Comparative Biochemistry and Physiology, Part B 161 (2012) 134–139

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part B

j ourna l homepage: www.e lsev ie r .com/ locate /cbpb

Characterization and transcriptional regulation of thioredoxin reductase 1 onexposure to oxidative stress inducing environmental pollutantsin Chironomus riparius

Prakash M. Gopalakrishnan Nair, Jinhee Choi ⁎School of Environmental Engineering, Graduate School of Energy and Environmental System Engineering, University of Seoul, 90 Jeonnong-dong, Dongdaemun-gu, Seoul 130-743,Republic of Korea

⁎ Corresponding author: Tel.: +82 2 2210 5622; fax:E-mail address: jinhchoi@uos.ac.kr (J. Choi).

1096-4959/$ – see front matter © 2011 Elsevier Inc. Alldoi:10.1016/j.cbpb.2011.10.007

a b s t r a c t

a r t i c l e i n f o

Article history:Received 23 August 2011Received in revised form 19 October 2011Accepted 19 October 2011Available online 25 October 2011

Keywords:C. ripariusThioredoxin reductase 1Cadmium chlorideParaquatOxidative stress

We characterized thioredoxin reductase 1 (TrxR1) from Chironomus riparius (CrTrxR1) and studied itsexpression under oxidative stress. The full-length cDNA is 1820 bp long and contains an open readingframe (ORF) of 1488 bp. The deduced CrTrxR1 protein has 495 amino acids and a calculated molecularmass of 54.41 kDa and an isoelectric point of 6.15. There was a 71 bp 5’ and a 261 bp 3' untranslated regionwith a polyadenylation signal site (AATAAA). Homologous alignments showed the presence of conservedcatalytic domain Cys–Val–Asn–Val–Gly–Cys (CVNVGC), the C-terminal amino acids ‘CCS’ and conservedamino acids required in catalysis. The expression of CrTrxR1 is measured using quantitative real-time PCRafter exposure to 50 and 100 mg/L of paraquat (PQ) and 2, 10 and 20mg/L of cadmium chloride (Cd). CrTrxR1mRNA was upregulated after PQ exposure at all conditions tested. The highest level of CrTrxR1 expression wasobserved after exposure to 10 mg/L of Cd for 24 h followed by 20 mg/L for 48 h. Significant downregulation ofCrTrxR1 was observed after exposure to 10 and 20 mg/L of Cd for 72 h. This study shows that the CrTrxR1could be potentially used as a biomarker of oxidative stress inducing environmental contaminants.

© 2011 Elsevier Inc. All rights reserved.

1. Introduction

The larvae of the aquatic midge Chironomus riparius is widely usedas a test organism in aquatic ecotoxicological studies because it repre-sents an important link in the aquatic food web and its associationwith benthic sediments (Lucan-Bouché et al., 2000; OECD, 2001). Tradi-tionally whole-organism and biochemical level end points are used toevaluate potential ecotoxicological impacts of environmental pollutantsin Chironomus spp. (De Bisthoven et al., 2001; Martinez et al., 2003).However, recently it has been widely accepted that the use of theexpression of the genes involved in many biological processes offerhigh sensitivity andmechanistic value in the diagnosis of environmentalcontamination, as the mRNA levels represent a snapshot of the cellsactivity at a given time (Snell et al., 2003; Ankley et al., 2006). Measure-ment of single genemRNA expressions quantified using real-time PCR isalso used as a useful biomarker of stress in animals (Bustin, 2002). How-ever, due to limited sequence information molecular level studies arestill very limited in C. riparius and recently we have developed anExpressed Sequence Tags (ESTs) database using 454 pyrosequencingfor this ecotoxicologically important species (Nair et al., 2011b) and

+82 2 2244 2245.

rights reserved.

several antioxidant genes have been characterized and expression anal-ysis has been done (Nair and Choi, 2011a; Nair et al., 2011a).

The thioredoxin reductases (TrxRs) are homodimeric proteins,belonging to the flavoprotein family of pyridine nucleotide-disulfideoxidoreductases, with each monomer containing an FAD prostheticgroup, a NADPH-binding site and an active site that contains aredox-active disulfide (Holmgren, 1985; Williams, 1995; Tamura andStadtman, 1996; Arne´r and Holmgren, 2000; Mustacich and Powis,2000). In mammals three isozymes of TrxRs has been identified; thecytosolic form (TrxR1), mitochondrial form (TrxR2), and testis-specific form (TrxR3) (Gasdaska et al., 1995; Gladyshev et al., 1996).Model insects belonging to the dipteran order such as D.melanogasterand A. gambiae, have no glutathione reductase and the Trx system iswell studied (Kanzok et al., 2001; Huang et al., 2008a,b).

