of 23 /23
Cell Stem Cell Supplemental Information CRISPR-Cas9-Mediated Genetic Screening in Mice with Haploid Embryonic Stem Cells Carrying a Guide RNA Library Cuiqing Zhong, Qi Yin, Zhenfei Xie, Meizhu Bai, Rui Dong, Wei Tang, Yu-Hang Xing, Hongling Zhang, Suming Yang, Ling-Ling Chen, Marisa S. Bartolomei, Anne Ferguson-Smith, Dangsheng Li, Li Yang, Yuxuan Wu, and Jinsong Li

Download (6.83 MB )

Embed Size (px)

Text of Download (6.83 MB )

  • Cell Stem Cell

    Supplemental Information

    CRISPR-Cas9-Mediated Genetic Screening

    in Mice with Haploid Embryonic Stem Cells

    Carrying a Guide RNA Library

    Cuiqing Zhong, Qi Yin, Zhenfei Xie, Meizhu Bai, Rui Dong, Wei Tang, Yu-Hang Xing,

    Hongling Zhang, Suming Yang, Ling-Ling Chen, Marisa S. Bartolomei, Anne

    Ferguson-Smith, Dangsheng Li, Li Yang, Yuxuan Wu, and Jinsong Li

  • 1. Supplemental Figures and Legends:

    Figure S1. Deficiency of Dlk1-Gtl2 Cluster in H19DMR AGH Cells and Their SC Pups,

    Related to Figure 1 and Table 1. (A) Genotyping analysis of derived H19DMR AGH cell

    lines. Note that all three lines carry mutant H19-DMR but not WT H19-DMR. (B) Around

    80% of oocytes reconstructed with H19DMR AGH cells (ICAHCI) (right) cleaved into

    two-cell embryos the day after activation, at efficiency similar to that of round spermatid injection (ROSI) (left). Scale bar, 100 m. (C) Newborn SC pups from ICAHCI using

    H19DMR AGH-1, 2 and 3 cells. Pups and placentas obtained by C-section from

    pseudopregnant mice at E19.5 are shown. Passage numbers are indicated in bracket. Asterisks indicate the growth-retarded SC pups and placentas. (D) Genotyping analysis of SC pups

    derived from H19DMR AGH cells. Note that all tested SC pups carry both mutant H19-DMR

    and WT H19-DMR while the control pup carries only WT H19-DMR. (E) Transcription analysis of imprinted genes (Gtl2 and Dlk1) in important organs of growth-retarded (n=3) and

    survived (n=3) SC mice generated from H19DMR AGH cells. The transcription level of Gtl2

    (right) was higher in lung and heart of growth-retarded SC mice compared with normal SC mice and control newborn mice. The expression values (means SD) were normalized to that of Gapdh. (F) Growth-retarded pups harbored severe loss of the IG-DMR methylation imprint. Methylation state of the IG-DMR in a WT pup (top), a normal SC pup (middle) and a retarded SC pup (bottom). Open and filled circles represent unmethylated and methylated CpG sites, respectively. (G) Cobra assay of IG-DMR in retarded and normal pups. (H)

    Methylation state in IG-DMR of H19DMR AGH cells.

  • Figure S2. DKO-AG-haESCs Are Efficient Donors for SC mice Generation, Related to

    Figure 1, 2 and Table 1. (A) Genotyping analysis of H19DMR- IGDMR-AGH cells derived

    after removal of IG-DMR in H19DMR-AGH cells. (B) The sequence of one DKO-AG-haESC

    line (represented by H19DMR- IGDMR-AGH-4). The sgRNA-targeting sequences are

    underlined. The deleted sequence is marked in black. Note that a region of 4.161 kb at

    IG-DMR is deleted. (C) Two-cell embryos generated by ICAHCI of H19DMR- IGDMR-AGH

    cells. Scale bar, 100 m. (D) Genotyping analysis of SC pups. (E) SC pups from ICAHCI

    using IGDMR AGH-2. Pups and placentas obtained by C-section from pseudopregnant mice

    at E19.5 are shown. Asterisks indicate the growth-retarded SC pups and placentas. (F)

    Methylation state of H19-DMR in IGDMR AGH cells. (G) Methylation state of H19-DMR in

    normal and retarded SC pups derived from IGDMR AGH-2. (H) The sequence of one

    DKO-AG-haESC line (represented by IGDMR- H19DMR-AGH-2). The deleted sequence is

    marked in black. Note that a region of 4.042 kb at H19-DMR is deleted. (I) SC pups from

    ICAHCI using IGDMR- H19DMR-AGH-2 cells. (J) Genotyping analysis of SC pups derived

    from IGDMR- H19DMR-AGH-2 cells.

