Unconjugated bilirubin mediates heme oxygenase-1-induced … · 2014. 12. 2. · 2 Abstract Heme oxygenase-1 (HO-1) exerts vaso-protective effects. Such benefit in diabetic vasculopathy

1

Unconjugated bilirubin mediates heme oxygenase-1-induced vascular

benefits in diabetic mice

Jian Liu1, Li Wang

1, Xiaoyu Tian

1, Limei Liu

2, Wing-Tak Wong

3, Yang Zhang

1, Quanbin Han

4,

Hing-Man Ho4, Nanping Wang

5, Siu-Ling Wong

1, Zhenyu Chen

6, Jun Yu

7, Chi-Fai Ng

8, Xiaoqiang

Yao1, Yu Huang

1,*

1Institute of Vascular Medicine and Li Ka Shing Institute of Health Sciences, Chinese University of

Hong Kong; 2Department of Physiology and Pathophysiology, Peking University Health Science

Center, Beijing, China; 3Department of Cardiovascular Sciences, Houston Methodist Research

Institute, Houston, Texas; 4School of Chinese Medicine, Hong Kong Baptist University;

5Institute of

Cardiovascular Science, Peking University, Beijing, China; 6School of Life Sciences,

7Department

of Medicine and Therapeutics and 8Department of Surgery, Chinese University of Hong Kong,

China;

Running title: Bilirubin and endothelial function in db/db mice

*Addressed to: Yu Huang, School of Biomedical Sciences, Chinese University of Hong Kong,

Hong Kong SAR, China. Tel: (852)39436787; e-mail: [email protected]

Word count: 3846

Number of figures: 7

Page 1 of 41 Diabetes

Diabetes Publish Ahead of Print, published online December 4, 2014

2

Abstract

Heme oxygenase-1 (HO-1) exerts vaso-protective effects. Such benefit in diabetic vasculopathy

however remains unclear. We hypothesize that bilirubin mediates HO-1-induced vascular benefits in

diabetes. Diabetic db/db mice were treated with hemin (HO-1 inducer) for two weeks, and aortas

were isolated for functional and molecular assays. Nitric oxide (NO) production was measured in

cultured endothelial cells. Hemin treatment augmented endothelium-dependent relaxations (EDRs)

and elevated Akt and eNOS phosphorylation in db/db mouse aortas, which were reversed by HO-1

inhibitor SnMP or HO-1 silencing virus. Hemin treatment increased serum bilirubin and ex vivo

bilirubin treatment improved relaxations in diabetic mouse aortas, which was reversed by Akt

inhibitor. Biliverdin reductase silencing virus attenuated the effect of hemin. Chronic bilirubin

treatment improved EDRs in db/db mouse aortas. High glucose-induced reductions in Akt and

eNOS phosphorylation, and NO production were reversed by hemin and bilirubin. The effect of

hemin but not bilirubin was inhibited by biliverdin reductase shRNA. Furthermore, bilirubin

augmented EDRs in renal arteries from diabetic patients. In summary, HO-1-induced restoration of

endothelial function in diabetic mice is most likely mediated by bilirubin which preserves NO

bioavailability through the Akt/eNOS/NO cascade, suggesting bilirubin as a potential therapeutic

target for clinical intervention of diabetic vasculopathy.

Page 2 of 41Diabetes

3

Cardiovascular disease (CVD) is the leading cause of death and disability for patients with diabetes

(1). Hyperglycemia and insulin resistance reduce NO bioavailability and diminish the

anti-atherogenic capacity of the endothelium, resulting in platelet aggregation, increased vascular

contractility, and accelerated atherosclerosis. Thus, strategies aim at preserving endothelial function

may help alleviate diabetic vasculopathy (2).

Heme oxygenase (HO) catalyzes heme to form carbon monoxide (CO), Fe2+

and biliverdin; the

latter is converted into unconjugated bilirubin by biliverdin reductase (BVR) (3). Two distinct

isoforms of HO have been identified: heme oxygenase 1 (HO-1) and heme oxygenase 2 (HO-2).

While HO-2 is constitutively expressed, the expression of HO-1 is normally low but inducible.

HO-1 can be up-regulated by stimuli such as lipopolysaccharide and H2O2 in various cells or organs

(4; 5). Limited studies show an altered HO-1 expression under metabolic conditions. HO-1

expression and activity is increased in human umbilical vein endothelial cells (HUVECs) when

exposed to 10 mM glucose for 48 hours compared to 5.5 mM glucose, but remains unchanged when

exposed to 20 mM glucose for 48 hours (6). HO-1 mRNA is down-regulated in skeletal muscle of

diabetic patients, but it is increased in liver and visceral fat of obese patients (7; 8), suggesting that

HO-1 expression can be differently regulated in major metabolic organs under different disease

states. Growing evidence suggests HO-1 as a potential target for intervention of diabetes. Induction

of HO-1 in obese mice increases plasma adiponectin and improves insulin sensitivity; while it

decreases visceral and abdominal adiposity and plasma pro-inflammatory cytokines (9). HO-1

over-expression reduces lymphocytic infiltration in Langerhans islets and retards the progression of


4

type 1 diabetes (10). HO-1 also protects against high glucose-induced impairment of

endothelial-dependent relaxations (EDRs) in rat aortas (11) and high glucose-induced endothelial

cell apoptosis (6; 12). These studies indicate that HO-1 induction may serve as a potential

therapeutic strategy to treat diabetic vascular complications. However, the precise intracellular

mechanisms mediating the vaso-protective benefits of HO-1 remain largely unexplored.

Bilirubin is converted from biliverdin by BVR. Clinical studies show an inverse association

between serum bilirubin concentration with incidences of myocardial infarction, peripheral artery

disease, and stroke (13-16) and serum bilirubin level is lower in diabetic patients (17). Of note,

Gilbert syndrome patients, that with higher serum unconjugated bilirubin, are less prone to major

adverse cardiovascular events (18) and individuals with higher serum bilirubin are better protected

from developing metabolic disorders in a 4-year retrospective longitudinal study (19). Bilirubin is a

potent antioxidant and efforts have been directed to determine whether bilirubin can be used to treat

diseases associated with oxidative stress. Indeed, atazanavir, a drug that raises unconjugated

bilirubin levels, enhances the plasma antioxidant capacity and improves EDRs in diabetic patients

(20).

This study examined the hypothesis that unconjugated bilirubin mediates vascular benefits of

HO-1 induction to restore the impaired endothelial function in diabetic db/db mice and investigated

the possible mechanisms involved. The present new findings support the clinical observation that

bilirubin is vaso-protective in diabetes.


5

RESEARCH DESIGN AND METHODS

Animals and reagents

Animal care and experimental protocol were approved by Animal Research Ethics Committee,

Chinese University of Hong Kong (CUHK) in compliance with the Guide for the Care and Use of

Laboratory Animals (NIH Publication no.85–23, revised 1996). Twelve-week-old male diabetic

db/db mice on a C57BL/KsJ background and non-diabetic littermates db/m+ mice were supplied by

CUHK Animal Service Center, kept in a temperature-controlled room (∼23°C) with a 12-h

light/dark cycle, and fed a standard diet and water ad libitum. db/db mice were treated with: vehicle,

hemin [HO-1 inducer, 25 mg/kg body weight (BW), 3 times weekly, i.p.], hemin+SnMP (HO-1

inhibitor, 20 mg/kg BW, 3 times weekly, i.p.), hemin+scramble virus (109 pfu), hemin+HO-1

shRNA virus (109 pfu), bilirubin (5 mg/kg BW, 3 times weekly, i.p.). db/m

+ mice were treated with:

vehicle and hemin (25 mg/kg BW, 3 times weekly, i.p.).

Diet-induced obese (DIO) mice were generated by feeding 6-week old C57BL/6J mice with

high fat diet (Rodent diet with 45% kcal% fat, D12451, Research Diets Inc. New Brunswick, NJ,

USA) for 10 weeks, and then treated with hemin or vehicle for two weeks (25 mg/kg BW, 3 times

weekly, i.p.).

SnMP was purchased from Frontier Scientific (Utah, USA) and all other reagents were from

Sigma (St Louis, MO, USA) unless otherwise stated.


