Plant Physiology and Biochemistry 161 (2021) 166–175

Available online 16 February 20210981-9428/© 2021 Elsevier Masson SAS. All rights reserved.

Research article

A vital role of chitosan nanoparticles in improvisation the drought stress tolerance in Catharanthus roseus (L.) through biochemical and gene expression modulation

E.F. Ali a,b,*, A.M. El-Shehawi c,d, O.H.M. Ibrahim b, E.Y. Abdul-Hafeez b, M.M. Moussa e, F.A. S. Hassan a,f

a Department of Biology, College of Science, Taif University, P.O. Box 11099, Taif, 21944, Saudi Arabia b Department of Horticulture (Floriculture), Faculty of Agriculture, Assuit University, Egypt c Department of Biotechnology, College of Science, Taif University, Saudi Arabia d Department of Genetics, Faculty of Agriculture, Alexandria University, Alexandria, 21527, Egypt e Department of Horticulture, Faculty of Agriculture, Menoufia University, Egypt f Department of Horticulture, Faculty of Agriculture, Tanta University, Egypt

A R T I C L E I N F O

Keywords: Alkaloids Antioxidant enzymes Drought Gene expression Lipid peroxidation Proline

A B S T R A C T

Drought is a main abiotic stress that restricts plant growth and development. The increased global demand of anti-cancer alkaloids extracted from periwinkle (Catharanthus roseus) is mainly related to plant growth and development, which are severely affected by drought. Chitosan nanoparticles (CSNPs) have been used to boost plant growth and defense mechanism, however their impact to alleviate drought stress of C. roseus has not been investigated yet. In this study, control and stressed plants (100 and 50% of field capacity [FC], respectively) were subjected to CSNPs application at 1%. Drought stress considerably reduced plant growth, relative water content (RWC), stomatal conductance and total chlorophyll; however, CSNPs mitigated these effects. They enhanced proline accumulation and the activity of catalase (CAT) and ascorbate peroxidase (APX) with possible mitigation of drought-induced oxidative stress. Therefore, they reduced H2O2 and malondialdehyde (MDA) accumulation, and eventually preserved membrane integrity. Drought stress increased alkaloid accumulation, and further in-crease was observed with the application of CSNPs. High alkaloid content was associated with induced gene expression of strictosidine synthase (STR), deacetylvindoline-4-O-acetyltransferase (DAT), peroxidase 1 (PRX1) and geissoschizine synthase (GS) up to 5.6 folds under drought stress, but more accumulation was noticed with the application of CSNPs. Overall, this study is the first on using CSNPs to mitigate drought stress of C. roseus by inducing the antioxidant potential and gene expression of alkaloid biosynthesis.

1. Introduction

As an abiotic stress, drought inhibits plant growth, development and productivity (Ali and Hassan, 2017). Global warming has led to limited water resources that ultimately affected agriculture (Zolin and Rodri-gues, 2015) due to drought stress (Mirajkar et al., 2019). Drought affects the physiological and biochemical processes, and led to loss of cell turgidity (Hassan et al., 2018) and ROS production that induce oxidative stress and lipid peroxidation (Talaat et al., 2015). To mitigate the deleterious effects of water stress, plants adapt various physiochemical mechanisms such as the accumulation of compatible solutes for osmotic adjustments that maintain cell turgidity (Marcinska et al., 2013). Among

these solutes is proline that allows the plant to retain low water potential and consequently enhances the compatible osmolytes that could buffer the instant effects of drought (Hassan et al., 2018).

The induction of antioxidant enzymes is another important mecha-nism required for ROS scavenging to mitigate drought stress (Mirajkar et al., 2019) and other abiotic stresses (Fatima et al., 2015; Attia et al., 2020; Hassan et al., 2020). The correlation between drought tolerance and the activity of antioxidant enzymes has been reported in C. roseus (Liu et al., 2017). The accumulation of secondary metabolites in me-dicinal plants has a physiological importance to alleviate drought stress (Jaleel et al., 2008; Hassan et al., 2013).

Although drought stress empowers the antioxidant machinery,

* Corresponding author. Department of Biology, College of Science, Taif University, P.O. Box 11099, Taif, 21944, Saudi Arabia. E-mail address: a.esmat@tu.edu.sa (E.F. Ali).

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy

https://doi.org/10.1016/j.plaphy.2021.02.008 Received 14 December 2020; Accepted 8 February 2021

Plant Physiology and Biochemistry 161 (2021) 166–175

167

which is insufficient to protect the plant under severe drought; therefore exogenous application of some products is required to enhance plant’s drought tolerance (Ali and Hassan, 2017; Hassan et al., 2018). Some of these products are amino acids (Hassan et al., 2013), silicon (Ali and Hassan, 2017) and polyamines (Hassan et al., 2018). Calcium chloride and ketoconazole have been also used to improve drought tolerance in C. roseus (Jaleel et al., 2007a, b). Enhancing drought stress tolerance using eco-friendly materials has much attention, particularly in medic-inal plants. Chitosan (CS) is a natural cationic polysaccharide (poly β- (1, 4)-N-acetyl-D-glucosamine) that has a consequential interest as a bio-stimulant to improve plant growth and productivity (Pichyangkura and Chadchawan, 2015). It was extracted from chitin, which has non-allergenic, non-toxic, biocompatible and biodegradable properties and has found to improve plant tolerance (Malerba and Cerana, 2016). As a bioactive material, chitosan has shown immense benefits on plant growth and productivity (Aranaz et al., 2018) due to its antioxidant activity, which is very important to encounter the oxidative damages caused by environmental stresses (Hidangmayum et al., 2019) such as drought (Bistgani et al., 2017; Li et al., 2017; Pirbalouti et al., 2017). Previous findings showed the simulative effect of CS on the biosynthesis of secondary metabolites in different medicinal plants; including alka-loids in C. roseus (Pliankong et al., 2018). High level of terpenoid indole alkaloids (TIAs) was correlated with the up-regulation of key genes involved in their biosynthesis including strictosidine synthase (STR), deacetylvindoline-4-O-acetyltransferase (DAT), peroxidase 1 (PRX1) and geissoschizine synthase (GS). Induction of TIAs biosynthesis genes was associated with stressful conditions and the accumulation of TIAs in C. roseus (Khataee et al., 2019).

Nanoparticles (NPs) have been used in agricultural and biological sector to enhance plant productivity (Hassan et al., 2014; Song et al., 2016; Tokatlı and Demirdoven, 2020). The small size and wide surface area of CSNPs make them more effective than bulk CS (Divya and Jisha, 2018). To date, there are actually very limited numbers of reports on using CS and CSNPs to alleviate abiotic stress. Tolerance of sugarcane to drought stress has been improved using CSNPs (Mirajkar et al., 2019; Silveira et al., 2019). Little information has been found about molecular changes in C. roseus grown under drought conditions; however the role of CSNPs on alkaloid biosynthesis genes has not been yet investigated.

Periwinkle (Catharanthus roseus, L. Don.), family Apocynaceae, is an important medicinal plant that contains alkaloids known for their anticancer effect (Han et al., 2013). They have been used in chemo-therapy treatments of leukaemia and Hodgkin’s diseases (Sreevalli et al., 2004). Periwinkle is also used for diabetes, cough and wasp stings, as well as a diuretic component (Nammi et al., 2003). Due to its medicinal importance, there is a high global demand on C. roseus alkaloids (Kar-thikeyan et al., 2007); however, plant is severely affected by drought stress (Liu et al., 2017). To date, no findings have been reported on using CSNPs to alleviate drought stress of C. roseus, and hence the aim of this study is to investigate the possible physiological, biochemical and mo-lecular roles of CSNPs on drought stress tolerance of C. roseus.