  • Figure S3. H19 and IG DMRs Are Two Barriers to High-Efficiency Generation of SC Mice in AG-haESCs, Related to Figure 2 and Table 1. (A) The sequences of two DKO-AG-haESC lines derived after removing H19-DMR and IG-DMR in WT AG-haESCs

    (AGH-OG-3). (B) SC pups from ICAHCI using H19DMR-IGDMR-AGH-OG3-1 cells. (C)

    Genotyping analysis of SC pups derived from H19DMR-IGDMR- AGH-OG3-2 cells. (D)

    Transcription analysis of imprinted genes (H19, Igf2, Gtl2 and Dlk1) in DKO-AG-haESCs and normal AG-haESCs. Note that the transcription levels of H19 and Gtl2 in AGH-OG-3 were decreased after removal of H19 and IG DMRs. In contrast, the transcription levels of Igf2 and Dlk1 in AGH-OG-3 were increased after removal of H19 and IG DMRs. The expression values (means SD) were normalized to that of Gapdh. The experiments were repeated for three times. (E) Bigwig track of Gtl2 and H19. RNA-seq of WT AG-haESCs and DKO-AG-haESCs reveals a low expression level of Gtl2 and H19 in DKO-AG-haESCs compared with WT AG-haESCs. (F) Methylation of H19-Igf2 and Dlk1-Dio3 cluster regions. The heights of vertical grey lines represent the read depth for CpG sites, with at most 30 reads. The heights of vertical red lines represent methylation levels for methylated CpG sites, ranging from 0 to 1. (G) Methylation profiles of DKO-AG-haESCs, WT AG-haESCs and round spermatids based on imprinted genes (Yamaguchi et al., 2013).

  • Figure S4. Multiple Gene Knockout in DKO-AG-haESCs, Related to Figure 3 and Table 1. (A) The sequences of Tet1, 2 and 3 in Tet-TKO-DAH-3 cells. Deletions are indicated with (-). Insertions are highlighted with white background. (B) SC pups from ICAHCI using Tet-TKO-DAH-3 cells. Passage number is indicated in bracket. (C) The sequences of p53, p63 and p73 in p53-TKO-DAH-1 cells. Deletions are indicated with (-). Insertions are highlighted with white background. (D) SC pups from ICAHCI using p53-TKO-DAH-1 cells. Passage number is indicated in bracket. (E) DNA sequence of PCR products amplified from p53, p63 and p73 genes of one SC pup generated from p53-TKO-DAH-1 and one SC pup from p53-TKO-DAH-2. Two peaks can be observed in the sequences of the SC pups carrying heterozygous mutations in p53, p63 and p73.

  • Figure S5. Multiple Gene Knockin in DKO-AG-haESCs, Related to Figure 3 and Table 1. (A) Schematic for exogenous double double-stranded vectors, including Tet1-EGFP, Tet2-mCherry and Tet3-ECFP. (B) Genotyping analysis of DKO-AGH-haESCs carrying Tet1-EGFP knockin. (C) Genotyping analysis of DKO-AGH-haESCs carrying Tet3-ECFP knockin. (D) Genotyping analysis of Tet1&3-KI-DAH-1 cells. (E) The sequences of Tet1-EGFP and Tet3-ECFP in Tet1&3-KI-DAH-1 cells. The border sequences on genome are labeled in black. The sequences of gene encoding EGFP and ECFP are labeled in red. The sequences of left arm (LA) and right arm (RM) for homology recombination are labeled in blue. The sequence of P2A peptide is labeled in yellow. The sequence of restriction enzyme cutting site is labeled in purple. (F) SC pups from ICAHCI using Tet1&3-KI-DAH-1 cells (passage 40) at 3 wks with a foster mother (ICR strain). (G) Genotyping analysis of SC pups from Tet1&3-KI-DAH-1 cells. (H) The sequence of Tet2-mCherry in Tet-TKI-DAH-1 cells. The border sequences on genome are labeled in black. The sequences of gene encoding EGFP and ECFP are labeled in red. The sequences of left arm (LA) and right arm (RM) for homology recombination are labeled in blue. The sequence of P2A peptide is labeled in yellow. The sequence of restriction enzyme cutting site is labeled in purple. (I) Newborn SC pups from Tet-TKI-DAH-2 cells (passage 50). (J) Genotyping of SC pups from Tet-TKI-DAH-1 cells.