6

Vessel preparation

After mice were sacrificed, thoracic aortas were removed, placed in ice-cold Krebs solution (in

mmol/L: 119 NaCl, 4.7 KCl, 2.5 CaCl2, 1 MgCl2, 25 NaHCO3, 1.2 KH2PO4, and 11 D-glucose), and

cut into ring segments. Changes in isometric tension in aortic rings were recorded by Multi

Myograph System (Danish Myo Technology A/S, Denmark) (21). The baseline tension was set at

3 mN and all rings were equilibrated for 60 min was before the start of the experiments.

Functional study

Aortic rings were contracted by 1 µmol/L phenylephrine to induce a sustained tension before

acetylcholine (ACh, 10-8

to 10-5

mol/L) was added cumulatively to trigger endothelium-dependent

relaxations. Endothelium-independent relaxations induced by NO donor sodium nitroprusside (SNP,

10-8

to 10-5

mol/L) were compared in arteries from different groups.

Organ culture of aortic rings

Mouse aortas were cultured for 24-h at 37°C in Dulbeco’s Modified Eagle’s Medium (DMEM,

Gibco, Gaithersberg, MD, USA) supplemented with 10% FBS (Gibco) and 100 IU/ml penicillin

plus 100 µg/ml streptomycin as described (22). The db/db mouse aortas were treated with 5 µmol/L

hemin or 1 µmol/L unconjugated bilirubin, in control and in the presence of 30 µmol/L SnMP or 5

µmol/L Akt inhibitor V.

For ex vivo viral transduction, mouse aortas were cultured with 109

pfu BVR shRNA or GFP


7

shRNA adenovirus for 24-h and then treated with hemin or unconjugated bilirubin for another 24-h.

Human artery specimen

The use of human specimen was approved by the Joint Chinese University of Hong Kong-New

Territories East Cluster Clinical Research Ethics Committee. Human renal arteries were obtained

after informed consent from patients without cardio-metabolic complications and diabetic patients

undergoing nephrectomy due to neoplasm at ages between 50 and 80 years. Diabetes is defined as

having fasting plasma glucose level ≥7.0 mmol/L in patients.

Oral glucose tolerance test and intra-peritoneal insulin tolerance test

Mice were loaded with glucose (1.2 g/kg BW) for oral glucose tolerance test after 8-h fasting. For

insulin tolerance test, mice were injected with insulin at 0.75 U/kg BW after 2-h fasting. Blood

glucose was measured at 0, 15, 30, 60 and 120 min with glucometer (Ascensia ELITE®, Bayer,

Mishawaka, IN).

Plasma insulin level and lipid profile

Plasma insulin levels were assayed by enzyme immunoassay (Mercodia, Sweden). Plasma levels of

total cholesterol, triglyceride, high-density lipoprotein (HDL) and non-HDL were determined using

enzymatic methods (Stanbio, Boerne, TX).


8

Liquid chromatography mass spectrometry measurement of unconjugated bilirubin

400 µl of 60% (v/v) acetonitrile in 0.01 M-phosphate buffer (pH 8.0) was added to 100 µl serum or

culture medium, vortexed for 30 s, and centrifuged for 5 min at 1000 rpm (23). 100 µl of

supernatant was applied on the Agilent 6460 Triple Quadrupole Mass Spectrometer with UHPLC

(UHPLC–MS/MS, Agilent Technologies, Santa Clara, CA, USA). The chromatographic separation

was performed on a ACQUITY UPLC® BEH C18 column (2.1mm×100mm, ID, 1.7µm particle

size) (Waters, Milford, MA, USA) at 4 °C with the mobile phase consisting of 0.1% formic acid in

water (A) and 0.1% formic acid in acetonitrile (B) by a gradient elution method (55 to 100% of B

from 0 to 12.5 min, 100% of B from 12.5 to 13 min, 55% of B from 13.1 to 16 min). The injection

volume was 3 µl and the flow rate was 0.4 mL/min. The elution was directed to the mass

spectrometer without splitting. The temperature of the auto-sampler was set at 4 °C throughout the

analysis. The mass spectrometer equipped with an ion source of ESI (Agilent Jet Stream) in

negative ion mode was used for bilirubin detection. The source parameters were set as follows: gas

temperature, 300 °C; gas flow, 8 L/min; nebulizer: 30 psi; sheath gas temperature: 350 °C; sheath

gas flow: 10 L/min; capillary voltage: 3500 V, and nozzle voltage: 1000 V. The MS recordings were

carried out in multiple reactions monitoring (MRM) mode. Nitrogen was used as the collision gas,

the monitor ion and collision energy were m/z 583.2 � 285.2 and 20eV, respectively.


9

Measurement of nitrite in mouse aortas

Mouse aortas were treated with hemin (5 µmol/L) or bilirubin (1 µmol/L) for 24 h, followed by

addition of 10 µmol /L acetylcholine (10 min) to stimulate NO generation with the presence of

nitrate reductase to reduce nitrate to nitrite. Aortas were then homogenized and nitrite level in the

supernatants was measured by a Griess reagent kit (Molecular Probes, Eugene, OR, USA) and

normalized by the protein content.

Construction of HO-1 shRNA adeno-associated virus

Short hairpin (sh)RNA sequence targeting mouse HO-1 was obtained from sigma

(TRCN0000234077). The 5’- GATCCACA GTGGCAGTGGGAATTTATCTCGAGATAAATTCC

CACTGCCACTGTTTTTTA-3’ and 5’-AGCTTAAAAAACAGTGGCAGTGGGAATTTATCTCG

AGATAAATTCCCACTGCCACTGTG-3’ were annealed and cloned into the pAAV-ZsGreen

-shRNA (YRGene) shuttle vector to construct pAAV-ZsGreen-HO-1 shRNA plasmid, and then it

was co-transfected into HEK-293T with RGDLRVS-AAV9 cap plasmid (a gift of Dr. OJ Müller,

University Hospital Heidelberg, Germany) (24) and pHelper (Stratagene). AAV viral particles were

harvested as reported (25). Mice were injected with 109 pfu HO-1 shRNA or scramble (empty

vector) virus via tail vein. The knockdown efficiencies were confirmed by Western blotting.

Knockdown of biliverdin reductase by adenoviral shRNA transduction

The U6 promoter and 1.9kb stuffer sequence were excised from pLKO.1 (addgene) with NotI/ XhoI


10

and cloned into pShuttle. shRNA targeting mouse BLVRA (sigma, TRCN0000042128) was

generated similarly to the pLKO.1 system (26). Briefly, the forward (CCGGGCCAAATGTAGGA

GTCAATAACTCGAGTTATTGACTCCTACATTTGGCTTTTTG) and reverse (TCGAGAAAAA

GCCAAATGTAGGAGTCAATAACTCGAGTTATTGACTCCTACATTTGGC) oligos were

annealed and ligated to pShuttle-U6 predigested with AgeI and XhoI. The pAd-U6-shBLVRA

plasmid was produced as reported previously (27) and linearized by PacI and transfected to

Hek-293 cell to produce the viral particle.

Overexpression of HO-1 by adenoviral transduction

db/db mice were injected with HO-1 overexpressing adenovirus (109 pfu, a gift from Jun Yu, Prince

of Wales Hospital in Hong Kong) through tail vein and kept for 4 days before sacrificed.

Knockdown of Akt in HUVECs

HUVECs were purchased from Lonza (San Diego, CA) and cultured in Endothelial Cell Growth

Medium (EGM, Lonza) supplemented with 10 % FBS plus 1 % penicillin/streptomycin. HUVECs

were transfected with a dominant negative Akt construct (DN-Akt) by electroporation using

Nucleofector II machine (Amaxa/Lonza, Walkersville, MD, USA) according to the manufacturer’s

instruction.


11

Measurement of NO and ROS generation in HUVECs

NO production in HUVECs was measured by Olympus Fluoview FV1000 laser scanning confocal

system using 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-DA, Invitrogen) as

indicator. The amount of NO produced in response to A23187 (100 nmol/L) was evaluated by

measuring fluorescence intensity at excitation 488 nm and emission 515 nm. Changes in [NO]i were

displayed as a ratio of fluorescence intensity after and before the addition of A23187 (F1/F0). For

ROS measurement, HUVECs were incubated for 30 min in 5 µmol/L CM-H2DCFDA (Invitrogen)

and measured using Fluoview FV1000 confocal system at excitation 488 nm and emission 520 nm.