2. Materials and methods

2.1. Experimental site and cultivation

This study was carried out under greenhouse conditions (25 ± 1 ◦C and 62.62 ± 5% RH) at the Faculty of Science, Taif University, Taif (21◦26′02.4′′N, 40◦29′36.9′′E), Saudi Arabia during the 2019 and 2020 seasons. Mature seeds of C. roseus were sterilized with HgCl2 solution (0.2%) for 10 min and then washed with distilled water. Seeds were sown in plastic trays (30 × 70 cm) containing peat moss at the first of September of both seasons. After one month, seedlings with similar viability and height were transplanted into 20 × 25 cm plastic pots containing sandy soil (69.34% sand, 12.24% silt and 18.42% clay, 0.23% N+, 0.039% PO4

3− , 0.054% K+, 39.82 meqL− 1 Ca2þ, pH = 7.79, and EC = 1.88 dSm− 1).

2.2. Treatments

After two weeks, transplanted seedlings were subjected to the following treatments: 100% of FC (control plants); 50% of FC (stressed plants); 100% of FC + foliar application of CSNPs (1%); and 50% of FC + foliar application of CSNPs (1%). Treatments were arranged in a complete randomized design (CRD) with 4 replicates each. All pots were daily weighed and the amount of lost water was compensated to maintain soil water content at the specific FC, according to (Beadle et al., 1985) and (Hassan et al., 2013). The CSNPs were prepared according to the method of Fan et al. (2012), based on the ionic gelation of CS with tripolyphosphate (TPP) anions. Medium molecular weight of CS (80% deacetylation, Sigma Aldrich) was used for preparing CSNPs by dis-solving CS sample (1 g) in 100 mL acetic acid (1%) to prepare 10 mg mL− 1 solution. This solution was stirred at 60 ◦C for 30 min, and then stirring was continued overnight at room temperature for CS dissolution. The pH was adjusted to 4.8 using NaOH (1.0 M). To obtain a uniform emulsion, 400 mL of Tween-80 was added to the solution and centri-fuged at 10,000 g for 10 min. Using a magnetic stirrer at room tem-perature, Na-TPP aqueous solution (0.75 mg mL− 1) was gradually added to the CS solution, and then the solution was re-centrifuged at 10,000 g for 35 min to collect the supernatant of CSNPs that was later preserved at 4 ◦C until application. Foliar spray with CSNPs was first applied after 15 days of transplanting, and repeated every 2 weeks until flowering. The four treatments were arranged in a complete randomized design (CRD) and each treatment had 4 replicates.

2.3. Growth and yield

By the beginning of flowering stage, plant height (cm), main branch number/plant, and the fresh weight (FW) and dry weight (DW) of both shoot and root (g) were evaluated, as indication of plant growth and herb yield.

2.4. Relative water content (RWC)

Leaf RWC was measured according to Weatherley (1950) using the following formula: (Wfresh – Wdry)/(Wturgid – Wdry) × 100, where Wfresh is sample FW, Wturgid is the sample turgid weight after saturation in distilled water at 4 ◦C for 24 h, and Wdry is the dry weight after oven discation at 70 ◦C for 48 h.

2.5. Stomatal conductance

Leaf porometer (Delta T AP4, UK) was used to evaluate the stomatal conductance, and the values were presented as mol H2O m− 2s− 1.

2.6. Determination of total alkaloids

The content of total alkaloids was evaluated according to Uniyal el al. (2001). Fresh plant samples were collected and oven-dried at 60 ◦C for 48 h, and then ground until fine powder. A sample of 5 g was mixed with 30 mL ethanol (90%) and left overnight then filtered. The residue was extracted again using 90% ethanol at room temperature, and the extract was filtered and concentrated in vacuum at 40 ◦C. The dried residue was then dissolved in 10 mL ethanol, diluted with 10 mL distilled water and acidified using 10 mL hydrochloric acid (3%). The mixture was extracted by hexane, and the extract was discarded, but the aqueous portion was cooled to 10 ◦C, and the pH of the mixture was adjusted to 8.5 using 3% ammonium hydroxide. The aqueous portion was then re-dissolved in chloroform (1 mL) and passed through a silica cartridge (Sep-Pak, Waters) initially saturated with chloroform. After-wards, the aqueous solution was washed using 5 mL of a mixture con-sisted of chloroform: methanol (9:1, v/v), dried over anhydrous sodium sulphate and evaporated until complete dryness. The residue was dried to a constant weight to determine the content of total alkaloids that was

E.F. Ali et al.

Plant Physiology and Biochemistry 161 (2021) 166–175

168

recorded as mg g− 1 DW.

2.7. Chlorophyll assessment

The method of Metzner et al. (1965) was used for the assessment of total chlorophyll. Acetone solvent (80%) was used for chlorophyll extraction from leaf samples (0.02 g). The centrifugation of the extract was performed at 15,000 g for 10 min, and the extract was evaluated using a spectrophotometer (Pharmacia, LKB-Novaspec II) at 663 and 644 nm, and the amount of chlorophyll a and b was calculated using the following equations:

Chlorophyll a (μg mL− 1) = 10.3 E663 - 0.918 E644

Chlorophyll b (μg mL− 1) = 19.3 E644 - 3.87 E663

Both values were combined to calculate total chlorophyll expressed as mg g− 1 FW.

2.8. Lipid peroxidation assessment

To assess lipid peroxidation, malondialdehyde (MDA) was evaluated according to Hodges et al. (1999). Homogenization of fresh leaf sample (0.2 g) was performed using 2 mL trichloroacetic acid (0.1%), and then solution was centrifuged at 14,000 g for 15 min. A sample of 2 mL of the collected supernatant was mixed with tri-chloroacetic acid (5%) and 3 mL of thiobarbituric acid (0.5%) for 30 min in water bath (95 ◦C), and the reaction was stopped thereafter using ice. Centrifugation of the mixture was then conducted at 5000 g for 15 min. The supernatant was finally evaluated using a spectrophotometer (Pharmacia, LKB-Novaspec II) at 450, 532 and 600 nm, and 1,1,3,3-tetraethoxy propane (TEP) was used as a standard. The MDA content (μmol mL− 1) was measured using the following equation:

MDA content = 6.45 × (A532 - A600) - 0.56 × A450.

2.9. H2O2 production

The production of H2O2 in leaf was estimated according to Patterson et al. (1984). Briefly, a leaf sample (0.5 g) was homogenized in 6 mL chilled acetone (100%), and then cooled-centrifuged (4 ◦C) at 12,000 g for 10 min. One mL of the extract was added to 0.1 mL Ti(SO4)2 (5%) and 0.2 mL of NH4OH, and then centrifuged for 10 min at 3000 g. Four mL of H2SO4 (2M) was then used to dissolve the remained pellets. The solution optical density was evaluated using a spectrophotometer (Pharmacia, LKB-Novaspec II) at 412 nm. Several H2O2 levels were used to perform a standard curve for calibration and results were recorded as μmol g− 1

FW.

2.10. Membrane stability index (MSI)

This was performed according to Sairam et al. (1997). Two leaf samples of 0.2 g each were placed in two different flasks (50 mL) con-taining deionized water (20 mL). One flask was kept at 40 ◦C for 30 min and the second one was kept in water bath (100 ◦C) for 15 min. The conductivity of both samples (C1 and C2) was then measured by a con-ductivity meter and ions leakage was used to calculate MSI, as follows: MSI = [1- (C1/C2)] × 100.

2.11. Proline investigation

The methodology of Bates et al. (1973) was used to determine free proline. Frozen leaf tissue (0.5 g) was homogenized in 10 mL sulfosali-cylic acid (3%) at 4 ◦C., and the extract was filtered using Whatman No. 2. Two mL of the filtrated material was mixed with acid-ninhydrin (2

mL) and glacial acetic acid (2 mL) in a test tube and then incubated at 100 ◦C for 1 h. The reaction was ended using ice, and the mixture was extracted by toluene (4 mL). The solution was then evaluated using a spectrophotometer (Pharmacia, LKB-Novaspec II)) at 520 nm using toluene as the blank. The concentration of proline was calculated based on the calculated standard curve and expressed as μmol g− 1 FW. A commercial pure proline was used as a standard to performe a calibra-tion curve.