  • Figure S6. Generation of Biallelic Mutant Mice by DKO-AG-haESC Carrying sgRNA Library, Related to Figure 5 and Table 2. (A) Schematic for generation of biallelic mutant mice by injection of haploid cells carrying sgRNAs, which had been transiently transfected with pX330-mCherry plasmids, into mature oocytes, followed by injection of Cas9 mRNA into reconstructed oocytes (strategy of Lenti-sgRNA+pX330+Cas9 injection). (B) PCR analysis of sgRNA in haploid cell clones expanded from single cells. All tested clones carry sgRNA. (C) SC pups from DKO-AG-haESCs carrying sgRNA library. (D) PCR analysis of sgRNA in SC pups. (E) Sequencing analysis of biallelic mutant mice generated via the strategy of Lenti-sgRNA+pX330+Cas9 injection. Represented by one SC mouse carrying biallelic mutant Slco5a1 gene, indicated by more than two peaks in the sequences of PCR products. (F) Sequence of the targeted Slco5a1 gene in the mouse-tail by TA cloning and sequencing analysis. 18 of 20 tested clones carry frameshift indel mutations. Deletions are indicated with (-). Insertions are highlighted with white background. (G) Summary of TA cloning and sequencing analysis of 4 biallelic mutant mice. Over 70% tested clones carry frameshift indels.

  • 2. Supplemental Tables:

    Table S1. Detailed Information for In Vivo Development of ICAHCI Embryos

    from Different AG-haESCs, Related to Figure 1, 2 and Table 1

    Donor Cell Type

    Haploid ES Cell Line

    Passage Number

    No. of Embryos Transferred

    No. of Growth-retarded Pups (% of Transferred Embryos)

    No. of Normal Pups (% of Transferred Embryos)

    H19-DMR KO AG-haESCs

    H19DMR-AGH-1

    p8 375 10 (2.7) 10 (2.7) p9 180 9 (5.0) 13 (7.2)

    H19DMR-AGH-2

    p8 210 5 (2.4) 6 (2.9) p9 116 2 (1.7) 4 (3.4) p11 123 3 (2.4) 3 (2.4)

    H19DMR-AGH-3

    p8 271 1 (0.4) 29 (10.7) p17 168 9 (5.4) 21 (12.5)

    IG-DMR KO AG-haESCs

    IGDMR-AGH-1

    p14 84 0 0 p15 100 4 (4) 0 p17 54 4 (7.4) 1 (1.9) p23 81 1 (1.2) 0

    IGDMR-AGH-2

    p8 180 3 (1.7) 3 (1.7)

    H19DMR-IGDMR-AGH Cells

    H19DMR-IGDMR-AGH -1

    p19 175 1 (0.6) 44 (25.1)

    H19DMR-IGDMR-AGH-2

    p19 245 2 (0.8) 56 (22.9)

    H19DMR-IGDMR-AGH-3

    p29 204 0 46 (22.5)

    H19DMR-IGDMR-AGH-4

    p29 165 1 (0.6) 32 (19.4) p33 150 0 32 (21.3)

    IGDMR-H19DMR-AGH Cells

    IGDMR-H19DMR-AGH-1

    p24 120 1 (0.8) 26 (21.7)

    IGDMR-H19DMR-AGH-2

    p24 180 2 (1.1) 47 (26.1) p28 244 2 (1.3) 32 (22.2)

    H19DMR-IGDMR-AGH-OG3 Cells

    H19DMR-IGDMR-AGH-OG3-1

    p26 118 0 17 (14.4)

    H19DMR-IGDMR-AGH-OG3-2

    p30 192 1 (0.5) 36 (18.8) p37 200 0 34 (17)

    WT AG-haESCs

    AGH-OG-3a p12 82 0 1 (1.2) p20 93 4 (4.3) 0

  • p24 140 2 (1.4) 5 (3.6) p26 64 0 1 (0.9)

    AGH-2b p19 114 0 1 (0.9) p20 62 3 (4.8) 0

    AGH-3b p9 118 0 1 (1.2)

    a: AG-haESCs generated in this study.

    b: AG-haESCs generated in our previous study (Yang et al., 2012)