Aquatic organisms are exposed to various environmental pollutantsincluding oxidative stress inducing chemicals. Cadmium (Cd) is onesuch highly toxic heavymetal contaminant, with no physiological func-tion, released to the aquatic environments from industrial effluents(Korte, 1983; Nriagu et al., 1998; Jung et al., 2005) and has been demon-strated to be toxic to many organisms (Sastry and Subhadra, 1982;Pratap and Wendelaar Bonga, 1990; Ahel et al., 1993; Gillesby andZacharewski, 1998; Satarug et al., 2003; Henson and Chedrese, 2004;Lee and Choi, 2006; Sandhu and Vijayan, 2011). Cadmium is known toinduce the production of reactive oxygen species (ROS) which couldcause multiple toxic effects such as DNA damage, lipid peroxidation,

Table 1Primers used in Real time PCR study.

Gene Primer Name Sequence of primer (5’–3’) Amplified productlength (bp)

CrTrxR1 CrTrxR1-F GACATTTTCTCATTAGACCGTGAAC 120CrTrxR1-R ACGAACCAAAATTGTTGACTCATAG

β-actin CrActin-F GATGAAGATCCTCACCGAACG 145CrActin-R TTCGAGTGAGGTTGATGCAG

135P.M.G. Nair, J. Choi / Comparative Biochemistry and Physiology, Part B 161 (2012) 134–139

and induction of apoptosis (Stohs and Bagchi, 1995; Stohs et al., 2000;Risso-de Faverney et al., 2001; Waisberg et al., 2003; Yalin et al., 2006;Liu et al., 2008). Induction of antioxidant genes on exposure to Cd hasbeen reported in many studies (Shaikh et al., 1999; Wang et al., 2004;Murugavel et al., 2007; Soares et al., 2008; Kim et al., 2010).

Several antioxidant enzyme genes like glutathione S-transferases(EC 2.5.1.18) and catalase (EC 1.11.1.6), are induced to protect thecells from oxidative stress causing chemicals in C. riparius (Nair andChoi, 2011a; Nair et al., 2011a). Thioredoxin reductase (TrxR) is alsoan antioxidant enzyme playing an important role in the cellular defenseto scavenge ROS (Mustacich and Powis, 2000). Thioredoxin reductase 1is induced under stress conditions including oxidative stress and is thecritical component of the Trx system in the cytosol (Sakurai et al.,2005). Since TrxR play important role in the oxidative stress response,studying the regulation of C. riparius TrxR1 gene under oxidative stressand its expression on exposure to environmental pollutants will beuseful in understanding its role in defense responses. Moreover,the expression profiles CrTrxR1 to a specific environmental pollutantcould be used as a potential biomarker for future environmental bio-monitoring studies. However, as far as we know, no sequence informa-tion is available about TrxR genes in C. riparius and thus, its response tooxidative stress causing environmental pollutants remains unknown.Therefore, in the present study, the full length cDNA of CrTrxR1 is iden-tified from C. riparius ESTs database and themRNA expression profile ofCrTrxR1 is studied in different developmental stages (egg, larva, pupa,male and female), as well as in response to a known oxidative stressinducer, Paraquat (1, 14-dimethyl-4, 44-bipyridinium) dichloride(Suntres, 2002) and subsequently to Cd exposure is investigated. Phylo-genetic analysis and secondary structure predictions were done usingfree internet based software.

2. Materials and methods

2.1. Maintenance of C. riparius and chemical exposure

Chironimus riparius (Diptera: Chironomidae) larvae were reared ina 2 L glass chamber containing aerated, dechlorinated tap water andacid washed sand. The larvae were fed with fish flake food (Tetramin,Tetrawerke, Melle, Germany) and exposed to a 16 h light plus 8 hdark photoperiod at a temperature of 20±2 °C. Fourth instar larvaewere exposed to 50 and 100 mg/L of known oxidative stress inducerparaquat (N,N′-dimethyl-4,4′-bipyridinium dichloride; PQ) (Sigma-Aldrich Chemical, St. Louis, MO, USA) for 12 and 24 h and also to 0,2, 10 and 20 mg/L of cadmium chloride (Sigma-Aldrich) for 0, 12,24, 48 and 72 h. The exposure concentrations of PQ and Cd were se-lected based on the result from previously conducted acute andchronic toxicity tests (Lee and Choi, 2006; Choi and Ha, 2009).Three replicates of 15 fourth instar larvae in each exposure set wereperformed for all exposure conditions and for the controls in beakerscontaining 100 mL dechlorinated tap water. The controls were main-tained without any exposure to chemicals for the different durationsand concentrations along with the chemical exposed samples. Afterthe exposure, the larvae were collected and immediately frozen inliquid nitrogen before being stored at −80 °C. Developmental expres-sion of the CrTrxR1 transcriptwas investigated in egg (two eggmasses),fourth instar larvae, pupae andmale and female adults (five animals foreach stage).

