Upload
others
View
19
Download
0
Embed Size (px)
Citation preview
Regulation of DNA Replication Initiation in a Baculovirus, AcMNPV
Yuntao Wu
A thesis submitted to the Depamnent of Microbiology and Immunology in conformity with the requirements for the degree of
Doctor of Philosophy
Queen ' s University Kingston, Ontario, Canada
February, 1998
copyright@ Yuntao Wu, 1998
National Library I*! of Canada Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
395 Wellington Street 395. nie Wellington OttawaON K1AON4 Ottawa ON K1A ON4 Canada Canada
The author has granted a aon- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sell copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfichelfih, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
QUEEN'S UNIVERSITY AT KINGSTON
SCHOOL OF GRADUATE STUDIES AND RESEARCH
PERMISSION OF CO-AUTHOR(S)
I/we, the undersigned, hereby grant permission to microfilm any materiai designated as being co-authored by melus in the thesis copyrighted to the person named below:
Name of Copyrighted Author Signature of copyrighted author
ABSTRACT
Homologous regions (hrs) of Aitrographa californica multicapsid nuclearpolyhe-
drovims (AcMNPV) may funcrion as ongins of viral DNA replication. To determine the
role of hrs in the replication process, plasrnids containing specific deletions of various hrs
were generated and tested in a standardized, plasmid-based replication assay. Deletion of
hr2 and hr5 abolished the ability of plasmids to replicate in the infected cells, while
deletion of h r l . hr3 and hr4a did not, suggesting that hrs were not unique sequences
possessing the ability to support plasmid DNA replication in the infected cells. Plasmids
carrying the complete ie-2 and pe38 genes. the ie-l gene upsueam region or a variety of
baculovirus early genes were also able to replicate in vims infected cells. Thus, certain
sequences within viral early genes could also function as putative origins of replication.
The iti vivo effects of hr deletions were firther invesagated to detect whether any h r was
essential or important for the replication of baculovinis. Six groups of recombinant vinises
carrying deletions in either hr 1. hrla, hR, hr3, hr4a. hr4b were consmicted. Each of these
recombinant viruses replicated normally in cultured cells, as judged by the production of
progeny vinons, even though levels of products of viral early genes such as ie-1, p M 3 ,
lef-3 orp47 were changed. These data indicated that individually none of the hrs was
essential for the viral replication.
In contrast to DNA replication in the vims infected cells, plasmids in the absence of
v i n l inserts replicated in cells cotransfected with virai DNA. Replication of plasmid DNA
was not due to acquisition of hrs or other viral sequences following cotransfection; nther.
it depended on the presence of viral genes including ie-1, p I 4 3 . dnapol, lefil, lef-2. ief-3
and p35, iti rmrs. The data suggested that the replication machinery of baculovinis could
potentially initiate DNA replication from multiple sequences, including non-viral
sequences in cenain circurnsmces. A mode1 was proposed suggesting that the selection of
replication initiation sites may be imposed directly by a chromatin structure and indirectly
by specific sequences and that the process of viral DNA replication may be linked with
viral transcription. The conformation of plasrnid DNA replicating in the coa-ansfected cells
was analyzed and found to be high moiecular weight concatemers. Ten to 25% of the
replicated plasmid DNA was integrated into multiple locations on the viral genome and
was present in progeny virions following serial passage. No homologous or conserved
sequences were identified at the proximiry of the integration sites. indicating possible
involvement of non-homologous recombination in the process of viral DNA replication.
These data also suggested that while roLling-circle mechanism could be used for the viral
DNA replication, recombination rnay be highly involved.
