly over the last two decades. DNA

based markers, such as microsatellites (SSR) are very powerful tools for the analysis of genetic

biodiversity due to their high level of polymorphism, frequency distribution in the eukaryotic

genome, co-dominant patterns of inheritance and have a high discrimination power. Studies of

common juniper based on the molecular markers included analysis of plants growing in Southern

and Western parts of Europe. However, not enough attention has been paid consider the

importance of genetic diversity of common juniper in more Eastern and Northern parts of Europe.

J. communis is the third common species among conifers naturally growing in Lithuania. In this

country J. communis is important component of forest ecosystems also is widely used in the

pharmaceutical, spicy, ornamental and fragrant plant. Our study aimed at evaluation of

polymorphic SSR loci of Lithuania populations of common juniper from different geographic

regions and habitat types. Samples were collected from 14 population (140 juniper individuals in

total) of J. communis belonging to 5 different habitat types: coastal brown dunes covered with

natural coniferous forest (Pinus sylvestris); Juniperus communis scrubs; subcontinental moss;

scots pine forests; transition mires and quaking bogs, xero-thermophile fringes. Genomic DNA

was extracted from current-year needles using CTAB method. Five pairs of SSR primers were

tested: Jc016 (forward − F: CAAAATGATGCTTATGATGA; reverse − R:

TGAAAATCATTGTTGTTTTCTT), Jc031 (F: CCTAATGTTGTAATCACGTATATCT; R:

TGACCTTGGGCGTATAGATT), Jc032 (F: ACATTGCAAATATGGGGTAA; R:

TTGATGAGTTGTTGAGTTATTAAG), Jc035 (F: TGTGTTT ATTCTCCCCATCT; R:

CCCCCAGTTATTCTAAACATT); Jc037 (F: GGCAATTAGTAA GGCACAAG; R:

TAAGGTGGATATCACCAAGG). All primers have generated DNA fragments of J. communis

after optimization PCR. For primers Jc031 and Jc037 annealing temperature was 53 C°, while for

primers Jc016, Jc032 and Jc035 − 52 C°. Polymorphic DNA fragments length ranged from 114 to

220 bp. Number of alleles ranged from 10 to 20. At the species level all generated alleles were

polymorphic.

Keywords: microsatellite markers, SSR loci, common juniper

ISSN 2335-8653

86

Serum Albumin Corona on ZnO NPs has Opposite Effect in Cellular and

Mitochondrial Toxicity Experimental Models

Karolina Rilskytė1, Zita Naučienė1, Valentinas Snitka2, Rasa Žūkienė1

1Department of Biochemistry, Vytautas Magnus University, K. Donelaicio 58, LT-44248, Kaunas, Lithuania 2Research Centre for Microsystems and Nanotechnology, Kaunas University of Technology, Studentu 65, LT-51369,

Kaunas, Lithuania

Abstract

Zinc oxide nanoparticles (ZnO NPs) are increasingly applied in a diverse array of industrial and

commercial products. In the biological milieu a protein corona is formed on the surface of NPs.

The protein corona changes the mode of NPs interaction with cells, organelles and molecules

resulting in a different biological effect of NPs as compared to plain NPs. Bovine serum albumin

(BSA) and zinc oxide nanoparticles (ZnO NPs) were chosen in this study as a model system to

investigate NPs-protein corona complex toxicity to cells and isolated mitochondria.

In the cellular experimental model plain 20 nm ZnO NPs (ZnO) and ZnO NPs coated with bovine

serum albumin (ZnO-BSA) were tested for citotoxicity and ROS generation in rabbit myoblast

(Fr2) and human breast carcinoma (MX-1) cell lines. Both NPs types were cytotoxic with similar

dependency on concentration, however, NPs were appr. 10% less toxic to Fr2 at high

concentration (200 μg/ml) as compared to MX-1 and ZnO-BSAwere less toxic than ZnO NPs in

the concentration range of 150-200 μg/ml. ZnO-BSA NPs haven’t induced ROS generation in

none of cell line. The minimum ZnO concentration that induced ROS generation in MX-1 was

lower as compared to Fr2 – 20 and 50 μg/ml, respectively.

The treatment of mitochondria with ZnO NPs had an unexpected effect: ZnO-BSA NPs impaired

stronger the mitochondrial respiration in metabolic state 3 and uncoupled state and induced more

pronounced mitochondrial swelling than ZnO NPs meaning the opening of the permeability

transition pore. ZnO-BSA NPs inhibited state 3 respiration rate by 50% at the concentration of

0.25 μg/ml, whereas ZnO NPs – at 0.40 μg/ml. Moreover, the site of inhibition in oxidative

phosphorylation system was different for plain and BSA-coated NPs: the main effect of ZnO NPs

was on phosphorylation subsystem whereas the main effect of ZnO-BSA NPs was on respiratory

subsystem. It could be speculated that opposite effect of protein corona in isolated mitochondria as

compared to cells can arise from absence of cytosolic NPs trafficking and endosomal detoxication

mechanisms which were shown to be crutial for NPs cytotoxicity.

This research is funded by the European Social Fund under the Global Grant measure (Grant No.

VP1-3.1-SMM-07-K-03-044).

Keywords: ZnO nanoparticles, BSA, protein corona, mitochondria, cytotoxicity, ROS.

ISSN 2335-8653

87

Modified pyridine nucleotides in biosynthesis of DNA

Algirdas Mikalkėnas1, Bazilė Ravoitytė1, Daiva Tauraitė2, Rolandas Meškys2, Saulius

Serva1,3

1Department of Biochemistry and Molecular Biology, Faculty of Natural Sciences, Vilnius University, M.K. Čiurlionio

21/27, LT-03101 Vilnius, Lithuania, 2Department of Molecular Microbiology and Biotechnology, Institute of

Biochemistry, Vilnius University, Mokslininkų str. 12, LT-08662 Vilnius, Lithuania, 3 Department of Chemistry and

Bioengineering, Vilnius Gediminas Technical University, Saulėtekio al. 11, LT-10223 Vilnius, Lithuania. E-mail:

saulius.serva@gf.vu.lt

Pyridine is a heterocyclic organic compound, structurally related to benzene bearing

one methine group (=CH-) replaced by a nitrogen atom. The pyridine ring occurs in many

important compounds, including vitamins B3 (niacin) and B6 (pyridoxal). It is closely related to

pyrimidine ring, one of two common nucleobase precursors; however, pyridine is unspotted in

structure of natural nucleic acids. Close chemical and structural relation of pyridine to natural

analogue prompted for investigation of pyridine-based artificial deoxyribonucleotides as effectors

of DNA biosynthesis, evaluating the presumed inhibitory potential toward this process.

We employ several DNA biosynthesis approaches, capable to address incorporation

of compounds of interest at single nucleotide resolution. In general, they involve well-controlled

in vitro procedures, relying on primer extension by polymerase of choice. The full control on

composition of reaction components allows to address both incorporation and/or resistance for it

of nucleotide of interest. Most importantly, alterations in structure of primer-template duplex

direct programmable incorporation of nucleotides of interest, so enabling experiments on

selectivity of enzymes regarding the compounds to be involved in biosynthesis of DNA.

To address the properties of five pyridine-based deoxyribonucleotide triphosphates,

we investigated these compounds in direct DNA biosynthesis approach. Since nucleobase

structures in all instances were clearly different from any of natural pyrimidine-based moieties, it

comes as big surprise the incorporation of three of five compounds tested into the structure of

DNA. Importantly, incorporation was sequence-specific, confirming the elongation of DNA to

obey hybridization rules. The observed incorporation is valid for representatives of at least two

different families of DNA polymerases, main cellular replicative polymerase including. Watson-

Crick base pairing is barely possible for the encountered partners, as well as Hoogstein

hybridization. We continue our efforts to further characterize the stereo- and charge-specific

determinants of the observed phenomenon.

Keywords: pyridine nucleotides, DNA biosynthesis, DNA polymerase.

Acknowledgement: This research was funded by a grant MIP-035/2014 from the Research

Council of Lithuania.

ISSN 2335-8653

88

Investigations Of Resistance To Cold And Hardening In Vitro Of Rosaceae

Family Plants

Rytis Rugienius1, Lina Šnipaitienė2 1 The Institute of Horticulture of the Lithuanian Research Center for Agriculture and Forestry, Kauno g. 30, Babtai,

LT-54333, 2 Vytautas Magnus University, The Faculty for Natural Science, Vileikos g. 8, 44404 Kaunas,

linute@doctor.com

Abstract

Dehydrin-like proteins, which are responsible for resistance to cold, were investigated in model

plants, the genes of dehydrins were identified in many herbaceous and woody plants, however we

know very little about the hardening and the specificity of the resistance to cold of the most part of

the garden plants - the Rosaceae family plants. Therefore, the study of dehydrins of the Rosaceae

family plants was performed in The Institute of Horticulture of the Lithuanian Research Center for

Agriculture and Forestry. The efficacy of the hardening of strawberry (Fragaria ananassa) , wild

strawberry (F. vesca), cherry (Prunus cerasus), sweet cherry (P. avium), apple (Malus domestica)

and pear (Pyrus communis) cultivars was investigated under controled cooling conditions in vitro,

the ion yield of cells was measured and critical temperature of the tissue damage was calculated. It

was found that the maximum hardening is reached in 4 weeks and the critical temperature of the

hardened microshoots has increased approximately 1,2°C, compared to non-hardened

microshoots. Protein electrophoresis and immunochemical analysis showed that the expression of

the two to five dehydrin-like proteins of the different molecular mass is characteristic to

investigated cultivars and the significant increase of the amount of dehydrins in hardened

microshoots.

Keywords: Rosaceae, dehydrins, cold resistance, hardening.

ISSN 2335-8653

89

Amino Acid Impact On Rape (Brassica Napus L.) Germination

Kristina Teiserskyte, Ilona Jonuskiene, Justa Sirvaityte, Virgilijus Valeika

Kaunas University of Technology, Faculty of Chemical Technology, Radvilenu pl. 19, Kaunas, LT- 50254, Lithuania

E-mail: justa.sirvaityte@ktu.lt

Abstract

The predominant oil crop for food, industry, and renewable energy needs in Lithuania is oilseed

rape (Brassica napus). Seed yield and fat concentration are the primary parameters in crop

cultivation for both nutritional and industrial uses. High seed yield double-low rapeseed varieties

developed in other countries (Sweden, Germany, Denmark) are cultivated in Lithuania, but they

often cannot fully realize the productivity potential encoded in the variety genome because of

unfavourable climatic and soil conditions [1]. Rapeseed requires a greater level of nitrogen (N)

and other nutrients than cereal crops. Nitrogen nutrition remains the factor that significantly

restricts plant also and rape productivity. Amino acids as organic nitrogenous compounds

stimulated cell growth [2]. It was apllied Humiforte to stimulate shoot growth of Norway spruce

[3]. Humiforte is a high-tech soluble liquid nutrient, w5ith rapidly absorption via leaves or roots,

and a high concentration of free amino acids and biologically active oligopeptides, especially

recommended for shock treatments. It was also studied role of biologically active amino acid

formulations such as Humiforte on quality and productivity of tea crop [4]. Mostafa et al studied

effect of Arginine on growth and yield of late sowing wheat [4]. Some of biological stimuli, such

as Humiforte have been introduced to the market in order to deal with environmental stresses.

Collagen hydrolysate prepared from leather industry waste approx. contain: glycine 30-40%,

alanine 10-15%, proline 10-15%, glutamic acid 5-10%, hydroxyproline 5-10%, acid aspargic 4-

6%, arginine 4-6 %, serine 3-5%, threonine 1-3%, lysine 2-4%, valine 2-4%, leucine 2-3%,

phenylalanine 1.5-2%, isoleucine 1-1.5%, histidine 0.7-1.5%, methionine 0.2-0.5% [5].

The aim of the research was to investigate the influence of some amino acids, which presence in

collagen hydrolysate prepared from leather industry solid wastes, on rapeseed (Brassica napus)

germination.

Keywords: amino acid, rapeseed, germination, collagen hydrolysate.

References:

[1] G. Siaudinis, B. Butkute. Communications in Soil Science and Plant Analysis. 2013, 44, 145–157.

[2] J.A. Goss. Physiology of Planta and their Cells. 1973. Pergamon Press, Inc., New York.

[3] M. Slavik. J FOR SCI., 2005, 51(1), 15-23.

[4] J. Thomas, A.K.A. Mandal, R. R. Kumar, A. Chordia. Int. J. Agric. Res., 2009, 4(7), 228- 236.

[5] C. Sirbu, T. Cioroianu, M. Dumitrascu. Lucrari Stiintifice, seria Agronomie, 52, 473-478.

ISSN 2335-8653

90

The Effect Of Light-Emitting Diodes Photoperiod On Tocopherols Content In

Brassicaceae Microgreens

Monika Valaitytė1, Akvilė Viršilė2, Aušra Brazaitytė2, Viktorija Vaštakaitė2, Julė

Jankauskienė2, Ramūnas Sirtautas2

1Vytautas Magnus University, The Faculty of Natural Sciences, Vileikos str. 8, LT-44404, Kaunas, Lithuania

2Institute of Horticulture, Lithuanian Reasearch Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333

Babtai, Kaunas distr., Lithuania

E-mail: mvalaityte@yahoo.com

Abstract

The objective of our study was to evaluate the effect of light-emitting diodes (LEDs) light

photoperiod on tocopherols content of Brassicaceae microgreens. Tocopherols as primary

antioxidants are considered to protect lipids from oxidation; however, their antioxidant activities

may differ greatly. Our previous studies revealed that the content of tocopherols may be affected

by LEDs light spectra or intensity, and hypothesized to be photoperiod dependent. Red pak choi

(Brassica rapa var. chinensis ‘Rubi F1’), tatsoi (Brassica rapa var. rosularis) and mustard

(Brassica juncea L. ‘Red Lion’) microgreens were cultivated in controlled-environment growth

chamber for 10 days under five photoperiods (8-, 12-, 16-, 20-, 24 h) created by high-power solid-

state lighting modules with blue 447-, red 638-, red 665-, far red 731 nm LEDs light. Total

photosynthetic photon flux density (PPFD) was ~300 µmol m-2 s-1. The day/ night temperatures at

21±2/17±2 °C and the relative air humidity at 55±5 % were maintained. Tocopherols (α-, β-, γ-, δ-

) contents in hexane extracts were evaluated using high-performance liquid chromatography

(HPLC) method. Based on the data obtained, the accumulation of tocopherols homologies

depended on LEDs light duration; moreover it varied among Brassicaceae species. The

significantly higher (P<0.05) contents of all determined tocopherols were evaluated in mustard

microgreens grown under 8-, 12-, 16 h LEDs photoperiods. The significantly higher content of α-

tocopherol was determined in red pak choi during 8- and 12 h photoperiods, while β- and δ-

tocopherols significantly accumulated under 16-, 24 h, and under 20 h photoperiods, respectively.

The duration of 24 h photoperiod led to the highest content of α-tocopherol in tatsoi, while under

8- and 12 h photoperiod plants accumulated more β-, γ- and δ-tocopherols. Finally, higher

tocopherols concentrations in Brassicaceae microgreens tissues may be achieved through their

photophysiological response evoked by LEDs light photoperiod, which is species dependent.

Keywords: antioxidant, tocopherols, microgreens, light photoperiod

Acknowledgement: This research was funded by a grant (No. SVE-03/2011) from the Research

Council of Lithuania

ISSN 2335-8653

91

The Impact Of Supplemental UV-A Irradiation On Phytochemical Content Of

Microgreens In Greenhouse

Viktorija Vaštakaitė, Akvilė Viršilė, Aušra Brazaitytė, Julė Jankauskienė, Ramūnas

Sirtautas

Institute of Horticulture, Lithuanian Reasearch Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333

Babtai, Kaunas distr., Lithuania

E-mail: v.vastakaite@lsdi.lt

Abstract

It is well known that plants sensitive to UV light may respond by accumulating various

phytochemical products to protect them from UV damage; moreover, the same metabolites play an

important role to human health. UV-A (320-400 nm) light is known to be the least hazardous part

of UV radiation. Furthermore, it is thought, that a low level of UV-A may increase antioxidant

properties of edible plants without disturbing their growth and development. In this study, the

impact of UV-A light-emitting diodes (LEDs) irradiation on phytochemical content of

microgreens was investigated. Experiments were performed at the Institute of Horticulture,

Lithuanian Research Centre for Agriculture and Forestry. Mustard (Brassica juncea L., ‘Red

Lion’), red pak choi (Brassica rapa var. chinensis, ‘Rubi F1’), tatsoi (Brassica rapa var.

rosularis), basil (Ocimum basilicum L., ‘Sweet Genovese’), beet (Beta vulgaris L., ‘Bulls Blood’)

and parsley (Petroselinum crispum, ‘Plain Leaved or French’) were grown for 10-14 days within

a greenhouse (21±2/ 16±2 °C day/ night) under daylight and artificial light provided by high

pressure sodium (HPS) lamps (SON-T Agro, Philips). For lighting treatment, HPS lamps were

supplemented by ~13-16 µmol m-2 s-1 UV-A 390 nm LEDs; and total photosynthetic photon flux

density (PPFD) was ~115-135 µmol m-2 s-1. The data obtained showed that the influence of UV-A

varied among microgreens species. In comparison with HPS lamps, after UV-A light treatment

some changes in primary metabolites (soluble carbohydrates) syntheses were revealed. The

significantly (P<0.05) higher contents of sucrose (red pak choi, tatsoi, beet, parsley), glucose

(mustard, red pak choi, basil) and fructose (tatsoi, basil, red pak choi) were determined. Also, UV-

A led to higher anthocyanins accumulation in all of investigated microgreens, except in basil and

parsley in which these compounds are not specific. The ability to synthesize significantly more

ascorbic acid during UV-A light treatment showed beet and parsley microgreens. The significantly

higher contents of total phenols and DPPH• scavenging activity were also determined in parsley.

Finally, although microgreens response to UV-A irradiation differed among species, the small

level of UV-A in main greenhouse lighting system may lead to higher contents of phytochemicals.

More studies should be carried out in order to determine the optimal UV-A irradiation level for

maximized production of phytochemicals rich microgreens.

Keywords: UV-A, metabolites, microgreens, phytochemicals, greenhouse

Acknowledgement: This research was funded by a grant (No. SVE-03/2011) from the Research

Council of Lithuania

ISSN 2335-8653

92

The Concentration of Non-essential Elements in Lithuania Populations of

Juniperus communis L.

Edvina Krokaitė, Ramūnas Vilčinskas, Lina Zybartaitė, Algimantas Paulauskas, Eugenija

Kupčinskienė

Vytautas Magnus University, Vileikos g 8-212, LT-44404, Kaunas, Lithuania, edvina.krokaite@gmail.com

Abstract

Juniperus communis L. is one out of three naturally growing conifer species of Lithuania. This

conifer is characterized as valuable species for medicine, pharmacology, culinary or ornamental

purposes. Processes of secondary metabolite formation and changes in some vital functions of the

plants could be influenced by concentration of non-essential elements. Concentration of heavy

metals in the needles of common juniper sampled near industrial pollution sources have been

documented [1], but information about these element concentrations depending on habitat type is

still missing. J. communis is widely spread in non-polluted areas of Lithuania, so it could be useful

indicator of areas with elevated level of contamination. In our study plant material was collected

from 14 populations (140 juniper individuals) from different geographic regions of Lithuania

distributed in 5 habitat types. Elements (Cr, Ni, Cd, Pb) from J. communis needles were analysed

using atomic absorption spectrometry. Our results showed that mean (per population)

concentration of Cr ranged from 0.238 to 0.531 µg/g dry mass (d. m.), Ni – 0.180–1.520 µg/g d.

m., Cd – 0.004–0.105 µg/g d. m., Pb – 0.126–0.537 µg/g d. m. The highest concentration of Cr

and Cd was found in coastal brown dunes covered with natural Scots pine forest in Curonian spit.