2.1.1. Sequence analysis and phylogenetic tree generationAn ESTs database was developed by pyrosequencing from fourth

instar larvae of C. riparius using genome sequencer GSFLX system(Roche, Mannheim, Germany). The reads were assembled using theGS De Novo Assembler (http://www.454.com/products-solutions/analysis-tools/gs-de-novo-assembler.asp). C. riparius thioredoxin re-ductase 1 cDNA sequence was retrieved from the ESTs databaseusing BlastX searches of the NCBI GenBank database (http://blast.

ncbi.nlm.nih.gov/). Secondary structure was predicted using thePSIPRED protein structure prediction server (http://bioinf4.cs.ucl.ac.uk:3000/psipred/). Phylogenetic analysis of the predicted aminoacid sequences of different classes of TrxRs along with CrTrxR1 wereconducted using the neighbor joining method using MEGA software,version 4.0 and bootstrap values calculated with 1000 replicates(Tamura et al., 2007).

2.1.2. Expression analysis of CrTrxR1 by real-time polymerase chainreaction

Total RNA was isolated using Trizol™ (Invitrogen, USA) fromchemical exposed and control larvae as per manufacturer's instruc-tions and the quality of RNA preparation was verified. One microgramof total RNA was reverse transcribed to cDNA with oligo dT20 primerusing iScript™ select cDNA synthesis kit (Bio-Rad, USA) as per themanufacturer's instructions in a total reaction volume of 20 μL. Theprimers were designed using Primer3 (http://frodo.wi.mit.edu/primer3/) (Table 1) and were tested on a representative C. ripariuscDNA preparation using reaction conditions with 94 °C for 4 min fol-lowed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C or 30 s and72 °C for 10 min using PTC 100 thermal cycler (MJ Research, Lincoln,MA, USA) with the PCR mix (Bioneer, South Korea) according to themanufacturers’ manual. The RT-PCR products were visualized on a1.5% agarose gel stained with ethidium bromide to verify the ampliconlength and to assure that only one product is amplified.

To study CrTrxR1gene transcript expression in each developmentalstage and after exposure to different concentrations and durations ofPQ and Cd quantitative real-time RT-PCR (qRT-PCR) was performed.Each reaction included 1 μL of template cDNA, 0.2 μM of correspondingforward and reverse primers, 10 μL of 2× IQ SYBR Green Super Mix(Bio-Rad, USA) in a final reaction volume of 20 μL. The RT-PCR reactionswere run with an initial denaturing at 95 °C for 7 min followed by44 cycles of 95 °C for 15 s, 55 °C for 1 min and 72 °C for 0.15 s and amelting curve analysis was done. Amplification and detection wereperformed using a CFX96TM Real-Time PCR detection system (Bio-RadLaboratories, Inc., Hercules, CA USA) and accompanying software (CFXManager Software) according to the manufacturer's instructions. TheqRT-PCR was done using samples from three independent exposureand control sets. The expression level of CrTrxR1 gene in differentdevelopmental stages and after exposure to different concentrationsand time intervals of PQ and Cd was calculated relative to expressionlevels of the Chironomus β-actin mRNA used as an internal standardto normalize the expression levels.

2.2. Statistical analysis

Cycle threshold (Ct) values were converted to relative gene ex-pression levels by 2–ΔΔCt method using the gene expression analysissoftware in the CFX96 PCR-machine (Bio-Rad, USA). The data werechecked for of homogeneity of variance before analysis. Statistical dif-ferences between the results obtained from different experiments incontrol and treated larvae were analyzed using one-way ANOVAwith SPSS 12.0 KO (SPSS Inc., Chicago, IL, USA). Dunnett's post-doc

136 P.M.G. Nair, J. Choi / Comparative Biochemistry and Physiology, Part B 161 (2012) 134–139

test was done to determine the effect of different exposures on geneexpressions. A probability level of Pb0.05 was considered significant.

3. Results

3.1. Sequence analysis of CrTrxR1

The full-length cDNA of CrTrxR1 was 1820 bp long and contains anopen reading frame of 1488 bp. There was a 71 bp of 5′ untranslatedregion (UTR) upstream of the start codon and a 261 bp 3′ UTR follow-ing the stop codon and also a consensus polyadenylation sequence(AATAAA). The deduced CrTrxR1 protein has 495 amino acids, a cal-culated molecular mass of 54.41 kDa, and an isoelectric point of6.15. The nucleotide and deduced amino acid sequences of CrTrxR1is shown in Supplementary Fig. 1. The deduced amino acid sequenceof CrTrxR1 was compared with its homologs from other organisms.The results showed that CrTrxR1 shares 55% sequence identity withits orthologues from humans and 73% identity with Culex quinquefas-ciatus and Aedes aegypti, 72% identity with Anopheles gambiae and 69%Drosophila melanogaster. Homologous alignments showed the pres-ence of conserved catalytic domain Cys–Val–Asn–Val–Gly–Cys(CVNVGC), the C-terminal amino acids ‘CCS’ and conserved aminoacids required in catalysis (Fig. 1). Phylogenetic analysis showedthat the CrTrxR1 is grouped with TrxR1 cluster and is closely relatedto the insects belonging to the dipeteran order (Fig. 2). Secondarystructure analysis showed that the CrTrxR1 protein is composed of29.76% alpha helix (10 helices; 123 residues), 28.54% extended-beta