Specific roles of viral factors in the process of DNA replication in the cotransfected
cells were investigated, based on possible interactions of viral factors with the putative
helicase, P143. P l 4 3 was localized in the nuclei of infected cells or cells cotransfected
with viral DNA but retained in the cytoplasm in the absence of other viral proteins. The
viral single-smded DNA binding protein, LEF-3, was essential and sufficient to mediate
the localization of Pl43 into the nucleus. LEF-3 and P l 4 3 colocalized in the nucleus,
suggesting that these two proteins rnay exist as a complex in the infected cells. In contrast,
other viral proteins such as IE- 1, LEF- 1. LEF-2. DNA polymerase and P35 failed to
mediate the nuclear localization of P143, suggesting that a direct interaction between Pl43
and these viral factors rnay not exist. Together. it was implicated that regulation in the
initiation of DNA replication in baculovirus rnay be closely related to possible function of
the putative helicase P l 4 3 in the nucleus. Interactions between DNA and Pl43 or the
complex of Pl43 and LEF-3 rnay promote the replication of multiple sequences in the
infected or cotransfected celis. Resaictions on possible interactions between Pl43 and the
viral genorne rnay determine specific sites to be used as ongins during the replication of
the baculovinis genome.
ACKNOWLEDGMENTS
1 would like to thank my supervisor Dr. Eric B. Cantens, for introducing me to this great country, and for his guidance and help throughout the period when 1 was in culture shock, financial crisis, and while standing in the darkness of an unknown world, both academically and cuiturally. His unique way of training has helped to make me what 1 am today. My growth is evident when cornpared with what 1 was like when 1 fust arrived here - barely able to speak a complete sentence of English but confident with a Chinese-English dictionary in rny hand. which unfortunately was later confmed to have taught me many unusual expressions. I am proud of not only what 1 have achieved today, but also what 1 will be able to do tornorrow.
1 also would like to thank my supervisory cornmittee. Dn. Peter Faulkner, Andrew fiopinski, and Chris Mueller for their invaluable suggestions at many critical points of my research and for their sound jud&ment of my progress.
Special thanks to my lab mates: Renée Lapointe who tolerated my invasion of her bench space many times until 1 was kicked out of the main lab; Ge Liu who shared with me his extensive experiences in DNA replication assays and Qiagen columns; Kent Arrell who was my batting coach in my first softball garne; and Jian J. Liu and Wei Qiu who gave me many valuable suggestions during lab meeting. Special thanks to Richard Casselman, our technicianship. whose lab slang 1 used unsuccessfully as necessary jargon in my academic writing and as key words for Medline literature searches.
1 gratefully acknowledge the help of Drs. Albert Lu and Ge Liu for providing plasmids pAcHE4.3, pAcHE4.5, pAchr2, pAcp 143. pAclefl, pAcIE 1 hrP 143 and pAcIEl LEF-3; Dr. Lois Miller for pAcdnap and pAclef3; and Dr. Paul Friesen for p E l- IacZ.
1 wouid also like to thank members of my family: my wife Tao Liu, who adjusted her personal life to help rny personal growth and endured many lonely days and nights; my daughter Anqi Wu, to whorn 1 promise to devote more time: and my brothers and sisters, who were al1 in China providing me with encouragement through their letters.
1 would like to thank to my parents who are laying peacefully undemeath. but on the other side of the earth. 1 am sure they would be proud of me if they were still alive. 1 do not intend to disturb them tliis time but just want to say that I appreciate very much what they have done for me during their life tirnes. My mother's philosophy of life, do your best but do not expect anything, influenced me for so many years and helped me to deai with al1 kinds of hardship in life.
I dedicate this thesis to three extraordinary women: my mother, my wife and my daughter.
Finally , 1 grate full y acknowledge the financial support of the Medical Research Council of Canada, the National Science and Engineering Research Council of Canada, the Canada Student Loan Program, the Ontario Student Loan Program, Queen's University and the University of Konstam in Germany.
Yuntao Wu
TABLE OF CONTENTS ABSTRACT ....................................................................................... ii ACKNOWLEDGMENTS ........................................................................ iv TABLE OF CONTENTS ......................................................................... v
LIST OF FIGURES .............................................................................. vii ...