To detect NO mediated antioxidant capacity of bilirubin, NO scavenger oxidized-hemoglobin (20

µmol/L) was used together with bilirubin in HG-treated HUVECs. HUVECs were incubated with 5

µmol/L dihydroethidium (DHE, Invitrogen) for 30 min and fluorescence intensity was measured

using Fluoview FV1000 confocal system at excitation 515 nm and emission 585 nm.

Western blotting

Protein lysates from mouse aortas or HUVECs were separated by electrophoresis and then

transferred onto an immobilon-P polyvinylidene difluoride membrane (Millipore Corp., Bedford,

MA, USA). The blots were then blocked with 1% BSA in 0.05% Tween-20 PBS for 1-h and

incubated with primary antibodies overnight at 4°C, including: polyclonal anti-eNOS (1:500,

Abcam, Cambridge, UK), anti-phospho-eNOS Ser1177

(1:1000, Abcam), polyclonal anti-HO-1

(1:1000, Assay Designs, Michigan, USA), monoclonal anti-phospho-Akt Thr308

(1:1000, Cell


12

Signaling, Danvers, MA, USA), monoclonal anti-Akt1 (1:1000, Cell Signaling), and polyclonal

anti-IRS1(1:1000, Cell Signaling). After washing, blots were incubated with horseradish peroxidase

(HRP) -conjugated secondary antibody (DakoCytomation, Carpinteria, CA, USA). Protein

expression was normalized by monoclonal anti-GAPDH (1:10000, Ambion, Texas, USA). Protein

expression was determined by a densitometer (Flurochem, Alpha Innotech Corp., San Leandro, CA,

USA).

Immunohistochemical staining of biliverdin reductase

Human renal arteries were frozen in OCT compound (Sakura Finetek, CA, U.S.A), cut into 10

µm-sections on a microtome (Leica Microsystems, Germany) and fixed with 4% paraformaldehyde.

Sections were washed in PBS and blocked in 5% normal donkey serum (Jackson Immunoresearch,

West Grove, PA, USA), and incubated with anti-biliverdin reductase antibody (1:200, Enzo life

sciences, USA) or PBS overnight at 4 ºC. Biotin-conjugated goat anti-rabbit secondary antibodies

(1:500, Jackson Immunoresearch), streptavidin-HRP conjugate (1:500, Zymed laboratory, San

Francisco, CA, USA), and DAB substrate (Vector laboratory, Burlingame, CA, USA) were used to

visualize positive staining. Pictures were taken under Nicon TI-S microscope.

Statistical Analysis

Results are means±SEM of n experiments. The relaxation was expressed as percentage reduction in

phenylephrine-induced contraction. Concentration-response curves were constructed using


13

GraphPad Prism software (Version 4.0, San Diego, CA, USA). Statistical significance was

determined by two-tailed Student’s t-test or one-way ANOVA followed by Bonferroni post-hoc tests

when more than two treatments were compared. p<0.05 indicates statistical significance.

RESULTS

HO-1 induction restored EDRs in diabetic mice

Acetylcholine (ACh)-induced EDRs were impaired in aortas of diabetic db/db mice compared with

those from db/m+ mice. Two-week hemin treatment restored EDRs in db/db mouse aortas, which

were reversed by co-treatment with HO-1 inhibitor SnMP (Fig. 1A). By contrast, SNP-induced

endothelium-independent relaxations were similar in all groups (Supplemental Fig. 1). Hemin

treatment induced ~3 fold increase of HO-1 expression in aortas from both db/db and db/m+ mice,

which was unaffected by SnMP (Fig. 1B). Ex vivo treatment with hemin (5 µmol/L, 24-h) or tail

vein injection of HO-1-overexpressing adenovirus (4 days) also improved EDRs in db/db mouse

aortas (Fig. 1C&D) and elevated HO-1 expression (Supplemental Fig. 2A&B); the effect of hemin

was again reversed by co-treatment with 30 µmol/L SnMP (Fig. 1C). To confirm that HO-1

mediates vascular benefits of hemin in db/db mice, HO-1 shRNA adeno-associated virus (AAV)

was constructed and injected into db/db mice via tail vein and these mice were treated with hemin

for 2 weeks. Compared with scramble virus, HO-1 shRNA AAV reversed the effect of hemin on

EDRs and HO-1 expression (Fig. 1E&F). In addition, we also used DIO mice to confirm the

findings in db/db mice. Hemin administration for two weeks augmented EDRs and HO-1


14

expression in DIO mouse aortas (Supplemental Fig. 3A&B), suggesting HO-1 is most likely to

mediate hemin-induced improvement of EDRs in diabetic mice.

PI3K/Akt/eNOS contributed to vascular benefits of HO-1 induction in diabetic mice

The phosphorylation levels of Akt (The308) and eNOS (Ser1177) in aortas were lower in db/db

mice than db/m+ mice. In vivo hemin treatment restored the diminished phosphorylation of Akt and

eNOS and such effects were reversed by co-treatment with SnMP (Fig. 2A&B). Chronic hemin

treatment also increased phosphorylation of Akt and eNOS in DIO mouse aortas (Supplemental Fig.

3C&D). HO-1 shRNA AAV transduction inhibited hemin-stimulated phosphorylation of Akt and

eNOS (Fig. 2C-E). The hemin-improved EDRs were reversed by PI3K inhibitor wortmannin (100

nmol/L) or Akt inhibitor V (5 µmol/L) (Fig. 2F). However, neither inhibitor affected ACh-induced

relaxations of db/m+ mouse aortas (data not shown).

Bilirubin improved EDRs in db/db mouse aortas

The concentration of serum unconjugated bilirubin was 77.5 ± 7.8 nmol/L in db/db and 350.0 ± 3.9

nmol/L in db/m+ mice. Hemin treatment increased bilirubin to 201.4 ± 13.6 nmol/L, which was

inhibited by SnMP (Fig. 3A). Ex vivo bilirubin treatment (1 µmol/L, 24-h) improved EDRs in db/db

mouse aortas, and such effect was inhibited by co-incubation with Akt inhibitor V (5 µmol/L) but

not by SnMP (30 µmol/L) (Fig. 3B). To investigate whether bilirubin mediated the beneficial effect

of HO-1, a biliverdin reductase (BVR) shRNA adenovirus was constructed. The vascular benefit of


15

hemin (Fig. 3C) but not that of bilirubin (Fig. 3D) was reversed by BVR shRNA. Successful

inhibition of BVR expression by shRNA adenovirus was shown by Western blotting (Fig. 3E) and

immunohistochemical staining (Fig. 3F). To confirm the role of bilirubin to mediate the vascular

benefit of HO-1 in vivo, we treated db/db mice with bilirubin for 2 weeks. Chronic bilirubin

administration improved EDRs in db/db mouse aortas (Fig. 4A) accompanied with increased

phosphorylation of Akt (Thr308) and eNOS (Ser1177) (Fig. 4B-D). These results further indicate

that bilirubin is most likely to mediate the effect of HO-1 induction to improve endothelial function.

Hemin and unconjugated bilirubin restored NO production in HUVECs

High glucose (HG, 36-h) reduced Ca2+

ionophore A23187 (100 nmol/L)-stimulated NO elevation

detected by DAF-DA in HUVECs, compared with normal glucose (Fig. 5A&B). Hemin or bilirubin

restored the HG-impaired NO production (Fig. 5A, B&C). Ex vivo treatment with hemin and

bilirubin also raised nitrite level (which reflects tissue NO level) in db/db mouse aortas

(Supplemental Fig. 4). Akt inhibitor V (5 µmol/L) abolished the effect of hemin and bilirubin while

SnMP only inhibited the effect of hemin on NO production (Fig. 5B&C). Inhibition of Akt activity

by Ad-DN-Akt, the plasmid expressing dominant negative Akt abolished the effect of both hemin

and bilirubin (Fig. 5D). In addition, treatment with hemin or bilirubin increased phosphorylation of

Akt and eNOS in HG-treated HUVECs. Again, the effect of hemin was abolished by SnMP while

the effect of hemin and bilirubin was reversed by Akt inhibitor V (Fig. 5E-H).