  • Table S2Off-Target Analysis in DKO-AG-haESCs, Related to Figure 1 and 2

    Targeted Site and

    Sequence

    Potential Off-target Sites

    Sequence Tested Cell Line Indel Mutation

    IG-DMR-sgRAN1: chr12:110

    765036 CGTACAGAGCTCCATGGCACAGG

    chr8:116672129 CGCCCAGAGTTCCATGGCACCAG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr4:71893313 CTTCCAGAGCTCCATGGCAGTAG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr4:126538001 CTGTCAGGGCTCCATGGCACCAG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr17:41076900 AGGTCAGAGGTCCATGGCACAAG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr18:47648088 CTGACACAGCCCCATGGCACTGG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr3:95480895 AGGACAGAGGTCAATGGCACAAG

    H19DMR-IGDMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr1:160441184 GGCACAGAGGTC

    CATGGCCCAGG H19DMR-IGDMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr3:94252225 TGTACAGCCCTCC

    ATGGCTCAAG H19DMR-IGDMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr17:35793498 GGCTCAGAGCTC

    CCTGGCACTGG H19DMR-IGDMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr6:90569642 CGTACAGGGCTC

    CAAGGGAGAGG H19DMR-IGDMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr11:77992776 CGCACAGAGCAC

    CCTGGGACTGG H19DMR-IGDMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N

  • Targeted Site and

    Sequence

    Potential Off-target Sites

    Sequence Tested Cell Line Indel Mutation

    IG-DMR-sgRNA2: chr12:110

    769204 CTGCTTAGAGGTACTACGCTAGG

    chr18:4314724 ATGCTTACAGGTACTATGCTTGG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr1:92909983 CTGGCTATAGGTTCTACGCTAGG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr13:97194693 AAGCTGAGAGGTACTACGCCTGG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr7:132553861 CTTCTTGAAGGTACTAAGCTCAG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr13:14524990 GTACTTAGAGTTACTATGCTAAG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr13:45267048 CTGATTACAGGTTCTAAGCTTGG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr9:120725277 CTTCTTGGAGTTACTAGGCTAAG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr16:31987622 CTACTTGGAGGTTCTAAGCTAAG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr10:4532468 CTGCTAAAAGATACAACGCTCGG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr17:85478026 CAGCTTACAGGTTCTTCGCTTGG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr7:133963384 GTGCTTTGTGGTATTACGCTGGG

    H19DMR-IGDMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

  • Targeted Site and

    Sequence

    Potential Off-target Sites

    Sequence Tested Cell Line Indel Mutation

    H19-DMR-sgRNA1:

    chr7:149768813

    CATGAACTCAGAAGAGACTGA

    GG

    chr7:103320976 AAAGAACTCAGAAGAGACTGGAG

    IGDMR-H19DMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 Y

    chr12:105735036 CAGGAATTCAGAAGAGACTGGGG

    IGDMR-H19DMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr7:125049085 ACTGAACACAGAAGAGACTGGAG

    IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr3:56173560 CATGAACTCCGG

    AGAGACTGAAG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr3:32443165 GATGAACTAGGA

    AGAGACTGAGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr8:126921829 CTTGAAGTCAGG

    AGAGACTGTGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr10:80037252 CCTGCACAGAGA

    AGAGACTGGGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr2:8044072 AAAGAACTGGGA

    AGAGACTGAGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr9:118786319 CGGGAACCCAGA

    AGAGACTCTGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr4:11454132 CACGATCTCGGA

    AGAGACTCTGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr11:48661555 CTTCATCTCAGAT

    GAGACTGTGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N

  • Targeted Site and

    Sequence

    Potential Off-target Sites

    Sequence Tested Cell Line Indel Mutation

    H19-DMR-sgRNA2:

    chr7:149764924

    AGGTGAGAACCACTGCTGAGT

    GG

    chrX:160504351 AGTTGAGAACCACTGCTTAGGGG

    IGDMR-H19DMR-AGH-2 Y IGDMR-H19DMR-AGH-OG3-2 Y

    chr12:54007189 AGATGATAAGCACTGCTGAGAAG

    IGDMR-H19DMR-AGH-2 N IGDMR-H19DMR-AGH-OG3-2 N

    chr1:93014037 AAGTGAGCCCCACTGCTGAGAGG

    IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr18:83528678 TGGGCAGAAGCA

    CTGCTGAGAAG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr3:127517958 GTGTCAGAAACA

    CTGCTGAGAAG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr7:137266149 AGGAGACAGCCA

    CTGCTGAGCAG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr18:69559398 AGGTCAGTACCA

    ATGCTGAGGGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chrX:47778863 AGAAGAGAGACA

    CTGCTGAGAGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr2:163460149 AGGTATGACTCA

    CTGCTGAGGGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr7:29681873 AGGTGAGCACCA

    CTGCCCAGGGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N chr7:148268503 ACGTCAGATCCA

    CGGCTGAGCGG IGDMR-H19DMR-AGH-2 N

    IGDMR-H19DMR-AGH-OG3-2 N

    Mismatchs are highlighted with underlie. PAM is marked in blue. N: non-indel mutation. Y: indel mutation.

