Od gena do eugenike

  • Published on
    08-Jul-2015

  • View
    1.327

  • Download
    1

Embed Size (px)

Transcript

Slide 1

" . ."

(Richard Dawkins),

- 1 2 3 4 5

" ... "

(Erwin Schrdinger), , 1943

- 1 2 3 4 5

" ."

(Francis Crick), 28. 1953. - 1 2 3 4 5

?" , , ... "

(Richard Dawkins),

1 2 3 4 5

G-A-T-A-C-A . . , ,

(Bil Gejts), , 1996

- 1 2 3 4 5

:

:

:

:

, , ,

-

-

Word !

: 334KRVVG : 3() : , III - , 72 , , III - , 36+30 1.

:

( : ; : ; : ; : G-A-T-A-C-A - )

( , - )

.

, , , (Moodle)

, , , , ( ) , . , , .

. .

, . .

. .

20. , 21.

.

?

(Marc Prensky)

, , , , . , 2.0 . , ( ) , .

. . , . , . , . . , , . . , , , . , . , .

, . , , , . , .

2.

( ) .

,

, ,

()

" ... "

, , , , , . , .

- 8 . a . . .

, , , .

. . . , . .

, , , , .

, , , , .

, , (LMS Moodle).

.

1.9.7, http://www.skola.vigimnazija.edu.rs

: . genetika. ( )

()

. . ,

(1997) (http://www.youtube.com/watch?v=m_nkVmRSpfE) .

, , . :

?

?

, , , ?

?

, ( ), , . . , .

?

?

?

?

. .

, .

:I. http://www.bionet-skola.com/w/Genom, http://en.wikipedia.org/wiki/Genome. : , , .

II. http://www.bionet-skola.com/w/Genom, http://en.wikipedia.org/wiki/Genome. .

III. , http://www.bionet-skola.com/w/Humani_genom http://en.wikipedia.org/wiki/Human_genome. 3,2 30.000 .

IV. , http://www.bionet-skola.com/w/Humani_genom http://en.wikipedia.org/wiki/Human_genome. .

.

. ( ).

, . .

,

5 -

,

15 -

-

-

-

10 -

/

10 -

-

5 -

-

1. :

I. http://www.bionet-skola.com/w/Genom, http://en.wikipedia.org/wiki/Genome. : , , .

II. http://www.bionet-skola.com/w/Genom, http://en.wikipedia.org/wiki/Genome. .

III. , http://www.bionet-skola.com/w/Humani_genom http://en.wikipedia.org/wiki/Human_genome. 3,2 30.000 .

IV. , http://www.bionet-skola.com/w/Humani_genom http://en.wikipedia.org/wiki/Human_genome. .

(1997) - http://www.youtube.com/watch?v=m_nkVmRSpfE

, ( ) , .

()

" ... " , , 1943

M .

. .

:

I. http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , : , , .

II. http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , .

III. http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , .

IV. http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , .

, . .

(Transcription, NDSU Virtual Cell Animations, http://www.youtube.com/watch?v=WsofH466lqk) (mRNA Splicing, NDSU Virtual Cell Animations, http://www.youtube.com/watch?v=FVuAwBGw_pQ) .

. :

ATTAACGGGCAATCTTGTTTAAACCCGGGG :

a)

b)

.

7

10 -

10

10

8

:

1. :

I. http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , : , , .

II. http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , .

III. http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , .

IV. http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , .

2. :

ATTAACGGGCAATCTTGTTTAAACCCGGGG :

a)

b)

3. :

, , , .

:

. : (Transcription, NDSU Virtual Cell Animations, http://www.youtube.com/watch?v=WsofH466lqk) (mRNA Splicing, NDSU Virtual Cell Animations, http://www.youtube.com/watch?v=FVuAwBGw_pQ ).

.

, ( ) , .

()

."

, 28. 1953.

. :

?

() ?

?

, , ?

?

, , .

, , , . .

:

http://www.bionet-skola.com/w/Translacija (Translation, NDSU Virtual Cell Animations, http://www.youtube.com/profile?user=ndsuvirtualcell#p/u/16/5bLEDd-PSTQ), .

.

.

?