LIST OF TABLES ................................................................................ v u LIST OF ABBREVIATIONS .................................................................... ix
1 . DNA Replication Initiation and its Regulation ................................... 1 A . Origins of Replication ........................................................... 1 B . Replication Initiaton ............................................................ 4 C . Helicases for Unwinding at Origins ........................................... 5 D . Priming DNA Synthesis ....................................................... - 7 E . Assembly of DNA Polymerases ont0 Ongins by Accessoiy
Factors .............. ... .......................................................... - 8 F . DNA Polymerases ............................................................... 10 G . Other Factors Involved in DNA Replication ................................. 12 H . DNA Replication Initiation in Cells of Multicellular
....................................................................... Eukaryotes 12 II . DNA Replication Initiation in DNA Viruses ...................................... 16 III . DNA Replication Initiation in Baculovirus ........... .... .................. 20
A . AcMNPV and its Genome ...................................................... 21 B . Baculovirus Putative Replication Origins ................................. 2 2 C . Genes Involved in DNA Replication .......................................... 24
1 . ie-l gene ................................................................... 24 . ............................................................... 2 dnopoi gene 25
3 . p l 4 3 gene .................................................................. 25 4 . lef.1, 2, 3 genes .......................................................... 26 5 . p3.5. ie-2 and pe38 genes ............................................... 26
................................... 6 . pcia and putative exonuclease genes 27 D . Baculovirus DNA Replication and Gene Transcription ..................... 28
............................................. E . Possible Replication Mechanisms 29
............................................................................. III . Rationale -30
MATERIALS AND METHODS ................................................................ 35 A . Cells and Viruses ................................................................... -35
.................................. B . Cloning and Subcloning Viral DNA Fragments 36 ............................................. C . Construction of Recombinant Viruses 41
.......................... D . DNA Purification, Elecaophoresis and Hybridization 41 .................... E . Rotein Exmction, Electrophoresis and Immuno Detection 43
F . Transfection and Replication Assays in Sf21 Cells .............................. 44 G . Immunofluorescence Microscopy .................................................. 45 H . Cornputer Assisted Data Analysis .................................................. 47
RESULTS .......................................................................................... 48
A . Replication of Plasrnids and Recombinant Viruses Canying hr Deletions ............................................................................. -48
B . Identification of Alternative Origins of Replication ............................. - 5 5 1 . initiation of DNA Replication by Viral Early Gene Regions ............... 55
................ 2 . Initiation of DNA Replication by the ie-I Promoter Region 60
........................ C . Replication of Plasmid DNA in Cotransfected Cells ..... 62 1 . Plasmid RepLication is Independent of Specifc Viral
Sequences ....................................................................... -62 2 . Plasmid Replication Depends Upon Viral Genes ........................... -64
D . Conformation of the Replicated Plasrnid DNA in Cotransfected CeUs .................................................................................. -66 1 . High Molecular Weight, Concatemeric Structure of the
Replicated Plasmid DNA ....................................................... 68 2 . Inte_ption of the Replicated plasrnid DNA into Viral
Genome ........................................................................... 68 E . Possible Interaction of Viral proteins in Initiation of DNA
Replication ........................................................................... - 8 5 1 . Different ïntncelluiar Localization of Pl43 and IE-l in CeUs
Co-producing P 143 and IE- 1 .................................................. 85 2 . The Abiiiry of the Viral Replication Factors to Facilitate the
Nuclear Localization of Pl43 .................................................. 87 ............................... 3 . Pl43 and LEF-3 colocalize in the nucleus ... 90
DISCUSSION .................................................................................... -94