The lowest concentration of Cr was found in xero-thermophile fringe near Kaunas. The highest

concentration of Ni was found in subcontinental moss Scots pine forest besides Kelme, while the

lowest concentration was characteristic for transition mires quaking bog of Ignalina. The lowest

concentration of Cd was common for xero-thermophile fringe in Jurbarkas. The highest Pb was

found in transition mires quaking bog site near Kelme, the lowest – subcontinental moss Scots

pine forest in Ignalina district. This data set provides valuable information about concentration of

heavy metals of the needle differences among populations originating from various habitats.

Keywords: heavy metals, lead, cadmium, chromium, nickel, conifers, common juniper, needles

References [1] D. Ceburnis, E. Steinnes, Atmos. Environ. 2000, 34, 4265−4271.

ISSN 2335-8653

93

Light as a Tool for Manipulation of Plant Responses – Internal and External

quality (Part II)

Akvilė Viršilė1, Giedrė Samuolienė1,2, Aušra Brazaitytė1, Viktorija Vaštakaitė1, Ramūnas

Sirtautas1, Pavelas Duchovskis1,2 1 Lithuanian Research Centre for Agriculture and Forestry, Institute of Horticulture, Kaunas str. 30, Babtai, LT-

54333, Lithuania. 2Aleksandro Stulginskio Universitetas, Studentų g. 11 LT – 53361, Akademija, Kauno raj.

E-mail: a. virsile@lsdi.lt

Abstract

Light is one of the main environmental factors, determining plant growth and

development processes. It is of the high importance in greenhouse horticulture, where lighting

strategies determines productivity and production costs. Light emitting diodes – the progressive

lighting source and also a handy tool for plant investigations that provided new objectives for

photophysiological researches. Light parameters were proved to be limiting factors for plant

growth and photosynthesis. Recent investigations show, that light also directly and indirectly

affects plant metabolism and thus determines internal phytochemical contents in plant. It decides

nutritional value of vegetable food (vitamin, antioxidant contents), as well as external quality and

taste. In this study we present the overview, how to employ light parameters as a tool for

manipulations of plant metabolic processes, seeking to improve nutritional quality of green

vegetables and how to apply light for medicinal plant cultivation with enhanced selected

phytochemical contents.

Keywords: green vegetables, light-emitting diodes, light spectra, medicinal plants, secondary

metabolites.

ISSN 2335-8653

94

Extraction And Characterization Of Chitins From Coackroach Ootheca

Murat Kaya1, Mujtaba Muhammad1, Bahar Akyuz1, Esra Bulut1, Karwan Sofi1, Laura

Zelencova1,2,*

1 Department of Biotechnology and Molecular Biology, Faculty of Science and Letters Aksaray University, 68100,

Aksaray, Turkey. 2 Department of Biology, Vytautas Magnus University, 44404 Kaunas, Lithuania.

*Corresponding author: Laura Zelencova, E-mail: lzelencova@gmail.com

Abstract

Currently researchers are isolating chitins from fungal cell walls [1], crustaceans shells [2],

insect cuticles [3], sponges [4] and crabs [5] because of its high biomass (chitin value) and large

availability. But still there are many organisms which need a thorough examination for their chitin

value. Until now none of the studies are reported on physiochemical properties of cockroach egg

shells. For the first time egg shells of three notable and abundantly available species of coackroach

(Blatta orientalis, Blatella germanica, Periplaneta americana) were physicochemically

investigated for its chitin values using FTIR, chitin content %, SEM. For said study selection of

these species was made because of its worldwide distribution and large availibility. Periplaneta

americana can be easily found in buildings, restaurants, bakeries, basements, sewers, steam

tunnels and drainage systems [6]. Blattella germanica is also a widely distributed urban pest.

Adult B.germanica is 1/2 to 5/8 inch long and tan to light brown and can found in houses,

apartments, restaurants, hotels. Blatta orientalis is often called water bugs because of their damp

and cool habitats such as under sinks, washing machines and in damp basements. Adult

B.orientalis is about one inch in length. The egg capsule color and size of B.orientalis is dark

reddish-brown and 8 to 10 mm respectively.

The dry weight chitin content of Blatta orientalis was determined as 0.66%, Blatella

germanica 1.4%, Periplaneta americana 6.61%. The SEM analysis showed that in chitins of

coackroach egg shells were found highly fibrous, various crumblier clumpy zones and some

highly porous zones were detected. After overall results of SEM we can say that surface

morphology of coackroach egg shell’s chitin is highly fibrous along with some highly and rarely

porous zones. In this study we observed FTIR bands at 1651, 1621 and 1555 cm-1 for Blatta

orientalis, 1656, 1621, 1542 cm-1 for Blatella germanica and 1574, 1623, 1537 cm-1 for

Periplaneta americana. These results are very similar to the theoretical FTIR bands (1650, 1620

and 1550 cm-1) [10, 11]. For commercial chitin, these three characteristic FTIR bands were

measured between 1654 and 1662, 1620 and 1630 and 1556 and 1560 cm-1 in some studies [14,

15, 16]. All these results revealed that the chitin extracted from three different species of

coakroach (Blatta orientalis, Blatella germanica, Periplaneta americana) is in the α form.

Key words: coakroach, Blatta orientalis, Blatella germanica, Periplaneta americana, chitin

ISSN 2335-8653

95

Selection Of Inter-Simple Sequence Repeat Markers For Investigation Of

Genetic Diversity Of Impatiens Spp. Populations

Lina Zybartaite, Edita Sajonaite, Rasa Janulioniene, Eugenija Kupcinskiene, Algimantas

Paulauskas

Vytautas Magnus University, Department of Biology, Vileikos 8, LT-44404 Kaunas, Lithuania,

lina.zybartaite@gmail.com

Abstract

More than 1000 species are in family Balsaminaceae, among them only five species: Impatiens noli-

tangere, I. parviflora, I. glandulifera, I. balfourii and I. balsamina are present in Europe. Impatiens

balfourii is not often met and I. balsamina is known only as introduced and grown ornamental plant.

Europe’s Impatiens represents a unique opportunity to study invasion process due to very special set of the

species: I. noli-tangere is growing naturally, I. parviflora is widely spread alien with a very high degree of

naturalization and I. glandulifera is an alien very actively spreading nowadays. The objective of our study

was to select inter-simple sequence repeat (ISSR) markers appropriate for genetic assessment of Impatiens

spp. growing in Lithuania and Czech Republic. For this purpose 6 ISSR primers (twelve nucleotide length

each) were tested [1]. Conditions of polymerase chain reaction were the same for all examined plant

species. In total 5 primers were suitable for Impatiens studies. The primer ISSR1 has not generated

amplification of any Impatiens species DNA, ISSR4 was not applicable for I. noli-tangere and I.

parviflora, the primer ISSR6 did not generate clear, reproducible DNA fragments for I. glandulifera. Three

(ISSR2, ISSR3 and ISSR5) out of six primers were useful for all three species. Examination of 12

Lithuania and 12 Czech Republic populations of I. noli-tangere, I. parviflora and I. glandulifera shown that

the number of DNA fragments was ranged from 23 to 55, the length was 150–2100 bp. The mean number

of polymorphic ISSR fragments per population for I. noli-tangere was 45, for I. parviflora 41.1 and for I.

glandulifera 40.5. The mean percentage of polymorphic DNA fragments per population was 48 % for I.

noli-tangere, 26.5 % for I. parviflora and 22 % for I. glandulifera. Mean Nei’s genetic diversity and

Shannon’s information index for I. noli-tangere respectively was 0.125 and 0.199, for I. parviflora 0.075

and 0.117, for I. glandulifera 0.074 and 0.112. Obtained results revealed that chosen ISSR markers are

valuable for evaluation of molecular diversity between Impatiens spp. populations.

Keywords: ISSR, Touch-me-not Balsam, Small Balsam, Himalayan balsam

1. J. Provan, H.M. Love, C.A. Maggs. Mol Ecol Notes 2007, 7:451-453

ISSN 2335-8653

96

A Research of a Behaviour of Saccharomyces Family Yeast in Contact with

PAHs

VioletaVaitkeviciene1, Mantas Vaitkevicius2, Neringa Venslauskaite1

1VDU GMF Biochemijos katedra, Vileikos g.8, Kaunas, 2Kauno moksleivių aplinkotyros centras, Šeštokų g. 30, LT-

46430, Kaunas

v.vaitkeviciene@gmf.vdu.lt

Abstract

Friendly ways to decompose organic polutants in an environment is being studied by scientists in

all the world [1]. Determining the behaviour of natural microorganisms in contact with organics is

important to understand their application possibilities for environmental protection. The aim of

this study was to analyse impact of Polycyclic Aromatic Compounds (PAHs) on Saccharomyces

family yeast. The yeast behaviour under the influence of different concentration of carbazole and

its compounds [2] solutions have been investigated using usual biochemical technics. It was found

that cells remained undisturbed and had tendency to grow. Microorganisms growth kinetics in 0.1

mg/mL solutions was analysed as well.

Keywords: Yeast, PAHs, organic polutants.

References: [1] A. Mrozik, Pol. J. Environ. Stud. 2003, 12(1), 15-25

[2] J. Jwo-Huei, J. Mater. Chem. C. 2014, 2, 8707-8714

ISSN 2335-8653

97

Antibiotic-Resistant Bacteria Isolated From Dairy Cattle With Endometritis

Mindaugas Levickis1*, Vytuolis Žilaitis1, Anita Rokaitytė2, Irmantas Rokaitis2

1Department of Non-infectious Diseases of the Veterinary Faculty of Lithuanian University of Health Sciences, Tilžės

st. 18, Kaunas, LT-47181, Lithuania 2Department of Food Safety and Quality of the Veterinary Faculty of Lithuanian University of Health Sciences, Tilžės

st. 18, Kaunas, LT-47181, Lithuania

*Mindaugaslva@gmail.com

World wide there is growing concern about the increased prevalence of antibiotic

resistance. It is now generally accepted that the main risk factor for this increase in resistance in

pathogenic bacteria is the increased use of antibiotics. Resistant commensal bacteria of food

animals might contaminate meat and reach the intestinal tract of humans. Monitoring the

prevalence of resistance in indicator bacteria such as faecal Escherichia coli and enterococci in

different populations, animals, patients and healthy humans, makes it feasible to compare the

prevalence of resistance and to detect transfer of resistant bacteria or resistance genes from

animals to humans and vice versa. Resistance genes against antibiotics, that are or have only been

used in animals were found soon after their introduction, not only in animal bacteria but also in the

commensal flora of humans, in zoonotic pathogens. This makes it clear that not only clonal spread

of resistant strains occurs, but also transfer of resistance genes between human and animal

bacteria.

The objective of this study was to isolate bacteria from samples of dairy cattle with

endometritis and to determine their antibiotic susceptibility patterns.

Escherichia coli, Enterococcus faecalis, Staphylococcus aureus, Streptococcus spp.,

Bacillus spp. and Arcanobacterium pyogenes was isolated from dairy cattle with endometritis.

Almost all strains were resistant to Penicillin G (PG) (10 μg), Ampicillin (AP) (10 μg),

Amoxicillin-Clavulanic acid (AC) (30 μg), Ciprofloxacin (CIP) (5 μg), Erythromycin (E) (15 μg),

Ceftriaxone (CRO) (30 μg), Gentamicin (G) (10 μg), Trimethoprime-Sulfamethoxazole (TMP-

SMZ) (25 μg), Oxacillin (Ox) (1 μg), Oxytetracycline (OX) (30 μg), Neomycin (NM) (10 μg) and

Vancomycin (V) (30 μg). But all strains were sensitive to Cefapirin (CF) (10 μg).

Based on our results, we can assert that to safeguard public health, the selection and

dissemination of resistant bacteria from animals should be controlled. This can only be achieved

by reducing the amounts and type of antibiotics used in animals.

Keywords: Cattle, antibiotic, resistant, bacteria.

ISSN 2335-8653

98

Evaluation of cannabidiol and plant antioxidant activity dynamics in Lithuania

cultivated Cannabis sativa L.

Ignas Popa1, Vidmantas Dirsė2, Guoda Kiliuvienė3 1Faculty of pharmacy, Medical academy, Lithuanian university of health sciences, Eivenių str.4 Kaunas, Lithuania

2,3Department of analytical and toxicological chemistry, Faculty of pharmacy, Medical academy, Lithuanian

university of health sciences; Eivenių str.4 Kaunas, Lithuania

Corresponding author’s e-mail address: ignaspopa@yahoo.com

Abstract

Cannabis sativa, depending on its breed and growth conditions may be used as a source of fiber,

cannabis oil or as a medicinal plant [1]. The aim of this study was to determine cannabidiol

(CBD) concentration and antioxidant activity dynamics of Cannabis sativa L. cultivated in

Lithuania. The object of the study was Cannabis sativa L., Finola breed, female aerial plant parts

(leaves, stems, flowers), which were collected in three different regions of Lithuania during four

vegetation periods. Main biological substances in C. sativa L., which have attracted the most

attention in science, are cannabinoids. Cannabidiol is neutral, non-psychotropic cannabinoid that

distinguishes wide spectra of biological activities like: anticonvulsive, sedative, hypnotic,

antipsychotic, anti-inflammatory and neuroprotective properties [2]. Beside cannabinoids, C.sativa

L. contains plenty of terpenoids: monoterpenoids of which main are: β-myrcene, α-pinene,

terpinolene and sesquiterpenoids of which main are: β-caryophyllene, caryophyllene oxide and

humulene. [3] The latter substances are potential oxidative stress damage reducers [4].

Cannabidiol identification and concentration dynamics was determined using high-performance

liquid chromatography method. Validation of quantitative assay of cannabidiol was performed.

Antioxidant activity was evaluated using ferric reducing ability of plasma method and

spectrophotometric analysis. Equivalent of antioxidant activity was 6-hydroxy-2,5,7,8-

tetramethylchroman-2-carboxylic acid – otherwise known as trolox. The results have shown that

the highest cannabidiol concentration was observed in flowers. The most high detected CBD

concentration was 2,99 ± 0,22 mg/g which was determined in flowers, at the beginning of the

flowering in Kupiškis region; the lowest cannbidiol amount was 0,024 ± 0,00001 mg/g in stems at

the end of seed maturity in Kupiškis region. Results of antioxidant activity assay of Finola breed

C. sativa L. have shown that highest antioxidant capacity was 0,3784 ± 0,0008 TE mg/g in leaves

during flowering ending in Kupiškis region, the lowest - 0,036 ± 0,0015 TE mg/g in stems during

beginning of flowering in Telšiai region. Conclusion – results have shown that Cannabis sativa L.

cultivated in Lithuania possesses antioxidant activity and certain CBD concentrations. Finola

breed Cannabis sativa L. may be used as a source of cannabidiol for pharmaceutical industry, but

further economical evaluation is required.

Keywords: Cannabis sativa L., antioxidant activity, cannabidiol.

ISSN 2335-8653

99

Determination Of Changes Of Common Lungwort (Pulmonaria Officinalis L.)

Composition Of Biologically Active Substances During Different Phenological

Phases Using Instrumental Analysis Methods

Simonas Juodis1, Audrius Maruška1, Ona Ragažinskienė2

1Faculty of Natural Sciences, Vytautas Magnus University, Vileikos g. 8-212, LT-44404 Kaunas, Lithuania

simonas.juodis@yahoo.com

2Vyatautas Magnus University Kaunas Botanical Garden, Sector of Medicinal Plants, Kaunas, Lithuania

Abstract

One of the Global Strategy for Plant Conservation goals is to secure mankind ability to fully utilize

the potential of plants, thus improving our livelihood and well-being. To optimize the use of

medicinal plants an extensive analysis of their biologically active substances is needed.

Comparative analysis of volatile, phenolic compounds, flavonoids and radical scavenging activity

of different phenophases in medicinal plant common lungwrot (Pulmonaria officinalis L.) was

carried out by means of spectrophotometric and chromatographic methods. 19 volatile compounds

have been identified. The content of phenolic compounds ranged between 110.35 – 118.06 mg of

rutin equivalents (RE)/g of which rutin was found to be the most prevalent. Total flavonoid content

was found to be lower. i.e. 87.33 – 93.81 mg RE/g. Radical scavenging capacity ranged from 97.41

to 114.33 mg RE/g and was found to be the lowest during open the flowering phenophase – 97.41

mg RE/g. Radical scavenging activity reached a maximum during full flowering phenophase, but

there were no statistically significant differences (p < 0.05) between radical scavenging capacity of

full flowering, end of flowering and fruit ripening phenophases, leading to a conclusion that

medicinal plant material can be harvested at any time during the three phenophases to maximize the

effectiveness of its use as a high quality antioxidant medicinal plant raw material.

Keywords: Pulmonaria officinalis L., Volatile compounds, Phenolic compounds, Flavonoids,

Radical Scavenging Activity

References: [1] Kaškonienė V, Stankevičius M., Drevinskas T., Akuneca I., Kaškonas P, Bimbiraitė-Survilienė K,

Maruška A., Ragažinskienė O. Evaluation of phytochemical composition of fresh and dried raw

material of introduced Chamerion angustifolium L. using chromatographic, sprectophotometric and

chemometric techniques. Phytochemistry. Article in press. 2015.

[2] Kaškonienė V, Kaškonas P, Maruška A. Volatile compound composition and antioxdiant activity of

bee pollen collected in Lithuania. Chem Pap. 2015; 69:291-299.

[3] Strategic plant for biodiversity 2011 – 2020 and the Aichi Targets.

ISSN 2335-8653

100

Platinum Group Metals Measurement In Used Automobile Catalyst With Two

Pulse LIBS Method

Deivydas Kiznys1, Karolis Gedvilas1, Valdas Girdauskas1,2 1 Vytautas Magnus University, Faculty of nature science, Vileikos St. 8, LT-44404 Kaunas 2 Center for physical sciences and technology, Savanorių St. 231, 02300 Vilnius

Abstract

Platinum, palladium, rhodium are platinum group of metals (PGM) which are used in automobile

catalyst manufacturing for motor emission control devices. The supply limitation of newly-mined

PGM indicate the needs for catalyst recycling for recovery and re-use. Fast and inexpensive

quantitative determination of the PGM elemental concentration in catalyst scrap it is significant

part of catalyst recycling. Laser-indused breakdown spectroscopy (LIBS) is particularly suitable

for rapid determination of the PGM elemental concentration [1]. In this presentation the results of

Pt and Pd concentrations measurements using two pulse LIBS are presented.

We used 20 samples with known PGM concentrations (Pt 665-5527 ppm; Pd 245-6621 ppm).

Two samples made from Standard Reference Material and 18 from used catalysts. Samples were

in the form of ground powder prepared from catalysts scrap and pressed in tablets.

