Unit 4: Molecular GeneticsLeft side Pg

#Right Side Pg #

Unit Page 58 Table of contents 59

Double Bubble 60 C.N. – DNA & RNA Structure

61

DNA & RNA Coloring 62

DNA & RNA

Unit 4: DNA & RNAChapter 12-1

Learning Goals• 1. What is the primary job of DNA? Why

are genes important? • 2. Describe the structure of DNA.

(Include the 3 parts of a nucleotide)• 3. Explain the base pairing rules.• 4. Describe the parts of a DNA double

helix • 5. Compare & Contrast DNA & RNA (Give

at least 2 similarities & 2 differences.

Nucleic Acids

•DNA and RNA are nucleic acids (polymer) made up of nucleotides (monomer).

•DNA’s primary purpose is to code for proteins.–Proteins express our genes!

DNA: deoxyribonucleic acid

•Genes are made up of DNA–1. Genes carry information from one generation to the next.

–2. Genes determine inherited traits.

–3. Genes are easily copied.

Structure of DNA

•Made up of nucleotides (3 parts of a nucleotide):– 1) Deoxyribose: a sugar– 2) Phosphate group: bonds one

nucleotide to the next sugar– 3) Nitrogenous base: there are 4 kinds

of bases in DNA

•There are four kinds of bases in DNA:

• Purines = adenine(A) & guanine(G) • Pyrimidines = cytosine(C) & thymine

(T)

Nucleotides

Base Pairing•Rules

–Hydrogen bonds can only form between certain base pairs:1) adenine only bonds to

thymine (Aunt = Tia)2) guanine only bonds to

cytosine (Cat = Gato)

Practice pairing the bases to complete the DNA

•ATCGGCTCAATCGATTACCA•TAGC

Discovery of DNA• Rosalind Franklin used X-ray

diffraction to get information about the structure of DNA.

•She aimed an X-ray beam at concentrated DNA samples and recorded the scattering pattern of the X-rays on film.

The Double Helix 

–Using clues from Franklin’s pattern, James Watson and Francis Crick built a model that explained how DNA carried information and could be copied.

•Shape of DNA: Double Helix

 

Double helix: Double (2) stranded, twisted ladder

• Rails of ladder – formed by the “sugar-phosphate backbone” –alternating deoxyribose sugar and phosphates

• Steps of ladder - formed by nitrogenous base pairs (A, T, G, C) –two strands of the ladder are “complimentarycomplimentary” to each other. (they go together)

RNA: ribonucleic acidRNA: ribonucleic acid• RNA is used to take

DNA info outside the nucleus to be used by cell– Structure

• RNA is a singlesingle strand• RNA has riboseribose instead of deoxyribose

• RNA uses UracilUracil instead of Thymine

Learning Goals• 1. What is the primary job of DNA? Why

are genes important? • 2. Describe the structure of DNA.

(Include the 3 parts of a nucleotide)• 3. Explain the base pairing rules.• 4. Describe the parts of a DNA double

helix • 5. Compare & Contrast DNA & RNA (Give

at least 2 similarities & 2 differences.