Regents Biology 2006-2007

Genetic EngineeringBiotechnology

Regents Biology

We have been manipulating DNA for generations! Artificial breeding

creating new breeds of animals & new crop plants to improve our food

Regents Biology

Animal breeding

Regents Biology

Breeding food plants “Descendants” of the wild mustard

the “Cabbage family”

Regents Biology

Breeding food plants

Evolution of modern corn (right) from ancestral teosinte (left).

Regents Biology

A Brave New World

Regents Biology

The code is universal Since all living

organisms… use the same DNA use the same code

book read their genes

the same way

Regents Biology

TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT

human genome3.2 billion bases

Regents Biology

Can we mix genes from one creature to another?

YES!

Regents Biology

Mixing genes for medicine… Allowing organisms to produce new

proteins bacteria producing human insulin bacteria producing human growth hormone

Regents Biology

How do we do mix genes? Genetic engineering

find gene cut DNA in both organisms paste gene from one creature into other

creature’s DNA insert new chromosome into organism organism copies new gene as if it were its

own organism reads gene as if it were its own organism produces NEW protein:

Remember: we all use the same genetic code!

Regents Biology

Cutting DNA

DNA “scissors” enzymes that cut DNA restriction enzymes

used by bacteria to cut up DNA of attacking viruses

EcoRI, HindIII, BamHI

cut DNA at specific sites enzymes look for specific base sequences

GTAACGAATTCACGCTTCATTGCTTAAGTGCGAAGTAACG|AATTCACGCTTCATTGCTTAA|GTGCGAA

Regents Biology

Restriction enzymes Cut DNA at specific sites

leave “sticky ends”

GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA

GTAACGAATTCACGCTTCATTGCTTAAGTGCGAA

restriction enzyme cut site

restriction enzyme cut site

Regents Biology

Sticky ends Cut other DNA with same enzymes

leave “sticky ends” on both can glue DNA together at “sticky ends”

GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA

gene you want

GGACCTG AATTCCGGATACCTGGACTTAA GGCCTAT

chromosome want to add

gene to

GGACCTG AATTCACGCTTCCTGGACTTAA GTGCGAA

combinedDNA

Regents Biology

Sticky ends help glue genes together

TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTTAACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA

gene you want cut sitescut sites

AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTTTTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA

chromosome want to add gene tocut sites

AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene

sticky ends

chromosome with new gene addedTAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC

CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

sticky ends stick together

DNA ligase joins the strands Recombinant DNA molecule

Regents Biology

Why mix genes together?

TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC

CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

Gene produces protein in different organism or different individual

aa aaaa aa aa aa aa aa aa aa

“new” protein from organism ex: human insulin from bacteria

human insulin gene in bacteria

bacteria human insulin

How can bacteria read human DNA?

Regents Biology

Uses of genetic engineering Genetically modified organisms (GMO)

enabling plants to produce new proteins Protect crops from insects: BT corn

corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)

Extend growing season: fishberries strawberries with an anti-freezing gene from

flounder

Improve quality of food: golden rice rice producing vitamin A

improves nutritional value

Regents Biology

Bacteria Bacteria are great!

one-celled organisms reproduce by mitosis

easy to grow, fast to grow generation every ~20 minutes

Regents Biology

Bacterial DNA Single circular chromosome

only one copy = haploid no nucleus

Other DNA = plasmids!

bacteriachromosome

plasmids

Regents Biology

There’s more… Plasmids

small extra circles of DNA carry extra genes that bacteria can use can be swapped between bacteria

bacterial sex!! rapid evolution = antibiotic resistance

can be picked up from environment

Regents Biology

How can plasmids help us? A way to get genes into bacteria easily

insert new gene into plasmid insert plasmid into bacteria = vector bacteria now expresses new gene

bacteria make new protein

+

transformedbacteriagene from

other organism

plasmid

cut DNA

recombinantplasmid

vector

glue DNA

Regents Biology

Grow bacteria…make more

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

Regents Biology

Applications of biotechnology

Regents Biology 2006-2007

I’m a very special pig!

Got any Questions?

Regents Biology 2006-2007

BiotechnologyGel Electrophoresis

Regents Biology

Many uses of restriction enzymes… Now that we can cut DNA with

restriction enzymes… we can cut up DNA from different

people… or different organisms… and compare it

why? forensics medical diagnostics paternity evolutionary relationships and more…

Regents Biology

Comparing cut up DNA How do we compare DNA fragments?

separate fragments by size

How do we separate DNA fragments? run it through a gelatin gel electrophoresis

How does a gel work?

Regents Biology

Gel electrophoresis A method of separating

DNA in a gelatin-like material using an electrical field DNA is negatively charged when it’s in an electrical

field it moves toward the positive side

+–

DNA

“swimming through Jello”

Regents Biology

DNA moves in an electrical field… so how does that help you compare DNA

fragments? size of DNA fragment affects how far it travels

small pieces travel farther

large pieces travel slower & lag behind

Gel electrophoresis

+–

DNA

“swimming through Jello”

Regents Biology

Gel Electrophoresis

longer fragments

shorter fragments

powersource

completed gel

gel

DNA &restriction enzyme

wells

-

+

Regents Biology

Running a gel

1 2

cut DNA with restriction enzymes

fragments of DNAseparate out based

on size

3

Stain DNA ethidium bromide

binds to DNA fluoresces under

UV light

Regents Biology

DNA fingerprint Why is each person’s DNA pattern different?