For LIBS measurements the Nd:YAG lasers with first pulse energy 16 mJ, second – 27 mJ and

pulse duration 5 ns were used for sample ablation.

The laser beam was focused on the sample surface by the lens (f=90mm). Optical emission were

collected by 20 mm diameter and 50 mm focal length quartz lens on the end of the quartz optical

fiber (N.A. = 0.22) connected to a AvaSpec-2048 spectrometer (entrance slit of a 10 µm,

2400 lines/mm grating). 50 LIBS spectra from every sample were collected from 176 to 308 nm

and from 268 to 380 nm.

Detection parameters were gate delay (time between laser pulse emission and optical signal

detection) of 3.92 µs, gate width (time duration for optical signal detection) of 1.1 µs, time delay

between pulses of 400 ns, pulse repetition rate 1 Hz.

Pt spectra examination revealed that the following two interference–free platinum lines can be

used for Pt concentration measurement: 214.42 nm and 224.55 nm. Calibration curve for these two

lines normalized intensities were obtained. The Pt calibration curve has an R2 = 0.966. The

corresponding limit of detection (LOD) is equal to 334 ppm [2]

Pd spectra analysis showed that the following three interference–free palladium lines can be used

for Pd concentration measurement: 340.46 nm, 342.12 nm and 343.35 nm. Calibration curve for

the line 342.12 nm normalized intensity was obtained. The Pd calibration curve has lower R2 value

equal to 0.867. The corresponding limit of detection (LOD) is equal to 947 ppm.

Keywords: Laser-induced breakdown spectroscopy, platinum group metals, automobile catalysts.

References: [1] G. Asimellis, N. Michos, I. Fasaki and M. Kompitsas, "Platinum group metals bulk analysis in automobile catalyst

recycling material by laser-induced breakdown spectroscopy," Spectrochimica Acta Part B, vol. 63, no. 11, pp. 1338-

1343, 2008.

[2] S. Snyder, W. Wickun, J. Mode, B. Gurney and F. Michels, "The Detection of Palladium Particles in Proton

Exchange Membrane Fuel-Cell Water by Laser-Induced Breakdown Spectroscopy (LIBS)," Applied Spectroscopy,

vol. 65, no. 6, pp. 642-647, 2011.

ISSN 2335-8653

101

Influencing factors of chemical element accumulation in peat and

peat humic substances

Diana Dudare1, Maris Klavins1 1Department of Environmental science, University of Latvia, Raina Blvd. 19, Riga, Latvia,

corresponding author: dianadudare@inbox.lv

Abstract

Peatland cores provide us with the potential to research aspects of the atmospheric cycling of

elements, as metal pollutants, on timescales. In general, peatland ecosystems are thereof notable

sources of data about the carbon cycle, as well processes of acid deposition and heavy metal

accumulation.

Our study provides a better understanding of the basic peat properties and their effects on trace

and major element distributions in peat and peat humic substances (HS). Humic substances

isolated from ombrotrophic bogs - Eipurs, Dzelve, Dizpurvs - peat profiles (Latvia) were used as

study objects. Relations among peat depth, properties of peat and its humic substances (elemental

composition), as well as element content were studied. Elemental and functional analysis of the

isolated humic substances were done, using total reflection X-ray fluorescence, atomic absorption

spectrometry, Elemental Analyzer Model EA – 1108, Thermospectronic Helios γ UV (Thermo

Electron Co.) spectrophotometer, Total acidity method.

The distribution and content of chemical elements in bog profiles are influenced by several factors

such as geographical location of studied bogs, the nature of formation and differences of possible

element supply source. The compiled principal component matrix of studied chemical elements,

taking into account a number of variables, gives a better understanding of which processes -

natural or anthropogenic – influence the accumulation of elements in peat bog profiles and humic

substances.

The component analysis show that metal accumulation in peat formation processes depend on the

depth of the bog, the content of carbon, sulfur and carboxylic group, whereas there was observed a

correlation between the content of sulphur in humic substances and concentrations of zinc in peat

and peat HS. The accumulation process of chemical elements, such as As, Ni, Ca, Fe, Cu, Cr, Mn

characterizes a strong resemblance.

Correlation analysis between chemical elements in peat HS from different depth layers of Eipurs,

Dzelve and Dizpurvs bogs mark an essential differences in natural and anthropogenic

accumulation zones. The absolute values of chemical elements, determined in HS of studied bogs,

are similar to values obtained in other countries, like Belgium, Sweden, that reflects the local

distinctions, affecting the accumulation process of elements.

Accomplished correlation pair analysis allow to assess the mutability of interconnection between

chemical elements in HS of studied bogs and depending on the accumulation place of analyzed

element, peat layers can be divided into the upper, medium deep and bottom layers. Factors such

as geographic location of studied bogs, peculiarities of bog formation character and differences of

the possible element supply source are substantial with respect to the content of chemical elements

and their dispersion in peat HS of studied bogs.

Keywords: humic substances, peat, heavy metals, component analysis.

Acknowledgments: This work has been supported by the European Social Fund within the

project “Support for Doctoral Studies at University of Latvia” Nr.2009/0138/ 1DP/1.1.2.1.2.

ISSN 2335-8653

102

Ectoparasites From Nests And Burrows Of Swallow (Hirundinidae) In

Lithuania

I. Lipatova1, E. Šukauskaitė1, V. Matulaitytė1, A. Paulauskas1, J. Radzijevskaja1, A. Petraitis

1Department of Biology, Vytautas Magnus University, Vileikos 8, LT-44404 Kaunas, Lithuania,

E-mail address: a.paulauskas@gmf.vdu.lt

Abstract

The knowledge of ectoparasites fauna in nests and burrows of swallow in Lithuania is not clear.

Various ectoparasites occurring in nests and burrows of swallow can influence condition and

development of swallows. At the same time, huge infestation of ectoparasites can do lower the

reproductive success of their hosts, even can cause birds mortality. A biodiversity of ectoparasites

was performed from burrows of the Sand martin (Riparia riparia) and nests of the Barn swallows

(Hirundo rustica) in Lithuania. During 2013 – 2014 vacated nests and burrows of Swallow were

collected from two districts in Lithuania. A total 42 nests of swallows were examined. We

collected 472 ticks (Ixodida), 530 fleas (Siphonaptera), 2 bugs (Cimicidae), 8 lice (Mallophaga)

and 31 mites (Gamasida) from nests and burrows of swallows. Using microscopic and

morphometric analysis were identified 5 fleas species (Ceratophyllus styx, C. pullatus, C. farreni,

C. rusticus, C. hirundinis) and 1 tick species (Ixodes lividus). Biodiversity of ectoparasites in nests

of Barn swallow was higher then in burrows of Sand martin. A total 76.9 proc. of Barn swallows

nest was infected by ectoparasites. Infestation rate of ectoparasites in Sand martin burrows was 40

proc. This is a first concerning our survey of ectoparasites of swallow in Lithuania.

Keywords: ectoparasites, tick, flea, nests of swallow, Lithuania

ISSN 2335-8653

103

Stable Isotope Method For Tracing The Poultry Farm Environment

Raminta Skipitytė1, Agnė Mašalaitė1, Andrius Garbaras1, Rūta Mickienė2, Ona

Ragažinskienė3, Bronius Bakutis4, Jūratė Šiugždaitė4, Violeta Baliukonienė4, Saulius

Petkevičius4, Audrius Sigitas Maruška2 ir Vidmantas Remeikis1

1Center for Physical Sciences and Technology, Institute of Physics, Savanoriu av. 231, LT-02300, Vilnius, Lithuania,2

Vytautas Magnus University, Faculty of Natural Sciences, Vileikos st. 8-204, LT-44404 Kaunas, Lithuania,3 Kaunas

Botanical Garden of Vytautas Magnus University, Z.E. Zilibero st., LT-463224 Kaunas, Lithuania,4 Lithuanian

University of Health Sciences, Veterinary Academy, Faculty of Veterinary Medicine, Tilzes st. 18; LT-47181 Kaunas,

Lithuania

Correspondence to: agne.masalaite@ftmc.lt; mickiene@lva.lt

Abstract

In this work, we examined the applicability of the stable isotope (δ13C and δ15N) method to

describe the poultry farm environment in terms of source materials and their impact on isotope

distribution. Stable carbon and nitrogen isotope ratios were measured in airborne bacteria and

fungi extracted from the air filters, aerosol particles as well as feed, litter, dust from the ventilation

system, feathers and eggs. The chicken tissues were investigated during the sampling campaign on

3 July, 2014. Great consideration was given to aerosol particles as they can transfer

microorganisms and make a huge impact on health of both animals and their caretakers. Samples

were collected from two poultry farms in southeastern Lithuania. The pilot study showed the

contribution of the main sources – feed and litter ─ to aerosol formation processes as well as the

impact of the feed isotope ratio on chicken and the distribution of stable isotopes in its different

tissues. A separate study was carried out to identify fractionation between microorganisms and

their matrix in order to test the applicability of the stable isotope method in bulk samples for the

source material assimilation. Stable isotope distribution revealed the fates of the source materials

in the poultry farm environment.

These data are of great importance in understanding the poultry farm environment along with their

biology and ecology and serve as a basis for the further studies.

Keywords: stable isotopes, aerosol particles, poultry farm.

ISSN 2335-8653

104

Formation Of Nanoclusters On Pre-Expanded Polystyrene Beads

Šarūnas Varnagiris, Darius Milčius

Lithuanian Energy Institute, Breslaujos st. 3, LT-44403 Kaunas – Lithuania

Sarunas.Varnagiris @lei.lt

Abstract

Expanded polystyrene foam (EPS) is used for wide variety of products. One of the biggest

utilization spheres of EPS is insulation of buildings. The biggest EPS manufacturers are trying to

increase some of EPS characteristics (resistance to fire, antibacterial characteristic). There are

many of different ways how to incorporate additional materials into polystyrene. However, some

of EPS characteristics, such as elasticity, hardness, could be changed.

This work presents the results of nanoclusters formation on pre-expanded polystyrene beads by

using physical vapour deposition. These beads could be expanded and combined into foam after

nanoclusters formation.

Physical vapour deposition was used in order to form TiO2 nanoclusters on pre-expanded

polystyrene beads. Titanium cathode was used as a basic material of nanoclusters. Pressure of

deposition process was P=12 Pa. Plasma was generated by using DC power source (current I=0,25

A, voltage U=370V). Distance between cathode and polystyrene beads was 15 cm. Mixture of

argon and oxygen gas was used in order to form TiO2 nanoclusters (argon – 20 %, oxygen – 80

%).

Polystyrene beads were analysed by using scanning electron microscope (SEM), X-ray energy

dispersive spectroscope (EDS) and X-ray photoelectron spectroscope (XPS). Results showed that

titanium and oxygen particles distributed on the surface of polystyrene beads and form TiO2

nanoclusters.

Keywords: Pre-expanded polystyrene beads, nanoclusters, physical vapour deposition.

ISSN 2335-8653

105

High Precision Parallel Implementation Of Four-Particle Harmonic Oscillator

Transformation Brackets For Nuclear Calculations

Augustinas Stepšys1 , Saulius Mickevičius2 , Darius Germanas3 , Ramutis K Kalinauskas3 1Vilnius University, Faculty of physics, Saulėtekio av. 9, 10222, Vilnius, 2Vytautas Magnus University, K. Donelaičio

58, LT-44248, Kaunas, Lithuania, augustinas.stepsys@ff.vu.lt

Abstract

The microscopic description of nuclear shell model is one of rapidly developing area of modern

physics. While solving the Schrödinger's equation, the basis of harmonic oscillator functions has

proven to be extremely useful and efficient in describing compact quantum systems, such as

nucleons in atomic nuclei and quarks in hadrons. This kind of basis is simple to use, although it

has one major disadvantage- it converges quite slow. For this reason the dimensions of matrices

becomes very big as the values of quantum numbers, which are describing the elements of matrix.

These values are required to find the coefficients for a few particle harmonic oscillator

transformation brackets, which are constructed from Clebsh-Gordan, 6j and 9j coefficients.

Although the analytical expressions of these coefficients are simple,but big problems arise while

doing calculations on the computer. Currently widely used 64 bit (Double) precision is not

sufficient for these type of calculations as doing intermediate evaluation of coefficients requires

very large factorial values. Therefore calculated coefficients are represented not corectly. Another

problem is quite slow calculation, which could be solved by paralleling the computer code and

using large computer clusters. This component of multiparticle problem limits its evaluation, so

the expansion of limits for algorithms for calculating of harmonic oscillator transformation

brackets must be done.

Using external parallelization library and mutable precision we created a pack of numerical codes

based on the methods of compact expressions of the three and four- particle harmonics oscillator

brackets. Program code is written in Fortran 90 programing language. For parallelization of used

algorithm MPI parallel communication standard was used.

Considering that even in small harmonic oscillator energy and angular momentum values Double

Precision is not sufficient, we decided to use higher precission methods in intermediate

calculations, as it increases the stability of algorithms and extends the validity of used algorithms

for larger input values. Thus, we created routines for calculating required coefficients using GNU

Quadruple Precision and arbitrary precision library FMLib. The use of different kind of precision

for calculation allows to balance speed of calculation ( fastest calculation is done using Double

precision, slowest - FMLib) with tolerable margin of error.

Keywords: nuclear shell model, parallel techniques

ISSN 2335-8653

106

Ab Initio Calculations Of Six-Body Systems

Augustinas Stepšys1 , Saulius Mickevičius2 , Darius Germanas3 , Ramutis K Kalinauskas3 1Vilnius University, Faculty of physics, Saulėtekio av. 9, 10222, Vilnius, 2Vytautas Magnus University, K. Donelaičio

58, LT-44248, Kaunas, Lithuania, augustinas.stepsys@ff.vu.lt

Abstract

For description of physical proterties of many-body systems besides the physical part of the

problem, requires efficient mathematical and computational methods. One of the hugest projects

with an emphasis on computational and algorithmic developments in nuclear physics, was

UNEDF project [1,2], carried out in USA from 2006 to 2012. This project revealed the

complexity of many-body systems and the limitations of the models which were used. As an

example calculations of 12C, required supercomputer resources with more than 100,000 cores.

Here for basis antisymmetrisation Slater determinants were employed. The method of Slater

determinants is quite simple method of antisymmetrisation of N fermion systems, but it gives a

huge basis states used in calculations and therefore may require superpowerfull computer

resources.

One of the possible solution of the problem- to create efficient models of many-

body systems which allows to optimize the use of computer resources. For the solution of the

problem, method of binary cluster model can be applied. The approach is based on a simple

enumeration scheme for antisymmetric N particle states, and I suggest an efficient method for

constructing the eigenvectors of two-particle transposition operator PN1;N in a subspace where N1

and N2 = N −N1 nucleons basis states are already antisymmetrized [4]. Using this method we can

distinguish totally asymmetrical N particle states from the other states with lower degree of

antisymmetry. Calculations were performed for systems composed of six nuclei.

Keywords: nuclear physics, Mathematical physics, Ab initio calculations

References should be listed as below: [1] S. Bogner, etc., arXiv:1304.3713v1 [nucl-th] 2013

[1] G. F. Bertsch, D. J. Dean, W. Nazarewicz, SciDAC Rev. 2007, 6, 42

[1] E. Lusk, S. C. Pieper, R. Butler, SciDAC Rev. 2010, 17, 30

[1] S. Mickevičius, etc., Central European Journal of Physics 2013, 11, 5 568-574

ISSN 2335-8653

107

Plasma Based Ex-Situ And In-Situ Hydrogenation Of Mg Films

Dalius Girdzevicius, Darius Milcius, Marius Urbonavicius

Lithuanian Energy Institute, Breslaujos st. 3, LT-44403, Kaunas, Lithuania

Dalius.girdzevicius@lei.lt

Abstract

Magnesium hydride (MgH2) is an attractive material for hydrogen storage applications due to its

high volumetric capacity reaching 7.65 wt%. However, MgH2 demonstrates slow kinetics for

adsorption and desorption of hydrogen and requires high temperatures for decomposition. In order

to enhance hydrogenation process and its thermodynamic properties different additives can be

used. In this consequence, deactivation and degradation of additives can decrease efficiency of

metal hydrides.

In this work Mg films were synthesized using magnetron sputtering in Ar+ atmosphere and then

ex-situ and in-situ hydrogenated in magnetron induced hydrogen plasma. This thechnique enables

to achieve metal hydrides without the use of additional compounds. Therefore, undesired

deactivation and degradation of additves can be avoided.

Current study aims to analyze the main differences between the samples prepared during plasma

based ex-situ and in-situ hydrogenation. SEM, AFM, XRD and XPS techniques are used to

identify formation of magnesium hydrides in this work. Advantages of in-situ hydrogenation of

Mg are identified according to experimental results.

Keywords: Magnesium hydride, Hydrogenation, Magnetron sputtering.

ISSN 2335-8653

108

The Effect Of Foliar Spray Fertilizers On Hordeum Vulgare Resistance To

Combined UV-B Radiation And Drought Stress Effect

Irena Januškaitienė1, Inga Ivankova1

1 Vytautas Magnus Universit; Vileikos 8, LT-44404 Kaunas, Lithuania

E-mail address to I.Januskaitiene@gmf.vdu.lt

Abstract

During the study there was examined the microelement foliar spray fertilizers effect on spring

barley (Hordeum vulgare L.) resistance to combined UV-B radiation doses (1, 3 kJm-2d-1) and

drought effects. Barley seeds were sown in prepared pots with neutral pH peat substrate. 7 days

after germination was carried out in the first spray on the leaves with microelement fertilizers and

free amino acids (Aton Az). Within 2 days after the first fertilizer application, the different

irradiation (1, 3 kJm-2d-1) UV-B doses and drought affected were started. Experiment lasted for 6

days. The second and third fertilizer spray applications were made 3 and 5 days of exposure.

During the experiment (i.e. 2 and 4 days of exposure) were measured physiological indicators,

while the main characteristics of all investigated indicators were carried out at the end of

exposure, i.e. 6th day and after recovery period, i.e. after 7th days after end of exposure. The

strongest effect on barley physiological, morphological, and biochemical parameters were under

single impact of the drought. The highest combined effect on investigated parameters were under

UV-B radiation and fertilizers impact. It was found that the weakest photosynthetic rate of barley

was on the 6th day of exposure. The largest positive effect of fertilizers on photosynthetic rate of

barley were under single impact of the drought, i.e. photosynthetic rate of fertilized barley was

more than 6 times higher than not applied plants (p<0.05). With increasing UV-B radiation dose

the content of chlorophylls in leaves of barley decreased. Fertilizers have helped to overcome the

UV-B radiation induced stress, since in the sprayed barley leaves content of chlorophyll a and b

were higher (p<0.05). The highest carotenoid content and the lowest dry biomass was for barley

exposed to a combined 3 kJm-2d-1 UV-B radiation and drought effects, compared with the control

there was 40,3 more carotenoids (p<0.05) and 36,5 less dry biomass (p<0.05).

Malondialdehyde (MDA) content increased with the strength of stressors compared to controls

(p<0.05). After a recovery period, the maximum positive effect of fertilizers was on the

photosynthetic rate, chlorophyll a/b ratio, MDA content in leaves of barley. The most positive

effect of fertilizers was under weak and average stress intensity.

Keywords: UVB, drought stress, pigments, dry biomass, malondialdehyde, foliar spray fertilizers.

