Unit 4: Molecular GeneticsLeft side Pg
#Right Side Pg #
Unit Page 58 Table of contents 59
Double Bubble 60 C.N. – DNA & RNA Structure
61
DNA & RNA Coloring 62
DNA & RNA
Unit 4: DNA & RNAChapter 12-1
Learning Goals• 1. What is the primary job of DNA? Why
are genes important? • 2. Describe the structure of DNA.
(Include the 3 parts of a nucleotide)• 3. Explain the base pairing rules.• 4. Describe the parts of a DNA double
helix • 5. Compare & Contrast DNA & RNA (Give
at least 2 similarities & 2 differences.
Nucleic Acids
•DNA and RNA are nucleic acids (polymer) made up of nucleotides (monomer).
•DNA’s primary purpose is to code for proteins.–Proteins express our genes!
DNA: deoxyribonucleic acid
•Genes are made up of DNA–1. Genes carry information from one generation to the next.
–2. Genes determine inherited traits.
–3. Genes are easily copied.
Structure of DNA
•Made up of nucleotides (3 parts of a nucleotide):– 1) Deoxyribose: a sugar– 2) Phosphate group: bonds one
nucleotide to the next sugar– 3) Nitrogenous base: there are 4 kinds
of bases in DNA
•There are four kinds of bases in DNA:
• Purines = adenine(A) & guanine(G) • Pyrimidines = cytosine(C) & thymine
(T)
Nucleotides
Base Pairing•Rules
–Hydrogen bonds can only form between certain base pairs:1) adenine only bonds to
thymine (Aunt = Tia)2) guanine only bonds to
cytosine (Cat = Gato)
Practice pairing the bases to complete the DNA
•ATCGGCTCAATCGATTACCA•TAGC
Discovery of DNA• Rosalind Franklin used X-ray
diffraction to get information about the structure of DNA.
•She aimed an X-ray beam at concentrated DNA samples and recorded the scattering pattern of the X-rays on film.
The Double Helix
–Using clues from Franklin’s pattern, James Watson and Francis Crick built a model that explained how DNA carried information and could be copied.
•Shape of DNA: Double Helix
Double helix: Double (2) stranded, twisted ladder
• Rails of ladder – formed by the “sugar-phosphate backbone” –alternating deoxyribose sugar and phosphates
• Steps of ladder - formed by nitrogenous base pairs (A, T, G, C) –two strands of the ladder are “complimentarycomplimentary” to each other. (they go together)
RNA: ribonucleic acidRNA: ribonucleic acid• RNA is used to take
DNA info outside the nucleus to be used by cell– Structure
• RNA is a singlesingle strand• RNA has riboseribose instead of deoxyribose
• RNA uses UracilUracil instead of Thymine
Learning Goals• 1. What is the primary job of DNA? Why
are genes important? • 2. Describe the structure of DNA.
(Include the 3 parts of a nucleotide)• 3. Explain the base pairing rules.• 4. Describe the parts of a DNA double
helix • 5. Compare & Contrast DNA & RNA (Give
at least 2 similarities & 2 differences.