Fig. 1. Multiple sequence alignment of thioredoxin reductases (TrxR) from different organissequence of CrTrxR1 was aligned with homologous sequences (NCBI accession numbers in pand H. sapiens (AAB35418). Identical amino acids in all species are highlighted with same coand the predicted amino acids required in catalysis are highlighted by asterisks.

(21 strands; 116 residues) and 41.70% random coil (32coils; 259 res-idues) configurations. The cDNA and deduced amino acid sequence ofthe CrTrxR1 described in this study is deposited in NCBI GenBankwith the following accession number JN600620.

3.2. Expression profiles of CrTrxR1

The substrate specificity of the CrTrxR-1 and β-actin primer was ver-ified and we found only a single amplified product. The CrTrxR1 mRNAexpressionwas found in all developmental stages viz. egg, larvae, pupaeand adults (male and female) and the expression level was almostsimilar with no significant difference between different developmentalstages (Supplementary Fig. 2). The expression of CrTrxR1 was quanti-fied after 12 and 24 h exposure to 50 and 100 mg/L of PQ and it wasobserved that the mRNA expression of CrTrxR1 was significantly in-creased compared to the control sets. The upregulation of CrTrxR1mRNA was more pronounced after 24 h exposure to 50 and 100 mg/Lof PQ compared to 12 h exposure to corresponding concentrations(Fig. 3).

The expression of CrTrxR1 after exposure to Cd was investigatedusing a time and dose dependant exposure condition and significantmodulation of CrTrxR1 was noticed after different time intervalsand concentrations of Cd exposure. For 2 mg/L Cd-treated group, theexpression level of CrTrxR1 transcript significantly increased after ex-posure for 12 and 24 h and no significant change was observed at 48and 72 h compared to the control (Fig. 4). At 10 and 20 mg/L of Cd,the expression of CrTrxR1 mRNA showed significant increase at 12,

ms with that of C. riparius thioredoxin reductase 1 (CrTrxR1). The deduced amino acidarentheses) from Anopheles gambiae (CAD30858), Drosophila melanogaster (AAG25639)lor. The predicted catalytic site ‘CVNVGC’ and C-terminal amino acids ‘TCCS’ are boxed

A.aegypti-I

A.gambiae-I

C.riparius-I

A.pisum-I

D.melanogaster-I

H.sapiens-III

B.taurus-III

D.melanogaster-II

G.gallus-II

M.musculus-II

M.crassus-II

P.falciparum-II

100

100

86

73

70

58

49

42

85

Fig. 2. Phylogenetic tree of C. riparius thioredoxin reductase 1 (CrTrxR1) with that of different classes of TrxRs from different species generated by MEGA version 4.0. The NCBI Gen-Bank accession numbers as follows: A. pisum-I (XP001942650), D.melanogaster-I (AAF46354), A. aegypti-I (XP001662665), A. gambiae-I (CAD30858), M. crassus-II (ACL81231), P.falciparum-II (AAQ07981), M. musculus-II (BAA86986), D.melanogaster-II (NP524216), H. sapiens-III (NP001087240), B. taurus-III (XP583261).

137P.M.G. Nair, J. Choi / Comparative Biochemistry and Physiology, Part B 161 (2012) 134–139

24 and 48 h time periods, with the highest expression being observedafter 24 h exposure period. However, significant downregulation wasobserved after 72 h exposure with 10 and 20 mg/L of Cd (Fig. 4).Overall, the qRT-PCR analysis revealed that the expression of CrTrxR1mRNA could be modulated by PQ and Cd exposure.