A . Roles of hrs in DNA Replication ................................................... 94
B . DNA Repiication Initiation and Early Gene Transcription ..................... -97 .................. C . Possible Mechanisms of Initiation of Viral DNA Replication 100
D . Recombination and V i n l DNA Replication ....................................... 107 . E Conclusions .......................................................................... 111
REFERENCES .................................................................................... 113
CURRICULUM VITAE ......................................................................... 142
LIST OF TABLES
Table 1. Production of progeny budded vimses at 24 hours post infection with hr deletion viruses. ......................................................... .52
Table 2. Roduction of progeny budded viruses at 48 houn post infection with hr deletion viruses. .......................................................... 52
Table 3. Determination of replication initiation efficiency following standard replication assay. ................................................................. .59
LIST OF ABBREVIATIONS
AcMNPV ARS ATP bp BV DAH 0 dCTP DNA m7-P DOPE dpm rn DUE EBV EBNAl E. coli EDTA FSC h hl- IE kb kD LEF rnA
min MCM MNPV
Autographa cafvornica MNPV autonornously replicating sequences Adenosine triphosphate base pair budded virus 4',6-diamidino-2-phenylindole diameter deoxycytidine triphosphate deox yribonucleic acid deoxynucleotide triphosphate 1 2-dioleoyl-sn-glycero-phosphatidylethanol-amine disin tegrations per minute Di thiothreitol DNA unwinding element Epstein-Bar vims Epstein-Bar nuclear antigen 1 Eschericia cofi ethylenediamineteaaacetic acid fatal caIf serum hour hornologous region immediate-earl y kilo base kilodal ton late expression factor rnilliampere microCurie microfaraday microlitre microgram micromolar miiiigrarn millili ue millime ter minutes minichromosome maintenance multicapsid nucleopolyhedrovirus multiplicity of infection nanometre nucleopolyhedrovirus nucleotide occluded virus omega op tical density
on ORE OBR RP- A PAGE PBS PCNA PCR pol-a p l - 6 PI RFC rPm RNA SV40 SSB ts Tris TEMED v
ongin origin recognition element origin of bidirectional repiication replication protein A po lyacry larnide gel electrop horesis p hosphate-buffered saline proliferation ceil nuclear antigen polyrnerase chah reaction polyrnerase a polymerase S propidium iodide replication factor C revolutions per minute ribonucleic acid S imian virus 40 singe-stranded DNA binding protein temperature-sensi tive ~s(hydroxymethyl)aminomethane N,N,N',N' -Te tramethylethylenediarnine volts
INTRODUCTION
1. DNA Replication Initiation and its Regulation
Self-multiplication is the ultimate goal for the existence of a biologicai species;
genorne replication is the center of the matter. Organisrns. cornpeting for existence, have
evolved well diversified replication strategies. However, while remaining unique and
cornpetitive, they do share some basic mechanisms for the genome replication. Below is a
review about aspects of these basic mechanisms, with a focus on the replication of DNA
genomes.
Watson and Crick fxst predicted a geeneeral mechanism for DNA replication based
on the DNA helix s m c m . The duplication of a DNA molecule could simply be a process
of melting apart two DNA strands followed by polymerization of new complementary
strands on the melted DNA templates. But problems such as how to denature double-
stranded DNA at the physiological condition, or where to initiate the first polymenzation
reaction impiied the complexity of this process.
A. Origins of Replication
Jacob and Brenner f i s t proposed a replicon mode1 more than 30 years ago. in
which the proposed major control step of DNA synthesis is at initiation (Jacob et al..
1964). Initiation would depend on the specific interaction of a cis-acting DNA sequence
(replicator) and a cognate tram-ac ting protein (initiator). For simple genomes such as
those of bacteria. plasrnids. many vinises, yeast and rnitochondria of higher eukaryotes.
this prediction proved to be fairly accurate. Replication of these genomes starts from
specific sites caiied origins (Kelly, 1988; Fangman and Brewer, 1991; Marians, 1992). In
general. an origin of replication for simple genomes usudly includes a core component
and one or more auxiliary components. The core consists of a cenual origin recognition
element (ORE), a DNA-unwinding element (DUE). and an A+T-rich element
(DePamphilis, 1993). The ORE is usually the binding site for the origin recognition
protein, which initiates DNA replication by its binding to ORE and exerting double
smnded DNA unwinding activity directly (Borowiec et al., 1990; Gutierrez et al., 1990;
Seki et al.. 1990: Lorimer et al., 1991) or indirectly through recruiting an unwinding
enzyme (helicase) (Middleton and Sugden, 1992; Bell and Scilhan, 1992) ont0 the origin.