ISSN 2335-8653

109

Species Composition And Distribution Of Terrestrial Isopods (Isopoda) In

Region Alytus Of Lithuania

Karolina Kvašnauskaitė1, Ingrida Šatkauskienė2

1 Department of Biology, Faculty of natural science, Vytautas Magnus University, Kaunas Lithuania

2 Department of Biology, Faculty of natural science, Vytautas Magnus University, Kaunas Lithuania.

i.šatkauskienė@gmf.vdu.lt

Abstract

Terrestrial isopods/woodlice are widespread and fuctions as the dominant component of the soil

arthropod macro decomposer community in many terrestrial habitats [1]. Terrestrial isopods have

morphological advantages, as desiccation protection also respiration, reproduction, nutrition

systems, which allow them distribute in various natural terrestrial biotopes and urbanized areas [2].

The interesting fact, that these organisms are abundant and widespread in Lithuania, but their

research began only in 2004. Till now, known fauna of terrestrial isopods of Lithuania contains 12

species [3]. Isopods were collected in 2014 during summer (VI, VII, VIII) and autumn (IX, X)

from six different habitats in Alytus (54° 23′20″ N, 24° 2′ 50″ E) region: mixed with coniferous

forest, leafy forest, wetland, young mixed with coniferous forest, part of leafy forest located by the

road and anthropogenic area. Sampling of isopods was mostly by hand collection. Basic statistical

parameters were applied to analyze the results: relative abundance (Ds), species richness (S),

Shannon-Wiener diversity index (H), Simpson dominance index (D) and Evenness (EH ) index.

The total 1775 individuals were collected and 8 species of isopods were identified: Trachelipus

rathkii, Hyloniscus riparius, Porcellio scaber, Trichoniscus pusillus, Cylisticus convexus,

Ligidium hypnorum, Oniscus asellus, Porcellionides pruinosus.

The latest species P. pruinosus was found as new species in Lithuania. The highest species

richness (S=5) was found in mixed forest and the lowest (S = 2) was in young mixed forest. The

highest biodiversity (H = 1.41; D = 0.50) of terrestrial isopods was found in mixed forest,

meanwhile the lowest (H = 0.13; D = 0.96) was observed in urban area. T.rathkii, a eurytope

species, was found in all investigated habitats, whereas P. pruinosus spread only at urban area.

Abundance (surface activity) of isopods showed a seasonal pattern. The sample size of T. rathkii,

P.pruinosus allowed calculating the sex ratio of this species; Females dominated in all habitats and

during all period of research.

Keywords: terrestrial isopods, diversity, distribution, decomposers

References [1] Ferenţi S., Cupsa D., Covaciu-Marcov S. D. 2012. Ecological and zoogeographical significance of terrestrial

isopods from Carei Plain natural reserve (Romania). Archives of Biological Sciences, 1029­1036.

[2] Paoletti M. G., Hassall M. 1999. Woodlice (isopoda: Oniscidea): their potencial for assessing sustainability and

use as bioindicators. Agriculture, Ecosystems and Environment, 157­165.

[3] Vilisicsa F., Ivinskis P., Rimšaitė J. 2012. Terrestrial isopods (Crustacea, Oniscidea) at the Baltic Sea coast in

Lithuania. Zoology and Ecology.226- 232.

ISSN 2335-8653

110

Characterization of low flux neutron sources by using neutron activation

analysis, MCNP6 modeling and solid state nuclear track detectors

Elena Lagzdina, Danielius Lingis, Artūras Plukis, Rita Plukienė, Darius Germanas, Jevgenij

Garankin

Center for Physical Sciences and Technology, Savanorių pr. 231, LT-02300 Vilnius, Lithuania

elena.lagzdina@ftmc.lt

Abstract

This study is focused on optimization of low flux neutron sources for radiobiological applications.

Prior to choose optimal conditions for irradiation of biological sample, neutron flux intensity and

energy distribution should be determined. Neutron activation analysis (NAA), solid state nuclear

track detectors (SSNTD) and MCNP6 simulation were used for identification of neutron flux

parameters. Experiments were carried out using isotopic PuBe neutron source at total activity

4.5×107 n/s and neutron generator based on 3H(2H,n)4He reaction resulting monoenergetic 14.7

MeV neutron flux (108 n/s). MCNP6 is used for neutron transport calculation, energy deposition,

assessment of the reaction rates and dose rates in the biological sample [1]. For the experimental

cross-checking of the MCNP6 simulation samples of V, Mn, Fe, Al, Ti as well as TASTRAK

(Track Analysis Systems Ltd.) and MAKROFOL (Bayer) detectors have been irradiated. After

irradiation chemical etching of SSNTD’s was performed. Subsequently, the surface of the samples

was analyzed for tracks identification. The samples of V, Mn, Fe, Al, Ti were measured by the

high purity germanium (HPGe) detector and the activities of neutron induced isotopes were

obtained [2]. According to the experimental results and MCNP6 modeling the characterization of

low flux neutron sources is performed.

Keywords: Neutron activation analysis, MCNP6, solid state nuclear track detectors.

References [1] D.B. Pelowitz, MCNP6 User’s Manual, Version 1.0, Report LA-CP-13-00634, 2013, Los Alamos National

Laboratory, New Mexico.

[2] L. Hamidatou, H. Slamene, T. Akhal, B. Zouranen, 2013, Concepts, Instrumentation and Techniques of Neutron

Activation Analysis, Faycal Kharfi ISBN 978-953-51-1033-0.

ISSN 2335-8653

111

The Effect Of Equal Cd And Cu Exposure In Peat Substrate On Growth And

Bioaccumulation Of Hordeum Vulgare

Irena Januškaitienė1, Martynas Klepeckas1

1 Vytautas Magnus Universit; Vileikos 8, LT-44404 Kaunas, Lithuania

E-mail address to I.Januskaitiene@gmf.vdu.lt

Abstract

Environment pollution with heavy metals is becoming more important these days because of

working industry, agriculture, raising usage of heavy metals and their emissions. In this work there

was investigated the impact of two heavy metals Cd and Cu various concentrations (100; 200;

400; 800 and 1600 mg/kg soil) contaminated soil on barley (Hordeum vulgare) morphological

parameters, content of photosynthetic pigment and malondialdehyde (MDA) concentration.

Investigated plants were sown in vegetative pots with prepared peat and sand substrate (ratio 2:1),

and 4 days after germination plants were watered with appropriate metal concentration solutions.

Experiment lasted for 14 days, until the second true leaf unfolded. At the end of experiment the

content of pigments was measured using spectrophotometer, MDA – using thiobarbituric acid

method and also detected plants height and dry mass. For the quantitative determination of metals

in plant material a Shimadzu AA-6800 atomic absorption spectrometer equipped with deuterium

background correction, and single-element hollow-cathode lamps as radiation sources were used.

Bioaccumulation factors (BAF) of Cu and Cd of barley plants were calculated according Mattina

et al. method. Increasing metal concentrations decreased plant height and biomass, and Cd effect

on morphological parameters were higher than Cu, when correlation between barley height and Cd

concentration was -0.74 (p<0.05), and between height and Cu concentration – -0.39 (p<0.05).

Increasing metal concentrations effect on photosynthetic pigments was different, i.e. under Cu

effect the content of pigments (a+b) increased and correlation was 0.47 (p>0.05), while under Cd

effect it decreased and correlation was -0.13, (p>0.05), but statistically insignificant. Between

MDA concentration in barley leaves and heavy metals concentration in the substrate there was

estimated a strong correlation (p<0.05), which was slightly stronger under copper impact. At

lower concentrations there were detected lower MDA levels, compare to the control plants, when

the concentration increased up to 1600 mg Cu and Cd / kg substrate, the MDA concentrations

increased statistically significant by 68% and 32% respectively. Up to 800 mg/kg concentration in

substrate accumulation of copper was more willing than accumulation of cadmium in barley

leaves (p <0.05), but when concentration rises up to 1600 mg/kg, plant starts to accumulate more

Cd than Cu.

Keywords: Cadmium, copper, malondialdehyde, pigments, dry biomass, bioaccumulation factor.

ISSN 2335-8653

112

Radiation Interaction Impact On Environment And Technology

S. Mickevičius1 D. Adlienė2

1 Faculty of Natural Sciences, Vytautas Magnus University, Vileikos str. 8, LT-44404, Kaunas, Lithuania

2Department of Physics, Kaunas University of Technology, Studentų str. 50, LT-51368, Kaunas, Lithuania

Email: s.mickevicius@gmf.vdu.lt

One of profiles of our group is scientific, technological and medical applications of

ionizing radiation. Currently we are focused on the development of the new methods for patient

dose assessment in radiation therapy and new nanostructured materials for commercial application

in radiation detectors and Pb free radiation protection equipment.

We are pioneering in starting verification of in vivo doses in interstitial catheter based high

dose rate brachytherapy when catheters are preimplanted direct into the cancerous tumor. For this

purpose we are using a complex of (well-known and new developed ) experimental dosimetry

methods: Metal – Oxide Semiconductor Field Effect Transistor detectors, thermoluminescent

dosimeters (special „pin worms“ and rods, having diameter ~1mm or less, to fit into catheter), film

dosimetry (radiographic and Gafchromic films and special method for their evaluation), gel

dosimetry and simple pixel based method for dose evaluation in irradiated gels. It is also to point

out that the reliability of all methods is validated performing uncertainty evaluation tests.

Experimental verification of theoretical patient doses calculated using standard treatment planning

system alow avoiding certain patient irradiation mistakes.

Now we are working on development of new polymeric gels for dosimetry that provide

visual information on radiation induced polymerisation due to irradiation doses applied, are

sensitive to small (0.01 or 0.1 Gy) dose variations, are stable for at least one year. In paralell we

are developing optical methods for dose assessment since gel evaluation in MRI modality, which

is usual for this assessment, is time consuming and expensive.

In line with European Union Directive 2011/65/ on the restriction of the use of certain

hazardous substances in electrical and electronic equipment, which also limitts the use of leaded

equipment for medical applications we are working on development of nanostructured Pb free

materials that might replace currently used leaded radiation protection shields and other adiation

protection equipment. Developed nanocomposites are transparent (86-92%), and provide Pb

equivalent thickness of 0.5- 1.0 mm for scattered radiation in interventional radiology

corresponding to the voltage applied.

ISSN 2335-8653

113

Hydrogen Production By Reacting Activated Aluminum Metal With Water

Marius Urbonavičius, Darius Milčius

Lithuanian Energy Institute, Breslaujos st. 3, LT-44403 Kaunas – Lithuania

E-mail address: Marius.Urbonavicius@lei.lt

Abstract

During the past decade, hydrogen production as regenerative and environmentally friendly fuel

has been an active area of research. There are many methods which could be applied for stationary

hydrogen production (mainly steam reforming; electrolysis, photo-chemical methods and etc.).

However, hydrogen-powered portable devices still remain a challenge because of complex

hydrogen storage systems.

Consequently, aluminum reaction with water can be a solution for hydrogen production on-board

(in-situ). Aluminum is relatively cheap, widespread with high volumetric density metal. Although

Al-water reaction is thermodynamically stable, metal surface is passivated by formation of thin

oxide film which prevents metal surface from direct contact with water.

According to literature a number of aluminum activation and reaction-inducing methods have

been investigated and some of them patented. The easiest way is addition of some promoters to the

reaction which help to disrupt oxide layer. It could be sodium hydroxide (NaOH), metal oxide

additive (Al2O3, TiO2, CuO, ZnO) or salt (NaCl, KCl) promoters. Alkaline is simple and low cost

catalyst. Another method is forming aluminum alloys with other metals which prevent from

surface oxidation. Probably, the best known is aluminum-gallium alloy. Also complex alloys

which include Zn, In, Bi, Mg, Sn, Li, Mn could be used. Moreover, aluminum powder could be

milled with sharp-edge salt particles. Theoretically, 1 gram of Al can produce about 1245 ml of

hydrogen. The production depends on many factors: activation method, aluminum particle size,

al/water ratio, water temperature, pH value.

In this research, the surface layer of aluminum powder was modified under hydrogen gas plasma

treatment. Many various analysis methods (scanning electron microscopy, energy dispersive X-ray

spectroscopy, X-ray diffraction analysis, O/N/H gas analysis) were used to characterize Al powder

before and after plasma treatment. Hydrogen generation was investigated after Al immersion in

water as well.

Keywords: Aluminum activation, alloy, sodium hydroxide, water, hydrogen generation, plasma.

ISSN 2335-8653

114

Safety Aspects of Higher Value Wheat Bread

Elena Bartkiene1, Vadims Bartkevics2,3 Iveta Pugajeva2,3, Ida Jakobsone2, Vita

Krungleviciute1, Grazina Juodeikiene4, Daiva Vidmantiene4, Loreta Basinskiene4, Gerhard

Schleining5

1 Lithuanian University of Health Sciences, Tilzes g. 18, 47181 Kaunas, Lithuania 2 University of Latvia, Centre of Food Chemistry, Kr.Valdemara iela 48, LV-1013 Riga, Latvia 3 Institute of Food Safety, Animal Health and Environment, Lejupes iela 3, LV-1076 Riga, Latvia 4Kaunas University of Technology, Radvilenu pl. 19, 50254 Kaunas, Lithuania 5 University of Natural Resources and Life Sciences, Muthgasse 18, 1190 Wien, Austria

Elena.Bartkiene@lsmuni.lt

Abstract

Consumer awareness of the value of functional foods has greatly increased in the past years, and

the global market for functional foods is expected to increase to €14.7 billion by 2013 [1]. A

variety of ingredients are used during bread making to ensure the development of a continuous

protein network that is essential for bread quality. Attempts at incorporating bioactive ingredients,

for example, dietary fiber and phenolic antioxidants into popular foods such as bread have grown

rapidly, due to the increased consumer health awareness. Functional foods with elevated levels of

antioxidants and dietary fibers are in high demand due to their associated health benefits,

including maintenance of health and protection from diseases, such as cancer, cardiovascular

diseases, and degenerative diseases [2].

Usually studies about the wheat bread value improving are focused on the quality, but not on the

safety parameters evaluation. To ensure safety parameters of wheat bread, for some special

chemical composition functional ingredients (with high protein content, with high reducing

saccharides content etc.) should be adapted special technological steps before using for wheat

bread value improving. Otherwise, the new developed product may be not only not beneficial but

just harmful to consumers health [3; 4; 5; 6; 7].

Keywords: wheat bread, quality, safety.

References [1] The Medical News, 2010

[2] K.P. Scott, S.H. Duncan, H.J. Flint, Nutrition Bulletin, 2008, 33, 201-211

[3] E. Bartkienė, G. Juodeikienė, D. Vidmantienė, G. Zaborskienė, D. Kunkulberga, Agriculture, 2009, 96, 181-196

[4] E. Bartkienė et al., LWT - Food Science and Technology, 2013, 54, 414-420

[5] E. Bartkienė et al., International journal of food sciences and nutrition, 2013, 64, 890-896

[6] E. Bartkienė et al., International journal of food science & technology, 2013, 48, 2613-2620

[7] E. Bartkienė et al., Food control, 2013, 30, 35-40

ISSN 2335-8653

115

Optimization of Extraction of Linden Flowers Phenolics with Water Using

Response Surface Method

Agnė Birštonaitė, Vytenis Venclovavičius, Raimondas Raudonis

Department of Pharmacognosy, Lithuanian University of Health Sciences, Eivenių 4, 50161, Kaunas, Lithuania

agne.birstonaite@gmail.com

Abstract

Linden is a traditional Lithuanian plant which medicinal raw is linden flower. European

pharmacopeia linden raw material is comprised of flowers (or mixes of them) of Tilia cordata

Miller, Tilia platyphyllos Scop., Tilia vulgaris Heyne. Traditionally linden flowers are used for

insomnia, migraine, cold with fever, cardiovascular or digestive tract disorders [1].

Pharmacological effects depends on phenolic compounds, flavonoids, proanthocyanidins,

carbohydrates, essential oil, enzymes, vitamins [2]. There is lack of information in the literature

about the impact of grinding of pharmaceutical raw material on bioactive compounds extraction.

The object of this study was the tea of linden flowers, which has been divided into 7 fractions: >

2.5 mm, 2.0–2.5 mm, 1.6–2.0 mm, 1.4–1.6 mm, 1.12–1.4 mm, 0.9–1.12 mm, < 0.9 mm. The aim

was to optimize the extraction of phenolic compounds with water using response surface method

and quantify the groups of the extracted compounds. The ANOVA analysis was used for the

evaluation of constructed model.

It was determined that the optimal temperature extracting the maximum amounts of phenolic

compounds was (p<0.05) was 100 °C. The amounts of total phenolic compounds, flavonoids,

proanthocyanidins vary significantly in different fractions in the time scale. Fractions containing

particles larger than 1.4 mm were determined with greater amounts of phenolic compounds. The

maximum amount of phenolic compounds has been detected in the 2.0–2.5 mm fraction after 45

min – 72.76 GAE mg/g. This fraction has had the greatest (p<0.05) amount of proanthocyanidins

– 12.75 mg/g. The smallest amount of proanthocyanidins has been accumulated by 0.9–1.12 mm

fraction. The smallest fraction (< 0.9 mm) provides greater extraction of flavonoids, up to 17

mg/g.Selecting method giving the highest yield of target compounds could be preferable for

consumers and producers.

Keywords: Linden flowers, phenolic compounds, Tilia.

Acknowledgment: Agnė Birštonaitė acknowledge support by project "Promotion of Student Scientific

Activities" (VP1-3.1-ŠMM-01-V-02-003) from the Research Council of Lithuania. This project is funded

by the Republic of Lithuania and European Social Fund under the 2007-2013 Human Resources

Development Operational Programme’s priority 3.

References

1. Barnes J, Anderson LA, Phillipson JD. Herbal Medicines. 2th ed. Pharmaceutical Press, London 2007

2. EMA, Community herbal monograph on Tilia cordata Miller, Tilia platyphyllos Scop., Tilia x vulgaris

Heyne or their mixtures, flos, 2012

ISSN 2335-8653

116

Growth Parameters Of Centaurium Erythraea Cell Culture In Relation To Its

Chemical Composition And Antiradical Activity

Anete Boroduske1, Ilva Nakurte1, Agneta Lindmane2, Madara Lazdane3, Signe Tomsone3

1 Laboratory of Bioanalytical and Biodosimetry Methods, 7 Ratsupites str., Riga LV-1069, Latvia 2 Faculty of Medicine of University of Latvia, Raina blvd. 19, Riga, LV – 1586, Latvia

3 Botanical Garden of the University of Latvia, Kandavas 2, LV-1083, Riga

anetekeisa@lu.lv

Abstract

Minimal impact on wild populations, independence of seasonal and environment-related variations,

short time of scale-up and availability on demand are just a few but not all advantages of in vitro culture

derived plant material over cultivated plants or plants harvested in wild. However, many studies have

shown that richness and diversity of chemical composition and biological activity of wild plant derived

extracts usually exceeds that of in vitro plant derived extracts. Therefore, in order to reach commercial

scale of plant derived extract production using in vitro culture techniques correct choice regarding culture

type, growth conditions and timing of sampling has to be made.