4. Discussion

In mammals three types of TrxRs has been identified and themammalian TrxRs are selenoproteins primarily catalyzing the NADPHdependent reduction of thioredoxin (Trx) and contains a C-terminalselenocysteine residue essential for its catalytic activity (Williams,1995; Matsui et al., 1996; Tamura and Stadtman, 1996). In A. gambiae,two cytosolic and one mitochondrial TrxR have been reported and arenot seleno enzymes but instead contain redox-active Cys–Cys sequence(Bauer et al., 2003). The main differences between the insect enzymesand the TrxR from mammals are concerned with the amino acid resi-dues adjacent to the cysteines. In mammalian TrxRs, including the

Fig. 3. Expression of C. riparius thioredoxin reducatase 1 (CrTrxR1) mRNA after 50 and100 mg/L Paraquat (PQ) exposure for 12 and 24 h. The mRNA expression of CrTrxR1gene was quantified using real time PCR and normalised using Chironomus β-actingene. These data are means±SE of three independent experiments. Asterisks indicatesignificant difference as compared to the control (control=1) (Pb0.05*).

human orthologue, a Gly–Cys–Cys–Gly sequence is present, whereasin A. gambiae TrxR1, it is Thr–Cys–Cys–Ser and in D. melanogasterTrxR1 it is Ser–Cys–Cys–Ser. In the present study, we found that similarto A. gambaie TrxR1 (Bauer et al., 2003), CrTrxR1 also contains the Thr–Cys–Cys–Ser residues in the redox site.

The developmental expression of CrTrxR1 was examined and wasfound to be expressed in all developmental stages with no significantdifference between different developmental stages. Similar to ourresults, it was reported that TrxR1 from Apis cerana cerana was alsoconstantly expressed in different developmental stages (Yang et al.,2010). In this study, we found an increase of CrTrxR1 gene transcrip-tion in C. riparius fourth instar larvae after oxidative stress induced byexposure to the redox-cycling compound PQ, which is known toproduce different ROS, including H2O2 (Bus et al., 1974; DeGray etal., 1991). Over-expression of glutathione S-transferases (GSTs) andcatalase (CAT) mRNA after exposure to PQ as observed in our earlierstudies is in agreement with the hypothesis of pro-oxidant propertiesof PQ in C. riparius (Nair and Choi, 2011a; Nair et al., 2011b). Similarly,

Fig. 4. Expression of C. riparius thioredoxin reductase 1 (CrTrxR1)mRNA after 0, 2, 10 and20 mg/L Cadmium chloride (Cd) exposure for 12, 24, 48 and 72 h. ThemRNAexpression ofCrTrxR1 gene was quantified using real time PCR and normalised using Chironomus β-actin gene. These data are means±SE of three independent experiments. Asterisks indi-cate significant difference as compared to the control (control=1) (Pb0.05*).

138 P.M.G. Nair, J. Choi / Comparative Biochemistry and Physiology, Part B 161 (2012) 134–139

ROS produced by heat and UV (Heck et al., 2003) induced the expres-sion level of TrxR1 from Apis cerana cerana (Yang et al., 2010). There-fore, based on the results obtained in the present study, we couldpredict that CrTrxR1 also have an important role in protection againstoxidative stress in C. riparius.

In this study, we investigated the expression of CrTrxR1 after Cdexposure and found that the mRNA expression level of CrTrxR1 wasmodulated by Cd depending on the concentration and duration ofexposure. As TrxR is an antioxidant enzyme having an activity toscavenge ROS (Mustacich and Powis, 2000), Cd induced CrTrxR1expression might be one of the cellular defense mechanism againstCd in C. riparius. A previous study using Yeast mutants lacking TrxRshowed that they are highly sensitive to hydrogen peroxide toxicity(Carmel-Harel et al., 2001). In Hela cells, gene silencing of TrxR1had a dual effect on Cd-induced cell death, depending on the concen-tration of Cd used (Nishimoto et al., 2006) with high concentrationsdecreased the cell viability. Schallreuter and Wood (1986) reportedthat the Trx/TrxR system plays an important role in preventing celldamage from UV-generated free radicals in guinea pig and humanskin. In vascular endothelial cells cadmium TrxR1 expression was in-duced by Cd (Sakurai et al., 2005). Dimopoulos et al. (2002) reportedthe induction of the Trx system in A. gambiae including the TrxR genedue to oxidative stress. It was also observed from the present studythat the expression of CrTrxR1 was downregulated after exposure to10 and 20 mg/L of Cd for 72 h and this might be due to the increasedoxidative stress caused by Cd and the cells might have increased thesynthesis of proteins, such as heat shock proteins which could protectthe cells from oxidative stress (Lindquist and Craig, 1988; Juliann andGeorge, 1998; Nair and Choi, 2011b).

5. Conclusions

This is the first report on the identification and characterization offull-length cDNA sequence of antioxidant enzyme thioredoxin reduc-tase 1 from ecotoxicologically important invertebrate C. riparius. Theupregulation of CrTrxR1 on exposure to PQ and Cd shows that CrTrxR1has a protective role in the oxidative stress defense and adaptation re-sponses of C. riparius against oxidative stress causing environmentalpollutants. The identification and characterization of CrTrxR1 could bepotentially used as a biomarker for aquatic biomonitoring studiesusing C. riparius.