The DUE is an easily unwound region and appears to be the site where DNA unwinding
b e m s and the transition from discontinuous to continuous DNA synthesis occurs (Hay
and DePamphilis, 1982; Kowalski and Eddy, 1989; Marahrens and Stillman, 1992).
Ongin auxiliary components consist of transcription factor-binding sites that facilitate
ongin core activity by multiple rnechanisms such as facilitating the binding of ongin
recognition proteins to the core element, or p r e v e n ~ g chromatin structure fiom i n t e r f e ~ g
with the binding of replication factors to origins (Heintz. 1992). The best characterized
simple ongins include those for E. coli (Messer et al.. 1988). SV40 (Kelly. 1988) and
yeast Saccharomyces cerevisiae (Fangman and Brewer, 199 1). As examples. the structure
of the ongins for E. coli and yeast is described below.
Initiation of chromosomal replication in E. coli uses well defmed sequences. the E.
coli onC, which consists of three elements: a cenual sequence of 245 bp flanked on one
side by an A+T-rich region and on the other by three repeats of 13-mers (Komberg and
Baker. 1992; Yasuda and Hirota, 1977: Zyskind and Smith, 1986). The central sequence
is an origin recognition elemenr which contains four 9-mer specific recognition sites for an
initiator protein. DnaA (Fuller et al., 1984), and the 13-mer repeats are easily unwinding
sequences possessing a high propensity for melting. The 13-mer repeats and are also the
sites for loading another replication factor, the DnaB helicase. Binding of DnaA to the core
sequences is the first step in the initiation of DNA replication (Chiang et al., 199 1:
Marszalek and Kaguni. 1994). This binding induces localized unwinding of the 13-mer
repeats which may facilitate the assembly of the DnaB heiicase ont0 the ongin for initiation
of replication (Kubota et al.. 1997; Samin et al., 1989; Gille and Messer. 199 1).
Chromosomal ongins of replication in budding yeast Saccharomyces cerevisiae
coincide with autonomously replicating sequences (ARSs) in plasmids (S tinchcomb et al.,
1979; Campbell, 1993; Rowley et al., 1994). ARSs were identifiai by their ability to
promote the extrachromosomd maintenance of plasmids in S. cerevisiae. It has been
demonstrated using 2D gel electrophoresis that ARS elements function as replication
origins both on plasmids and on chromosomes (Stinchcomb et al.. 1979; Campbell. 1993;
Rowley et al., 1994). Moreover, when chromosome III was systematicall y searched for
origins other than ARS, no additional origins were found (Greenfeder and Newlon, 1992;
Collins and Newlon. 1994), suggesting that ARSs function specificdly as origins for
chromosomal replication. All ARSs contain a 11 bp consensus sequence
(AmmA(T/C)(A/G)TTT(A/T), known as the ARS consensus sequence. Mutational
analyses have revealed that the ARS consensus sequence functions as an origin
recognition element. The six-subunit origin recognition complex (ORC) specifically
recognizes the ARS consensus sequence, both in vivo and in vitro (Bell and Stillman,
1992; Diffley and Cocker, 1992). In addition, three other regions (BI, B2 and B3)
flanking the ARS consensus sequence increase the efficiency of origin function of ARS
(Marahrens and Stillman, 1992; Rao and Stillman, 1995; Rowley et al., 1995). Extensive
analysis of these regions by linker-scan substitutions and point mutations suggested that
the presence of any 2 of these 3 elements was sufficient for ARS activity (Theis and
Newlon, 1994; Rao et al., 1994). The B2 element may function as a DNA-unwinding
element (Marahrens and Stillman. 1992), whereas the B 1 and B3 elements are functionally
involved in binding of proteins. The B 1 element is also a binding site for ORC (Rao and
Stillman, 1995; Rowley et al., 1995). Point mutations within B 1 of ARS 1 caused a
dramatic decrease in the plasmid stability and ORC binding (Diffley et al., 1994),
suggesting the stimulatory effect of B 1 may be related to its interaction with ORC. The B3
element of ARS1 is the binding site of a rnultifunctional transcription and replication
protein, ARS-binding factor 1. Interestingly, the B3 element of ARS 1 can be replaced by
binding sites for other aanscription factors such as Gal4p and Raplp (Marahrens and
Stillman, 1992). suggesting that the B3 element might play a general role in stimulation of
replication initiation. This stimulation may be relared to a general effect of transcription
factors on the origin activity, such as û-anscription factors influencing the local chromatin
srxucture or facilitating the interaction between multiprotein cornplex and the origh.