?

?

. .

-

5

-

,

10

-

12

- - 13

5

:

1. :

(Translation, NDSU Virtual Cell Animations, http://www.youtube.com/profile?user=ndsuvirtualcell#p/u/16/5bLEDd-PSTQ, .

2. .

:

. : (Translation, NDSU Virtual Cell Animations, http://www.youtube.com/profile?user=ndsuvirtualcell#p/u/16/5bLEDd-PSTQ)

.

, ( ) , .

( )

?

" , , ... "

. .

? , , . :

.

?, , .

:

?

?

?

?

?

. ( ?)

:

?

?

?

?

. ( ?)

. : .

:

1. procedure Inicijacija(iRNK:string, var iRNKbp:string );2. procedure Sinteza(iRNKbp:string, var gotovprotein:string);3. function tRNK(kod : string) : string;4. , , . 64 , .

, .

, () .

( ?)

.

, , , , .

: ? ? ?

, , .

, , 10

-

- ,

,

10

-

,

20

5

-

1. :

1. procedure Inicijacija(iRNK:string, var iRNKbp:string );2. procedure Sinteza(iRNKbp:string, var gotovprotein:string);3. function tRNK(kod : string) : string;4. 2. , , .

? ,

, ( ) , .

()

G-A-T-A-C-A

. . ,

, , 1996

(1997) (http://www.youtube.com/watch?v=m_nkVmRSpfE), :

? ?

- : , , ? ( ), . , , .

, .

.

-

-

-

5 -

-

-

20 -

-

- 15 -

-

- 5 -

-

:

- .

:

(1997) - http://www.youtube.com/watch?v=m_nkVmRSpfE :1.

http://www.b92.net/zivot/nauka.php?nav_id=402004

2. , ?

http://www.b92.net/zivot/nauka.php?nav_id=300413

3.

http://www.pregled.com/nauka.php?id_nastavak=988&tmpl=nauka_tmpl&tekuca_strana=1

: ?

" . , !"

, , 1885 - . . . , . . .

, . . , . . .

:

?

?

?

- ?

?

?

.

1. - - , , , , , , , , , 2009

2. : http://www.bionet-skola.com : http://sr.wikipedia.org 3. : http://www.wikipedia.org :

4. Youtube: http://www.youtube.com

:

5. http://sr.burnham.org/sr/homepage/dna/images/pic001.jpg6. http://psalmtrees.files.wordpress.com/2009/08/dna.jpg7. http://www.nigms.nih.gov8. http://archive.gersteinlab.org/mark/site/Images-for-talks/FORPPT--I-RIC-from--kvhs-nbed-nb-ca--transcription.jpg

1. , o , , 2003.

2. , , , , , , 2001.

3. , , 2007, www.cnti.info/portal/

4. , , .. , . , . , , , 1990.

5. 23 , , , , 2001.

PAGE 1

1. . .

a (1997) (http://www.youtube.com/watch?v=m_nkVmRSpfE) ? ? , , , ? ?

, , , .

? ? ? ?

: ( ) (, ) ( ) ( ) - - . http://publications.nigms.nih.gov/thenewgenetics/images/ch1_dnagenes.jpg

http://www.bionet-skola.com/w/Genom, http://en.wikipedia.org/wiki/Genome. : , , .

http://www.bionet-skola.com/w/Genom, http://en.wikipedia.org/wiki/Genome. .

, http://www.bionet-skola.com/w/Humani_genom http://en.wikipedia.org/wiki/Human_genome. 3,2 30.000 .

, http://www.bionet-skola.com/w/Humani_genom http://en.wikipedia.org/wiki/Human_genome. . : . : Ameba, Amoeba dubia , 671010 : Virus, fag -X174; 5386 () , . 3,2 25 30 . ,

, . , . , , . , . , . a. ..2. " ... "

, , 1943

http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , : , , . http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , . http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. , .

http://www.bionet-skola.com/w/Osnovna_dogma_molekularne_biologije. o , . : (1958). : , . , . , , .

. , .

: (Transcription, NDSU Virtual Cell Animations, http://www.youtube.com/watch?v=WsofH466lqk) (mRNA Splicing, NDSU Virtual Cell Animations, http://www.youtube.com/watch?v=FVuAwBGw_pQ ).