Supplementary materials related to this article can be found onlineat doi:10.1016/j.cbpb.2011.10.007.

Acknowledgments

This work was supported by the 2010-2011 sabbatical year re-search grant of the University of Seoul.

References

Ahel, M., McEvoy, J., Giger, W., 1993. Bioaccumulation of the lipophilic metabolites ofnonionic surfactants in freshwater organisms. Environ. Pollut. 79, 243–248.

Ankley, G.T., Daston, G.P., Degitz, S.J., Denslow, N.D., Hoke, R.A., Kennedy, S.W., Miracle,A.L., Perkins, E.J., Snape, J., Tillitt, D.E., Tyler, C.R., Versteeg, D., 2006. Toxicoge-nomics in regulatory ecotoxicology. Environ. Sci. Technol. 40, 4055–4065.

Arne´r, E.S., Holmgren, A., 2000. Physiological functions of thioredoxin and thioredoxinreductase. Eur. J. Biochem. 267, 6102–6109.

Bauer, H., Gromer, S., Urbani, A., Schnölzer, M., Schirmer, R.H., Müller, H.M., 2003. Thiore-doxin reductase from the malaria mosquito Anopheles gambiae. Eur. J. Biochem. 270,4272–4281.

Bus, J.S., Aust, S.D., Gibson, J.E., 1974. Superoxide and singlet oxygen catalyzed lipidperoxidation as a possible mechanism for paraquat (methyl viologen) toxicity. Bio-chem. Biophys. Res. Commun. 58, 749–755.

Bustin, S.A., 2002. Absolute quantification of mRNA using real-time reverse transcrip-tion polymerase chain reaction assays. J. Mol. Endocrinol. 25, 169–193.

Carmel-Harel, O., Stearman, R., Gasch, A.P., Botstein, D., Brown, P.O., Storz, G., 2001.Role of thioredoxin reductase in the Yap1p-dependent response to oxidative stressin Saccharomyces cerevisiae. Mol. Microbiol. 39, 595–605.

Choi, J.H., Ha, M.H., 2009. Effect of cadmium exposure on the globin protein expressionin 4th instar larvae of Chironomus riparius Mg. (Diptera: Chironomidae): An eco-toxicoproteomics approach. Proteomics 9, 31–39.

De Bisthoven, L.J., Postma, J., Vermeulen, A., Goemans, G., Ollevier, F., 2001. Morpholog-ical deformities in Chironomus riparius meigen larvae after exposure to cadmiumover several generations. Water Air Soil Pollut. 129, 167–179.

DeGray, J.A., Rao, D.N.R., Mason, R.P., 1991. Reduction of paraquat and related bipyridi-lium compounds to free radical metabolites by rat hepatocytes. Arch. Biochem.Biophys. 289, 145–152.

Dimopoulos, G., Christophides, G.K., Meister, S., Schultz, J., White, K.P., Barillas-Mury, C.,Kafatos, F.C., 2002. Genome expression analysis of Anopheles gambiae: Responsesto injury, bacterial challenge, and malaria infection. Proc. Natl. Acad. Sci. U. S. A.99, 8814–8819.

Gasdaska, P.Y., Gasdaska, J.R., Cochran, S., Powis, G., 1995. Cloning and sequencing of ahuman thioredoxin reductase. FEBS Lett. 373, 5–9.

Gillesby, B.E., Zacharewski, T., 1998. Endocrine disruptors:mechanismsof action and strat-egies for identification and assessment. Environ. Toxicol. Chem. Annu. Rev. 17, 3–14.

Gladyshev, V.N., Jeang, K.T., Stadtman, T.C., 1996. Selenocysteine, identified as the pen-ultimate C-terminal residue in human T-cell thioredoxin reductase, corresponds toTGA in the human placental gene. Proc. Natl. Acad. Sci. U. S. A. 93, 6146–6151.

Heck, D.E., Vetrano, A.M., Mariano, T.M., Laskin, J.D., 2003. UVB light stimulates produc-tion of reactive oxygen species: unexpected role for catalase. J. Biol. Chem. 278,22432–22436.

Henson, M.C., Chedrese, P.J., 2004. Endocrine disruption by cadmium, a common envi-ronmental toxicant with paradoxical effects on reproduction. Exp. Biol. Med. 229,383–392.

Holmgren, A., 1985. Thioredoxin. Annu. Rev. Biochem. 54, 237–271.Huang, H.H., Arscott, L.D., Ballou, D.P., Williams Jr., C.H., 2008a. Acid–base catalysis in

the mechanism of thioredoxin reductase from Drosophila melanogaster. Biochemis-try 47, 1721–1731.

Huang, H.H., Arscott, L.D., Ballou, D.P., Williams, C.H., 2008b. Function of Glu-469′ in theacid–base catalysis of thioredoxin reductase from Drosophila melanogaster. Bio-chemistry 47, 12769–12776.