Although the cis-acting elements required for chromosomal replication in E. coli
and yeast have little sirnilarity in sequence, as demonstrated above. common structures
such as the core elements or the DNA-unwinding elements in these origins are obvious.
The core sequences in both types of origins contain multiple binding sites for replication
initiator proteins. which initiate DNA replication by specific interaction with the core
sequences.
B. Replication Initiators
Replication initiators are proteins that bind to replication ongins in a sequence
specific manner, and function as a landing pad for the assembly of other replication
proteins such as helicases for the initiation of DNA replication. Initiator proteins often
oligomerize upon binding to the origin. The oligomerization probably acts to stabilize the
protein-DNA interaction and allows efficient interaction with other proteins. In some
cases. i t may cause local unwinding of a region at the origin. The E. coli replication
initiator, the DnaA protein, specifically recognizes its four 9-mer recognition sites at the
onC (Fuller et al., 1984). The specific DNA-protein interaction results in the cooperative
binding of about 30 monomers of DnaA protein to its four 9-mer binding sites at the oriC
(Fuller et al.. 1984; Messer et al., 1988). The binding of DnaA to onC promotes localized
melting of the DNA within the 13-mer repeats at the left edge of oriC, and helps the
loading of DnaB helicase to oriC (Kubora et al., 1997; Samitt et al.. 1989; Gille and
Messer, 1991). Once the helicase DnaB protein is associated with onC, the first step in the
assembly of other replication factors for the DNA synthesis begins (Chiang et al.. 1991;
Manzalek and Kaguni, 1994).
Similarly, the SV40 DNA replication initiator. large T antigen, interacts with its
four recognition sites in the SV40 origin, resulting in the binding of two hexamers of T
antigen to the SV40 ongin in an ATP-dependent manner (Goetz et al., 1988; Parsons et
al., 1990; San Martin et al.. 1997). This binding leads to unwinding of 8 bp within the
origin through the helicase activity of T antigen (Borowiec and Hunvitz, 1988; Borowiec
et al., 1990). Thus, the 8 bp DNA-unwinding element appears to be the enuy site for the
assembly of replication machinery (Collins and Kelly. 199 1; Erdile et al., 199 1). The
SV40 large T antigen is a special case since it functions as both the initiator protein and the
helicase for DNA unwinding. However, in most cases. extensive unwinding of DNA at
the ongin requires a separate protein, the helicase. and helicases need to be assembled onto
the origin.
C. Helicases for Unwinding at Origins
Following the binding of initiator proteins to an origin, replication factors are
sequentiaily assembled ont0 the origin. DNA helicases or single-stranded DNA-binding
proteins are usually the fiist factors assembled ont0 DNA. Helicases unwind the DNA
duplex, whereas the single-stranded DNA-binding proteins srabilize the unwound region.
For unwinding double-stranded DNA, DNA helicases utilize the energy of the binding
and/or hydrolyzing NTP to translocate in either the Y+3* or 3'-t5' direction.
Both prokaryotic and eukaryotic helicases have six distinctive conserved protein
motifs (1-VI) (Hodgman, 1988; Gorbalenya and Koonin, 1993; Gorbalenya et al., 1989).