16

Down-regulation of biliverdin reductase diminished the effect of hemin in HUVECs

GFP shRNA adenovirus served as the control virus. Hemin increased bilirubin level in medium

culturing HUVECs, which was diminished by BVR shRNA adenovirus (Supplemental Fig. 5A).

The stimulatory effect of hemin on Akt and eNOS phosphorylation in high glucose-treated

HUVECs was reversed by BVR shRNA adenovirus (Fig. 6A-C). Likewise, hemin-stimulated NO

production in HUVECs was inhibited by BVR shRNA adenovirus (Supplemental Fig. 5B&C). By

contrast, the effect of bilirubin remained unchanged by BVR shRNA (Fig. 6D-F; Supplemental Fig.

5B&C).

Bilirubin improved EDRs in renal arteries from diabetic patients.

The HbA1c concentrations in diabetic patients are presented in Supplemental Table 1. Compared to

renal arteries form patients without cardio-metabolic complications (control), EDRs in renal arteries

from diabetic patients (DM) were impaired, which were augmented after 24-h exposure to bilirubin

(1 µmol/L) (Fig. 7A&B). BVR expression was detected in the endothelium in human renal arteries

by immunohistochemistry (Fig. 7C).


17

DISCUSSION

Although HO-1 is known to benefit vascular function, whether such beneficial effects were directly

or indirectly induced by HO-1 induction remains poorly understood. HO-1 degrades heme to form

biliverdin, CO, and Fe2+

; the former is further converted into unconjugated bilirubin. Bilirubin is

increasingly recognized to be vaso-protective in cardio-metabolic diseases (18; 20) and total plasma

bilirubin concentration is lower in diabetic patients (17). The present study also shows a reduced

serum level of unconjugated bilirubin in db/db mice, which is increased following two-week hemin

treatment. Importantly, ex vivo treatment with unconjugated bilirubin (at 1 µM, a concentration

comparable to that detected in the serum of non-diabetic mice) and two-week administration of

bilirubin (i.p.) to db/db mice resulted in similar vascular benefits as hemin to restore EDRs. More

definitely, silencing BVR using shRNA adenovirus reverses ex vivo hemin-induced improvement of

EDRs in db/db mouse aortas and hemin-stimulated NO production in HUVECs. By contrast, the

beneficial effects of bilirubin were unaffected by BVR shRNA. Taken together, bilirubin is the most

likely mediator of the vaso-protective action of HO-1 induction. Likewise, bilirubin is also reported

to mediate the anti-atherogenic action of HO-1 through inhibiting vascular inflammation (28).

The present study provides the first piece of evidence showing that ex vivo treatment with

bilirubin improves EDRs in renal arteries from diabetic patients, further suggesting that bilirubin is

vaso-protective in human. It should be noted that the diabetic patients were with renal carcinoma

and had different duration of diabetes and HbA1c levels (Supplemental Table 1); this may influence

renal vascular responses to bilirubin. And also, in the future it would be important to investigate


18

whether bilirubin produces similar vascular benefit in other arteries such as coronary arteries,

carotid arteries and femoral arteries, which are more clinically relevant.

The PI3K/Akt signaling is important to preserve endothelial function in diabetic mice by

increasing eNOS phosphorylation at Ser1177

(22) and endothelial progenitor cell regenerative

capacity (29; 30). The present study reveals a critical role of Akt signaling in mediating vascular

benefits of both hemin and bilirubin, as inhibition of Akt activity abolishes the beneficial effects of

hemin and bilirubin to improve EDRs in db/db mice and restores the impaired NO production in

high glucose-treated HUVECs.

The biological action of bilirubin has long been considered due to its anti-oxidant property (31;

32). Bilirubin scavenges peroxyl radicals and reduces lipid peroxidation in vitro (33); it

down-regulates NAD(P)H oxidase activity and protects against diabetic nephropathy in rodents in

vivo (34). Bilirubin was also shown to mediate the effect of HO-1 to reduce reactive oxygen and

nitrogen species in lipopolysaccharide-treated HUVECs (35). Reduced ROS contribute to the

improved EDRs. Therefore, the antioxidant activity of bilirubin may partially accounts for its

vascular benefits. The present study shows that bilirubin also increases NO production. NO can

interact with superoxide anions to lower ROS levels. Our results show that bilirubin inhibits high

glucose-stimulated ROS generation in HUVECs, which was attenuated by Akt inhibitor V and NO

scavenger oxidized-hemoglobin (Supplemental Fig. 6), suggesting that increased NO is likely to

mediate a significant part of the effect of bilirubin to reduce ROS in endothelial cells. Thus, the


19

increased NO bioavailability may directly contribute to bilirubin-induced improvement in EDRs

and also indirectly by reducing ROS.

CO, one of the metabolic products of heme degradation, is reported to affect vascular reactivity,

causing either endothelium-independent relaxations (36) or contractions (37). Most studies show

that CO inhibits NO-mediated vasodilatation or NO production in endothelial cells (38; 39). Unlike

hemin or bilirubin, ex vivo treatment with CO-releasing molecule tricarbonyl-dichloro-

ruthenium (II) dimmer does not improve EDRs in db/db mouse aortas (Supplemental Fig. 7). Taken

together with results from experiments using BVR shRNA virus and chronic bilirubin treatment, the

present results suggest a minimal involvement of CO in hemin-induced endothelial protection in

diabetic mice.

It is worthwhile to note that HO-1 induction in vivo moderately reduces fasting glucose and

insulin levels in db/db mice and also improved insulin sensitivity (Supplemental Fig. 8). Previous

studies showed that HO-1 induction improves insulin sensitivity and reduces adiposity, which is

associated with increased adiponectin release (9; 40). Thus, the metabolic benefit is likely to

contribute albeit to a lesser degree to the restoration of endothelial function in hemin-treated

diabetic mice through HO-1 up-regulation in adipose tissues (40; 41). Although the role of vascular

HO-1 induction in improved insulin sensitivity cannot be ruled out, increased expression of insulin

receptor substrate 1 (IRS1) and Akt phosphorylation resulting from HO-1 over-expression in liver,

adipose tissue, and skeletal muscle might play a greater role in hemin-induced increase in

systematic insulin sensitivity (Supplemental Fig. 9). It is therefore probable that improved insulin


20

sensitivity upon hemin treatment is more likely a systematic effect.

In summary, the present study provides novel experimental evidence that bilirubin mediates

HO-1 induction-induced vascular benefits through activation of the PI3K/Akt/eNOS signaling

cascade in diabetic mice. The present findings enhance the prospective of using HO-1 inducers or

bilirubin to ameliorate diabetic vasculopathy.

Author contributions

JL, LW, LL, YZ and SLW conducted the experiments and analyzed the data. YH, LJ, XYT and

WTW designed the experiments and prepared the manuscript. QH and HMH performed bioassay

NW, ZYC, JY and XY conducted biochemical assay, provided plasmids and assisted with discussion.

YH is the guarantor of this study.

Acknowledgement

This study is supported by Hong Kong Research Grants Council (465611, CUHK2/CRF/12G,

T12-705/11), National Basic Research Program of China (2012CB517805).

No potential conflicts of interest relevant to this work.


21

References

1. Donner T, Munoz M: Update on Insulin Therapy for Type 2 Diabetes. J Clin Endocrinol Metab

2012;97:1405-1413

2. Wong WT, Wong SL, Tian XY, Huang Y: Endothelial dysfunction: the common consequence in

diabetes and hypertension. J Cardiovasc Pharmacol 2010;55:300-307

3. Cao J, Inoue K, Li X, Drummond G, Abraham NG: Physiological significance of heme

oxygenase in hypertension. Int J Biochem Cell Biol 2009;41:1025-1033

4. Keyse SM, Tyrrell RM: Both near ultraviolet radiation and the oxidizing agent hydrogen

peroxide induce a 32-kDa stress protein in normal human skin fibroblasts. The Journal of biological

chemistry 1987;262:14821-14825

5. Malaguarnera L, Imbesi R, Di Rosa M, Scuto A, Castrogiovanni P, Messina A, Sanfilippo S:

Action of prolactin, IFN-gamma, TNF-alpha and LPS on heme oxygenase-1 expression and VEGF

release in human monocytes/macrophages. International immunopharmacology 2005;5:1458-1469