2.12. Antioxidant enzymes

The activity of catalase (CAT, EC 1.11.1.6) was determined accord-ing to Clairbone (1985). Briefly, the enzyme extract was added to 0.4 mL H2O2 (15 mM), and then mixed with 2.6 mL KPO4 buffer (pH 7.0). The absorbance reduction was estimated using a spectrophotometer (Phar-macia, LKB-Novaspec II) at 240 nm to express the decomposition of H2O2. Standards of H2O2 ranged between 2 and 10 μM were preceded as a test with blank containing reagent only. The activity of CAT enzyme was measured as U mg− 1 protein where U = the decline of H2O2 by 1 mM min− 1 mg− 1 protein.

The activity of ascorbate peroxidase (APX, EC 1.11.1.11) was assayed using the method of Nakano and Asada (1981). Briefly, fresh leaf sample (0.1 g) was homogenized in 0.2 mL of the following extraction buffer (1% PVP, 0.1 M Na-phosphate, pH 7, 1% Triton X 100, 3 mM EDTA), and then centrifuged at 10,000 g for 20 min. Each 1 mL of the reaction buffer contained 0.5 mM ascorbate, 0.1 mM H2O2, 0.1 mM EDTA and 0.05 mL of the extract that contains the enzyme, and the reaction was conducted at 25 ◦C for 5 min. The absorbance coefficient (2.8 mM− 1 cm− 1) was used for APX activity calculation. The activity of APX was determined using a spectrophotometer (Pharmacia, LKB-Novaspec II) by following the absorbance decline at 290 nm. The required amount for the decomposition of 1.0 μ mol ascorbate min− 1 has expressed one unit of APX.

2.13. RNA isolation

Leaves were collected at the flowering stage, and directly frozen on ice, lyophilized at − 58 ◦C for 48 h, ground to fine powder in a coffee grinder, and stored at − 20 ◦C or directly used for RNA isolation. Five mg of lyophilized ground leaves were used for total RNA purification using QIAzol (Qiagen, Hilden, Germany), as previously described (Elseehy and El-Shehawi, 2020). Briefly, 1 mL of QIAzol was added to a micro-centrifuge tube containing 5 mg leaf powder, mixed thoroughly and incubated at room temperature for 5 min. Chloroform (0.2 mL) was then added to the powder with vigorous shake, and solution was kept at room temperature for 3 min. Samples were afterwards cooled-centrifuged (4 ◦C) at 12,000 g or 15 min. The top aqueous phase was transferred to new tube, and mixed with isopropanol (0.5 mL), and samples were kept at room temperature for 10 min to precipitate RNA. RNA was recovered by cold centrifugation (4 ◦C) at 12,000 g for 10 min, and RNA pellets were washed with 70% ethanol, air dried, and dissolved in DEPC water. The concentration of RNA samples were estimated by measuring the absorbance at A260, and their quality was checked by the ratio of A260/A280.

2.14. Quantitative PCR analysis

The source of information and the nucleotide sequence of PCR primers used in this study are summarized in Table 1 (Macrogen com-pany, https://dna.macrogen.com). First strand of cDNA was synthesized using ImProm-II reverse transcription system (Promega, Madison, Wis-consin, USA) in 20 μL reaction solution containing total RNA (1 μg), random hexmer (0.5 μg), 1X ImProm-II reaction buffer, MgCl2 (8 mM), dNTPs (0.5 mM), ImProm-II reverse transcriptase (1 μL). Real time PCR was conducted using GoTaq qPCR master mix system (Promega, Madi-son, Wisconsin, USA) in 20 μL reaction solution containing 1X GoTaq

E.F. Ali et al.

Plant Physiology and Biochemistry 161 (2021) 166–175

169

qPCR master mix, forward and reverse primer (250 nM) and cDNA in C1000 Thermal Cycler (1 μL) (BioRad, California, USA). The targeted DNA sequence was amplified using the following conditions; 95 ◦C for 2 min, 40 cycles at 95 ◦C for 15 s and 60 ◦C for 1 min. The expression of STR, DAT, PRX1 and GS genes was investigated. The gene expression level was normalized to actin mRNA level and was estimated by the 2− ΔΔCt method (Livak and Schmittgen, 2001; Shukry et al., 2020).

2.15. Statistical analysis

The results of both seasons were pooled and then the combined analysis was conducted. The SPSS program (13.3 versions) was used for performing ANOVA test, and means were separated using Duncan multiple range test (DMRT) (Heinisch, 1962) at P ≤ 0.05. Values were presented as means ± SE (n = 8), except the gene expression (n = 3).

3. Results

3.1. Growth and yield characters

Drought stress significantly (p ≤ 0.05) diminished plant height, branch number, and the fresh and dry weights of both shoots and roots in comparison to well-watered plants. Contrary, these parameters were considerably improved with the application of CSNPs (Table 2). The plant height of stressed plants has decreased by about 42.69%, compared to well-watered plants, while it was decreased only by 5.68% with the application of CSNPs. In addition, the dry weight of both shoot and root has decreased by 36.93 and 41.88%; however, the reduction was only 13.12 and 1.71%, respectively with CSNPs application compared to well-watered plants.

3.2. Relative water content (RWC)

A significant reduction in RWC was observed in drought-stressed plants, but CSNPs application improved RWC of both stressed and non-stressed plants, but the difference was only significant at 50% FC in comparison to the control (Fig. 1 A).

3.3. Stomatal conductance

The stomatal conductance has significantly decreased at 50% FC,

Table 1 Nucleotide sequence of primers used in this study.

Primer Name 5′nucleotide sequence3′ Reference

PRX1-F TCACTTCTGACCAAGATTTGTA Khataee et al. (2019) PRX1-R CTTGATTCCCCGTTAACAC STR-F GGTTCTACACTTCCGTCCA STR-R CAATGGTCTTTTCTCTGGATC DAT-F CCAAGCTATTAATTTACGTCC DAT-R CTTTCCTTAGCTCATTAATCACT GS-F GTGAACGGGATGTGAAGAT GS-R TCTCTACTTTGCTGCCAACT CrActin-F GTTCCCAGGTATTGCAGATAGAA Moghazee et al. (2018) CrActin-R GCCTCCAATCCACACACTATAC

Table 2 Plant height, branch number, and fresh weight (FW) and dry weight (DW) of both shoots and roots of Catharanthus roseus in response to drought stress based on field capacity (FC) and chitosan nanoparticles (CSNPs) treatments. Data are means ± SE of two experiments (n = 8). Letters represent statistical differences among treatments at p ≤ 0.05.

Treatments Plant height (cm) Branch number Shoot Root

FW (g) DW (g) FW (g) DW (g)

100% FC 50.17b ± 2.42 5.76b ± 0.32 86.75b ± 0.89 9.45b ± 0.21 3.15b ± 0.04 1.17b ± 0.01 50% FC 28.75d ± 2.91 3.22c±0.27 52.17d ± 1.14 5.96c± 0.23 1.82c±0.03 0.68c±0.02 CSNPs +100% FC 54.21a±2.25 6.82a±0.38 93.78 a±0.96 11.13a± 0.17 3.78a±0.06 1.46a±0.03 CSNPs +50% FC 47.32c±2.02 5.68b ± 0.49 82.32c ±1.12 8.21c± 0.24 2.94b ± 0.04 1.15b ± 0.01

Fig. 1. Relative water content (A), stomatal conductance (B) and chlorophyll content () of Catharanthus roseus in response to drought stress based on field capacity (FC) and chitosan nanoparticles (CSNPs) treatments. Values are means ± SE of two experiments (n = 8). Letters represent statistical differences among treatments at p ≤ 0.05.

E.F. Ali et al.

Plant Physiology and Biochemistry 161 (2021) 166–175

170

compared to the control plants, but the application of CSNPs enhanced it with significantly higher values at 100% FC (Fig. 1 B).

3.4. Chlorophyll content

Drought stress has adversely affected leaf chlorophyll. Application of CSNPs significantly (p ≤ 0.05) enhanced leaf chlorophyll content either at 100 or 50% FC. The chlorophyll content in drought-stressed plants that foliarly sprayed with CSNPs was insignificant when compared to 100% FC (Fig. 1 C). In comparison to 100% FC, chlorophyll content of stressed plants has decreased by 43.24%, while it was decreased only by 2.70% when CSNPs was applied.

3.5. H2O2 production

The production of H2O2 was significantly higher (5.6 fold) in stressed plants compared with the non-stressed ones. This production was significantly reduced with the application of CSNPs at 50% FC, but insignificant at 100% FC (Fig. 2 A).