Here we report a study on anti-oxidative compound production in Centaurium erythraea (source of

potentially valuable compounds for anti-aging cosmetics) cell suspension culture in relation to culture

growth parameters. In addition, a comparison of analyzed compound content, total phenolic content and

anti-radical activity of extracts derived from different culture types of C.erythraea (cell suspension, callus,

shoot culture and Centaurii herba drug) will be reported.

Keywords: Centaurium erythraea, cell suspension culture

ISSN 2335-8653

117

Characterization Of Plant Extracts In Cell And Tissue Culture-Based In Vitro

Test Systems For Development Of New Cosmetic Compositions For Skin

Renewal And Whitening

Martins Boroduskis1,2, Anna R-Stunda1,2, Elza Kaktina1, Anete Boroduske1, Ilva Nakurte1,

Janis Ancans1,2 1University of Latvia, Laboratory of Bioanalytical and Biodosimetry Methods, Ratsupites str. 7, LV-1067, Riga, Latvia 2InCell Ltd., Ratsupites str. 7, LV-1067, Riga, Latvia

martins.boroduskis@lu.lv

Abstract

Use of natural origin ingredients for cosmetic and personal care products is constantly

increasing and results in demand for ingredient characterization to establish safety profile and

efficacy. Since animal testing of cosmetic ingredients and final compositions is banned in the

European Union since 2013, in vitro cell and tissue culture-based methods have to be developed

and used instead. Furthermore, in vitro micro-propagation techniques of plants provide

opportunity to derive plant extracts without impact on wild plant populations and allow industrial

utilization of extracts also derived from endangered and rare plants. Thus, in vitro technique based

solutions are of increasing interest for cosmetic and personal care industry in order to address

rising demand for natural origin products manufactured according to environmentally friendly

practices.

Our in vitro service platform provides analysis of micro-propagated plant extracts using LC-

MS-TOF for identification of active ingredients of interest for anti-aging, skin whitening and UV-

protecting skin care and cosmetic product formulations. Extract characterization methods include

total phenolic content, anti-radical activity and tyrosinase inhibition assays in case of whitening

ingredients, as well as evaluation of biological effects of candidate ingredients in different cell and

tissue culture-based in vitro test systems. In vitro tests include assessment of cell proliferation and

migration profiles of human fibroblast, HaCaT and melanocyte cell cultures using IncuCyte

ZOOM system, real time PCR expression profiling with custom designed gene sets, quantitative

analysis of growth factor and cytokine secretion, and advanced in vitro test models such as cell co-

cultures and 3D organotypic tissue cultures.

Keywords: plant extracts, cell culture, in vitro tests, cosmetic products, natural ingredients, 3D

tissue culture

ISSN 2335-8653

118

Express test for honey quality

Violeta Krasevič1, Bogumila Kurtinaitiene2, Justinas Kretavičius2, Violeta Čeksterytė3 1Vilnius Gediminas Technical University, Saulėtekio al. 11, 10223, Lithuania 2Vilnius University, Institute of Biochemistry, Mokslininku str. 12, LT-08662, Lithuania 3 Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry Akademija, Kedainiai dist.,

Instituto aleja,1, LT–58344, Lithuania

The following enzymes are found in honey: α- and β-amylase, α- and β-glucosidase, glucose

oxidase, catalase, acid phosphatase, glucose dehydrogenase. The glucose oxidase (GOx), which

oxidizes glucose in honey, produces gluconic acid, one of the main acids found in honey, and

generates hydrogen peroxide, which is an important antimicrobial component of honey. The more

hydrogen peroxide, resulting from higher GOx activity, is found, the higher the value of honey is.

This work was aimed to evaluate the activity of GOx in honey samples collected in different

regions of Lithuania

Hydrogen peroxide is produced in honey in the process of glucose oxidation by GOx, as one of the

reaction’s products. It also acts as a substrate for peroxidase accepting protons. Due to the high

peroxidase selectivity we developed an express test for honey quality evaluation. The test is based

on peroxidase immobilized on a silica gel beads and coloured substrate 2,2'-azino-bis(3-

ethylbenzothiazoline-6-sulphonic acid). The carrier is selected from a number of inorganic and

organic carriers (activated carbon, hydrated alumina, polystyrene). Peroxidase immobilized on this

carrier had a higher enzymatic activity and temperature stability. The developed method was

applied for the measurement of GOx activity in 10-fold dilute samples of honey until 0.01 activity

units/mL. The method is well correlated with the reference method, which is based on the

measurement of GOx activity by an oxygen consumption rate (R=0.978).

The express method is a visual test of honey quality in a set of green colour palette that

corresponds to certain GOx concentration in the examined sample. The method allows us to

produce dry kits and perform honey quality tests without sophisticated analytical techniques at

room temperature. The test is about 10 min, the resulting colour is compared with the colour

palette, which shows enzyme concentration in the sample. The dry kit is stable for up to 4 months

at 4 ° C. This is especially convenient for beekeepers in order to prove the exceptional quality of

the bee products they market. The study found that the GOx activity of Lithuanian honey varied

within 0.03 – 1.49 U/g range. The highest GOx activity was identified in buckwheat and caraway

honeys, while the lowest GOx activity was in oilseed rape and alder buckthorn honeys. The test

could also help detect overheated or adulterated honey.

Keywords: honey, glucose oxidase, express method

ISSN 2335-8653

119

Blueberry Genotypes for the Selection of New Cultivars with Higher Contents

of Biologically Active Compounds

Vilma Kraujalytė1, Petras Rimantas Venskutonis1, Audrius Pukalskas1, Laima Česonienė2,

Remigijus Daubaras2 1Department of Food Science and Technology, Kaunas University of Technology, Radvilėnų pl. 19, Kaunas, LT-

50254, Lithuania, 2Kaunas Botanical Garden of Vytautas Magnus University, Žilibero g. 6, Kaunas LT-46324,

Lithuania, r.daubaras@bs.vdu.lt

Abstract

Blueberries (Vaccinium corymbosum L.) and some closely related species are among the most

popular commercial berry fruits. Continuous breeding programs were focusing on creating higher

commercial value berry plant genotypes with high productivity, large berry size, berry firmness,

and disease resistance factors. Large berry size, waxy coating, light blue color, firmness and long

shelf life are the most important berry characteristics of V. corymbosum cultivars. However, due to

an increasing demand of healthy foods by the consumers, breeding programs of new berry plant

cultivars, which would accumulate higher concentrations of healthy compounds are carried out.

Indigenous species of bog blueberry (Vaccinium uliginosum L.), highbush blueberry (Vaccinium

corymbosum L.) genotypes ‘Aron’, ‘Bluecrop’, ‘Bluegold’, ‘Bluehaven’, ‘Bluejay’, ‘Blueray’,

‘Hardyblue’, ‘Nui’, ‘Patriot’, ‘Puru’, ‘Reka’, ‘Toro’ ‘Weymouth’, and half-highbush blueberry

genotypes ‘Danutė’, ‘Freda’, ‘Northblue’, ‘Northland’, ‘Putte’, No.16 were investigated in this

study.

The juices of bog blueberry and newly bred blueberry genotypes ‘Danutė‘ and ‘Freda‘

demonstrated significantly stronger antioxidant properties than other analyzed genotypes. An

inverse relationship between average berry mass and total phenolic content as well as the

concentration of chlorogenic acid was observed. Moderate negative correlation was found

between the berry mass and ABTS•+, FRAP and ORAC values as well. The correlations between

similar characteristics measured by different methods were quite high. Thus, the genotypes

containing larger amounts of phenolics possessed high values of ABTS•+, FRAP, and ORAC;

positive correlation coefficients were 0.914, 0.917, and 0.903, respectively. The antioxidative

activity measured with ABTS•+, FRAP, and ORAC also had positive correlation with the

concentration of quinic and chlorogenic acids (p≤0.01).

The results of this study suggest that germplasm of half-highbush blueberry V.

corymbosum and V. uliginosum could be used in breeding of new cultivars with enhanced

antioxidant capacity.

Keywords: Vaccinium corymbosum, V. uliginosum, antioxidant activity phenolic compounds

ISSN 2335-8653

120

Determination Of Total Anthocyanin Content In Cranberry (Vaccinium

OxycoccoL.) Fruit Using UV Spectrophotometry

Eglė Ignatavičiūtė, Asta Kubilienė1 , Guoda Kiliuvienė1 , Kristina Gaivelytė2 1Department of Analytical and Toxicological Chemistry, Lithuanian University of Health Sciences, Eivenių 4, 50161,

Kaunas, Lithuania 2Department of Pharmacognosy, Lithuanian University of Health Sciences, Eivenių 4, 50161, Kaunas, Lithuania

E-mail: egle155@gmail.com

Introduction. Vaccinium oxyccocos L. is growing naturally in Lithuania. Cranberries are very

local where is high water tabel. Berries are rich in biologically active substances such as fenolic

compounds, organic acids, vitamins, macro- and microelements. People started using it long time

ago for lower of urinary tract infections. Anthocyanins are importoant for healths benefits for their

antitumour, antiulcer, antioxidant, anti – inflammatory activities [1,2].

Materials and methods.Fruits of V. oxyccocos L. were collected in different regions of

Lithuania(Mažeikiai, Merkinė, Veisiejai, Dubičiai, Joniškis, Jonava, Čepkeliai, Utena, Kėdainiai,

Žuvinto r.). Fresh fruits samples were frozen and stored in freezer at -19±1 °C.

Extraction. 3.0 g of V. oxyccocos L.fruits presscake were extracted with ethanol containing 0.1M

HCl.Extraction was continued with 20 mL portions of solvent until the sample became colorless.

Extracts were dilueted with acidified ethanol until 100 mL [1].

Spectrophotometry.The absorption was measured on spectrophotometer HALO-DB 20 at 544 nm.

Total anthocyanins amount were expressed as cyanidin-3-glucoside. Concentration of

anthocyanins (mmol/mL) was determined from the calibration curve and the concentration of

anthocyaninswas recalculated for 1 g of berries.

Results.In the present studywe evaluated totalanthocyanin content in V. oxycocco L. fruits from

different regions (n=10) of Lithuania. Highest value of total anthocyanin content (67.107 ± 0.103

mmol/g)was estimated in fruits from Veisiejų region, and lowest (33.511 ± 0.031 mmol/g) – from

Čepkelių region. The content of total anthocyanin differ significantly (at p<0.05) in all regions we

studied, except Dubičiai and Joniškis (p˃0.05).

Conclusion. Total anthocyanin content in Vaccinium oxycocco L. vary significantly depending on

the region of Lithuania, which would collect berries.

References: 1. P. Viskelis, M. Rubinskienė, I. Jasutienė, A. Šarkinas, R. Daubaras, L.

Česonienė.Journal of food science, 2009 ,74, C157-C161.

2. S. Zafra-Stone, T. Yasmin, M. Bagchi, A. Chatterjee, J. Vinson, D. Bagchi. Mol. Nutr.

Food Res. 2007, 51, 675 – 683.

ISSN 2335-8653

121

Isotope Ratio Mass Spectrometry Application in Food Authenticity Studies

Andrius Garbaras, Raminta Skipitytė, Matas Pocevičius and Vidmantas Remeikis

Center for Physical Sciences and Technology, Savanorių ave. 231, LT-02300 Lithuania

Correspondence to: garbaras@ar.fi.lt

Abstract

Stable isotope determinations have become valuable tools in authenticity control and origin

determination of food, food ingredients and beverages, especially fruit juices and wine, as well as

for the identification of the natural or synthetic origin of flavorings.

In this study, commercial fruit juices present on the Lithuanian market were investigated by means

of stable isotopes to check their correct labeling. In order to detect the sugar addition to

investigated fruit juices, δ13C values of whole juice, pulp and sugars were determined. Stable

isotope ratio mass spectroscopic measurements were performed on 30 randomly bought packed

juices with a different country origin. Separation of sugar was performed according to the ISO

method “PN-ENV 12140:2004 Fruit and vegetable juices – Determination of the stable carbon

isotope ratio (13C/12C) of sugars from fruit juices – Method using isotope ratio mass

spectrometry”, while pulp was separated from the fruit juice according to the method “PN-ENV

13070:2004 Fruit and vegetable juices – Determination of the stable carbon isotope ratio (13C/12C)

in the pulp of fruit juices – Method using isotope ratio mass spectrometry”.

The applicability of the stable isotope ratio mass spectrometry method and limitations for food

(juices, wine, dairy products) authenticity studies will be report during the presentation.

Keywords: Stable isotope ratio mass spectrometry, food, authenticity.

ISSN 2335-8653

122

Investigation of Antioxidant Activity in Medicinal Plants and Their Mixtures,

Identical to Commercial Teas, by Spectrophotometric and Chromatographic

Methods

Liudvika Juškaitė1, Vilma Kaškonienė1, Ona Ragažinskienė2

1Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, Kaunas, Lithuania; 2Kaunas Botanical

Garden of Vytautas Magnus University, Sector of Medicinal Plants, Ž. E. Žilibero str. 6, Kaunas, Lithuania

Abstract

There is a quite large number of science publications about various medicinal plants, their

antioxidant properties and biological activities, describing plants’ use for human health. These

articles characterize one or a few plants separately, but none of them try to evaluate how these

popular in daily life widely used plants act together. The purpose of this research was to evaluate

the total amounts of secondary metabolites in separate medicinal plants and their mixtures by

spectrophotometric methods and to carry out qualitative analysis by HPLC. Seven medicinal

plants were analysed: leaves of peppermint (Mentha piperita L.), lemon balm (Melissa officinalis

L.) and raspberry (Rubus idaeus L.), thyme (Thymus vulgaris L.) herb, blossoms of chamomile

(Matricaria recutita L.), seeds of caraway (Carum carvi L.) and rose hips (Rosa L.). All these

plants were grown in the Kaunas Botanical Garden of Vytautas Magnus University. The three

mixtures of plants were made parallel to the three Lithuanian commercial ETNO teas (JSC

Švenčionių Vaistažolės). Spectrophotometric assays (evaluating total phenolic compounds

content, total flavonoid content and antiradical activity) with separate medicinal plants showed

that the highest total amount of phenolic compounds was found in peppermint leaves (217.91 mg

rutin equivalents (RE)/g), the lowest – in the seeds of caraway (21.02 mg RE/g). The highest and

lowest total flavonoid contents were detected in peppermint and in rose hips, i.e., 87.65 and 0.77

mg RE/g, respectively. The highest radical scavenging activity was in the leaves of lemon balm

and peppermint (265.32 and 261.91 mg RE/g, respectively), while caraway seeds showed the

lowest activity (17.06 mg RE/g). All of the herbal mixtures showed the synergistic effect of

phenolic compounds, whereas the interaction of flavonoids was rather more antagonistic. The total

amounts of phenolic compounds and flavonoids in the three mixtures were as follows: ‘Nykštukų’

tea (rose hips 30%, caraway seeds 40 %, lemon balm 30%) – 108.34 and 9.06 mg RE/g,

respectively, ‘Aksominis vakaras’ (chamomile 30%, raspberry 10%, peppermint 60%) – 197.75

and 56.20 mg RE/g, respectively, ‘Šiltas prisiminimas’ (chamomile 40%, thyme 40%, peppermint

20%) – 154.79 and 39.53 mg RE/g, respectively.

Keywords: Antioxidant activity, phenolic compounds, flavonoids, radical scavenging activity,

synergism, antagonism

Acknowledgements

The study was financially supported by the Research Council of Lithuania. Project „Promotion of Students’ Scientific

Activities“ (grant No. PS-14-52).

ISSN 2335-8653

123

Formulation And Quality Evaluation Of Protective Lipstick With Oenothera

Biennis L. Oil

Ieva Kaminskienė, Zenona Kalvėnienė, Giedrė Kasparavičienė, Jurga Bernatonienė, Arūnas

Savickas

Department of Drug Technology and Social Pharmacy, Lithuanian University of Health Sciences, Eivenių str. 4,

Kaunas, Lithuania. E-mail address: ieva.paugyte@gmail.com

Abstract

The aim of this work was to design a lipstick with evening primrose oil (EPO) for daily

protection of the lips. The formulated lipsticks contained only natural compounds: evening

primrose oil, yellow beeswax, cacao butter, vitamin E (preservative), Tangerine essential oil

(fragrance), β-carotene (coloring agent). Design-Expert® 6.0 statistical modeling program was

used to design mixtures of ingredients for optimal lipstick composition. The physical properties -

pH value, melting point and hardness (texture analyzer) were evaluated. Water extracts of EPO

and produced lipsticks were tested for antioxidant activity using 2,2-diphenyl-1-picrylhydrazyl

(DPPH) antioxidant assay. Sensory analysis was performed with trained volunteers using

questionnaire survey.

The results of physical properties confirmed that all samples after production meet the

quality requirements. Sensory analysis showed that lipsticks’ qualities, such as spreadability,

hardness, residual layer, etc., were highly dependent on the balance between oils and waxes.

Therefore approximately 45-55% of base should consist of hard waxes in order to maintain

suitable texture. Although sensory analysis and antioxidant assay has shown that composition of

lipstick, containing the biggest amount of evening primrose oil (76.21%) had the best features as

well as the greatest antioxidant activity (24,84 ± 1,37%).

Based on the analysis of the results of textural, organoleptic and other quality

characteristics, the following composition of organic lipstick was chosen: Evening primrose oil

54,0 %, Beeswax 25,0 %, Cacao butter 25,0 %, Vitamin E 1,0 %, β-carotene, Tangerine essential

oil. Physical quality parameters were: pH value 5.94, melting point 59,77 C, hardness – power for

penetration 75,09 g/s. According to the obtained stability test results, the designed lipstick’s

quality remained appropriate at least six month after production at room temperature 252°C

temperature.

ISSN 2335-8653

124

The Application Of Chemometric Techniques For The Classification Of Bee

Products: A Review

Vilma Kaškonienė

Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, Kaunas, Lithuania,

v.kaskoniene@gmf.vdu.lt

Abstract

The chemometric techniques are used for the classification of the samples to the groups. The

classification may be unpredictable (when samples are grouped according to some specific

parameters) and predictable (when the dependence of the sample to some specific (already known)

group is tested). The hierarchical cluster analysis, principal component analysis, linear

discriminant analysis are the most popular in classification of food samples, including bee

products. However other tests, like artificial neural networks, partial least squares or partial least

squares discriminant analysis, canonical variate analysis, soft independent modelling class

analogy, and etc., are applied.

As composition of bee products is enough rich in diversity of chemical compounds, the various

factors are used for the classification of the samples: carbohydrates composition, amino acids

content and composition, volatile compounds composition, phenolic compounds and flavonoids

content and composition, mineral composition. Chemometric classification of bee products can be

based not only chemical composition, but also on other characteristics, like antiradical activity,

DNR composition, electrical conductivity, optical rotation, antibacterial activity, and etc.

Keywords: Bee products, classification, chemometric methods

ISSN 2335-8653

125

Variation Of Phenolic Compounds In Buckwheat Grain At Different Growth

Stages

Ilona Kerienė1, Audronė Mankevičenė1, Saulius Bliznikas2, Rūta Česnulevičienė1

1Lithuanian Research Centre for Agriculture and Forestry, Akademija, Lithuania 2Institute of Animal Science, Lithuanian University of Health Sciences, Baisogala, Lithuania

E-mail: ilona.keriene@gmail.com

Abstract

Buckwheat (Fagopyrum esculentum Moench) is a good source of health-benefiting phenols

whose amount depends on their chemical composition and environmental conditions. The current

research was aimed to quantify and identify the phenolic compounds in buckwheat grain at

different growth stages and to compare the results between the years 2013 and 2014. Lithuania-

grown buckwheat grains were examined for total phenolics, rutin and quercetin contents. Six

phenolic acids (p-hydroxybenzoic, 3,4-dihydroxybenzoic (3,4-DHBA), p-coumaric, ferulic,

vanillic and sinapic) were quantified and identified. The two growth stages were selected

according to the BBCH scale: 87 (ripening of grain) and 99 (harvested product) [1].