  • Table S3. Detailed Information for In Vivo Development of ICAHCI Embryos

    from Gene-modified DKO-AG-haESCs, Related to Figure 3 and Table 1

    Donor Cell Type

    Haploid ES Cell Line

    Passage Number

    No. of Embryos Transferred

    No. of Growth-retarded Pups (% of Transferred Embryos)

    No. of Normal Pups (% of Transferred Embryos)

    DKO-AG-haESCs Carrying Tet1, 2 and 3 Mutations

    Tet-TKO-DAH-1

    p37 131 2 (1.5) 17 (13)

    Tet-TKO-DAH-2

    p37 54 0 9 (16.7)

    Tet-TKO-DAH-3

    p36 174 1 (0.6) 27 (15.5)

    Tet-TKO-DAH-4

    p35 48 1 (2.1) 6 (12.5)

    DKO-AG-haESCs Carrying p53, p63 and p73 Mutations

    p53-TKO-DAH-1

    p42 182 1 (0.5) 34 (18.7) p44 186 0 32 (17.2)

    p53-TKO-DAH-2

    p41 154 0 23 (14.9) p42 48 1 (2.1) 8 (16.7)

    p53-TKO-DAH-3

    p46 90 0 14 (15.6)

    DKO-AG-haESCs Carrying Tet1 and 3 Knockin

    Tet1&3-KI-DAH-1

    p40 58 1 (1.7) 10 (17.2)

    p47 80 0 11 (13.8)

    DKO-AG-haESCs Carrying Tet1, 2 and 3 Knockin

    Tet-TKI-DAH-1

    p47 48 1 (2.1) 8 (16.7) p49 174 0 32 (19)

    Tet-TKI-DAH-2

    p47 96 3 (3) 10 (10.4) p50 136 1 (0.7) 22 (16.2)

    Tet-TKI-DAH-3

    p49 48 0 8 (16.7)

    Tet-TKI-DAH-4

    p50 102 1 (1.0) 14 (13.7)

    Tet-TKI-DAH-5

    p51 174 0 39 (22.4)

    Tet-TKI-DAH-6

    p51 96 0 18 (18.8)

  • Table S4. Results of TA Cloning and Sequencing Analysis of Biallelic Mutant

    Mice Generated by DKO-AG-haESCs Carrying SgRNA Library, Related to

    Figure 4, 5 and Table 2

    Strategies Mutant Genes

    No. of Tested Clones

    No. of Clones with 3n+1/2 bp Deletions or Insertions (n0) (% of Total Tested Clones)

    No. of Clones with 3n bp Deletions or Insertions (n0) (% of Total Tested Clones)

    No. of Clones with WT Sequence or Replacement (% of Total Tested Clones)

    Lenti-sgRNA+Cas9 injection

    Mthfd2 10 4 3 3 Eif2ak4 16 7 0 9 4930444A02Rik 11 8 0 3 Cd53 16 8 0 8 Olfr1053 17 12 5 0 Mthfs 14 8 0 6 1700024P16Rik 18 17 0 1 Subtotal 102 64 (62.7) 8 (7.8) 30 (29.4)

    Lenti-sgRNA+pX330+Cas9 injection

    0610007P14Rik 10 6 0 4 Wdr47 4 3 0 1 Hyal2 30 27 3 0 Xlr3c 17 13 0 4 Slco5a1 20 15 3 2 Subtotal 81 64 (79) 6 (7.4) 11 (13.5)

    Lenti-Cas9+lenti-sgRNA

    Gphn 13 4 8 1 Gm572 5 5 0 0 Polm 26 24 0 2 Kng1 31 27 1 3 Slc2a12 10 7 0 3 Ddrgk1 9 0 9 0 Ccdc75 7 4 1 2 Trim7 27 21 1 5 Scube1 27 21 2 4 Nmu 9 6 0 3 Zfp202 11 5 3 3 Rbp1 11 7 0 4 Smyd4 12 4 1 7

  • Sec23ip 13 7 0 6 Mlana 7 2 1 4 D2hgdh 7 7 0 0 F10 11 9 0 2 Prom1 10 8 1 1 Zfp872 12 1 7 4 Sar1b 10 8 0 2 Ankrd22 13 12 0 1 Tead2 12 5 7 0 C1ql4 13 9 0 4 Crlf2 12 4 4 4 Vipas39 9 8 0 1 Pml 11 9 0 2 Subtotal 338 224 (66.3) 46 (13.6) 68 (20.1)