3.6. Malondialdehyde content (MDA)

The lipid peroxidation was considerably elevated under drought stress conditions, and therefore the MDA accumulation was significantly higher in stressed plants, but CSNPs-treated plants significantly pro-duced lower MDA values. The production of MDA in stressed or non- stressed plants that foliarly sprayed with CSNPs was insignificant when compared to the control (Fig. 2 B).

3.7. Membrane stability index (MSI)

Drought-stress plants showed a significant reduction in MSI; how-ever, CSNPs-treated plants significantly preserved the stability of cell membrane, and recorded higher MSI values (Fig. 2 C). In comparison to the control, the MSI was reduced by 24% under drought stress condi-tions; while when stressed-plants treated with CSNPs, this reduction was only 1%.

3.8. Proline

Proline accumulation has significantly increased under drought conditions in comparison to well-watered plants. The increase in proline content due to drought stress was about 2.96-fold higher than that recorded in non-stressed plants. Application of CSNPs has increased proline content in stressed plants with about 3.76-fold compared to the control (Fig. 3 A). On the other hand, application of CSNPs under non- stressful conditions did not show any significant increase in proline content.

3.9. CAT and APX enzyme activities

The activities of CAT and APX enzymes have significantly increased with drought conditions compared to well-watered plants, and further increase has noticed with CSNPs application. The highest activities of CAT and APX enzymes were recorded in stressed plants that foliar sprayed with CSNPs while the treatment of 100% FC resulted in the lowest enzyme activities (Fig. 3 B and C).

3.10. Total alkaloids content

The accumulation of alkaloids in leaves and roots has significantly elevated under drought stress conditions (50% FC) in comparison to 100% FC treatment. The treatment of CSNPs also accumulated higher total alkaloids in both leaves and roots. The positive impact of CSNPs application on alkaloid accumulation was more visible under drought stress treatment and therefore the highest alkaloid content in both leaves

and roots were detected in stressed plants that sprayed with CSNPs (Fig. 4 A and B).

3.11. Gene expression

The expression of the four key genes; STR, DAT, PRX1 and GS involved in the biosynthesis of terpenoid indole alkaloids (TIAs) was estimated using quantitative PCR. Gene expression in non-stressed plants was normal, but stressful conditions have significantly induced all four genes for up to more than three folds of the control group. Spraying non-stressed plants with CSNPs has induced all four genes beyond their expression level under stressful conditions (Fig. 5). The

Fig. 2. H2O2 production (A), malondialdehyde (B) and membrane stability index (C) of Catharanthus roseus in response to drought stress based on field capacity (FC) and chitosan nanoparticles (CSNPs) treatments. Values are means ± SE of two experiments (n = 8). Letters represent statistical differences among treatments at p ≤ 0.05.

E.F. Ali et al.

Plant Physiology and Biochemistry 161 (2021) 166–175

171

only exception was the GS gene that showed a little higher expression under stressful conditions (Fig. 5D). Applying CSNPs to stressed plants significantly induced gene expression of all four genes in comparison to their application to non-stressed plants and the control, showing the highest up-regulation of about 5.6 folds compared to the control (Fig. 5). The STR, DAT, PRX1 and GS genes were induced by 2, 2.3, 4.2; 2.8, 3.3, 5.2; 1.8, 2.4, 4.0; and 3.5, 2.9, 5.6 folds in the 50% FC, CSNPs +100% FC, CSNPs +50% FC treatments, in comparison to the 100% FC (Fig. 5A, B, C, D, respectively).

4. Discussion

Limited water resources in arid and semi-arid regions have drawn the attention to maximize the productivity per unit of water. The findings of this study indicated that drought stress reduced plant growth; yield at-tributes, RWC, chlorophyll content and stomatal conductance in com-parison to non-stressed plants. Liu et al. (2017) reported a reduction in RWC of stressed C. roseus. This might lead to reduced leaf turgor pres-sure, and retard cell development and hence restrict plant growth (Hassan et al., 2013). This reduction may be ascribed to a reduction in photosynthetic radiation absorption, which lessening the dry matter accumulation through osmoregulation process (Al-Yasi et al., 2020). Alteration of plant morphology including slower rates of leaf and stem growth has been observed under drought stress conditions as a strategy to avoid the adverse effects of drought stress (Hassan et al., 2018). Drought stress has been found to impair the process of chlorophyll synthesis, resulting in reduced photosynthesis activity (Hidangmayum et al., 2019). This may be ascribed to oxidative injury incurred on pig-ments, proteins and lipids of the chloroplast (Ali and Hassan, 2017). The reduction in chlorophyll content under drought conditions in this study might lead to reduced photosynthesis efficiency and overall plant weight. Drought stress negatively affects stem growth, leaf expansion, and stomatal conductance (Engelbrecht et al., 2007), and this is in consistence with the current results. Reduced stomatal conductance resulted in lower transpiration rates (Wilkinson and Davies, 2010; Manzoni et al., 2011), which enhanced plant tolerance to water stress (Díaz-Lopez et al., 2012).

Under such conditions, the application of CSNPs has been found to mitigate drought effects and improve C. roseus growth. This effect was associated with reduced stomatal conductance and improved stomatal conductance, RWC and chlorophyll content. Chitosan stimulated the

Fig. 3. Proline content (A) and enzyme activities of catalase (B) and ascorbate peroxidase (C) of Catharanthus roseus in response to drought stress based on field capacity (FC) and chitosan nanoparticles (CSNPs) treatments. Values are means ± SE of two experiments (n = 8). Letters represent statistical differences among treatments at p ≤ 0.05.

Fig. 4. Total alkaloid content in leaves (A) and roots (B) of Catharanthus roseus in response to drought stress based on field capacity (FC) and chitosan nano-particles (CSNPs) treatments. Values are means ± SE of two experiments (n =8). Letters represent statistical differences among treatments at p ≤ 0.05.

E.F. Ali et al.

Plant Physiology and Biochemistry 161 (2021) 166–175

172

signaling pathways of some plant hormones such as auxins and gib-berellins (Safikhan et al., 2018); therefore, regulated carbon and nitro-gen metabolisms improving plant growth (Zhang et al., 2017). It has been proved that CSNPs is more effective than bulk CS due to the small size and wide surface area (Divya and Jisha, 2018). Enhanced growth with CSNPs application could be related to the positive impact of chi-tosan water and nutrient uptake due to enhanced root growth and adjusted cell osmotic pressure (Guan et al., 2009). Results of the current study showed that CSNPs improved RWC under drought stress, and this is supporting the previous findings on wheat (Zeng and Luo, 2012). Increasing the chlorophyll content is another possible mechanism that CSNPs might enhance photosynthesis efficiency and growth rate (Mondal et al., 2012; Van et al., 2013). Improved RWC and total chlo-rophyll with CSNPs treatment promoted photosynthesis (Katiyar et al., 2015). Chitosan could enhance the chlorophyll content (Sharma et al., 2020), and therefore protects the chlorophyll under water deficit con-ditions (Farouk and Amany, 2012), which in accordance with the cur-rent results. The positive role of chitosan on C. roseus growth under drought conditions has been also reported on thyme (Bistgani et al., 2017) and sweet basil (Pirbalouti et al., 2017).

Interestingly, CSNPs treatment increased the stomatal conductance both stressed and non-stressed plants. In some species, CS induced sto-matal closure through the activation of ABA signaling pathway; whereas in some other species, CS resulted in higher stomatal conductance in stressed plants. This could be related to the sensitivity of the plant species to water stress (Veroneze-Júnior et al., 2020). Therefore, the effects of chitosan on stomatal regulation may be depends on species and the current species is suggested to be partially tolerant to 50% FC. Further, the effects of chitosan on stomatal response to CS might also depend on stress level (Iriti et al., 2009), as well as CS structure and concentration (Limpanavech et al., 2008; Kananont et al., 2010). The current results showed the positive role of CSNPs on RWC and vegetative growth of both stressed and non-stressed C. roseus, which may suggest a positive role of CSNPs on stomatal conductance, water uptake and photosynthesis rate. Qu et al. (2019) previously confirmed these effects.