Our results showed that the highest concentrations of the total phenolic content, rutin and

quercetin were accumulated in the grain during ripening stage (BBCH 87) in 2013. The

concentrations of the analysed compounds in harvested grain (BBCH 99) were lower: the total

phenolic content by 16 %, the concentration of rutin by 20 % and quercetin content by up to 4-

fold. In 2014, the concentrations of these compounds declined compared with those in 2013

during the same ripening stage (87). The concentrations of phenolic compounds were similar to

those in harvested grain in 2013. Although it is known that the highest concentrations of phenolic

compounds are accumulated by cereals during flowering and ripening stages, the comparative

analysis showed that the concentrations of some phenolic compounds significantly increased in

harvested buckwheat grain in 2014, especially the content of rutin by 36 %. Analysis of phenolic

acids indicates that hydroxibenzoic acids predominated in buckwheat grain and together accounted

for 81 % of the total phenolic acids content, irrespective of the year and growth stage. The lowest

concentration was determined of vanillic acid, while the variation of other phenolic acids was

inconsistent. Among the phenolic acids tested, the highest variation was established for 3,4-

DHBA, whose amounts were 20 % higher in harvested grain than in ripening grain in 2014.

However, the total content of six phenolic acids remained similar ~84.00 µg g-1 during both test

years.

We think that the weather conditions might have affected phenolic compounds accumulation in

buckwheat grain. In 2013, the concentrations of these compounds were higher than in 2014 when

adverse weather conditions (shortage of moisture, especially in July) prevailed during grain

ripening stage, because of which plants grew slowly and inflorescences wilted. In August, the rate

of rainfall was 70 % higher than the long-term mean (180 mm) and the peak of phenolic

compounds synthesis determined higher concentration of phenolic compounds in harvested grain

than in ripening grain.

Keywords: Buckwheat grain, phenolic compounds, ripening stage.

References [1] Meier, U. (Ed.), 2001, Growth stages of mono- and dicotyledonous plants, 2th ed. BBCH Monograph, Federal

Biological Research Centre for Agriculture and Forestry, pp. 14 – 18.

ISSN 2335-8653

126

Impact Of L. Sakei On Dairy Cattle Production And Ruminal

Processes

Vita Krungleviciute1, Elena Bartkiene1, Rasa Zelvyte1, Igrida Monkeviciene1, Jone

Kantautaite1, Rolandas Stankevicius1, Grazina Juodeikiene2

1 Lithuanian University of Health Sciences, Tilzes str. 18, 47181 Kaunas, Lithuania 2 Kaunas University of Technology, Radvilenu str. 19, 50254 Kaunas, Lithuania Corresponding author: vitakrungleviciute@gmail.com

Lactic acid bacteria (LAB) including bacteriocin-like inhibitory substances (BLIS) producing

strains are generally recognized as safe [1]. Because of their antimicrobial effect, BLIS, or their

producing compounds, have a potential to be used as modifiers of the ecosystem in the

gastrointestinal tract [2] and stimulators of animal production [3].

The aim of the study was to evaluate the influence of BLIS producing Lactobacillus sakei

KTU05-6 on production and ruminal processes of dairy cattle. The supplement given to dairy

cattles was tested to determine the milk yield and composition, the activity of ruminal

fermentation and the microorganisms content. The experiment was performed in the winter period

at the farm of Black & White Holstein dairy cattle. Trial and control groups received identical

diet; however, during 65 days, the trial group received additionally 100 g of the supplement per

cow daily (1011 colony-forming units (CFU) of L. sakei/cow/day).

It was found that at the end of the experiment there were no significant differences in milk

yield and content of milk fat, protein, lactose and urea between the trial group and the control

group (p>0.05). At the end of the experiment, ruminal pH, total and individual volatile fatty acids,

total nitrogen, ammonia nitrogen, D(-)-lactic acid, reduction activity of bacteria, glucose

fermentation reaction, protozoa number, total count of lactobacilli and enterobacteria in the trial

group had no significant difference (p>0.05) from those characteristics in the control group. In the

trial group at the beginning of the experiment L(+)-lactic acid and total count of aerobic and

facultative anaerobic microorganisms (TCM) were different (TCM in the trial group increased by

1.25 log CFU/mL (p<0.05) in compare to the control group).

We conclude that 1011 CFU/cow/day of Lactobacillus sakei KTU05-6 may not be beneficial as

probiotic bacteria for dairy cows, as the assumed positive effects on the milk yield and milk

composition, on the activity of the ruminal fermentation and microorganisms of rumen fluid were

not observed in the animals tested.

Keywords dairy cattle, Lactobacillus sakei, milk, ruminal fermentation, rumen microorganisms.

References: [1] Mayo B., Aleksandrzak-Piekarczyk T., Fernandez M., Kowalczyk M., Alvarez-Martin P., Bardowski, J. Updates

in the metabolism of lactic acid bacteria. Biotechnology of lactic acid bacteria: Novel applications. Wiley-Blackwell,

Iowa. 2010. P. 3–33.

[2] Seo J. K., Kim S.-W., Kim M. H., Upadhaya S. D., Kam D. K., Ha J. K. Direct-fed Microbials for Ruminant

Animals. Asian-Australasian Journal of Animal Sciences. 2010. Vol. 23. P. 1657–1667.

[3] Yasuda K., Hashikawa S., Sakamoto H., Tomita Y., Shibata S., Fukata T. A new synbiotic consisting of

Lactobacillus casei subsp. casei and dextran improves milk production in Holstein dairy cows. Journal of Veterinary

Medical Science. 2007. 69. P. 205–208.

ISSN 2335-8653

127

Development And Evaluation Of Herbal Cosmeceutical For Skin

Care

Akash S Mali1, P Karekar*, Y Gurav*, Dr Yadav A*

Akash S Mali

Gourishankar Institute Of Pharmaceuical Education And Research Satara, Maharashtra ,India.

E-mail –Akash-Shivling.Mali@fc.vdu.lt

Abstract

Herbal cosmetics are the preparations used to enhance the human appearance. The aim of the

present research was to formulate the herbal Cream for the purpose of moistening ,nourishing ,

lightening, & treatment of various diseases of the skin. Different crude drugs; Aloe barbadensis

(Aloe vera-leaves), Ocimum sanctum (Tulsi-leaves),Azadirachta indica (Neem-leaves),Curcuma

longa (Turmeric- rhizomes),Cedro oil(Lemon peel),Myristica fragrans(Nutmeg seeds),Olium

rosae(Rose oil), Orange oil,Prunus dulcis(Almond oil)were taken. Accelerated stability testing of

two final sample has been conducted in the environmental chamber with temperature 25 ± 10C

and humidity 60 ± 10% RH. All the products were found to be stable with no sign of phase

separation and no change in the color. The patch test for sensitivity testing has also been done and

no evidence of skin irritation and allergic signs. The concept of beauty and cosmetics is as ancient

as mankind and civilization. Indian herbs and its significance are popular worldwide. An herbal

cosmetic have growing demand in the world market and is an invaluable gift of nature. Herbal

formulations always have attracted considerable attention because of their good activity and

comparatively lesser or nil side effects with synthetic drugs. Herbal cosmetics are defined as the

beauty products which posses desirable physiological activity such as healing, smoothing

appearance, enhancing and conditioning properties because of herbal ingredient. The work mainly

focuses on the assessment of the microbial quality of Formulated cosmetic preparations. To the

surprise, Both formulation was found to comply with the microbial limit tests as per the

international specifications. Thus herbal cosmetics formulation are safe to use was proved.

Keywords: Cosmetics, Herbal Cream, Formulation, API, Microbiological test.

References should be listed as below:

1. Kapoor V.P, Journal of Research in Pharmaceutical Sciences. Natural product

radiance, 4(4): 306-314, (2005).

2. Sahu Alakh N, Jha S B and Dubey S D,Formulation & evaluation of curcuminoid

based herbal face cream. Indo-Global Journal Of Pharmaceutical Sciences, 1: 77-

84, (2011).

ISSN 2335-8653

128

Antioxidant Activity Of Solidago L. Using HPLC- Cupric Reducing

Antioxidant Capacity (CUPRAC) Assay With Post-Column Detection

Mindaugas Marksa1, Justas Mačinskas1, Jolita Radušienė2, Liudas Ivanauskas1, Valdas

Jakštas3

1Department of Analytical and Toxicological Chemistry, Lithuanian University of Health Sciences, Eivenių 4, 50161,

Kaunas, Lithuania

2Nature Research Centre, Institute of Botany, Akademijos 2, 08412 Vilnius, Lithuania

3Medical Academy of Lithuanian University of Health Sciences, Department of Pharmacognosy, Lithuanian

University of Health Sciences, Eivenių 4, 50161, Kaunas, Lithuania

Introduction. Phenolic compounds are natural antioxidants, which are abundant in plants of

Solidago L. Studies have shown that flavonoids in this type of plants are the main phenolic

compounds that determine the pharmacological activity as an antioxidant and free radical

scavenging effects [1,2]. The aim of our study – to evaluate antioxidant activity in leaves and

flowers of Solidago L. by HPLC- cupric reducing antioxidant capacity (CUPRAC) method with

post-column detection.

Materials and methods. Leaves and flowers of Solidago canadensis L., Solidago gigantea L. and

Solidago virgaurea L. were collected in different places of Lithuania and dried at 25 °C.

Extraction. 0.1 g of air-dried S. canadensis, S. gigantea and S. virgaurea leafs and flowers were

extracted with 10 mL of methanol water mixture (70:30 v/v) by ultra-sonication at 25 °C for 50

min. The prepared extracts were passed through a 0.22 µm filter.

HPLC-CUPRAC method. CUPRAC post - column HPLC analysis was performed with Waters

Alliance 2695 separation module system equipped with Waters 996 PDA and Waters 2487

UV/VIS detectors. Chromatographic fractionation of active agents was carried out with 4.6×150

mm, 3 µm YMC column (injection volume – 10 µL, elution flow rate – 1.0 mL/min). The mobile

phase of gradient elution system consisted of 0.05% aqueous trifluoroacetic acid (solvent A) and

acetonitrile (solvent B). The following elution profile was used: 0 min. – 95% of solvent A and

5% of solvent B, 5 min. – 88% A and 12% B, 50 min. – 70% A and 30% B, 51 min. – 10% A and

90% B, 56 min. – 10% A and 90% B, 57 min. – 95% A and 5% B. Best results of Solidago L.

herbal extracts’ antioxidant activity were achieved while using 10 m length PTFE coil (OD 1.58

mm, ID 0.25 mm) with 50 oC temperature maintained (the flow rate of CUPRAC solution was 0.4

ml/min, absorption was measured at 450 nm). Antioxidant activity was expressed as Trolox

equivalent (TEAC).

Results. We evaluated total antioxidant reducing activity of tested compounds in flowers and

leaves of Solidago L. Strongest antioxidant properties showed leaves (37.73 ± 33.05 mg/g) and

flowers (16.39 ± 7.94 mg/g) of S. gigantea. We compared TEAC values of all tested five phenolic

compounds in leaves and in flowers. The largest TEAC of rutin (32.39 ± 12.65 mg/g) were

observed in leaves of S. virgaurea, whereas TEAC of chlorogenic acid (63.38 ± 30.97 mg/g),

quercitrin (83.83 ± 45.19 mg/g), isoquercitrin (7.50 ± 3.60 mg/g) and hyperozide (5.28 ± 3.37

mg/g) – in leaves of S. gigantea. Similar results were seen in samples of flowers. The largest

TEAC of rutin (26.88 ± 19.79 mg/g) and chlorogenic acid (16.22 ± 4.35 mg/g) were observed in

S. canadensis, whereas TEAC of quercitrin (27.86 ± 21.79 mg/g), isoquercitrin (9.09 ± 3.57 mg/g)

and hyperozide (20.75 ± 11.55 mg/g) – in S. gigantea.

Conclusions. Strongest antioxidant properties showed leaves and flowers of S. gigantea.

ISSN 2335-8653

129

Moisture And Short-Term UV-B Radiation Effect On Nitrate And

Photosynthesis In Spinacia Oleracea

Ingrida Odminytė1, Akvilė Viršilė2, Sandra Sakalauskienė2 1Vytautas Magnus University, Vileikos 8-212, Kaunas, Lithuania 2Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry Kauno street 30, LT-54333,

Babtai, Kaunas distr., Lithuania

ingridaodminyte@gmail.com

AbstractThe objective of this study was to evaluate the effects of substrate moisture and short-

term UV-B irradiation on spinach’s (Spinacia oleracea) nitrate ion assimilation and

photosynthesis intensity. Experiment was conducted in growth chambers of controlled

environment at the Institute of Horticulture, Lithuanian Research Centre for Agriculture and

Forestry. Three separate chambers (24 m2each) were used for the study. Seeds of spinach plant

were sown in120 ml vessels (one seed per vessel) in peat substrate (Durpeta, Lithuania). Plants

were placed at 18/13⁰C day/night thermo period and 12/12h day/night photoperiod. High pressure

sodium lamps (SON-T Agro, Philips) were used for illumination (photon flux density 150 µ mol

m-2 s-1). Plants were grown in those conditions 21 days before the experiment started. Plants were

grown in peat substrate at two moisture regimes: well watered (̴ 40 %) and mild water deficiency (̴

25 %) substrate moisture. After 7 days effect of substrate moisture plants were exposed to 0 kJm-

2day-1, 1 kJm-2day-1 and 2 kJm-2 day-1 UV-B for 1 day. The results showed that UV-B radiation,

independently of dosage, resulted in decrease of nitrate ion content in spinaches grown in well-

watered substrate. When spinaches were exposed to1 kJm-2day-1 UV-B radiation, nitrate ion

content determined 1.58 times lower and when plants were exposed to 2 kJm-2day-1 – it was 1.42

times lower as compared to UV-B untreated plants. Statistically reliable effect of UV-B dosage on

nitrate ion content in plants grown in mild water deficiency was not identified. Photosynthesis

intensity also decreases under UV-B exposure in spinaches grown in both moisture conditions.

Plants affected by UV-B radiation and grown in well-watered substrate showed significantly lower

photosynthesis intensity decrease. It was 1.08 times lower in plants exposed to 1 kJm-2day-1 UV-B

radiation and 1.22 times lower in plants exposed to 2 kJm-2 day-1 UV-B radiations. Photosynthesis

intensity in spinaches grown in water deficiency was determined 6.16 times lower in plants

exposed to 1 kJm-2day-1 UV-B radiation. In plants, grown in water deficiency and exposed to 2

kJm-2day-1 UV-B radiation photosynthesis intensity values were negative and respiration processes

occurred. Experiment showed that photosynthesis processes in plants, cultivated under water

deficiency, are more sensitive to UV-B exposure. Nitrate contents in spinach leaves are associated

to measured photosynthesis intensity and managing water regime and UV-B exposure nitrate ion

contents might be significantly reduced in spinach plants, thus promoting its nutritional value.

Keywords: nitrate ion, photosynthesis intensity, UV-B radiation, light flux, moisture

ACKNOWLEDGEMENTS. This research was supplementary funded by the Research Council of

Lithuania under the project “Promotion of Students’ Scientific Activities”.

ISSN 2335-8653

130

Effect Of Commercial Starter Cultures On Physicochemical

Characteristics, Microbial And Biogenic Amines Counts Composition

Of Fresh Pork Sausage

Anita Rokaityte1*, Gintare Zaborskiene1

1 Department of Food Safety and Quality of the Veterinary Faculty of

Lithuanian University of Health Sciences, Tilžės st. 18, Kaunas, LT-47181, Lithuania

*Anita.Rokaityte@lsmuni.lt

The need for high-quality safe products has resulted in the use of starter cultures for the

production of fresh pork sausages. The aim of this work was to evaluate the effect of commercial

starter cultures (Pediococcus pentosaceus, Staphylococcus xylosus, Leuconostoc carnosum) on the

physicochemical properties, microbiological and biogenic amines counts composition during 9

days at a temperature of 4±0.5 °C.

Microbial counts revealed that, although initial counts of Escherichia coli were similar in all

samples with (1.65 log CFU/g), this microbial group exhibited a strong decrease during the

storage of inoculated sausages, and have completely destroyed the count of E. coli after 9 days,

whereas the counts of E. coli in the control sausages were 1.24 log CFU/g at the end of the

storage. In the inoculated sausages with P. pentosaceus, S. xylosus have reduced the count of yeast

and mold from 4.46 log CFU/g to 5.54 log CFU/g (p≤0.05) compared to control sample. In

general, physicochemical parameters were not affected by the use of starter cultures, but by the

storage time, with the exception of pH values, since the inoculation of starter cultures resulted in a

stronger acidification. After 9 days of storage the level of pH in the inoculated sausages with P.

pentosaceus and S. xylosus was lower by 4.57 compared to control sample 5.64 (p≤0.05). Finally,

Pearson’s correlation was established between decreased values of E. coli, yeast and mold count

and pH (p<0.01). Also, statistical analysis revealed that biogenic amines count was not

significantly affected by starter cultures and it was far below the levels causing any health risk.

In conclusion, it seems that the inclusion of starter cultures contributes to improve the

hygienic quality of fresh pork sausages without significant effect on biogenic amines count,

texture and appearance.

Keywords: Sausages, Pediococcus pentosaceus, Staphylococcus xylosus, Leuconostoc

carnosum.

ISSN 2335-8653

131

Analysis Of Micro- And Macro- Elements Of Lupine Seeds Bred In Lithaunia

By Using Inductively Coupled Plasma Mass Spectrometry (ICP-MS)

Vytaute Starkute1, Elena Bartkiene1, Vadims Bartkevic2, Zita Maknickiene3, Grazina

Juodeikiene4

1Lithuanian University of Health Science, Tilzes str. 18, Kaunas, Lithuania , 2Latvia University of Centre Food

Chemistry, Kr. Valdemara str. 48, Riga, Latvia, 3Lithuanian Institute of Agriculture, Voke Branch, Zalioji a. 2,

Vilnius, Lithuania, 4 Kaunas University of Technology, Radvilenu pl. 19, Kaunas, Lithuania

Corresponding author: vytaute.starkute@gmail.com

Abstract

Essential elements are classified as macronutrients (N, P, K, Ca, Mg, S) and micronutrients

(Fe, Cu, Mn, Zn, B, Mo, Ni and Cl) and the classification is based on the relative abundance in

plants. From the knowledge of the concentration of the most important nutrients, it is possible to

define a strategy to correct for deficiencies, if present, that will limit the production and/or the

quality of plant materials (Gomes, 2014). Foliar nutrient analysis is a useful diagnostic tool to

complement soil testing as a best-management practice with plants (Mengel, 2001). Heavy metals

and metalloids represent a series of environmental hazards worldwide (Ehsan, 2015). The

accumulation of heavy metals in plants is related to the concentration and chemical fractions of the

metals in soils (Ehsan, 2007).