  • Table S5. Primer Information, Related to Experimental Procedures Primer Name Sequence (5-3) Application Reference Gapdh-F CACTCTTCCACCTTCGATGC

    Realtime PCR

    (Inoue et al., 2002)

    Gapdh-R CTCTTGCTCAGTGTCCTTGC Igf2-F CTAAGACTTGGATCCCAGAACC Igf2-R GTTCTTCTCCTTGGGTTCTTTC Gtl2-F TTGCACATTTCCTGTGGGAC Gtl2-R AAGCACCATGAGCCACTAGG Dlk-F ACTTGCGTGGACCTGGAGAA

    Realtime PCR (Ogawa et al., 2006) Dlk-R CTGTTGGTTGCGGCTACGAT

    H19-F CATGTCTGGGCCTTTGAA Realtime PCR

    (Ogawa et al., 2003) H19-R TTGGCTCCAGGATGATGT

    H19-DMR-BS-OF GAGTATTTAGGAGGTATAAGAATT Bisulfite sequencing

    (Li et al., 2004)

    H19-DMR-BS-OR ATCAAAAACTAACATAAACCCCT H19-DMR-BS-IF GTAAGGAGATTATGTTTATTTTTGG H19-DMR-BS-IR CCTCATTAATCCCATAACTAT

    IG-DMR-BS-OF TTAAGGTATTTTTTATTGATAAAATAATGTAGTTT

    Bisulfite sequencing

    (Gu et al., 2011b)

    IG-DMR-BS-OR CCTACTCTATAATACCCTATATAATTATACCATAA

    IG-DMR -BS-IF TTAGGAGTTAAGGAAAAGAAAGAAATAGTATAGT

    IG-DMR -BS-IR TATACACAAAAATATATCTATATAACACCATACAA

    H19-DR WT -F AGATGGGGTCATTCTTTTCC H19-DMR WT genotyping

    In this study

    H19-DMR WT -F ATTGCTCTTAGCTTCTGTTG H19-DMR KOF1 GCTCCCCTGGATGTTTCACT H19-DMR

    3.8K genotyping H19-DMR KOR1 ACTCCTCACCGTCCCTTTTC H19-DMR KO F2 GTGGTTAGTTCTATATGGGG Genotyping of

    deleted H19-DMR by CRISPR-Cas9

    H19-DMR KO R2 TCTTACAGTCTGGTCTTGGT

    IG-DMR KOF TGTGCAGCAGCAAAGCTAAG Genotyping of deleted IG-DMR by CRISPR-Cas9

    IG-DMR KOR ATACGATACGGCAACCAACG

    Tet1 LA-F TTTGTGTCTATGAACTACCAGTGAG Genotyping of Tet1-EGFP Knockin

    Tet1 LA-R CAGGCCCGGGGTTTTCTTC Tet1 RA-F CAACGAGAAGCGCGATCACA Tet1 RA-R TTTTGACTGATCCCAATTTGCCT Tet2 LA-F CACACCCTTCACCAACAGACG

    Genotyping of Tet2-mCherry Knockin

    Tet2 LA-R ATCTCGAACTCGTGGCCGTT Tet2 RA-F AAGACCACCTACAAGGCCAAG Tet2 RA-R GGTAGGCAAAGTGCTTTTCTAAGAC

  • Tet3 LA-F TGTTCACTGGTGAAGGCCAG Genotyping of Tet3-ECFP knockin

    Tet3 LA-R GAACAGCTCCTCGCCCTTG Tet3 RA-F TGAGCAAAGACCCCAACGAG Tet3 RA-R ATCGACAAACTTTGGGGCGA

    Lenti-sgRNA-F GTTACTCGAGCCAAGGTCGG Genotyping of SC pups generated from DKO-AG-haESCs-Carried sgRNA library

    In this study

    Lenti-sgRNA-R GACTCGGTGCCACTTTTTCA

    Cas9 RT-F CTGAGCAAGGACACCTACGA Realtime PCR

    In this study

    Cas9 RT-R CTCGGTGTTCACTCTCAGGA Realtime PCR Polm check-F TCCGATGGGAAGCCAAAAGC Polm check primer Polm check-R CGTACCGCAACCGCGAAGTA Polm check primer Scube1 check-F CCATAATAATCCACTTCCAT Scube1 check Scube1 check-R CCAACCCCTGTCCACTACCT Scube1 check Slco5a1 check-F GAGAAGTGCGAGTCAGAGTC Slco5a1 check Slco5a1 check-R ATAGGGGGGTGAGATAAAGT Slco5a1 check