The growth reduction of stressed plants may also be due to the excess production of ROS (H2O2), which caused lipids oxidative damage with increased MAD content and reduced MSI, which means membrane injury under drought conditions. Disruption of membrane integrity is often observed when plants are subjected to drought stress due to higher

accumulation of MDA and free radicals (Hidangmayum et al., 2019). It is known that ROS accumulation has a negative impact on protein and lipids causing membrane deterioration and led to cell death (Hassan and Fetouh, 2019; Attia et al., 2020). Moreover, MDA is known as an indi-cator of lipid peroxidation of oxidative-stressed plants grown under drought conditions (Talaat et al., 2015). In consistence with current results, higher accumulation of both ROS and MDA under drought resulted in membrane deterioration in several species (Jaleel et al., 2007b; Ali and Hassan, 2017; Hassan et al., 2018).

The application of CSNPs caused a considerable reduction in H2O2 and MDA production of drought-stressed C. roseus leaves. Therefore, it is suggested that CSNPs maintained the membrane integrity and functions with recorded high MSI content under drought. Chitosan can positively regulate the osmotic pressure and therefore eliminates the adverse ef-fects of drought stress (Hidangmayum et al., 2019). Application of CSNPs enhanced the growth and maintained the photosynthetic pig-ments; thereby it might improve the activity of ROS scavengers (Guan et al., 2009). The properties of CS as antioxidant have been attributed to its amino groups and abundant active hydroxyl groups, which may react with ROS to form relatively nontoxic macromolecular radicals (Xie et al., 2001). Similar to the current results, the stimulation of osmotic adjustment through the reduction of lipid peroxidation and improved membrane integrity has also been observed when drought-stressed thyme plants sprayed with CS (Bistgani et al., 2017).

The high accumulation of proline in C. roseus leaves may indicate the adjusting role of proline as an osmolyte produced under stressful con-ditions to reduce leaf osmotic potential and maintain cell turgidity (Ouzounidou et al., 2016). Therefore, increasing proline content is considered as an another adaptive mechanism of stressed plants (Ali and Hassan, 2017; Hassan et al., 2018). Proline has been suggested as ROS scavenger that protects tissues against oxidative injury (Kamiab et al., 2014; Attia et al., 2020). These results are in accordance with the report on damask rose that showed the accumulation of proline under drought (Al-Yasi et al., 2020). Consistently, the proline accumulation was increased under drought stress in C. roseus (Jaleel et al., 2007b; Liu et al., 2017). Despite no significant increase in proline content was observed in well watered plants due to CSNPs, a further increase was detected under drought stress. It has been reported that CS application enhanced proline content in drought-stressed clover plants (Li et al., 2017). Chitosan could be converted directly to other sugars and pyruvate, which is the

Fig. 5. Gene-relative expressions of STR (A), DAT (B), PRX1 (C) and GS (D), of Catharanthus roseus in response to drought stress based on field capacity (FC) and chitosan nanoparticles (CSNPs) treatments. Error bars indicate the standard deviations (n = 3). Different letters indicate significant differences at p ≤ 0.05.

E.F. Ali et al.

Plant Physiology and Biochemistry 161 (2021) 166–175

173

precursor of the tricarboxylic acid cycle and the biosynthesis of gluta-mate and other amino acids including proline (Geng et al., 2020). The enhanced proline level due to CSNPs application might be ascribed to the reduction in proline oxidation to glutamate, induction of proline biosynthesis, decrease in protein biosynthesis or increase in protein turnover (Hidangmayum et al., 2019). The induction in proline accu-mulation due to CSNPs could be related to the up-regulation of proline biosynthesis genes viz. c-glutamy1 kinase and glutamate-5-semi alde-hyde dehydrogenase, which are responsible for proline biosynthesis from glutamate (Chen et al., 2009). These results support the previous study on thyme that indicates a significant increase in proline content under drought (Bistgani et al., 2017). Contrary, the level of proline was not changed by chitosan treatment in Ricinus communis plants subjected to drought (Karimi et al., 2012). These different results suggest that the functionality of chitosan is dependent on species, molecular weight and deacetylation degree.

Enzymatic and non-enzymatic antioxidant components have vital roles in ROS scavenging mechanism inducing the plant resistance against several abiotic stresses (Hassan and Fetouh, 2019; Al-Yasi et al., 2020; Attia et al., 2020). The activity of CAT and APX enzymes in the current study has increased with stressful conditions, and further in-crease was noticed with the application of CSNPs. Enhancing antioxi-dant enzymes under drought stress has been reported in different species (Abedi and Pakniyat, 2010; Ali and Hassan, 2017; Hassan et al., 2018), including C. roseus (Jaleel et al., 2007; Jaleel et al., 2008).

The generation of H2O2 triggers the ROS scavenging system and the expression of other oxidative stress responsive genes (Desikan et al., 2001). It has been reorted that chitosan activated plant defense genes via the octadecanoid pathway (Doares et al., 1995) and induced octadeca-noid signaling components, 12-oxo-phytodieonic acid and jasmonic acid (Rakwal et al., 2002). Under stressful conditions, CS induced the accu-mulation of H2O2 (Lin et al., 2005) and up-regulated several plant de-fense enzymes in the ROS scavenging system (Kim et al., 2005). The activity of CAT and APX may be triggered due to CSNPs via the nitric oxide pathway (Zhang et al., 2011), and this indicates that CSNPs-treated plants have higher efficiency to scavenge H2O2 required to prevent membrane lipids peroxidation, as indicated in Fig. (2). Re-sults suggest that CSNPs can induce the enzymatic antioxidant ma-chinery, which able to scavenge ROS, preserve the membrane integrity, and eventually induce plant resistance against drought. Current results are supported by previous findings (Ma et al., 2014; Li et al., 2017).

This study is the first to investigate the effect of CSNPs on alkaloid accumulation indrought-stressed C. roseus. Results showed high content of total alkaloids under drought conditions, which confirm previous reports (Jaleel et al., 2007; Liu et al., 2017). Further increase was observed with CSNPs application. Results also showed higher alkaloid content in roots rather than leaves. This result is consistent with previ-ous findings on C. roseus that indicated more alkaloid content in roots rather than other plant parts (Jaleel et al., 2008). Interestingly, CSNPs foliar spray generally increased alkaloid content in both leaves and roots of the stressed and non-stressed C. roseus, and more content was noticed in the stressed ones (50% FC). Increasing the alkaloid content due to CSNPs application may be ascribed to improved growth rate, as results indicated increase in water and nutrient uptake via the adjustment of cell osmotic pressure (Guan et al., 2009) and possible improvement in translocation and accumulation of photosynthetic assimilates. It has been reported that the secondary metabolites were also induced as a defense mechanism to abiotic stress (Golkar et al., 2019). Application of CSNPs might trigger the intrinsic genetic potential resulted by increased enzyme activity, nutrient uptake, photosynthesis rate and translocation of photosynthates and other metabolites to the reproductive parts. Similar trend has been observed in C. roseus sprayed with growth reg-ulators (Alam et al., 2012). Increasd alkaloids content in roots with CSNPs application may be ascribed to the activated signal transduction pathways by promoting the transcriptional activation of STR, DAT, PRX1 and GS in leaves, similar to the observed results in the current

study. Chitosan stimulated the alkaloid content in C. roseus (Pliankong et al., 2018), as well as artemisinin content in Artemisia annua (Lei et al., 2011) and essential oil in thyme (Bistgani et al., 2017).