The aim of our study was to evaluate micro- and macro- elements of lupine seeds bred in

Lithaunia by using inductively coupled plasma mass spectrometry (ICP-MS).

It was found that the highest content of calcium, natrium, magnesium was found in the

lupine seeds No. 1072 (1.65%; 1.1%; 2.14%, respectively) and No. 1800 (2.04%; 1.1%; 2.44%,

respectively). The highest content of micro- elements (Fe, Mn, Cu, Zn) was found in lupine seeds

Vilciai (73.5%; 147.6%; 8.06%; 59.8%, respectively) and seeds No. 1734 (63.5%; 118.83%; 6.4%;

45.1%, respectively). The lowest content of micro- elements (Al, Ni, Ga, Sn) which has a negative

impact on health was obtained in seeds No. 1734 (6.26%; 1.94%; 0.62%; 28.49%; 4.87%,

respectively), the lowest content of As, Cd, Sb was obatained in lupine seeds Vilciai (0.03%;

0.37%; 0.03%, respectively).

Received results are very important and would complement the database about chemical

composition of new varieties of lupine seeds, and this is the first step of the lupine potential

application.

Keywords: microelements, macroelements, lupin seed, ICP-MS

References:

[1] Gomez M. S., Schenk E. R., Santos D., Krug F. J., Almirall J. R. Laser ablation inductively coupled plasma optical

emission spectrometry for analysis of pellets of plant materials // J. Spectrochimica Acta partB: Atomic Spectroscopy.

2014, Vol. 94-95, P. 27-33.

[2] Mengel K., Kirkby E. A., Kosegarten H., Appel T. Further elements of importance // Principles of plant nutrition.

2001, P, 639-655.

[3] Ehsan M., Viveros L. F. M., Hernandez V. E., Barakat M. A., Ortega A. R., Maza A. V., Monter J. V. Zinc and

cadmium accumulation by Lupinus uncinatus Schldl. grown in nutrient solution // Int. J. Envirion. Sci. Technol. 2015,

Vol. 12, P. 307-316.

ISSN 2335-8653

132

Food Supplement Legislation In The Eurasian Economic Union

Natalia Tsemborevitch1, Ekaterina Fedorenko

Scientific-Practical Center of Hygiene, Minsk, Belarus, 1tse.natasha@yandex.ru

Abstract

Preserving and improving health is among the basic needs of modern society. The past

several decades have been marked by explosive growth in technologies aimed at preventing

ailments, including nutrition-related diseases. Numerous studies in nutrition science, as well as a

better understanding of the role played by biologically active substances in preventing the

development of diseases, have advanced the food supplement industry. The Eurasian Economic

Union member states continue to perfect the joint legislative framework regulating the safety,

market access, and circulation requirements for food supplements. The article discusses these

requirements as compared to equivalent EU legislation.

There is a consensus that food supplements are foods, and that they contain nutrients and

biologically active substances. The EU legislation is clear that food supplements are intended for

supplementing the normal diet, and that they are released into circulation in a variety of dosage

forms. The Eurasian Economic Union legislation does not provide for such a clear definition.

The definition contained in the relevant Eurasian Economic Union technical regulation

indicates the possibility of food supplements containing natural and nature-identical nutrients and

other substances that have nutritional or physiological effects. Also, according to Eurasian

Economic Union requirements, the food supplement category includes substances used in the

manufacture of foods for special use or for enrichment purposes, as well as probiotic

microorganisms.

In the materials is said about the terminology, classification, general approaches to the food

supplement regulation and market access rules in the Eurasian Economic Union, and also the key

requirements for the ingredients used in food supplements.

There are requirements for foods in general and for food supplements in particular both at

the Eurasian Economic Union level and at the national level. The requirements contained in

Eurasian Economic Union technical regulations apply at the market entry stage, while the

national requirements are used when approving specific labelling inscriptions, regulating the

circulation of food supplements, and conducting overall market oversight.

In the materials are considered specific labelling and advertising requirements which are

regulated at the national law of the Eurasian Economic Union member states, supply several

examples of food supplement appraisals, touch upon potential certification problems and their

possible solutions.

Keywords: food supplement, legislation, requirements, biologically active substances, safety,

market access, labelling.

ISSN 2335-8653

133

Optimisation of Supercritical CO2 Extraction of Lycopene from Red Tomato

D. Urbonavičienė1,2, R. Bobinaitė1, J. Viškelis1, Č. Bobinas1, P. Viškelis1

1 Biochemistry and technology laboratory, Institute of Horticulture, Lithuania Research Centre for Agriculture and

Forestry, Kaunas st. 30, Babtai, Kaunas distr., Lithuania 2Department of Food Science and Technology, Faculty of

Chemical technology, Kaunas University of Technology, Radvilenu, Kaunas, Lithuania

dalia.urbonaviciene@ktu.edu

Abstract

The supercritical fluid extraction work on tomato has been driven by the interest and opportunity

to exploit these residues as a source of lycopene. Lycopene is a carotenoid with red color that can

be applied as the food additive, cosmetic and pharmaceutical industries. In addition lycopene

exhibits antioxidant features and some studies suggest this molecule is linked to anti-carcinogenic

and anti-atherogenic effects [1,2].

The aim of this study was to optimize parameters for supercritical CO2 extraction of lycopene

from freeze dried red tomato pulp with skin. Response surface methodology using the central

composite rotatetable design (CCRD) model was used. The total lycopene in the extracts was

analysed by the reversed–phase HPLC method using a C30 column, with photodiode array

detector. The CCRD consisting of three-factored factorial design with two levels was used in this

study. The factors used were temperature of the extraction chamber (40 80 °C), pressure of the

extraction fluid (200 550 bar) and duration (120 240 min). Coefficient of determination and

the standard errors results from the analysis of variance have shown the model to be adequate. The

linear and quadratic were 0.41 and 0.32, respectively. The independent variables have

significantly (p < 0.05) influenced the extraction of total lycopene from tomato. A second-degree

polynomial equation was developed from a response surface analysis for total lycopene yield and

the highest yield was predicted at 60 °C, 55 MPa (550 bar).

Keywords: lycopene, supercritical fluid extraction, optimization.

References: [1] A.F. Silva, de Melo M. M., C.M. Silva, J Supercrit. Fluids, 2014, 95, 618-627.

[2] J. S.J. Shi, Y. Xue, Ye.X. Jiang, S.S.H. Rizvi, 2010, 619-645.

Acknowledgement. This work was partly supported by a grant from the Research Council of

Lithuania, No. MIP-62/2015.

ISSN 2335-8653

134

Hop as an Important Source of Phytomedicinally Active Compounds

Eva Ürgeová, Natália Fehérová, Ivana Pšenáková

Faculty of Natural Sciences, University of SS. Cyril and Methodius, J. Herdu 2, Trnava, SK-917 01, Slovak

Republic, e-mail: eva.urgeova@ucm.sk

Abstract

Common hop is an agricultural crop known primarily for its use in the brewing industry.

Currently, however, chemical compounds with different biological activities have been found in

hops. In the paper, we focused on the determination of biologically active secondary metabolites

in wild hops collected from Slovakia. The objects of research were leaves and female cones of 46

genotypes. The analysis of wild hop confirmed the difference in the total content of polyphenols,

flavonoids between genotypes. The leaves showed concentration of polyphenols from 1.7 to 10.8

mg/g dry weight. Similarly variability was detected in the flavonoids content of leaves, ranging

from 0.6 to 3.9 mg/g dry weight. The polyphenol and flavonoid content in cones was higher than

in leaves reaching 23.7 mg/g dry weight in case of polyphenols and 5.5 mg/g dry weight in case of

flavonoids, respectively.

Keywords: wild hop, polyphenols, flavonoids

Acknowledgement: This work was financially supported within the grants VEGA 1/0635/13

ISSN 2335-8653

135

Optimisation of Water Extraction of Medicinal Herbal Tea of Birch Leaves

Using Response Surface Method

Vytenis Venclovavičius, Agnė Birštonaitė, Raimondas Raudonis

DepartmentofPharmacognosy, Lithuanian University of Health Sciences, Eivenių 4, 50161, Kaunas, Lithuania

vytenislt@gmail.com

Abstract

European Pharmacopoeia defines medicinal raw material of birch trees as dried leaves of Betula

pendula Roth. and Betula pubescens Ehrh. Leaves contain not less than 1.5 % of flavonoids in the

form of hyperoside [1]. Various birch leave preparations are used for urinary tract disorders,

various infections and inflammations, joints’ diseases – arthritis, osteoarthritis due to antioxidant

activity, antihistamine and anti-bacterial characteristics [1, 2]. All these pharmacological effects

depend on phenolic acids and flavonoids [1].

The aim of the research was to determine the optimal extraction temperature, time and degree of

leaves grinding (size of fraction) on yields of bioactive compounds. The tea of birch leaves has

been divided into 7 fractions of different sizes. The aim was to optimize the extraction of phenolic

compounds with water using response surface method and quantify the groups of the extracted

compounds. The ANOVA analysis was used for the evaluation of constructed model.

It was determined that the optimal temperature to extract the maximum amount of phenolic

compounds is 100 ºC and 45 minutes. The amount of extracted total phenolic compounds,

flavonoids, proanthocyanidins has been increasing up to 45 minute. The longer extraction gave no

significant increments (p<0.05).The size of the particles did not influence the amount of phenolic

compounds, flavonoids, proanthocyanidins obtained in the process of extraction.

On the average, the maximum amount of phenolic compounds has been determined after 45 min

in all fractions – 41.72 ± 2.86 GAE mg/g. The smallest amount of flavonoids has been detected in

< 0.9 mm fraction – around 10 mg/g. The amount of flavonoids in other fractions showed no

significant differences and varied from 16 to 22 mg/g. The amount of proanthocyanidins

determined in all fractions– was in arrange of 2.5–4.5 mg/g. Optimal determined conditions for

maximal extraction of phenolics could be relevant to producers and consumers.

Keywords: Birch leaves, phenolic compounds, Betula.

References:

1. EMA, Betula pendula Roth; Betula pubescens Ehrh., folium 2008.

Grundemann C, Gruber CW, Hertrampf A, Zehl M, Kopp B, Huber R.,Anaqueous birch leaf extract of Betula pendula

inhibits the growth and cell division of inflammatory lymphocytes, J Ethnopharmacol. 2011; 136:444–451

ISSN 2335-8653

136

Phytochemical Analysis Of Bidens Tripartita L. Using Spectrophotometric And

Liquid Chromatographic Methods

Gintarė Naujokaitytė1, Audrius Sigitas Maruška1, Ona Ragažinskienė2

1Vytautas Magnus University, Faculty of Natural Sciences, Vileikos str. 8, Kaunas, Lithuania; 2Kaunas Botanical

Garden of Vytautas Magnus University, Sector of Medicinal Plants, Ž. E. Žilibero str. 6, Kaunas, Lithuania

Abstract

In medicinal plants are found biologically active chemical compounds: alkaloids, flavonoids,

glycosides, tannins, saponins, phenols, essential oils etc. These compounds are known as

secondary metabolites. that plants accumulate mainly phenolic. Bidens tripartita L. was selected

as phytochemical investigation object. It belongs to the family of Asteraceae, Bidens L. genus. It

accumulates mainly essential oils and phenoloc compounds. In this research work phenolic

compounds present in Bidens tripartita L. were analysed spectrophotometrically and using HPLC.

Radical scavenging activity of rhe extracts of this plant were evaluated. Bidens tripartita L. was

grown in VMU Kaunas Botanical Garden. The raw material was collected at different vegetation

phases, bud formation, flowering, massive flowering and in the end of flowering. The raw material

is dried at 20 – 25 ° C in a well–ventilated and direct sunlight protected place. Loss of weight was

determined according to requirements of the European Pharmacopoeia (2006). Phenolic

compounds (2012 year plant material) was analysed spectrophotometrically using the Folin –

Ciocalteu reagent. The highest amounts of phenolic compounds were determined during the

intensive plant growth phenological phase (162.5 mgRE/g) and the lowest – at the end of

flowering (32.3 mgRE/g). The bigest amounts of flavonoids in the plant was also in phase of

intensive growth (94.5 mgRE/g) and the lowest – in the end of flowering (20.9 mgRE/g). The

highest free radical scavenging activity was in the end of flowering (145.5 mgRE/g) and the

lowest activity in intensive growth phase (93.7 mgRE/g). Plant material, collected in 2014 year

was also analyzed. The content of phenolic compounds was highest during the intensive growth

period (123.1mgRE/g) and the lowest during the intensive flowering (62.7 mgRE/g). Flavonoid

contents in all periods of growth were similar (ca. 34.2 mgRE/g). During the intensive flowering

the highest activity of free radical scavenging was determined (86.1 mgRE/g). Analyzing raw

material of Bidens tripartita L. with liquid chromotography with the reaction detector (HPLC –

RD), severalphenolic compounds have been identified, namely: vanillic acid, trans–2–

hydroxycinammic acid, hesperidin, catechin, chlorogenic acid, epicatechin, ferulic acid, quercetin

dihydrate, rutin.

Keywords: Bidens tripartita L., radical scavenging activity, phenolic compounds, flavonoids,

liquid chromatography

ISSN 2335-8653

137

Influence Of Different Extraction Methods Of Rosmarinic Acids Yield From

Origanum Vulgare L. Herb

Justė Baranauskaitė*a, Jurga Bernatonienėa, Rūta Marksienėb aDepartment of Drugs Technology and Social Pharmacy, Lithuanian University of Health Sciences, Medical academy,

Kaunas LT-50161, Lithuania;

bDepartment of analytical and toxicological chemistry , Lithuanian University of Health Sciences, Medical academy,

Kaunas LT-50161, Lithuania.

*Corresponding author: baranauskaite.juste@gamail.com

Oregano (Origanum vulgare L., fam. Lamiaceae), is perennial, aromatic plant of 20-80 cm height (1).

Rosmarinic acid (RA) has a number of interesting biological activities such as antiviral, antibacterial and

antioxidant (2).

The aim of this study was to evaluate the impacts of different extraction methods of RA yields from

oregano herb.

Ethanolic oregano extracts were made by ultrasound-assisted extraction, heated reflux extraction, stirring

extraction and maceration. The amount of RA was determined by HPLC. HPLC analysis was carried out on

a Waters Alliance 2695 separation module system equipped with Waters 996 PDA detector. For

determination of RA the ACE 5 C18 250×4.6 mm (Advanced Chromatography Technologies, Aberdeen,

Scotland) column was used. The mobile phase consisted of solvent A (methanol) and solvent B (0.5 %

(v/v) acetic acid in water). The linear gradient elution profile was as follows: 95%A/5%B 0 min,

40%A/60%B 40 min, 10%A/90%B 41-55 min, 95%A/5%B 56 min. The flow rate was 1ml/min and

injection volume was 10µl. Absorption was measured at 329 nm. Data analysis was performed using

ANOVA statistical analysis package, using parametric and nonparametric methods for the analysis.

The amount of RA varied depending on different ethanol concentration in extracts prepared by ultrasound

extraction. The highest yield of RA are extracted with 50% - 70% ethanol respectively, 6,442±0,003 mg/g,

6,221±0,002 mg/g, 5,837±0,002 mg/g. The lowest content of RA is determined with 96% ethanol –

1,439±0,004 mg/g (p<0.05 vs 30-90% ethanol concentrations). The most effective extraction method is

heated reflux extraction, yield of RA extracted by this method is – 9,393 ± 0,001 mg/g (p<0.05 vs stirring

extraction and maceration). Unfortunately, long-term extraction method such as maceration gives the

significantly lowest yield of RA.

In order to extract the highest amount of RA of oregano herb is important ethanol concentration and

extraction method. The best results can be achieved using 50 – 70% ethanol concentration and heated

reflux extraction.

Keywords: Oregano herb, rosmarinic acid, HPLC.

ISSN 2335-8653

138

Comparison of Different Extraction Methods and Influence of Extraction

Conditions on the Total Phenolic Content and Antioxidant Activity of

Rosemary Extracts

Ugnė Čižauskaitė1, Jurga Bernatonienė1

1 Department of Drugs Technology and Social Pharmacy, Lithuanian University of Health Sciences, Medical

academy, Kaunas LT-50161, Lithuania;

ugne.cizauskaite@lsmuni.lt

AbstractRosmarinic acid is one of the most important constituents of rosemary, which has strong

antioxidant effect [1]. Previous studies revealed that the antioxidative activity of rosmarinic acid

was higher than that of vitamin E or trolox [2,3]. Also it was determined that antioxidant activity

directly depended on the content of phenolic compounds in the extracts [4]. However, the

influence of different extraction methods on the yield of phenolic compounds and antioxidant

activity has not been investigated yet to our knowledge, so it became the aim of our

study.Extraction of R.officinalis L. leaves was performed by ultrasound-assisted extraction,

percolation, maceration and two-phase extraction. The antioxidant activity was evaluated by

means of the 2,2-diphenyl-1-picrylhydrazil (DPPH) radical scavenging method. The concentration

of phenolics in plant extracts was determined using spectrophotometric method. Statistical

analysis was performed, a value of p < 0.05 was taken as the level of significance.The results

showed that the change in extraction temperature from 30°C to 50°C and decrease in

material:solvent ratio from 1:20 to 1:5 significantly increased content of phenolic compounds and

antioxidant activity in extracts prepared by ultrasound assisted extraction. The extension of

ultrasound-assisted extraction time to 30min resulted in up to 17% higher content of phenolic

compounds (p<0.05 vs 10min,15min). The extraction time change had significant influence on

total phenolic content in extracts prepared by two phase extraction too, it increased up to 366%.

Significantly higher content of phenolic compounds compared to other extracts was obtained

during standard extraction procedures - maceration and percolation. In extracts obtained by

maceration, 2.5 times higher concentration of phenolic compounds was achieved compared to that

by percolation. It was noticed that using lower concentration of ethanol, more phenolic

compounds are extracted, however, their antioxidant activity depended on the conditions of extract

preparation. For example in extracts prepared using 70 % ethanol as a solvent with

material:solvent ratio 1:10 and 1:20, content of phenolic compounds differ insignificantly by 5%,

however, antioxidant activity of extract prepared at material:solvent ratio 1:5 was higher by 53%

(p<0.05). It is noteworthy that surfactant Tween 20, which was used for two-phase extraction,

highly increased antioxidant activity of the tested extracts. Antioxidant activity of extract,

macerated in water bath for 180min with 7.5% of surfactant, was found to be only 20% lower than

that of extract with the highest activity found (maceration) although content of phenolic

compounds differed 8 times in these samples.We can conclude that there was no correlation

observed between content of phenolic compounds and antioxidant activity of the tested rosemary

extracts. Due to the long lasting diffusion of active ingredients, the highest content of phenolic

compounds was determined in the extracts, which were prepared by principal extraction

techniques: maceration (20.34±0.053mg/ml) and percolation (8.08±0.04 mg/ml) (p<0.05). These

extracts were characterized with strong antioxidant activity as well. The optimal ultrasound-

assited extraction conditions for extract with highest antioxidant activity were as follows:

extraction temperature- 50°C, time -10min, material:solvent ratio -1:5, solvent- 70% ethanol.