6. Iori E, Pagnin E, Gallo A, Calo L, Murphy E, Ostuni F, Fadini GP, Avogaro A: Heme

oxygenase-1 is an important modulator in limiting glucose-induced apoptosis in human umbilical

vein endothelial cells. Life sciences 2008;82:383-392

7. Bruce CR, Carey AL, Hawley JA, Febbraio MA: Intramuscular heat shock protein 72 and heme

oxygenase-1 mRNA are reduced in patients with type 2 diabetes: evidence that insulin resistance is

associated with a disturbed antioxidant defense mechanism. Diabetes 2003;52:2338-2345

8. Jais A, Einwallner E, Sharif O, Gossens K, Lu TT, Soyal SM, Medgyesi D, Neureiter D,

Paier-Pourani J, Dalgaard K, Duvigneau JC, Lindroos-Christensen J, Zapf TC, Amann S, Saluzzo S,

Jantscher F, Stiedl P, Todoric J, Martins R, Oberkofler H, Muller S, Hauser-Kronberger C, Kenner

L, Casanova E, Sutterluty-Fall H, Bilban M, Miller K, Kozlov AV, Krempler F, Knapp S, Lumeng

CN, Patsch W, Wagner O, Pospisilik JA, Esterbauer H: Heme oxygenase-1 drives metaflammation

and insulin resistance in mouse and man. Cell 2014;158:25-40

9. Li M, Kim DH, Tsenovoy PL, Peterson SJ, Rezzani R, Rodella LF, Aronow WS, Ikehara S,

Abraham NG: Treatment of obese diabetic mice with a heme oxygenase inducer reduces visceral

and subcutaneous adiposity, increases adiponectin levels, and improves insulin sensitivity and

glucose tolerance. Diabetes 2008;57:1526-1535

10. Li M, Peterson S, Husney D, Inaba M, Guo K, Terada E, Morita T, Patil K, Kappas A, Ikehara

S, Abraham NG: Interdiction of the diabetic state in NOD mice by sustained induction of heme

oxygenase: possible role of carbon monoxide and bilirubin. Antioxid Redox Signal 2007;9:855-863


22

11. Fang XD, Yang F, Zhu L, Shen YL, Wang LL, Chen YY: Curcumin ameliorates high

glucose-induced acute vascular endothelial dysfunction in rat thoracic aorta. Clin Exp Pharmacol

Physiol 2009;36:1177-1182

12. Abraham NG, Rezzani R, Rodella L, Kruger A, Taller D, Li Volti G, Goodman AI, Kappas A:

Overexpression of human heme oxygenase-1 attenuates endothelial cell sloughing in experimental

diabetes. Am J Physiol Heart Circ Physiol 2004;287:H2468-2477

13. Hunt SC, Kronenberg F, Eckfeldt JH, Hopkins PN, Myers RH, Heiss G: Association of plasma

bilirubin with coronary heart disease and segregation of bilirubin as a major gene trait: the NHLBI

family heart study. Atherosclerosis 2001;154:747-754

14. Kimm H, Yun JE, Jo J, Jee SH: Low serum bilirubin level as an independent predictor of stroke

incidence: a prospective study in Korean men and women. Stroke 2009;40:3422-3427

15. Perlstein TS, Pande RL, Creager MA, Weuve J, Beckman JA: Serum total bilirubin level,

prevalent stroke, and stroke outcomes: NHANES 1999-2004. Am J Med 2008;121:781-788

16. Perlstein TS, Pande RL, Beckman JA, Creager MA: Serum total bilirubin level and prevalent

lower-extremity peripheral arterial disease: National Health and Nutrition Examination Survey

(NHANES) 1999 to 2004. Arterioscler Thromb Vasc Biol 2008;28:166-172

17. Dullaart RP, de Vries R, Lefrandt JD: Increased large VLDL and small LDL particles are

related to lower bilirubin in Type 2 diabetes mellitus. Clinical biochemistry 2014; pii:

S0009-9120(14)00621-3

18. Lin JP, O'Donnell CJ, Schwaiger JP, Cupples LA, Lingenhel A, Hunt SC, Yang S, Kronenberg

F: Association between the UGT1A1*28 allele, bilirubin levels, and coronary heart disease in the

Framingham Heart Study. Circulation 2006;114:1476-1481

19. Lee MJ, Jung CH, Kang YM, Hwang JY, Jang JE, Leem J, Park JY, Kim HK, Lee WJ: Serum

bilirubin as a predictor of incident metabolic syndrome: A 4-year retrospective longitudinal study of

6205 initially healthy Korean men. Diabetes & metabolism 2014;40(4):305-309

20. Dekker D, Dorresteijn MJ, Pijnenburg M, Heemskerk S, Rasing-Hoogveld A, Burger DM,

Wagener FA, Smits P: The bilirubin-increasing drug atazanavir improves endothelial function in

patients with type 2 diabetes mellitus. Arterioscler Thromb Vasc Biol 2011;31:458-463

21. Wong WT, Tian XY, Xu A, Ng CF, Lee HK, Chen ZY, Au CL, Yao X, Huang Y: Angiotensin

II type 1 receptor-dependent oxidative stress mediates endothelial dysfunction in type 2 diabetic

mice. Antioxid Redox Signal 2010;13:757-768


23

22. Tian XY, Wong WT, Wang N, Lu Y, Cheang WS, Liu J, Liu L, Liu Y, Lee SS, Chen ZY,

Cooke JP, Yao X, Huang Y: PPARdelta activation protects endothelial function in diabetic mice.

Diabetes 2012;61:3285-3293

23. Onishi S, Isobe K, Itoh S, Kawade N, Sugiyama S: Demonstration of a geometric isomer of

bilirubin-IX alpha in the serum of a hyperbilirubinaemic newborn infant and the mechanism of

jaundice phototherapy. Biochem J 1980;190:533-536

24. Varadi K, Michelfelder S, Korff T, Hecker M, Trepel M, Katus HA, Kleinschmidt JA, Muller

OJ: Novel random peptide libraries displayed on AAV serotype 9 for selection of endothelial

cell-directed gene transfer vectors. Gene therapy 2012;19:800-809

25. Grieger JC, Choi VW, Samulski RJ: Production and characterization of adeno-associated viral

vectors. Nature protocols 2006;1:1412-1428

26. Moffat J, Grueneberg DA, Yang X, Kim SY, Kloepfer AM, Hinkle G, Piqani B, Eisenhaure TM,

Luo B, Grenier JK, Carpenter AE, Foo SY, Stewart SA, Stockwell BR, Hacohen N, Hahn WC,

Lander ES, Sabatini DM, Root DE: A lentiviral RNAi library for human and mouse genes applied

to an arrayed viral high-content screen. Cell 2006;124:1283-1298

27. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B: A simplified system for

generating recombinant adenoviruses. Proc Natl Acad Sci U S A 1998;95:2509-2514

28. Kawamura K, Ishikawa K, Wada Y, Kimura S, Matsumoto H, Kohro T, Itabe H, Kodama T,

Maruyama Y: Bilirubin from heme oxygenase-1 attenuates vascular endothelial activation and

dysfunction. Arterioscler Thromb Vasc Biol 2005;25:155-160

29. He T, Smith LA, Lu T, Joyner MJ, Katusic ZS: Activation of peroxisome proliferator-activated

receptor-{delta} enhances regenerative capacity of human endothelial progenitor cells by

stimulating biosynthesis of tetrahydrobiopterin. Hypertension 2011;58:287-294

30. Han JK, Kim HL, Jeon KH, Choi YE, Lee HS, Kwon YW, Jang JJ, Cho HJ, Kang HJ, Oh BH,

Park YB, Kim HS: Peroxisome proliferator-activated receptor-{delta} activates endothelial

progenitor cells to induce angio-myogenesis through matrix metallo-proteinase-9-mediated

insulin-like growth factor-1 paracrine networks. European heart journal 2011; 34(23):1755-1765

31. Jangi S, Otterbein L, Robson S: The molecular basis for the immunomodulatory activities of

unconjugated bilirubin. Int J Biochem Cell Biol 2013;45:2843-2851

32. Sticova E, Jirsa M: New insights in bilirubin metabolism and their clinical implications. World

journal of gastroenterology : WJG 2013;19:6398-6407


24

33. Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN: Bilirubin is an antioxidant of

possible physiological importance. Science 1987;235:1043-1046

34. Fujii M, Inoguchi T, Sasaki S, Maeda Y, Zheng J, Kobayashi K, Takayanagi R: Bilirubin and

biliverdin protect rodents against diabetic nephropathy by downregulating NAD(P)H oxidase.