  • 3. Supplemental Experimental Procedures

    Bisulphite Sequencing

    Genomic DNA was extracted from tails or FACS-derived AG-haESCs by pretreating

    with proteinase K lysis, followed by phenol-chloroform extraction. Bisulphite

    conversion was performed in agarose beads as described (Hajkova et al., 2002) or EZ

    DNA methylation Gold kit (ZYMO Research). The PCR products were cloned into

    pMD19-T vectors (Takara) and individual clones were sequenced by Invitrogen,

    Shanghai. Bisulphite primer information is presented in Table S4.

    Quantitative Reverse Transcription PCR

    Total RNA was isolated from the cells or organs using Trizol reagent (Invitrogen).

    One microgram of total RNA was reverse transcribed using a First Strand cDNA

    Synthesis kit (TOYOBO). Real-time quantitative PCR reactions were set up in

    triplicate using the SYBR Green Realtime PCR Master Mix (TOYOBO) and run on a

    Bio-Rad CFX96. All the gene expression levels were normalized to the internal

    standard gene, Gapdh. The primer sequences are listed in Table S4.

    Cobra Assay

    Approximately 100 ng of the purified PCR products was digested with restriction

    enzyme. TaqI (T/CGA) was used to digest bisulfate-treated IG-DMR for its

    methylation analysis.

    RNA-seq and Gene Expression Analysis

    RNA-Seq libraries were prepared from total RNAs under different treatments

    according to the manufacturers instructions, and then applied for deep sequencing on

    Illumina HiSeq 2000 at CAS-MPG Partner Institute for Computational Biology

    Omics Core, Shanghai, China. Roughly, 32 and 52 million 1X100 single reads from

    two biological replicates of WT AG-haESCs, 48 million 1X100 single reads from

    H19DMR-IGDMR-AGH-2, 48 million 1X100 single reads from

    H19DMR-IGDMR-AGH-OG3-2, 31 million 1X100 single reads from

    IGDMR-H19DMR-AGH-2, and 65 million 1X100 single reads from round spermatid

    were individually obtained and used for further analyses as described previously

  • (Yang et al., 2011). Briefly, sequence reads were uniquely aligned to the mouse

    mm10 genome by Tophat2 (version 2.0.9) (Kim et al., 2013) with up to two

    mismatches. Normalized gene expression levels were determined in units of RPKM

    (Reads Per Kilobase per Million mapped reads). For visualization, Bigwig files were

    generated using UCSC bedGraphToBigWig from Bedgraph files, which were

    generated using genomeCoverageBed_2.13.3 from Tophat generated Bam files. An

    unsupervised hierarchical clustering for all genes or imprinting genes was individually

    performed in cluster 3.0 (de Hoon et al., 2004; Eisen et al., 1998).

    Reduced Representation Bisulfite Sequencing (RRBS)

    RRBS library were generated from MspI-digested genomic DNA and subjected to

    sequence with Illumina HiSeq 2000 as previously described, with some modifications

    (Gu et al., 2011a). All sequenced reads were mapped against the mouse genome

    mm10 with Bismark (version 0.12.2) (Krueger and Andrews, 2011). The methylated

    CpG sites were extracted by bismark methylation extractor script. CpG sites covered

    by at least 5 reads were chosen for further analyses. Integrative Genomics Viewer

    (IGV) (Thorvaldsdottir et al., 2013) was applied to visualize the pattern of

    methylation at CpGs. The methylated level was calculated by C/(C+T) for each CpG

    site. An unsupervised hierarchical clustering for methylated CpG sites identified in all

    six samples was performed by cluster 3.0 (de Hoon et al., 2004; Eisen et al., 1998).

    The promoters of imprinting genes with at lease four CpG sites that were covered

    with at least five reads were selected for subsequent analyses. Promoters were defined

    from -1.5kb to +1.5 kb of RefGene transcription start sites. The methylated levels of

    imprinting gene promoters were calculated by C/(C+T) and an unsupervised

    hierarchical clustering for methylated CpG sites in imprinting gene promoter regions

    was performed by cluster 3.0 (de Hoon et al., 2004de Hoon et al., 2004; Eisen et al.,

    1998).

  • 4. Supplemental References

    de Hoon, M.J., Imoto, S., Nolan, J., and Miyano, S. (2004). Open source clustering

    software. Bioinformatics 20, 1453-1454.

    Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster analysis

    and display of genome-wide expression patterns. Proceedings of the National

    Academy of Sciences of the United States of America 95, 14863-14868.

    Gu, H., Smith, Z.D., Bock, C., Boyle, P., Gnirke, A., and Meissner, A. (2011a).

    Preparation of reduced representation bisulfite sequencing libraries for genome-scale

    DNA methylation profiling. Nature protocols 6, 468-481.

    Gu, T.P., Guo, F., Yang, H., Wu, H.P., Xu, G.F., Liu, W., Xie, Z.G., Shi, L., He, X.,

    Jin, S.G., et al. (2011b). The role of Tet3 DNA dioxygenase in epigenetic

    reprogramming by oocytes. Nature 477, 606-610.

    Hajkova, P., el-Maarri, O., Engemann, S., Oswald, J., Olek, A., and Walter, J. (2002).

    DNA-methylation analysis by the bisulfite-assisted genomic sequencing method.

    Methods in molecular biology 200, 143-154.

    Inoue, K., Kohda, T., Lee, J., Ogonuki, N., Mochida, K., Noguchi, Y., Tanemura, K.,

    Kaneko-Ishino, T., Ishino, F., and Ogura, A. (2002). Faithful expression of imprinted

    genes in cloned mice. Science 295, 297.

    Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013).

    TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions

    and gene fusions. Genome biology 14, R36.

    Krueger, F., and Andrews, S.R. (2011). Bismark: a flexible aligner and methylation

    caller for Bisulfite-Seq applications. Bioinformatics 27, 1571-1572.

    Li, J.Y., Lees-Murdock, D.J., Xu, G.L., and Walsh, C.P. (2004). Timing of

    establishment of paternal methylation imprints in the mouse. Genomics 84, 952-960.

    Lin, S.P., Youngson, N., Takada, S., Seitz, H., Reik, W., Paulsen, M., Cavaille, J., and

    Ferguson-Smith, A.C. (2003). Asymmetric regulation of imprinting on the maternal

    and paternal chromosomes at the Dlk1-Gtl2 imprinted cluster on mouse chromosome

    12. Nature genetics 35, 97-102.

  • Ogawa, H., Ono, Y., Shimozawa, N., Sotomaru, Y., Katsuzawa, Y., Hiura, H., Ito, M.,

    and Kono, T. (2003). Disruption of imprinting in cloned mouse fetuses from

    embryonic stem cells. Reproduction 126, 549-557.

    Ogawa, H., Wu, Q., Komiyama, J., Obata, Y., and Kono, T. (2006). Disruption of

    parental-specific expression of imprinted genes in uniparental fetuses. FEBS letters

    580, 5377-5384.

    Thorvaldsdottir, H., Robinson, J.T., and Mesirov, J.P. (2013). Integrative Genomics

    Viewer (IGV): high-performance genomics data visualization and exploration.

    Briefings in bioinformatics 14, 178-192.

    Thorvaldsen, J.L., Mann, M.R., Nwoko, O., Duran, K.L., and Bartolomei, M.S.

    (2002). Analysis of sequence upstream of the endogenous H19 gene reveals elements

    both essential and dispensable for imprinting. Molecular and cellular biology 22,

    2450-2462.

    Yamaguchi, S., Shen, L., Liu, Y., Sendler, D., and Zhang, Y. (2013). Role of Tet1 in

    erasure of genomic imprinting. Nature 504, 460-464.

    Yang, H., Shi, L., Wang, B.A., Liang, D., Zhong, C., Liu, W., Nie, Y., Liu, J., Zhao,

    J., Gao, X., et al. (2012). Generation of genetically modified mice by oocyte injection

    of androgenetic haploid embryonic stem cells. Cell 149, 605-617.

    Yang, H., Shi, L., Zhang, S., Ling, J., Jiang, J., and Li, J. (2010). High-efficiency

    somatic reprogramming induced by intact MII oocytes. Cell research 20, 1034-1042.

    Yang, L., Duff, M.O., Graveley, B.R., Carmichael, G.G., and Chen, L.L. (2011).

    Genomewide characterization of non-polyadenylated RNAs. Genome biology 12,

    R16.

  • 5. Supplemental Spreadsheet, Related to Figure 4, 5 and Table 2

    An independent excel file, including information about all analyzed SC pups derived

    from DKO-AG-haESC carrying sgRNA library. 6. Supplemental Movie, Related to Experimental Procedures and ICAHCI

    experiments (Figure 1 to 5)