Keywords: rosmarinus officinalis L., total phenolic content, antioxidant activity

ISSN 2335-8653

139

Impact of production chemical hazard on element status of welders

Tatyana M. Rybina, Victor A. Zaitsev, Liudmila S. Ivashkevich, VolhaF.Kardash

Scientific Practical Centre Of Hygiene

E-mail address:tanya-rybina@list.ru

Abstract

The stability of the chemical composition of the body is one of the most important and mandatory

conditions for its normal functioning. Many chemical elements are essential catalysts of metabolic

processes and play a significant role in the functioning of all body systems. Workers employed in

the foundry and welding production are at increased risk of metabolic disorders of trace elements,

which can lead to pathogenic changes, increased morbidity and reduced professional longevity.

Aim of the study was to investigate the effect of environmental pollution of workplace on element

status of welders

Materials and Methods. Airborne particulate matter sampling was carried out in the breathing zone of welders at 10 typical

operating conditions sites by using high volume air sampler with millipore filter. Human scalp

hair from the occipital part of 80 welders and 29 office workers was collected according to the

recommendation of IAEA for sample collection. The mean age was 36.8±15.6 years for welders

and 36.9±13.4 years for office workers. Welder experience was from 1 to 38 (mediana 7) years.

Determination of metals and metalloids in samplings was done by atomic emission spectrometry

with inductively coupled plasma (Ultima 2, Horiba Jobin Yvon, Japan-France).

Statistical analysis was performed using the software package Microsoft Excel XP (Microsoft

Corp., USA) and Statistica 6.0 (StatSoft Inc., USA).

Results.

The toxic elements in the working area of welders are the following aluminum, copper, iron,

manganese, lead, zinc, titanium, chromium, nickel, silica. The content of all elements except

manganese and iron is below hygienic standards.

Analysis of the element composition of scalp hair shows a high content of phosphorus, iron,

manganese, chromium, nickel, zinc and lead compared to the office workers. The main type of

microelementoses for all welders is elevated manganese content. The amount of manganese in the

hair of the head exceeds the reference values, even for a group of welders who did not have a

higher content of this element in the working area.

A reduced content of calcium, copper and magnesium in the scalp hair was observed compared

with the reference values.

Conclusions. An imbalance of trace elements in welders was observed regardless of the level of

these elements in the working area.

Keywords: copper, iron, manganese, zinc, welder.

ISSN 2335-8653

140

Effect of Smirnov‘s Rhododendron and Black Mulberry Seeds Treatment by

Low Temperature Plasma and Electromagnetic Field to Seed Germination and

Early Plant Development

V. Aleknavičiūtė1, V. Mildažienė2, G.Paužaitė2, A. Malakausikienė2, I. Filatova3, V.

Azharonok3, Veronika Lyushkevich3

1Vytautas Magnus University, 2 VMU Kaunas botanical garden, 3 Stepanov Institute of Physics of National Academy of

Sciences of Belarus

E-mail vesta.aleknavičiūtė@fc.vdu.lt

Abstract

The effects of short term pre-sowing seed treatment by radio frequency electromagnetic field and

cold plasma on two perennial woody plant species Smirnov‘s rhododendron (Rhododendron

Smirnowii Trautv., RS) and black mulberry (Morus nigra L., MN) were estimated in this study. It is

reported more substantial changes induced by pre-sowing seed treatment by physical stressors in

perennial plant germination and plant development than it was reported previously for annual

plants. The effects of stressors were species dependent – vacuum and electromagnetic field

stimulated germination of freshly harvested seeds of RS, but negatively affected germination of

fresh MN seeds; the response to cold plasma treatment was negative for RS, and positive for MN

seeds. The changes induced by treatments in germination dynamics and yield were critically

dependend on seed dormancy state: the same treatments induced positive effects in freshly

harvested but negative effects – in after-ripened seeds. Longer term observations revealed that

initially noticed effects persisted for more than one year, however shift from negative effects on

germination to positive effects on plant morphometric traits took place over time. Some effects,

characterised as distressful by changes in germination and seedling length after 13 months resulted

in remarkable increase in RS growth: induced stem and root branching, increased leave number and

surface area . These findings imply that such commonly used estimates for stressor effects as

germination rate or seedling morphology not always can be regarded as sufficient parameters for

qualifying the response to stressors (eustress or distress). At least for the perennial plants much

longer observations are strongly recommended.

Keywords: cold plasma, electromagnetic field, Rhododendron Smirnowii, Morus nigra, perennials

plants, germination.

ISSN 2335-8653

141

Ligninolytic Activity Of White Rot Fungi And Their Efficiency In

Bioremediation

Jurgita Mikašauskaitė1, Nicola Tiso1, Mantas Stankevičius1, Vilija Snieškienė2, Antanina

Stankevičienė2, Emanuella Galli4, Chiara Polcaro4, Audrius Sigitas Maruška1

1Department of biochemistry and biotechnologies, Vytautas Magnus University, Vileikos 8, LT-44404,

Kaunas, Lithuania 2Kaunas Botanical Garden, Vytautas Magnus University, Z. E. Zilibero st. 6, Kaunas LT-46324

Kaunas, Lithuania 4National Research Council (CNR), Istitute of Agroenvironmental and Forestal Biology (IBAF) & Institute of Chemical

Methodologies (IMC), Area della Ricerca di Roma, Via Salaria Km 29,300, 00015, Monterotondo (Roma), Italy

Abstract

Wooden railway sleepers impregnated with creosote or coal tar are protected from wood-

degrading microorganisms. Coal tars and creosote are complex and variable mixtures of polycyclic

aromatic hydrocarbons (PAH), phenols and heterocyclic compounds.

Bioremediation using various microorganisms is one of the ways to remove PAHs from the

environment. There are three known different pathways of microbial degradation; the basis of these

mechanisms is the oxidation of the aromatic ring. PAH-degrading microorganisms are divided in

three groups: bacteria, non-ligninolytic fungi and ligninolytic fungi. Ligninolytic fungi like

Pleurotus ostreatus, Irpex lacteus, Pleurotus eryngii or others, produce extracellular enzymes with

very low substance specifity. This is supposed to be advantageous for the degradation of PAHs.

Ligninolytic system of white rot basidiomycetes consists of a pool of enzymes, namely laccases,

lignin peroxidase, versatile peroxidase, cellobiose dehydrogenase, H2O2-producing enzymes and

reactive oxygen species produced by such enzymes.

The aim of this research consists in the determination of fungi ligninolytic activity and the

determination of the efficiency of different fungal species for the degradation of PAH.

Five different species of fungi (Pleurotus ostreatus SMR 684, Pleurotus eryngii VMU001,

Bjerkandera adusta VMU004, Irpex lacteus VMU003 and Schizophyllum commune VMU002)

demonstrate degradation activity of different concentrations of treated railway sleepers.

Composition of coal tar in railway wooden sleepers was determined using GC-MS and GC-FID.

Acknowledgement: This project is financed by EUSFA, grant No VP1-3.1-ŠMM-10-V-02-010

(BIOREM).

Keywords: mycoremediation, ligninolytic activity, GC-FID, white rot fungi

ISSN 2335-8653

142

Development and evaluation of ligninolytic fungal consortia for the

bioremediation of wooden railway crossties.

N. Tiso1, J. Mikašauskaitė1, V. Snieškienė2, A. Stankevičienė2, M.Stankevičius1, E. Galli4,

C.Polcaro4, E.Donati4, A. Maruška1

1Department of biochemistry and biotechnologies, Vytautas Magnus University, Vileikos 8, LT-44404,

Kaunas, Lithuania 2Kaunas Botanical Garden, Vytautas Magnus University, Z. E. Zilibero st. 6, Kaunas LT-46324

Kaunas, Lithuania 4National Research Council (CNR), Istitute of Agroenvironmental and Forestal Biology (IBAF) & Institute of

Chemical Methodologies (IMC), Area della Ricerca di Roma, Via Salaria Km 29,300, 00015, Monterotondo

(Roma), Italy

Creosote is widely used as wood preservative due to its efficient properties as biocide, and it is a

complex mixture of several hundreds chemicals obtained from distillation of hard coal tar mainly

composed by aromatic hydrocarbons, including polycyclic aromatic hydrocarbons (PAHs) and

alkylated PAHs (which can constitute up to 90% of it).

The aim of this research is to investigate the potential of selected basidiomycetes and ascomycetes,

in particular white-rot fungi for the bioremediation of creosote in expended wood crossties and to

develop fungal consortia with faster biomass growth rate and/or able to enhance the production of

ligninolytic enzymes in order to increase the efficiency of the mycoremediation process.

Fungal species, previously selected for their resistance to different pollutant concentrations, have

been further investigated to assess their ability to produce ligninolytic enzymes, such as laccase

(E.C. 1.10.3.2), lignin peroxidase (E.C. 1.11.1.14), manganese dependent peroxidase (E.C.

1.11.1.13), as a parameter to determine their potential for mycoremediation.

36 different dual co-culture consortia were investigated to evaluate their ability to improve the

bioremediation effectiveness. Composition of creosote in railway wood sleepers and coal tar

samples was estimated by GC-MS, GC-FID, HPLC, UPLC, while enzymatic activity was

determined by qualitative enzymatic assay in vitro and UV-visible spectroscopy.

Acknowledgement: This project is financed by EUSFA, grant No VP1-3.1-ŠMM-10-V-02-010

(BIOREM).

Keywords: white-rot fungi, fungal consortium, bioremediation, creosote, railway crossties,

ligninolytic enzymes.

ISSN 2335-8653

143

Phytochemical Analysis Of Grindelia Robusta Nutt. Depending On Phenologic

Stades

Clémentine M. Fayol1,2,3, Audrius Maruska2, Ona Ragazinskiene3,

1Angers's University, Institute of Technology (IUT), 4 bld Lavoisier - 49000 Angers, France, 2Sector of Medicinal

Plants, Kaunas Botanical Garden of Vytautas Magnus University, Z.E. Zilibero str. 6, LT- 46324 Kaunas, Lithuania, 3Department of Biology, Vytautas Magnus University, Vileikos str. 8, LT-44404, Kaunas, Lithuania.

clementine.fayol@etud.univ-angers.fr

Abstract

Grindelia robusta Nutt. Is a perennial plant native from western part of North America. It has been

used as a medicinal plant by native american people against cough, asthma and pneumonia. It has

got anti-inflammatory, antimicrobial and antioxidant activities thanks to its phenolic and flavonoid

composition. The aim of this study is to analyse the composition in active principles of G. robusta

depending on its phenologic stades to optimize the harvest period in order to improve the quality of

the row material. Grindelia robusta was collected at four different phenologic stades (bud,

beginning of blooming, massive blooming and end of blooming) and air-dried at “Les quatre

saisons” farm in Chemillé (France). The extracts were analysed with spectrophotometric methods.

References

[1] SLAWOMIRA N. et RYCHLI I., 2012. Phenolic acids in the flowers and leaves of grindelia robusta nutt. and

grindelia squarrosa dun.(asteraceae). Acta Poloniae Pharmaceutica - Drug Research 69 n°4, 693-698.

[2] FERRERES F., GROSSO C., GIL-IZQUIERDOA A., VALENTÃO P., AZEVEDO C., ANDRADE P.B., 2014.

HPLC-DAD-ESI/MSn analysis of phenolic compounds for quality control of Grindelia robusta. Journal of

Pharmaceutical and Biomedical Analysis 94, 163–172.

[3] Grindelia pour préparations hométopatiques. Pharmacopée française.

[4] LA V.D., LAZZARIN F., RICCI D., FRATERNALE D., GENOVESE S., EPIFANO F., GRENIER D., 2010.

Active principles of Grindelia robusta exert antiinflammatory properties in a macrophage model. Phytother Res. 24(11):

1687-92.

ISSN 2335-8653

144

Quantification and comparison of phenolic compounds in leaves of

different types of Solidago L. by thin-layer chromatography

Mindaugas Marksa1, Marius Auglys1, Jolita Radušienė2, Asta Kubilienė1, Liudas

Ivanauskas1

1Department of Analytical and Toxicological Chemistry, Lithuanian University of Health Sciences, Eivenių 4, 50161,

Kaunas, Lithuania

2Nature Research Centre, Institute of Botany, Akademijos 2, 08412 Vilnius, Lithuania

E-mail: mindaugas.m.lsmu@gmail.com

Introduction. Goldenrods have been traditionally used to treat inflammations of the urinary tract

[1]. Preparations from goldenrods have a well-defined diuretic, spasmolytic and hypotensive effect

together with anti-inflammatory, bacteriostatic and analgesic properties [1]. The aim of our study –

to determine and comparison the amounts of phenolic compounds in leaves of different types of

Solidago L. by thin-layer chromatography (TLC).

Materials and methods. Leafs of Solidago canadensis L., Solidago gigantea L. and Solidago

virgaurea L. were collected in different places of Lithuania and dried at 25 °C.

Extraction. 0.5 g of air-dried S. canadensis, S. gigantea and S. virgaurea leafs were extracted with

10 mL of methanol water mixture (70:30 v/v) by ultra-sonication at 25 °C for 10 min. The prepared

extracts were passed through a 0.22 µm filter [2].

Thin-layer chromatography. TLC was performed on silica gel 60 UV254 glass plates. Samples were

applicated using CAMAG Linomat 5. 20.0 µL of every sample were sprayed over 10.0 mm band

length. As solvent systems were used anhydrous formic acid R, glacial acetic acid R, water R, ethyl

acetate R (7.5:7.5:17.5:67.5 V/V/V/V). Detection of the phenolic compounds was carried out by

spraying with a 10 g/L solution of diphenylboric acid aminoethyl ester R in methanol R and then

with a 50 g/L solution of macrogol 400 R in methanol R and observed using CAMAG TLC. Then

dried and visualizer under ultraviolet light (366 nm).

Results. In the present study, four phenolic compounds - chlorogenic acid, rutin, isoquercitrin and

quercitrin - were detected in the leaves of Solidago L. Lowest values of phenolic compounds except

rutin estimated in S. virgaurea. Highest values of rutin (4.862 ± 1.643 mg/g) showed in S.

canadensis, quercitrin (3.673 ± 1.178 mg/g), isoquercitrin (0.919 ± 0.642 mg/g) and chlorogenic

acid (38.847 ± 8.314 mg/g) – in S.gigantea. The content of isoquercitrin did not differ significantly

(at p˃0.05) in all species of Solidago L., while rutine did not differ significantly between S.

gigentea and S. virgaurea, quercitrin – between S. canadensis and S. virgaurea, chlorogenic acid –

between S. canadensis and S. gigantea.

Conclusions. The results of this study demonstrated that higher values of rutin was found in S.

canadensis and quercitrin, isoquercitrin and chlorogenic acid – in S. gigantea.

ISSN 2335-8653

145

The Effect of UV-B Exposure in Spinach Plants: Study of Nitrate and Ascorbic

Acid Accumulation

Justina Kiseliauskaitė1,2, *, Sandra Sakalauskienė1, Pavelas Duchovskis1

1Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kaunas str. 30, LT-54333, Babtai,

Kaunas distr., Lithuania, 2Vytautas Magnus University, Department of Biology, Vileikos str. 8, LT-44404, Kaunas,

Lithuania

*E-mail address: justinakiseliauskaite@gmail.com

Abstract

Spinach (Spinacia oleracea L.) has a high nutritional value. Nevertheless, leaves accumulate large

amount of nitrate. UV-B radiation exists in natural environment and has a significant impact on

physiology and nutrition of plants. It is important to identify if UV-B light effect can enrich the

nutritional quality of spinach. The aim of this study was to evaluate the impact of supplemental UV-

B of different concentrations and duration of exposure of nitrate and ascorbic acid in Spinach plants

using ‘Andromeda H’ and ‘Matador’. The experiment was conducted on controlled environment at

the Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry. Plants were

placed in different growth chambers at 18/13 °C day/night temperature and 12h photoperiod. High-

pressure sodium lamps were used for illumination (150 μmol m-2 s-1). UV-B radiation (290 – 320

nm) was provided by UV-B fluorescent tubes. Spinach plants were exposed to 0 kJm-2 day-1, 1 kJm-

2 day-1 and 2 kJm-2 day-1, UV-B for 1 or 2 days. ‘Matador’ plants exposed to 1 kJ UV-B dose after 1

day exposure accumulated a larger amount of nitrate. Nevertheless, ascorbic acid content was lower

in these conditions. After 1 kJ and 2 kJ UV-B exposure ‘Andromeda H’ plants showed significantly

larger reduction of nitrate meaning larger amount of ascorbic acid in the leaves. After 2 days

exposure UV-B radiation dose the amount of nitrate increased in ‘Andromeda H’ plants. ,Matador’

showed significant decrease in nitrate content only in 2 day with 2 kJ UV-B radiation dosage

treatment as well as increased amount of ascorbic acid. The results showed that the effect of UV-B

radiation on nitrate and ascorbic acid in spinach leaves depended on spinach species, UV-B dose

and duration of exposure. It is determined that 1 day UV-B exposure in ‘Andromeda’ and 2 days in

‘Matador’ plants have reduced nitrate and increased ascorbic acid which mean supplemental UV-B

light have a positive effect on nutrition of spinach.

Keywords: nitrate, ascorbic acid, UV-B, spinach plants

ISSN 2335-8653

146

Effect of Chitosan on Fruit Storage of Red Kiwifruit Actinidia melanandra

Laima Česonienė1, Remigijus Daubaras1, Daiva Leskauskaitė2, Donata Zabulionė2, Murat Kaya3

1Kaunas Botanical Garden of Vytautas Magnus University, Ž.E. Žilibero 6, LT-46324, Kaunas, Lithuania,

l.cesoniene@bs.vdu.lt, 2Department of Food Science and Technology, Kaunas University of Technology, Radvilėnų pl.

19, LT-50254, Kaunas, Lithuania, 3Aksaray University, 68100, Aksaray, Turkey

Abstract The species A. melanandra Franch. (red kiwifruit) is an attractive dioeciuos climbing plant which

produces reddish green large grape-like berries that are sweeter and more intensely flavored than the

fuzzy kiwi. Commercial production of Actinidia melanandra has been unsuccessful because of short

shelf life of its berries.

The aim of this study was to investigate the effects of chitosan coating on weight loss and firmness as

well as soluble solids, total polyphenols, and ascorbic acid contents of red kiwifruit A. melanandra.

Chitosan used in this study was obtained from Daphnia longispina ephippia.

After 26 days, ascorbic acid content of chitosan coated samples was recorded as 105.9±11.9 mg/100 g

while ascorbic acid content of uncoated samples was observed as 83.6±16.8 mg/100 g. These results

corroborate significant impact of chitosan coating on preservation of ascorbic acid in A. melanandra

fruits during storage. Chitosan coated berries contained on average 102.9±9.04 mg/100 g of total

polyphenols meanwhile uncoated berries were distinguish by significantly lower amount of total

phenolics (60.6±4.62 mg/100g) at the end of storage. Consequently, chitosan coated samples kept higher

antioxidant activity than uncoated samples during the long-lasting storage process.

Changes of soluble solids amounts revealed that chitosan coated samples had slower decomposition

than uncoated samples. It was observed that firmness values of not coated red kiwifruit started to decline

after the first days of storage meanwhile statistically reliable changes of this parameter were did not

detected during the period from 7 to 14 day.

Subsequently, we concluded that chitosan coating can be used to extend the shelf life of red kiwifruit

berries and preserve their value for longer time.

Keywords: red kiwifruit, chitosan, coating, storage.