Kidney international 2010;78:905-919

35. Jansen T, Hortmann M, Oelze M, Opitz B, Steven S, Schell R, Knorr M, Karbach S,

Schuhmacher S, Wenzel P, Munzel T, Daiber A: Conversion of biliverdin to bilirubin by biliverdin

reductase contributes to endothelial cell protection by heme oxygenase-1-evidence for direct and

indirect antioxidant actions of bilirubin. Journal of molecular and cellular cardiology

2010;49:186-195

36. Achouh PE, Simonet S, Fabiani JN, Verbeuren TJ: Carbon monoxide induces relaxation of

human internal thoracic and radial arterial grafts. Interact Cardiovasc Thorac Surg 2008;7:959-962

37. Ndisang JF, Zhao W, Wang R: Selective regulation of blood pressure by heme oxygenase-1 in

hypertension. Hypertension 2002;40:315-321

38. Ishikawa M, Kajimura M, Adachi T, Maruyama K, Makino N, Goda N, Yamaguchi T, Sekizuka

E, Suematsu M: Carbon monoxide from heme oxygenase-2 Is a tonic regulator against

NO-dependent vasodilatation in the adult rat cerebral microcirculation. Circ Res 2005;97:e104-114

39. Samora JB, Goodwill AG, Frisbee JC, Boegehold MA: Growth-dependent changes in the

contribution of carbon monoxide to arteriolar function. J Vasc Res 2010;47:23-34

40. Nicolai A, Li M, Kim DH, Peterson SJ, Vanella L, Positano V, Gastaldelli A, Rezzani R,

Rodella LF, Drummond G, Kusmic C, L'Abbate A, Kappas A, Abraham NG: Heme oxygenase-1

induction remodels adipose tissue and improves insulin sensitivity in obesity-induced diabetic rats.

Hypertension 2009;53:508-515

41. Burgess A, Li M, Vanella L, Kim DH, Rezzani R, Rodella L, Sodhi K, Canestraro M, Martasek

P, Peterson SJ, Kappas A, Abraham NG: Adipocyte heme oxygenase-1 induction attenuates

metabolic syndrome in both male and female obese mice. Hypertension 2010;56:1124-1130


25

Figure legends

FIG. 1. Effects of hemin, SnMP, HO-1 over-expression and HO-1 silencing on EDRs in mouse

aortas. A: The impaired EDRs of db/db mouse aortas were rescued by hemin (HO-1 inducer, 25

mg/kg, 3 times/week, 2-week, ip), which was antagonized by co-treatment with SnMP (HO-1

inhibitor, 20 mg/kg, 3 times/week, 2-week, ip). *p<0.05 vs db/m+; #p<0.05 vs db/db; †p<0.05 vs

db/db+Hemin. B: Hemin treatment increased HO-1 expression in mouse aortas. *p<0.05 vs db/m+;

#p<0.05 vs db/db. C: Ex vivo hemin treatment (5 µmol/L, 24 h) improved EDRs in db/db mouse

aortas, which was inhibited by SnMP (30 µmol/L). *p<0.05 vs Control; #p<0.05 vs Hemin. D:

HO-1 overexpressing adenovirus transduction augmented EDRs of db/db mouse aortas. GFP or

HO-1 adenovirus was injected via tail vein 4 days before mice were sacrificed. *p<0.05 vs GFP Adv.

E: HO-1 shRNA virus transduction inhibited hemin-induced improvement in EDRs in db/db mouse

aortas. *p<0.05 vs db/db; #p<0.05 vs db/db+Hemin+scramble. F: HO-1 shRNA virus transduction

suppressed hemin-induced HO-1 expression in db/db mouse aortas. *p<0.05 vs db/db; #p<0.05 vs

db/db+Hemin+scramble. Data are means±SEM of 4-6 experiments.

FIG. 2. PI3K/Akt/eNOS mediates the beneficial effect of HO-1 in db/db mouse aortas. A&B:

Chronic hemin treatment increased phosphorylation of Akt (Ser308) and eNOS (Ser1177). *p<0.05

vs db/m+; #p<0.05 vs db/db; † p < 0.05 vs db/db+Hemin. C, D&E: HO-1 shRNA virus transduction

suppressed Akt (Ser308) and eNOS (Ser1177) phosphorylation after hemin treatment. *p<0.05 vs

db/m+; #p<0.05 vs db/db; † p < 0.05 vs db/db+Hemin+scramble. F: Improved EDRs in aortas from

hemin-treated db/db mice were attenuated by wortmannin (100 nmol/L, 24 h) or Akt inhibitor V (5

µmol/L, 24 h). *p<0.05 vs Control. Data are means±SEM of 4-6 experiments.

FIG. 3. The effect of unconjugated bilirubin on EDRs. A: Hemin administration increased the level

of serum unconjugated bilirubin in db/db mice. *p<0.05 vs db/m+; #p<0.05 vs db/db; †p<0.05 vs

db/db+Hemin. B: Ex vivo treatment with bilirubin (1 µmol/L, 24-h) improved EDRs in db/db mouse

aortas, with or without Akt inhibitor V (5 µmol/L) or SnMP (30 µmol/L). *p<0.05 vs Control;

#p<0.05 vs Bilirubin. C&D: Mouse aortas were exposed to GFP shRNA or BVR shRNA

adenovirus for 24-h and then treated with hemin (5 µmol/L) or bilirubin (1 µmol/L) for another 24-h

before functional assay. *p<0.05 vs Control; #p<0.05 vs BVR shRNA+Hemin. E&F: Successful

suppression of biliverdin reductase expression by BVR shRNA was shown by Western blotting and

immunohistochemistry. *p<0.05 vs GFP shRNA. Data are means±SEM of 4-6 experiments.

FIG.4. Effect of chronic bilirubin treatment on EDRs in db/db mouse aortas. A: Oral administration

of bilirubin to db/db mice (5 mg/kg, 3 times/week, 2-week, ip) augmented EDRs in aortas. *p<0.05

vs db/m+; #p<0.05 vs db/db. B, C&D: Chronic bilirubin treatment increased phosphorylation of Akt

(Ser308) and eNOS (Ser1177) in db/db mouse aortas. *p<0.05 vs db/m+; #p<0.05 vs db/db. Data

are means±SEM of 4-6 experiments.


26

FIG. 5. The effects of hemin, bilirubin, or Akt activity inhibition on NO production in HUVECs. A:

Representative images of DAF-DA fluorescence signal in response to A23187 (100 nmol/L) in

HUVECs. The fluorescence before (F0) and after (F1) the addition of A23187 was analyzed. B&C:

Summarized results showing the levels of NO production in HUVECs treated with hemin (5 µmol/L,

36-h) or bilirubin (1 µmol/L, 36-h) in the presence or absence of SnMP (30 µmol/L, 36-h) or Akt

inhibitor V (5 µmol/L, 36-h) after exposure to NG or HG. *p<0.05 vs NG; #p<0.05 vs HG; †p<0.05

vs HG+Hemin/Bilirubin. D: Effects of DN-Akt on NO production in HUVECs co-incubated with

hemin (5 µmol/L) or bilirubin (1 µmol/L). *p<0.05 vs NG. E&F: Akt and eNOS phosphorylation in

HUVECs treated with hemin (5 µmol/L), with or without SnMP (30 µmol/L) exposed to NG or HG

(30 mmol/L, 36-h). *p<0.05 vs NG; #p<0.05 vs HG; †p<0.05 vs HG+Hemin. G&H: Bilirubin (1

µmol/L) increased Akt and eNOS phosphorylation in HUVECs exposed to HG (30 mmol/L, 36-h).

The effect was abrogated by Akt inhibitor V. *p<0.05 vs NG; #p<0.05 vs HG; †p<0.05 vs

HG+Bilirubin. Data are means±SEM of 4-6 experiments.