Juliann, G.K., George, C.T., 1998. Heat shock protein 70 kDa: molecular biology, bio-chemistry and physiology. Pharmacol. Ther. 80, 183–201.

Jung, H.B., Yun, S.T., Mayer, B., Kim, S., Park, S.S., Lee, P.K., 2005. Transport andsediment-water partitioning of trace metals in acid mine drainage: an examplefrom the abandoned Kwangyang Au-Ag mine area, South Korea. Environ. Geol.48, 437–449.

Kanzok, S.M., Fechner, A., Bauer, H., Ulschmid, J.K., Müller, H.M., Botella-Munoz, J.,Schneuwly, S., Schirmer, R.H., Becker, K., 2001. Substitution of the thioredoxin sys-tem for glutathione reductase in Drosophila melanogaster. Science 291, 643–646.

Kim, J., Kim, S., An, K.W., Choi, C.Y., Lee, S., Choi, K., 2010. Molecular cloning of Daphniamagna catalase and its biomarker potential against oxidative stress. Comp. Bio-chem. Physiol. C 152, 263–269.

Korte, F., 1983. Ecotoxicology of cadmium: General overview. Ecotoxicol. Environ. Saf.7, 3–8.

Lee, S.B., Choi, J., 2006. Multiple level evaluation of nonylphenol toxicity in 4th instarlarvae of Chironomus riparius (Diptera, chironomidae). Environ. Toxicol. Chem.25, 3006–3014.

Lindquist, S., Craig, E.A., 1988. The heat-shock protein. Annu. Rev. Genet. 22, 631–677.Liu, J., Qian, S.Y., Guo, Q., Jiang, J., Waalkes,M.P., Mason, R.P., Kadiiska, K.B., 2008. Cadmium

generates reactive oxygen and carbon centered radical species in rats: insights from invivo spin-trapping studies. Free Radic. Biol. Med. 45, 475–481.

Lucan-Bouché, M.L., Habets, F., Biagianti-Risbourg, S.V., 2000. Toxic Effects and Bioac-cumulation of Cadmium in the Aquatic Oligochaete Tubifex tubifex. Ecotoxicol. En-viron. Saf. 46, 246–251.

Martinez, E.A., Moore, B.C., Schaumloffel, J., Dasgupta, N., 2003. Morphological abnor-malities in Chironomus tentans exposed to cadmium and copper-spiked sediments.Ecotoxicol. Environ. Saf. 55, 204–212.

Matsui, M., Oshima, M., Oshima, H., Takaku, K., Maruyama, T., Yodoi, J., Taketo, M.M.,1996. Early embryonic lethality caused by targeted disruption of the mouse thior-edoxin gene. Dev. Biol. 178, 179–185.

Murugavel, P., Pari, L., Sitasawad, S.L., Kumar, S., Kumar, S., 2007. Cadmium induced mi-tochondrial injury and apoptosis in vero cells: protective effect of diallyl tetrasul-fide from garlic. Int. J. Biochem. Cell Biol. 39, 161–170.

Mustacich, D., Powis, G., 2000. Thioredoxin reductase. Biochem. J. 346, 1–8.Nair, P.M.G., Choi, J.H., 2011a. Identification characterization and expression profiles of

Chironomus riparius glutathione S-transferase (GST) genes in response to cadmiumand silver nanoparticles exposure. Aquat. Toxicol. 101, 550–560.

Nair, P.M.G., Choi, J., 2011b. Characterization of a ribosomal protein L15 cDNA fromChironomus riparius (Diptera; Chironomidae): Transcriptional regulation by cad-mium and silver nanoparticles. Comp. Biochem. Physiol. B 159, 157–162.

Nair, P.M.G., Park, S.Y., Choi, J., 2011a. Expression of catalase and glutathione S-transferasegenes in Chironomus riparius on exposure to cadmium and nonylphenol. Comp. Bio-chem. Physiol. C 154, 399–408.

Nair, P.M.G., Park, S.Y., Choi, J., 2011b. Analyses of Expressed Sequence Tags fromChironomus riparius using pyrosequencing: Molecular Ecotoxicology Perspec-tive. Environ. Health Toxicol. http://dx.doi.org/10.5620/eht.2011.26.e2011010.

Nishimoto, M., Sakaue, M., Hara, S., 2006. Short-interfering RNA-mediated silencing ofthioredoxin reductase alters the sensitivity of HeLa cells toward cadmium. Biol.Pharm. Bull. 29, 543–546.

Nriagu, J.O., Wong, H.K.T., Lawson, G., Daniel, P., 1998. Saturation of ecosystems withtoxic metals in Sudbury basin,Ontario, Canada. Sci. Total Environ. 233, 99–117.