C. rouses is considered a model system for TIAs synthesis, because it produces over 130 different TIAs components with high pharmaceutical values. It is also considered the only source of vinblastine and vincristine that have anticancer activity (Zhu et al., 2014). The molecular mecha-nisms underlying the accumulation of alkaloids in C. rouses have not well covered; therefore, gene expression of alkaloid biosynthesis has been investigated in the current study. Results showed that drought stress induced the expression of TIAs in C. roseus leaves, and CSNPs had a significant impact on TIAs production when combined with 50% FC. This indicates that CSNPs simulate the impact of drought stress on TIAs production and hence stress tolerance. It has been reported that TIAs accumulation is induced by several stresses, because they play indis-pensable role in plant defense mechanism (Khataee et al., 2019). The current gene expression results are going along the production and accumulation of TIAs in the C. rouses leaves and roots (Fig. 4). Therefore, the induction of these genes under drought stress and CSNPs application can explain the presence of high alkaloid content under such conditions. Several studies reported the induction of the four studied genes in response to abiotic stresses. In this regard, methyl jasmonate combined with putrescine have effectively induced these key four genes with different magnitudes that reached more than 6 folds in C. roseus (Kha-taee et al., 2019). Furthermore, CrWRKY1 transcription factor, regulator of TIAs production in C. rouses, was induced about 3.6 folds by the application of yeast extract (Moghazee et al., 2018). This indicates that CSNPs can significantly enhance TIAs production in C. rouses.

5. Conclusion

Application of CSNPs has significantly mitigated drought-induced oxidative stress through the induction of antioxidant potential mecha-nisms in C. roseus. Under drought stress conditions, CSNPs enhanced plant growth, RWC, stomatal conductance, chlorophyll content and the production of non-enzymatic (proline) and enzymatic (CAT and APX) antioxidants, and hence reduced the accumulation of H2O2 and malondialdehyde (MDA) and preserved membrane integrity. The in-duction of STR, DAT, PRX1 and GS genes due to drought stress and CSNPs treatment resulted in more accumulation of total alkaloids in both roots and leaves. This study is the first to show the vital role of CSNPs improving drought stress tolerance in C. roseus due to its impact on the induction of alkaloids biosynthesis genes. Therefore, CSNPs could be an alternative for synthetic materials to induce plant stress tolerance and reduce environmental contamination.

Author contributions

The researchers participated in developing a research plan design the experiment, and applying experimental treatments, Data collection and chemical analysis, data analysis and manuscript writing.

Declaration of competing interest

The authors declare that the research was conducted in the absence of any commercialor financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

The authors acknowledge Taif University Researchers Supporting Project number (TURSP-2020/143), Taif University, Taif, Saudi Arabia.

E.F. Ali et al.

Plant Physiology and Biochemistry 161 (2021) 166–175

174

References

Abedi, T., Pakniyat, H., 2010. Antioxidant enzyme changes in response to drought stress in ten cultivars of oilseed rape (Brassica napus L.). Czech J. Genet. Plant Breed. 46, 27–34.

Alam, M.M., Naeem, M., Idrees, M., Khan, M.M.A., Moinuddin, 2012. Augmentation of photosynthesis, crop productivity, enzyme activities and alkaloids production in Sadabahar (Catharanthus roseus L.) through application of diverse plant growth regulators. J. Crop Sci. Biotechnol. 15, 117–129.

Ali, E.F., Hassan, F.A.S., 2017. Water stress alleviation of roselle plant by silicon treatment through some physiological and biochemical responses. Annual Research & Review in Biology 21, 1–17.

Al-Yasi, H., Attia, H., Alamer, K., Hassan, F., Esmat, F., Elshazly, S., Siddique, K.H., Hessini, K., 2020. Impact of drought on growth, photosynthesis, osmotic adjustment, and cell wall elasticity in Damask rose. Plant Physiol. Biochem. 150, 133–139.

Aranaz, I., Acosta, N., Civera, C., Elorza, B., Mingo, J., Castro, C., Gandía, M.L.L., Heras Caballero, A., 2018. Cosmetics and cosmeceutical applications of chitin, chitosan and their derivatives. Polymers 10.

Attia, H., Al-Yasi, H., Alamer, K., Esmat, F., Hassan, F., Elshazly, S., Hessini, K., 2020. Induced anti-oxidation efficiency and others by salt stress in Rosa damascena Miller. Sci. Hortic. 274, 109681.

Bates, L.S., Waldren, R.P., Teare, I.D., 1973. Rapid determination of free proline for water-stress studies. Plant Soil 39, 205–207.

Beadle, C.L., Ludlow, M.M., Honeysett, J.L., 1985. Chapter 5 - water relations. In: Coombs, J., Hall, D.O., Long, S.P., Scurlock, J.M.O. (Eds.), Techniques in Bioproductivity and Photosynthesis, second ed. Pergamon, pp. 50–61.

Bistgani, E., Zohreh, Siadat, S.A., Bakhshandeh, A., Ghasemi Pirbalouti, A., Hashemi, M., 2017. Interactive effects of drought stress and chitosan application on physiological characteristics and essential oil yield of Thymus daenensis Celak. The Crop Journal 5, 407–415.

Chen, J.B., Wang, S.M., Jing, R.L., Mao, X.G., 2009. Cloning the PvP5CS gene from common bean (Phaseolus vulgaris) and its expression patterns under abiotic stresses. J. Plant Physiol. 166, 12–19.

Clairbone, A., 1985. Catalase activity. In: Greenwald, R. (Ed.), Handbook of Methods for Oxygen Radical Research. CRC Press, Boca Raton, Fla, pp. 283–284.

Desikan, R., Mackerness, S.A.H., Hancock, J.T., Neill, S.J., 2001. Regulation of the Arabidopsis transcriptome by oxidative stress. Plant Physiol. 127, 159–172.

Díaz-Lopez, L., Gimeno, V., Simon, I., Martínez, V., Rodríguez-Ortega, W.M., García- Sanchez, F., 2012. Jatropha curcas seedlings show a water conservation strategy under drought conditions based on decreasing leaf growth and stomatal conductance. Agric. Water Manag. 105, 48–56.

Divya, K., Jisha, M.S., 2018. Chitosan nanoparticles preparation and applications. Environ. Chem. Lett. 16, 101–112.

Doares, S.H., Syrovets, T., Weiler, E.W., Ryan, C.A., 1995. Oligogalacturonides and chitosan activate plant defensive genes through the octadecanoid pathway. Proc. Natl. Acad. Sci. U. S. A 92, 4095–4098.

Elseehy, M.M., El-Shehawi, A.M., 2020. Methylation of exogenous promoters regulates soybean isoflavone synthase (GmIFS) transgene in T0 transgenic wheat (Triticum aestivum). Cytol. Genet. 54, 271–282.

Engelbrecht, B.M.J., Comita, L.S., Condit, R., Kursar, T.A., Tyree, M.T., Turner, B.L., Hubbell, S.P., 2007. Drought sensitivity shapes species distribution patterns in tropical forests. Nature 447, 80–82.

Fan, W., Yan, W., Xu, Z., 2012. Formation mechanism of monodisperse, low molecular weight chitosan nanoparticles by ionic gelation technique. Colloids Surf. B Biointerfaces 90, 21–27.

Farouk, S., Amany, A.R., 2012. Improving growth and yield of cowpea by foliar application of chitosan under water stress. Egypt. J. Biol. 14, 14–16.

Fatima, S., Mujib, A., Tonk, D., 2015. NaCl amendment improves vinblastine and vincristine synthesis in Catharanthus roseus: a case of stress signalling as evidenced by antioxidant enzymes activities. Plant Cell Tissue Organ Cult. 121, 445–458.

Geng, W., Li, Z., Hassan, M.J., Peng, Y., 2020. Chitosan regulates metabolic balance, polyamine accumulation, and Na+transportcontributing to salt tolerance in creepingbentgrass. BMC Plant Biol. 20, 506. https://doi.org/10.1186/s12870-020- 02720-w.

Golkar, P., Taghizadeh, M., Yousefian, Z., 2019. The effects of chitosan and salicylic acid on elicitation of secondary metabolites and antioxidant activity of safflower under in vitro salinity stress. Plant Cell Tissue Organ Cult. 137, 575–585.

Guan, Y.J., Hu, J., Wang, X., Shao, C., 2009. Seed priming with chitosan improves maize germination and seedling growth in relation to physiological changes under low temperature stress. J. Zhejiang Univ. - Sci. 10 (6), 427–433.

Han, M., Heppel, S.C., Su, T., Bogs, J., Zu, Y., An, Z., Rausch, T., 2013. Enzyme inhibitor studies reveal complex control of methyl-D-erythritol 4-phosphate (MEP) pathway enzyme expression in Catharanthus roseus. PloS One 8, e62467.