FIG.6. The effects of BVR shRNA on Akt and eNOS phosphorylation in HUVECs. A-C: BVR

shRNA reversed the effect of hemin (5 µmol/L) on Akt and eNOS phosphorylation. *p<0.05 vs NG;

#p<0.05 vs HG; †p<0.05 vs HG+Hemin. D-E: BVR shRNA did not influence the effect of bilirubin

(1 µmol/L) on Akt and eNOS phosphorylation. #p<0.05 vs HG; †p<0.05 vs HG+Bilirubin. Data are

means±SEM of 4-6 experiments.

FIG.7. The effect of bilirubin on EDRs in renal arteries from diabetic patients. A&B: Bilirubin

treatment (1 µmol/L, 24 h) improved EDRs in renal arteries from diabetic patients (DM). C:

Immunohistochemistry staining showing the expression of biliverdin reductase in the endothelium

in human renal arteries. *p<0.05 vs Control, #p<0.05 vs DM. Data are means±SEM of 3

experiments.


253x356mm (300 x 300 DPI)


253x356mm (300 x 300 DPI)


253x356mm (300 x 300 DPI)


253x356mm (300 x 300 DPI)


253x356mm (300 x 300 DPI)


253x356mm (300 x 300 DPI)


253x356mm (300 x 300 DPI)


Data Supplement - Liu et al., 2014

1

Data Supplement

Unconjugated bilirubin mediates HO-1-induced vascular benefits in diabetic mice

Jian Liu1, Li Wang1, Xiaoyu Tian1, Limei Liu2, Wing-Tak Wong3, Yang Zhang1, Quanbin Han4, Hing- Man Ho4, Nanping Wang5, Siu-Ling Wong1, Zhenyu Chen6, Jun Yu7, Chi-Fai Ng8, Xiaoqiang Yao1, Yu Huang1 1Institute of Vascular Medicine and Li Ka Shing Institute of Health Sciences, Chinese University of Hong Kong; Department of Physiology and Pathophysiology, Peking University Health Science Center, China; 3Department of Cardiovascular Sciences, Houston Methodist Research Institute, Houston, USA; 4School of Chinese Medicine, Hong Kong Baptist University; 5Institute of Cardiovascular Science, Peking University, China; 6School of Life Sciences, 7Department of Medicine and Therapeutics and 8Department of Surgery, Chinese University of Hong Kong, China

Additional Results Sodium nitroprusside-induced relaxations of aortas were unaffected by in vivo hemin treatment in db/db mice. Endothelium-independent relaxations induced by sodium nitroprusside (SNP) were similar among all groups (Supplemental Fig. 1).

-9 -8 -7 -6 -5

0

50

100

db/db+Hemin

db/m+

db/db

db/m++Hemin

db/db+SnMP+Hemin

ACh (log mol/L)

Rela

xatio

n(%

Phe tone)

Supplemental Figure 1. The effect of hemin treatment on sodium nitroprusside-induced relaxations in mouse aortas. Data are means±SEM of 4-6 mice.

in vitro hemin treatment and in vivo transduction with HO-1 overexpressing adenovirus increased HO-1 expression in mouse aortas. Hemin treatment (5 µmol/L, 24-h) and tail injection of HO-1-overexpressing adenovirus increased HO-1 expression in mouse aortas (Supplemental Fig. 2A&B).



2

Supplemental Figure 2. (A) HO-1 expression after hemin treatment (5 µmol/L, 24-h). *p<0.05 vs Control. (B) HO-1 expression after transduction with control virus (GFP AdV) and HO-1 overexpressing adenovirus (HO-1 AdV). *p<0.05 vs GFP AdV. Data are means±SEM of 4-6 mice.

In vivo hemin treatment improved endothelial function in diet-induced obese mice. Compared to lean mice, ACh-induced endothelium-dependent relaxations were impaired in diet-induced obese (DIO) mice (Supplemental Fig. 3A), which were reversed by two-week hemin treatment. Hemin treatment also increased HO-1 expression, phosphorylation of Akt (Thr308) and eNOS (Ser1177) in mouse aortas (Supplemental Fig. 3B, C&D).

Supplemental Figure 3. The effect of two-week hemin treatment on endothelial function in DIO mice. (A) ACh-induced relaxations in DIO mouse aortas. *p<0.05 vs

Control; #p<0.05 vs DIO. (B-D) HO-1 expression, phosphorylation of Akt (Thr308) and

eNOS (Ser1177) after hemin treatment. *p<0.05 vs DIO. Data are means±SEM of 4 mice.



3

Hemin and bilirubin treatment increased nitrite level in the aorta. Treatment with hemin (5 µmol/L, 24-h) and bilirubin (1 µmol/L, 24-h) increased nitrite levels in mouse aortas (Supplemental Fig. 4).

Supplemental Figure 4. The effect of hemin and bilirubin treatment on nitrite levels in mouse aortas. *p<0.05 vs db/m+; #p<0.05 vs db/db. Data are means±SEM of 4-6 mice.

BVR shRNA adenovirus transduction inhibited the effect of hemin in HUVECs Hemin treatment (5 µmol/L, 36-h) of HUVECs increased the bilirubin level in culture medium, which was reversed by transduction with BVR shRNA adenovirus (Supplemental Fig. 5A). In addition, hemin restored NO production that was impaired by high glucose (HG, 30 mmol/L, 36 h) in HUVECs. This effect of hemin was reversed after transduction of BVR shRNA adenovirus. However, the effect of bilirubin to restore NO production was not affected by BVR shRNA adenovirus transduction (Supplemental Fig. 5B&C).

Supplemental Figure 5. The effect of BVR shRNA transduction on bilirubin and NO production in HUVECs. (A) Bilirubin level in culture medium after hemin treatment (5 µmol/L, 36-h). *p<0.05 vs NG; #p<0.05 vs HG+Hemin. (B&C) NO production in HUVECs treated with hemin (5 µmol/L, 36-h) or bilirubin (1 µmol/L, 36-h) in the presence or absence of BVR shRNA adenovirus in HUVECs exposed to NG or HG. *p<0.05 vs NG; #p<0.05 vs HG; †p<0.05 vs HG+Hemin. Data are means±SEM of 4 experiments.



4

Bilirubin reduced reactive oxygen species (ROS) generation in HUVECs. Exposure to high glucose (HG, 30 mmol/L) for 36-h increased ROS production in HUVECs compared to normal glucose (NG, 5 mmol/L). Co-treatment with bilirubin (1 µmol/L) inhibited HG-stimulated ROS production, and Akt inhibitor V (5 µmol/L) and oxidized-hemoglobin inhibited the effect of bilirubin (Supplemental Fig. 6).

Supplemental Figure 6. The effect of bilirubin on high glucose-stimulated ROS production when used together with Akt inhibitor V or NO scavenger oxidized-hemoglobin. (A&B) The effect of Akt inhibitor (A&B) or oxidized-hemoglobin (C&D) on ROS production when used together with bilirubin as detected by CM-H2DCFDA or dihydroethidium (DHE). Data are means±SEM of 4 experiments. *p<0.05 vs NG; #p<0.05 vs HG; †p < 0.05 vs HG+Bilirubin.

Carbon monoxide-releasing molecule did not modulate EDRs. Ex vivo treatment with carbon monoxide-releasing molecule (CORM) tricarbonyldichlororuthenium (II) dimmer (10-100 nmol/L) for 24 hours did not change EDRs in db/db mouse aortas, with or without co-treatment of Akt inhibitor V (5 µmol/L) (Supplemental Fig. 7).

Supplemental Figure 7. Lack of the effect of carbon monoxide-releasing molecule (CORM) on EDRs in db/db mouse aortas. Data are means±SEM of 4 experiments.

-9 -8 -7 -6 -5

0

50

100

CORM100 nM

CORM100 nM+Akt inhibitor V

Control

ACh (log mol/L)

Re

laxa

tio

n(%

Ph

e to

ne

)

-9 -8 -7 -6 -5

0

50

100

Control

CORM10 nM


ACh (log mol/L)

Re

laxa

tio

n(%

Ph

e to

ne

)

-9 -8 -7 -6 -5

0

50

100

CORM100 nM


Control

ACh (log mol/L)

Re

laxa

tio

n(%

Ph

e to

ne

)

-9 -8 -7 -6 -5

0

50

100

Control

CORM10 nM


ACh (log mol/L)

Re

laxa

tio

n(%

Ph

e to

ne

)



5

Hemin slightly increased insulin sensitivity in db/db mice. Chronic hemin treatment did not change body weight and lipid profile in db/db mice (Supplemental Table 2). But fasting blood glucose and plasma insulin level was decreased. Oral glucose tolerance test and intraperitoneal insulin tolerance test showed an improved glucose tolerance and insulin sensitivity (Supplemental Fig. 8).