A loosely defined seventh motif. Ia. also exists within a subgroup of the helicase
superfarnily (Gorbalenya and Koonin. 1989). The results of mutation analyses of these
motifs tend to support their cmcial roles for DNA helicase function (Zhu and WeIler,
1992; Martinez et al., 1992). Motifs Ia, I and II are required for recognition and
hydrolysis of nucleotide triphosphates since numerous proteins hydrolyzing purine
nucleotide triphosphates contain these motifs(Saraste et al.. 1990; Koonin, 1993). Motifs
III-VI have less clearly assigned function although they are essential (Zhu and Weller,
1992; Martinez et al.. 1992). Motif V has been implicated in single-srranded DNA binding
(Graves-Woodward and Welier, 1996), whereas motif III may function in coordination of
ATP and single-stranded DNA binding (Brosh and Maüon, 1996). Motif IV has also k e n
implicated in nucleotide binding (Hall and Matson, 1997).
In prokaryotic celts. the E. coli DnaB protein, a hexamer of a 50 k D subunit, is
likely the principal helicase for the chromosomal replication. The protein binds to the
single-stranded region of a partially duplex DNA molecule and translocates along the
single strand with a 5'-3' polarity, requiring energy derhed from the hydrolysis of either
ATP. GTP or CTP (Jezewska er al., 1996; Jezewska and Bujalowski, 1996; LeBowitz
and McMacken, 1986). Eukaryouc cells contain a group of DNA helicases (Borowiec,
1996; Thornmes and Hübscher, 1992; Passarge, 1995). However, the roles of these
identified helicases in the chromosomal replication remain unknown although they likely
function in the process of DNA repair, recornbination or transcription (Matson er al.,
1994; Tuteja and Tuteja, 1996; Prakash et al., 1993).
Helicases usually interact with other replication factors such as primases, single-
sûanded DNA binding proteins (SSB) or DNA polymerases. For example, the E. coli
DnaB and DnaC protein form a 6 : 6 complex which serves a critical role in the assembly
of the prepnming factors (Wahle et al., 1989b; Wahle et al.. 1989a; Allen and Komberg.
1991; Arai et al.. 1981). The 63 kD product of the bactenophage 77 gene 4 Qp4) has both
helicase and primase activities (Bernstein and Richardson, 1989; Matson et al., 1983;
Mendelman et al., 1993; Egelman et al., 1995); it also can interact with the T7 DNA
polymerase and T7 SSB (gp2.5), forming a discrete interactive complex (Notamicola et
al., 1997; Kim and Richardson, 1993). By analogy, some of the isolated helicases from
eukaryotic cells might interact with either DNA polymerase-a (Thornrnes and Hubscher,
1990; 'T'hommes et al., 1992; Biswas et al., 1993), polymerase-6 (Li et ai., l992a),
polymerase-e (Siegal es al., 1992). replication factor C (RF-C) (Li et al., 1992b), or
replication protein A (RP-A) (Georgaki et al., 1994). However, a role of these helicases in
the chromosomal replication remains undefie..
D. Priming DNA Synthesis
Following DNA unwinding by helicases at the origin, the next step requires
assembly of primases on the origin. Initiation of DNA synthesis by DNA polymerases
requues pnmers; in most cases primases function specifically in the synthesis of these
primers. Rimases can be loaded onto ongins by their direct association or interaction with
the assembled helicases or, altemauvely. by recognition of a DNA smicture created by
helicases. For example, the primase assembly involves direct interaction between large T
antigen and pol-a:primase in SV40 origin (Melendy and Stillman, 1993; Collins and
Kelly, 1991; Dormeiter et al., 1993). The E. coli primase DnaG is loaded ont0 the
replication fork by interaction with the helicase DnaB protein (Komberg and Baker,
1992). Once assembled ont0 the origin, primases synthesize short RNA pnmers that are
utilized by DNA polymerases.