Hassan, F., Fetouh, M., 2019. Does moringa leaf extract have preservative effect improving the longevity and postharvest quality of gladiolus cut spikes? Sci. Hortic. 250, 287–293.

Hassan, F., Ali, E., Al-Zahrany, O., 2013. Effect of amino acids application and different water regimes on the growth and volatile oil of Rosmarinus officinalis L. plant under Taif region conditions. Eur. J. Sci. Res. 1, 346–359.

Hassan, F.A.S., Ali, E.F., El-Deeb, B., 2014. Improvement of postharvest quality of cut rose cv. ‘First Red’ bybiologically synthesized silver nanoparticles. Sci. Hortic. 179, 340–348.

Hassan, F.A.S., Ali, E.F., Alamer, K.H., 2018. Exogenous application of polyamines alleviates water stress-induced oxidative stress of Rosa damascena Miller var. trigintipetala Dieck. South Afr. J. Bot. 116, 96–102.

Hassan, F., Mazrou, R., Gaber, A., Hassan, M., 2020. Moringa extract preserved the vase life of cut roses through maintaining water relations and enhancing antioxidant machinery. Postharvest Biol. Technol. 164, 111156.

Heinisch, O., 1962. Steel, R.G.D., and J.H. Torrie: Principles and Procedures of Statistics. (With Special Reference to the Biological Sciences. McGraw-Hill Book Company, New York, Toronto, London, 1960, 481 S., 15 Abb.; 81 s 6 d. Biometrische Zeitschrift 4, 207-208.

Hidangmayum, A., Dwivedi, P., Katiyar, D., Hemantaranjan, A., 2019. Application of chitosan on plant responses with special reference to abiotic stress. Physiol. Mol. Biol. Plants : an international journal of functional plant biology 25, 313–326.

Hodges, D.M., Delong, J.M., Forney, C.F., Prange, R.K., 1999. Improving the thiobarbituric acidreactive-substances assay for estimating lipid peroxidation in plant tissue containing anthocyanin and other interfering compounds. Planta 207, 604–611.

Iriti, M., Picchi, V., Rossoni, M., Gomarasca, S., Ludwig, N., Gargano, M., Faoro, F., 2009. Chitosan antitranspirant activity is due to abscisic acid-dependent stomatal closure. Environ. Exp. Bot. 66, 493–500.

Jaleel, C.A., Manivannan, P., Sankar, B., Kishorekumar, A., Gopi, R., Somasundaram, R., Panneerselvam, R., 2007a. Induction of drought stress tolerance by ketoconazole in Catharanthus roseus is mediated by enhanced antioxidant potentials and secondary metabolite accumulation. Colloids Surf. B Biointerfaces 60, 201–206.

Jaleel, C.A., Manivannan, P., Sankar, B., Kishorekumar, A., Gopi, R., Somasundaram, R., Panneerselvam, R., 2007b. Water deficit stress mitigation by calcium chloride in Catharanthus roseus: effects on oxidative stress, proline metabolism and indole alkaloid accumulation. Colloids Surf. B Biointerfaces 60, 110–116.

Jaleel, C.A., Sankar, B., Murali, P.V., Gomathinayagam, M., Lakshmanan, G.M.A., Panneerselvam, R., 2008. Water deficit stress effects on reactive oxygen metabolism in Catharanthus roseus; impacts on ajmalicine accumulation. Colloids Surf. B Biointerfaces 62, 105–111.

Kamiab, F., Talaie, A., Khezri, M., Javanshah, A., 2014. Exogenous applications of free polyamines enhance salt tolerance of pistachio (Pistacia vera L.) seedlings. Plant Growth Regul. 72, 257–268.

Kananont, N., Pichyangkura, R., Chanprame, S., Chadchawan, S., Limpanavech, P., 2010. Chitosan specificity for the in vitro seed germination of two Dendrobium orchids (Asparagales: orchidaceae). Sci. Hortic. 124, 239–247.

Karimi, S., Hossein, A., Jafar, M., Hassan, M., 2012. Effects of water deficit and chitosan spraying on osmotic adjustment and soluble protein of cultivars Castor bean (Ricinus communis L.). J. Stress Physiol. Biochem. 8, 160–169.

Karthikeyan, B., Jaleel, C.A., Gopi, R., Deiveekasundaram, M., 2007. Alterations in seedling vigour and antioxidant enzyme activities in Catharanthus roseus under seed priming with native diazotrophs. J. Zhejiang Univ. - Sci. B 8, 453–457.

Katiyar, D., Hemantaranjan, A., Singh, B., 2015. Chitosan as a promising natural compound to enhance potential physiological responses in plant: a review. Indian J. Plant Physiol. 20, 1–9.

Khataee, E., Karimi, F., Razavi, K., 2019. Alkaloids production and antioxidant properties in Catharanthus roseus (L.) G. Don. shoots and study of alkaloid biosynthesis-related gene expression levels in response to methyl jasmonate and putrescine treatments as eco-friendly elicitors. Biologia Futura 70, 38–46.

Kim, H., Chen, F., Wang, X., Rajapakse, N.C., 2005. Effect of chitosan on the biological properties of sweet basil (Ocimum basilicum L.). J. Agric. Food Chem. 53, 3696–3701.

Lei, C., Ma, D., Pu, G., Qiu, X., Du, Z., Wang, H., Li, G., Ye, H., Liu, B., 2011. Foliar application of chitosan activates artemisinin biosynthesis in Artemisia annua L. Ind. Crop. Prod. 33, 176–182.

Li, Z., Zhang, Y., Zhang, X., Merewitz, E., Peng, Y., Ma, X., Huang, L., Yan, Y., 2017. Metabolic pathways regulated by chitosan contributing to drought resistance in white clover. J. Proteome Res. 16, 3039–3052.

Limpanavech, P., Chaiyasuta, S., Vongpromek, R., Pichyangkura, R., Khunwasi, C., Chadchawan, S., Bangyeekhun, T., 2008. Chitosan effects on floral production, gene expression, and anatomical changes in the Dendrobium orchid. Sci. Hortic. 116, 65–72.

Lin, W., Hu, X., Zhang, W., Rogers, W.J., Cai, W., 2005. Hydrogen peroxide mediates defense responses induced by chitosans of different molecular weights in rice. J. Plant Physiol. 162, 937–944.

Liu, Y., Meng, Q., Duan, X., Zhang, Z., Li, D., 2017. Effects of PEG-induced drought stress on regulation of indole alkaloid biosynthesis in Catharanthus roseus. J. Plant Interact. 12, 87–91.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.) 25, 402–408.

Ma, L., Yue-ying, L., Lan-lan, W., Xue-mei, L., Ting, L., Ning, B., 2014. Germination and physiological response of wheat (Triticum aestivum) to pre-soaking with oligochitosan. Int. J. Agric. Biol. 16, 766–770.

Malerba, M., Cerana, R., 2016. Chitosan effects on plant systems. Int. J. Mol. Sci. 17. Manzoni, S., Vico, G., Katul, G., Fay, P.A., Polley, W., Palmroth, S., Porporato, A., 2011.

Optimizing stomatal conductance for maximum carbon gain under water stress: a meta-analysis across plant functional types and climates. Funct. Ecol. 25, 456–467.

Marcinska, I., Czyczyło-Mysza, I., Skrzypek, E., Filek, M., Grzesiak, S., Grzesiak, M.T., Janowiak, F., Hura, T., Dziurka, M., Dziurka, K., Nowakowska, A., Quarrie, S.A., 2013. Impact of osmotic stress on physiological and biochemical characteristics in drought-susceptible and drought-resistant wheat genotypes. Acta Physiol. Plant. 35, 451–461.

Metzner, H., Rau, H., Senger, H., 1965. Unter suchungen zur synchronisier barteit einzelner pigmentan angel mutanten von chlorela. Planta 65, 186.

Mirajkar, S.J., Dalvi, S.G., Ramteke, S.D., Suprasanna, P., 2019. Foliar application of gamma radiation processed chitosan triggered distinctive biological responses in

E.F. Ali et al.