Supplemental Figure 8. The effect of chronic hemin treatment on fasting blood glucose (A), plasma insulin (B), oral glucose tolerance test (C) and intra-peritoneal insulin tolerance test (D) in db/db mice. Data are means±SEM of 4-6 mice. *p<0.05 vs db/m+; #p<0.05 vs db/db; †p<0.05 vs db/db+Hemin.

Hemin increased insulin receptor substrate 1 (IRS1) expression, Akt phosphorylation and HO-1 expression in liver, adipose tissue and skeletal muscle of db/db mice. Chronic hemin treatment increased IRS1 expression and Akt phosphorylation, as well as HO-1 expression in the liver, epididymal fat and skeletal muscle of db/db mice, which may account for the improved systematic insulin sensitivity (Supplemental Fig. 9).

0

10

20

30

db/m+

db/dbB

loo

d g

luco

se

(mm

ol/L

)

SnMP

Hemin – – +– +–– +––

A B

*#

†

0.0

7.5

15.0db/m

+db/db

Pla

sm

a in

su

lin

(µg

/L)

– – +– +–– +––

*

#

†

+

0

1500

3000

4500

db/m+

db/db

Are

a U

nd

er

Cu

rve

( mm

ol/L X

120 m

in)

SnMP

Hemin – – +– +–– +––

* #†

0

3000

6000

9000

12000

db/m+

db/db

Are

a U

nd

er

Cu

rve

( % o

f in

itia

l X

120 m

in)

– – +– +–– ––

*#

†

Oral glucose

tolerance testIntra-peritoneal insulin

tolerance testC D

0

10

20

30

db/m+

db/dbB

loo

d g

luco

se

(mm

ol/L

)

SnMP

Hemin – – +– +–– +––

A B

*#

†

0.0

7.5

15.0db/m

+db/db

Pla

sm

a in

su

lin

(µg

/L)

– – +– +–– +––

*

#

†

+

0

1500

3000

4500

db/m+

db/db

Are

a U

nd

er

Cu

rve

( mm

ol/L X

120 m

in)

SnMP

Hemin – – +– +–– +––

* #†

0

1500

3000

4500

db/m+

db/db

Are

a U

nd

er

Cu

rve

( mm

ol/L X

120 m

in)

SnMP

Hemin – – +– +–– +––

* #†

0

3000

6000

9000

12000

db/m+

db/db

Are

a U

nd

er

Cu

rve

( % o

f in

itia

l X

120 m

in)

– – +– +–– ––

*#

†

0

3000

6000

9000

12000

db/m+

db/db

Are

a U

nd

er

Cu

rve

( % o

f in

itia

l X

120 m

in)

– – +– +–– ––

*#

†

Oral glucose

tolerance testIntra-peritoneal insulin

tolerance testC D



6

Supplemental Figure 9. The effect of chronic hemin treatment on IRS1 expression, Akt phosphorylation and HO-1 expression in liver, epididymal fat and skeletal muscle of db/db mice. Data are means±SEM of 4-6 mice. *p<0.05 vs db/m+; #p<0.05 vs db/db; †p<0.05 vs db/db+Hemin+Scramble.

Supplemental Table 1. HbA1c values and the duration of diabetes of patients

Patient 1 Patient 2 Patient 3

HbA1c 9.1%/76 mmol/mol 7.2%/55 mmol/mol 6.7%/50 mmol/mol

Duration (years) 2 13 9



7

Supplemental Table 2. Basic parameters after chronic hemin treatment

db/m+ db/m

++ Hemin

db/db db/db +

Hemin db/db + SnMP + Hemin

Body weight (g) 29.8 ± 0.7 29.3±0.5 55.0 ± 4.6* 53.8±1.3 51.5 ± 3.8 Plasma levels of Total cholesterol (mg�mL-1)

77.2 ±3.3 79.9± 2.4 133.6 ± 10.5* 124.4 ± 4.4 146.7 ± 10.5

Triglyceride (mg�mL-1)

63.4 ± 2.4 60.9±2.5 210.7 ± 26.3* 204.8 ± 16.2 210.7 ± 13.6

HDL (mg�mL-1) 42.1±1.1 42.1±1.1 83.1 ± 4.7* 89.4 ± 5.3 80.3 ± 2.7 non-HDL (mg�mL-1) 35.0± 2.4 37.7 ± 1.5 50.5 ± 5.2* 48.0 ±4.5 46.4 ± 4.0

The levels of total cholesterol, triglyceride, HDL, and non-HDL in the plasma from mice were measured by enzymatic methods (Stanbio, Boerne, TX, USA). Data are means±SEM of 4-6 mice *p< 0.05 vs db/m+.

Additional Discussion Akt is one of eNOS activators in endothelial cells. Reduced Akt phosphorylation is reported in arteries of diabetic animals or in high glucose-treated endothelial cells while Akt activation augments endothelium-dependent relaxations in aortas of diabetic mice (1). Previous studies showed that high glucose exposure suppresses Akt phosphorylation probably through increasing oxidative stress and protein kinase C activation (2-5). The present study shows a decreased Akt phosphorylation in db/db mouse aortas. Serum bilirubin concentration is reported to be lower in diabetic patients than in healthy subjects (6). We also detected less serum bilirubin level in diabetic mice, indicating that lower serum bilirubin may partly account for the reduced aortic Akt phosphorylation in diabetic mice. In view of the serum antioxidant capacity of bilirubin (7), oxidative stress in association with reduced bilirubin is probably another factor involved in decreased Akt phosphorylation under diabetic conditions (2-5). Our in vitro experiments show that high glucose exposure stimulates ROS generation and reduces Akt phosphorylation in human endothelial cells without changing the levels of HO-1 and bilirubin. In vitro and in vivo results show a different impact of hyperglycemia on bilirubin levels in cultured endothelial cells and in serum of diabetic mice probably due to far more complex mechanisms regulating circulating bilirubin concentration which is likely controlled by the balance between production and excretion of bilirubin in vivo. Although the present study does not provide direct data to support the possibility that decreased serum bilirubin is associated with decreased Akt phosphorylation in db/db mouse aortas, increased bilirubin production by hemin treatment and bilirubin administration to db/db mice can effectively increase Akt phosphorylation. The present study shows that bilirubin activates Akt/eNOS/NO cascade to lower oxidative stress as the major mechanism to restore the impaired endothelial function in hemin-treated diabetic mice. References 1. Tian XY, Wong WT, Wang N, Lu Y, Cheang WS, Liu J, Liu L, Liu Y, Lee SS, Chen ZY, Cooke JP, Yao X, Huang Y: PPARdelta activation protects endothelial function in diabetic mice. Diabetes 2012;61:3285-3293 2. Rask-Madsen C, King GL: Proatherosclerotic mechanisms involving protein kinase C in



8

diabetes and insulin resistance. Arterioscler Thromb Vasc Biol 2005;25:487-496 3. Geraldes P, King GL: Activation of protein kinase C isoforms and its impact on diabetic complications. Circ Res 2010;106:1319-1331 4. Scott JA, King GL: Oxidative stress and antioxidant treatment in diabetes. Annals of the New York Academy of Sciences 2004;1031:204-213 5. King GL, Loeken MR: Hyperglycemia-induced oxidative stress in diabetic complications. Histochemistry and cell biology 2004;122:333-338 6. Dullaart RP, de Vries R, Lefrandt JD: Increased large VLDL and small LDL particles are related to lower bilirubin in Type 2 diabetes mellitus. Clinical biochemistry 2014; pii: S0009-9120(14)00621-3 7. Vitek L, Jirsa M, Brodanova M, Kalab M, Marecek Z, Danzig V, Novotny L, Kotal P: Gilbert syndrome and ischemic heart disease: a protective effect of elevated bilirubin levels. Atherosclerosis 2002;160:449-456


Documents

Unconjugated bilirubin mediates heme oxygenase-1-induced … · 2014. 12. 2. · 2 Abstract Heme oxygenase-1 (HO-1) exerts vaso-protective effects. Such benefit in diabetic vasculopathy