1. . , . 2. . , . 3. .

o, : " " 5' e 200 , . 3' , . .

ATTAACGGGCAATCTTGTTTAAACCCGGGG :

3. :

.

, 28. 1953.

? () ? ? , , ? ? , , , 4 ( , ). , , , - .

, . , , . , , G C. 20 .

.

(et) - AUG. . , . , . "" (eng. nonsence) . UAA, UGA UAG . , . .

, , , , , .: http://www.bionet-skola.com/w/Translacija http://www.youtube.com/profile?user=ndsuvirtualcell#p/u/16/5bLEDd-PSTQ AUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGCiRNK Met AUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGC Ala Met -Ala

AUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGC RF Met AlaTrpThrRF - () () AUG

. - , -. - - - . () T

AUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGCiRNK Met AUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGC Ala Met -Ala

AUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGC RF Met AlaTrpThrRF ? ? ?

4. .

AUUAUGGCCUGGACUUGAAGCMet AlaTrpThrRFAUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGC Met AUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGC Ala Met -Ala

AUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGC RF Met AlaTrpThrRF Met -AlaAUUAUGGCCUGGACUUGAAGCAUUAUGGCCUGGACUUGAAGC Ala

Met -Ala ? ? ? ulaznaiRNKkodon:=copy(iRNKbp, pos, 3) aminokis:=tRNK(kodon )pos:=0 pos:=pos+1 tt:=copy(iRNK,pos,3) tt='AUG' ?pos:=pos+3 pos:=1 protein:='' ?protein:=protein+aminokis AUUAUGGCCUGGACUUGAAGCpos:=1tekuitripletpos:=2tekuitripletpos:=3tekuitripletpos:=4tekuitriplet1. procedure Inicijacija(iRNK:string, var iRNKbp:string );

2. procedure Sinteza(iRNKbp:string, var gotovprotein:string);

3. function tRNK(kod : string) : string;

4. :program translacija;var ulaznaiRNK, ulaznaiRNKbp, protein : string;

function tRNK(kod : string) : string; var i:integer; begin if kod='UUU' then tRNK:='Phe';........ if kod='GGG' then tRNK:='Gly'; end;

procedure Inicijacija(iRNK:string; var iRNKbp:string );var pos:integer; tt :string;begin pos:=0; repeat pos:=pos+1; tt:=copy(iRNK,pos,3) until tt='AUG'; iRNKbp:=copy(iRNK,pos,length(iRNK)-(pos-1))end;

procedure Sinteza(iRNKbp:string; var gotovprotein:string);var pos:integer; kodon, antikodon, aminokis, protein :string;begin pos:=1; protein:=''; repeat kodon:=copy(iRNKbp, pos, 3); aminokis:=tRNK(kodon); protein:=protein+aminokis; pos:=pos+3; until (pos>length(iRNKbp)-2) or (aminokis='RF'); gotovprotein:= proteinend;begin writeln; write('Uneti niz nukleotida iRNK: '); readln(ulaznaiRNK); Inicijacija(ulaznaiRNK, ulaznaiRNKbp); Sinteza(ulaznaiRNKbp, protein); writeln('Sintetisani protein je: ',protein); readlnend.

program translacija;

var ulaznaiRNK, ulaznaiRNKbp, protein : string;

function tRNK(kod : string) : string;

var i:integer;

begin

if kod='UUU' then tRNK:='Phe';

if kod='UUC' then tRNK:='Phe';

if kod='UUA' then tRNK:='Leu';

if kod='UUG' then tRNK:='Leu';

if kod='CUU' then tRNK:='Leu';

if kod='CUC' then tRNK:='Leu';

if kod='CUA' then tRNK:='Leu';

if kod='CUG' then tRNK:='Leu';

if kod='AUU' then tRNK:='Ile';

if kod='AUC' then tRNK:='Ile';

if kod='AUA' then tRNK:='Ile';

if kod='AUG' then tRNK:='Met';

if kod='GUU' then tRNK:='Val';

if kod='GUC' then tRNK:='Val';

...