OECD, 2001. Organization for Economic Cooperation and Development. Guideline for test-ing of chemicals, sediment-water chironomid toxicity test using spiked sediment. 218.

139P.M.G. Nair, J. Choi / Comparative Biochemistry and Physiology, Part B 161 (2012) 134–139

Pratap, H.B., Wendelaar Bonga, S.E., 1990. Effects of water-bornecadmiumon plasmacortisol and glucose in cichlid fish Oreochromis mossambicus. Comp. Biochem. Physiol.C 95, 313–317.

Risso-de Faverney, C., Devaux, A., Lafaurie, M., Girard, J.P., Bailly, B., Rahmani, R., 2001.Cadmium induces apoptosis and genotoxicity in rainbow trout hepatocytesthrough generation of reactive oxygen species. Aquat. Toxicol. 53, 65–76.

Sakurai, A., Nishimoto, M., Himeno, S., Imura, N., Tsujimoto, M., Kunimoto, M., Hara, S.,2005. Transcriptional regulation of thioredoxin reductase 1 expression by cadmiumin vascular endothelial cells: Role of NF-E2-related factor-2. J. Cell. Physiol. 203,529–537.

Sandhu, N., Vijayan, M.M., 2011. Cadmium-mediated disruption of cortisol biosynthesisinvolves suppression of corticosteroidogenic genes in rainbow trout. Aquat. Toxicol.103, 92–100.

Sastry, K.V., Subhadra, K., 1982. Effect of cadmium on some aspects of carbohydratemetabolism in a freshwater catfish Heteropneustes fossilis. Toxicol. Lett. 14, 45–55.

Satarug, S., Baker, R., Urbenjapol, S., Haswell-Elkins, M., Reilly, P., Williams, D., Moore,M., 2003. A global perspective on cadmium pollution and toxicity in nonoccupa-tionally exposed population. Toxicol. Lett. 137, 65–83.

Schallreuter, K.U., Wood, J.M., 1986. The role of thioredoxin reductase in the reductionof free radicals at the surface of the epidermis. Biochem. Biophys. Res. Commun.136, 630–637.

Shaikh, Z.A., Vu, T.T., Zaman, K., 1999. Oxidative stress as a mechanism of chroniccadmium-induced hepatotoxicity and renal toxicity and protection by antioxidants.Toxicol. Appl. Pharmacol. 154, 256–263.

Snell, T.W., Brogdon, S.E., Morgan, M.B., 2003. Gene expression profiling in ecotoxicology.Ecotoxicology 12, 475–483.

Soares, S.S.,Martins, H., Gutierrez-Merino, C., Aureliano,M., 2008. Vanadiumand cadmiumin vivo effects in teleost cardiac muscle: metal accumulation and oxidative stressmarkers. Comp. Biochem. Physiol. C 147, 168–178.

Stohs, S.J., Bagchi, D., 1995. Oxidative mechanisms in the toxicity of metal ions. FreeRadic. Biol. Med. 18, 321–336.

Stohs, S.J., Bagchi, D., Hassoun, E., Bagchi,M., 2000. Oxidativemechanisms in the toxicity ofchromium and cadmium ions. J. Environ. Pathol. Toxicol. Oncol. 19, 201–213.

Suntres, Z.E., 2002. Role of antioxidants in paraquat toxicity. Toxicology 180, 65–77.Tamura, T., Stadtman, T.C., 1996. A new selenoprotein from human lung adenocarcinoma

cells: purification, properties, and thioredoxin reductase activity. Proc. Natl. Acad. Sci.U. S. A. 93, 1006–1011.

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary GeneticsAnalysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.

Waisberg, M., Joseph, P., Hale, B., Beyersmann, D., 2003. Molecular and cellular mech-anisms of cadmium carcinogenesis. Toxicology 192, 95–117.

Wang, Y., Fang, J., Stephen, S.L., Rao, K.M.K., 2004. Cadmium inhibits the electron trans-fer chain and induces reactive oxygen species. Free Radic. Biol. Med. 36,1434–1443.

Williams Jr., C.H., 1995. Mechanism and structure of thioredoxin reductase fromEscherichia coli. FASEB J. 9, 1267–1276.

Yalin, S., Comelekoglu, U., Bagis, S., Sahin, N.O., Ogenler, O., Hatungil, R., 2006. Acute effectof single-dose cadmium treatment on lipid peroxidation and antioxidant enzymes inovariectomized rats. Ecotoxicol. Environ. Saf. 65, 140–144.

Yang, H., Kang, M., Guo, X., Xu, B., 2010. Cloning, structural features, and expressionanalysis of the gene encoding thioredoxin reductase 1 from Apis cerana cerana.Comp. Biochem. Physiol. B 156, 229–236.