sections of “junk” DNA doesn’t code for proteins made up of repeated patterns

CAT, GCC, and others

each person may have different number of repeats

many sites on our 23 chromosomes with different repeat patterns

GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTTCGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTTCGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA

Regents Biology

Allele 1GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTTCGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

repeats

DNA patterns for DNA fingerprintscut sitescut sites

GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTTCGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA

1 2 3

DNA – +allele 1

Cut the DNA

Regents Biology

Person 1GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTTCGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

Differences between peoplecut sitescut sites

DNA – +person 1

Person 2: more repeats

GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCTACGCTTCGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA

DNA fingerprint

person 2

1 2 3

Regents Biology

Uses: Evolutionary relationships Comparing DNA samples from different

organisms to measure evolutionary relationships

–

+

DNA

1 32 4 5 1 2 3 4 5

turtle snake rat squirrel fruitfly

Regents Biology

Uses: Medical diagnostic Comparing normal allele to disease allele

chromosome with disease-causing

allele 2

chromosomewith normal

allele 1 –

+

allele 1allele 2

DNA

Example: test for Huntington’s disease

Regents Biology

Uses: Forensics Comparing DNA sample from crime

scene with suspects & victim

–

+

S1

DNA

S2 S3 V

suspects crime scene sample

Regents Biology

DNA fingerprints Comparing blood

samples on defendant’s clothing to determine if it belongs to victim DNA fingerprinting

Regents Biology

RFLP / electrophoresis use in forensics 1st case successfully using DNA evidence

1987 rape case convicting Tommie Lee Andrews

“standard”

“standard”

“standard”

“standard”

semen sample from rapist

semen sample from rapist

blood sample from suspect

blood sample from suspect

How can you compare DNA from

blood & from semen?RBC?

Regents Biology

Electrophoresis use in forensics Evidence from murder trial

Do you think suspect is guilty?

“standard”

blood sample 3 from crime scene

“standard”

blood sample 1 from crime scene

blood sample 2 from crime scene

blood sample from victim 2

blood sample from victim 1

blood sample from suspect OJ Simpson

N Brown

R Goldman

Regents Biology

Uses: Paternity Who’s the father?

+

DNA

childMom F1 F2–

Regents Biology 2006-2007

I’m a-glow!

Got any Questions?

Regents Biology

Using Stem Cells A stem cell is a cell that can continuously

divide and differentiate into various tissues. Some stem cells have more potential to

differentiate than others. Adults’ bodies have some multipotent cells

that can be removed, frozen or cultured, and used for medical treatments.

The cells of new embryos have more potential uses.

The use of embryos for stem cell research poses ethical problems.

An alternative source of embryonic stem cells is through SCNT (somatic cell nuclear transplant).

Regents Biology

What are Stem Cells?Stem Cells are extraordinary because:

• They can divide and make identical copies of themselves over and over again (Self-Renewal)

• Remain Unspecialized with no ‘specific’ function or become . . . .

• Specialized (Differentiated) w/ the potential to produce over 200 different types of cells in the body.

Regents Biology

The Major Types of Stem Cells

A. Embryonic Stem Cells

• From blastocysts left over from In-Vitro Fertilization in the laboratory

• From aborted fetuses

B. Adult Stem Cells

• Stem cells have been found in the blood, bone marrow, liver, kidney, cornea,

dental pulp, umbilical cord, brain, skin, muscle, salivary gland . . . .

Regents Biology http://commons.wikimedia.org/wiki/Image:Stem_cells_diagram.png

Regents Biology

Advantages and Disadvantages to Embryonic and Adult Stem Cells.

Embryonic S.C. Adult S.C.

“Pluripotent”

(can become any cell)

“Multipotent”

(“can become many but not any”)

Stable. Can undergo many cell divisions.

Less Stable. Capacity for self-renewal is limited.

Easy to obtain but blastocyst is destroyed.

Difficult to isolate in adult tissue.

Possibility of rejection?? Host rejection minimized

Regents BiologyReprinted with permission of Do No Harm. Click on image for link to website. http://www.pbs.org/newshour/bb/science/jan-june14/stemcells_01-29.html

Regents Biology

http://www.youtube.com/watch?v=7QlWBnL0zjU

Regents Biology

Why is Stem Cell Research So Important to All of Us?

Stem cells allow us to study how organisms grow and develop over time.

Stem cells can replace diseased or damaged cells that can not heal or renew themselves.

We can test different substances (drugs and chemicals) on stem cells.

We can get a better understanding of our “genetic machinery.”

Regents Biology

What Human Diseases are Currently Being Treated with Stem Cells?

Parkinson’s Disease Leukemia (Bone Marrow Transplants) Skin Grafts resulting from severe

burns

Stem Cell Therapy has the Potential to: Regenerate tissues/organs Cure diseases like diabetes, multiple

sclerosis, etc.

Regents Biology

Why the Controversy Over Stem cells?

Embryonic Stem cells are derived from extra blastocysts that would otherwise be discarded following IVF.

Extracting stem cells destroys the developing blastocyst (embryo).

-Questions for Consideration-Is an embryo a person?Is it morally acceptable to use

embryos for research?When do we become “human

beings?”

Regents Biology

Key Concept Questions How are transgenic organisms useful to human

beings? Genetic engineering has spurred the growth

of biotechnology, a new industry that is changing the way we interact with the living world

How are cloning and stem cell research related? Cloning can produce organisms that are

genetically identical to preexisting individuals. Stem cells can be used to grow new tissues.