Plant Physiology and Biochemistry 161 (2021) 166–175

175

sugarcane under water deficit stress conditions. Int. J. Biol. Macromol. 139, 1212–1223.

Moghazee, M.M., Badway, F.M.I., Younis, R.A.A., Hassanein, S.H., 2018. Influence of yeast extract on gene expression of crwrky1 as a regulatory gene in alkaloids pathway in Catharanthus roseus (L.) G. Don. Arab Universities Journal of Agricultural Sciences 26, 647–654.

Mondal, M.M.A., Malek, M.A., Puteh, A.B., Ismail, M.R., Ashrafuzzaman, M., Naher, L., 2012. Effect of foliar application of chitosan on growth and yield in okra. Aust. J. Crop. Sci. 6, 918–921.

Nakano, Y., Asada, K., 1981. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 22, 867–880.

Nammi, S., Boini, M.K., Lodagala, S.D., Behara, R.B.S., 2003. The juice of fresh leaves of Catharanthus roseus Linn. reduces blood glucose in normal and alloxan diabetic rabbits. BMC Compl. Alternative Med. 3, 4 - 4.

Ouzounidou, G., Giannakoula, A., Ilias, I., Zamanidis, P., 2016. Alleviation of drought and salinity stresses on growth, physiology, biochemistry and quality of two Cucumis sativus L. cultivars by Si application. Braz. J. Bot. 39, 531–539.

Patterson, B.D., Macrae, E.A., Ferguson, I.B., 1984. Estimation of hydrogen peroxide in plant extracts using titanium (IV). Anal. Chem. 134, 487–492.

Pichyangkura, R., Chadchawan, S., 2015. Biostimulant activity of chitosan in horticulture. Sci. Hortic. 196, 49–65.

Pirbalouti, G.A., Malekpoor, F., Salimi, A., Golparvar, A., 2017. Exogenous application of chitosan on biochemical and physiological characteristics, phenolic content and antioxidant activity of two species of basil (Ocimum ciliatum and Ocimum basilicum) under reduced irrigation. Sci. Hortic. 217, 114–122.

Pliankong, P., Suksa-Ard, P., Wannakrairoj, S., 2018. Chitosan elicitation for enhancing of vincristine and vinblastine accumulation in cell culture of Catharanthus roseus (L.) G. Don. J. Agric. Sci. 10, 287–293.

Qu, D.Y., Gu, W.R., Zhang, L.G., Li, C.F., Chen, X.C., Li, J., Li, J.L., Xie, T.L., Wei, S., 2019. Role of chitosan in the regulation of the growth, antioxidant system and photosynthetic characteristics of maize seedling sunder cadmium stress. Russ. J. Plant Physiol. 66 (1), 140–151, 2019.

Rakwal, R., Tamogami, S., Agrawal, G.K., Iwahashi, H., 2002. Octadecanoid signaling component burst in rice (Oryza sativa L.) seedling leaves upon wounding by cut and treatment with fungal elicitor chitosan. Biochem. Biophys. Res. Commun. 295, 1041–1045.

Safikhan, S., Khoshbakht, K., Chaichi, M.R., Amini, A., Motesharezadeh, B., 2018. Role of chitosan on the growth, physiological parameters and enzymatic activity of milk thistle (Silybum marianum (L.) Gaertn.) in a pot experiment. Journal of Applied Research on Medicinal and Aromatic Plants 10, 49–58.

Sairam, R.K., Deshmukh, P.S., Shukla, D.S., 1997. Tolerance of drought and temperature stress in relation to increased antioxidant enzyme activity in wheat. J. Agron. Crop Sci. 178, 171–178.

Sharma, G., Kumar, A., Devi, K.A., Prajapati, D., Bhagat, D., Pal, A., Raliya, R., Biswas, P., Saharan, V., 2020. Chitosan nanofertilizer to foster source activity in maize. Int. J. Biol. Macromol. 145, 226–234.

Shukry, M., El-Shehawi, A.M., El-Kholy, W.M., Elsisy, R.A., Hamoda, H.S., Tohamy, H.G., Abumandour, M.M., Farrag, F.A., 2020. Ameliorative effect of graviola (Annona

muricata) on mono sodium glutamate-induced hepatic injury in rats: antioxidant, apoptotic, anti-inflammatory, lipogenesis markers, and histopathological studies. Animals : an open access journal from MDPI 10.

Silveira, N.M., Seabra, A.B., Marcos, F.C.C., Pelegrino, M.T., Machado, E.C., Ribeiro, R. V., 2019. Encapsulation of S-nitrosoglutathione into chitosan nanoparticles improves drought tolerance of sugarcane plants. Nitric Oxide 84, 38–44.

Song, H., Yuan, W., Jin, P., Wang, W., Wang, X., Yang, L., Zhang, Y., 2016. Effects of chitosan/nano-silica on postharvest quality and antioxidant capacity of loquat fruit during cold storage. Postharvest Biol. Technol. 119, 41–48.

Sreevalli, Y., Kulkarni, R.N., Baskaran, K., Chandrashekara, R.S., 2004. Increasing the content of leaf and root alkaloids of high alkaloid content mutants of periwinkle through nitrogen fertilization. Ind. Crop. Prod. 19, 191–195.

Talaat, N.B., Shawky, B.T., Ibrahim, A.S., 2015. Alleviation of drought-induced oxidative stress in maize (Zea mays L.) plants by dual application of 24-epibrassinolide and spermine. Environ. Exp. Bot. 113, 47–58.

Tokatlı, K., Demirdoven, A., 2020. Effects of chitosan edible film coatings on the physicochemical and microbiological qualities of sweet cherry (Prunus avium L.). Sci. Hortic. 259, 108656.

Uniyal, G.C., Bala, S., Mathur, A.K., Kulkarni, R.N., 2001. Symmetry C18 column: a better choice for the analysis of indole alkaloids of Catharanthus roseus. Phytochem. Anal. : PCA (Phytochem. Anal.) 12, 206–210.

Van, S.N., Minh, H.D., Anh, D.N., 2013. Study on chitosan nanoparticles onbiophysical characteristics and growth of Robusta coffee in green house. Biocatal. Agric. Biotechnol. 2, 289–294.

Veroneze-Júnior, V., Martins, M., Mc Leod, L., Souza, K.R.D., Santos-Filho, P.R., Magalhaes, P.C., Carvalho, D.T., Santos, M.H., Souza, T.C., 2020. Leaf application of chitosan and physiological evaluation of maize hybrids contrasting for drought tolerance under water restriction. Braz. J. Biol. 80 (3), 631–640.

Weatherley, P.E., 1950. Studies in the water relations of the cotton plant.1.The field measurements of water deficit in leaves. New Phytol. 49, 8.

Wilkinson, S., Davies, W.J., 2010. Drought, ozone, ABA and ethylene: new insights from cell to plant to community. Plant Cell Environ. 33, 510–525.

Xie, W., Xu, P., Liu, Q., 2001. Antioxidant activity of water-soluble chitosan derivatives. Bioorg. Med. Chem. Lett 11, 1699–1701.

Zeng, D., Luo, X., 2012. Physiological effects of chitosan coating on wheat growth and activities of protective enzyme with drought tolerance. Open J. Soil Sci. 2, 282–288.

Zhang, H., Zhao, X., Yang, J., Yin, H., Wang, W., Lu, H., Du, Y., 2011. Nitric oxide production and its functional link with OIPK in tobacco defense response elicited by chitooligosaccharide. Plant Cell Rep. 30, 1153–1162.

Zhang, X., Li, K., Xing, R., Liu, S., Li, P., 2017. Metabolite profiling of wheat seedlings induced by chitosan: revelation of the enhanced carbon and nitrogen metabolism. Front. Plant Sci. 8.

Zhu, X., Zeng, X., Sun, C., Chen, S., 2014. Biosynthetic pathway of terpenoid indole alkaloids in Catharanthus roseus. Front. Med. 8, 285–293.

Zolin, C.A., Rodrigues, R.d.A.R., 2015. Impact of Climate Change on Water Resources in Agriculture. CRC Press, Taylor & Francis Group, p. 232.

E.F. Ali et al.