In E. coli . the primase DnaG protein, a polypeptide of 60 kD, can synthesize
RNA pnmers on a stem-loop structure of a single-stranded DNA template (Kombeq and
Baker, 1992). This synthesis does not depend on other cellular or viral factors. However,
primases often form a rnultiprotein complex and act in concert with other factors in
prirning most of the templates. For the replication of 0x174 DNA, the DnaG protein
interacts with DnaB, DnaT, M A , W B , and PriC proteins, and forms a multiprotein
complex, the primosome (Arai et al., 1981). The pnmosome tracks along the 0x174
template and synthesizes primers at numerous places. In the replication of bacterial
plasmid DNA. DnaG teams up with DnaB and Pri A proteins to form functional
primosome to synthesize primers (Lu et al., 1996; Steger et al., 1996). In eukaryotic
cells, primase activity is a component of the DNA pol-a:pnmase (Plevani er al.. 1988;
Santocanale et al., 1992). The primase activity of the 48 kD and 58 kD subunits of human
pol-a:pnmase is evident both in the polymerase complex and in the separated forms
(Santocanale et al., 1992; Podust et al.. 1992). However, these two subunits appear to be
a functional unit to maintain the primase activity. Pol-a:pnmase likely synthesizes primers
for both the leading and lagging saands during DNA synthesis (Copeland and Wang.
1993; Foiani et al., 1994).
E. Assembly of DNA Polymerases onto Origins by Accessory Factors
Once the pnmers are synthesized, assembly of the DNA polymerase onto the origin
is the last critical step in initiation of DNA synthesis. DNA polymerases are loaded ont0
the template DNA at the primer sites. This process involves the recognition of the
synthesized primers by a complex of the DNA polymerase ar.d accessory factors,
including single-stranded DNA binding proteins (SSB), polymerase clamp proteins. and
DNA-dependent ATPases that load the polymerase clamps ont0 the DNA. In both
prokaryotic and eukaryotic ceus, the ATP-dependent clamp-Ioading proteins recopize the
primer-template junctions and assemble the polyrnerase clamps ont0 the junction sites
(Tsurimoto and Stillman, 1990; Tsurimoto et al., 1990). DNA polyrnerases are then
assembled onto the primers ready for DNA synthesis (Nethanel and Kaufmann. 1990).
For example, in the SV40 ongin, the clamp loading protein RF-C binds to the 3' terminus
of the synthesized RNA primes in the presence of ATP. then loads the polymerase clamp
protein PCNA (proliferating ce11 nuclear antigen) onto the DNA. This complex is
recognized by DNA polymerase-8 or E, which initiates DNA synthesis from the primers
(Tsunmoto et al., 1989; Tsurhoto and Stillman, 199 1 b; Tsurimoto and StilIrnan, 199 1 a;
Fien and Stillman, 1992).
Replication accessory factors such as RF-C and PCNA play a variety of roles such
as recruiting of DNA polymerases, facilitating the binding of DNA polymerases to the
pnmer temiinus, increasing processivity of DNA polyrnerases as well as preventing non-
productive binding of DNA polymerases to single-strandcd DNA. The E. coli SSB is an
exnemely stable tetramer of 18.9 kD, which binds to DNA single strands cooperatively
(Mitas et al.. 1997). Its function in DNA replication is to stabilize DNA single strands and
to protect unwinding regions from being used as the nonspecific sites for priming (Chase
and Williams, 1986). The SSB (RP-A) in eukaryotic cells is a heteroaimer with subunits
of 70 kD, 32-34 kD and 11-14 kD (Gomes et al., 1996; Bochkarev et ai., 1997; Wold,
1997; Ozawa et al., 1993; Wold and Kelly, 1988). RP-A aIso assists the SV40 large T
antigen in unwinding the viral replication origin, interacts with pol-a:prirnase and
suppresses nonspecific priming events (Kenny et al., 1989).
The polymerase clamp protein or the polymerase processivity factor in E. coli is
the 40.6 kD dimenc P subunit of pol III holoenzyme (Kuriyan and OIDonnell, 1993;
Komberg and Baker, 1992). The B subunit does not directly bind to DNA. but it c m
become tightly attached to the region of the template-primer duplex. The assembly of P subunit ont0 DNA depends on the ATP-driven action of the y complex of pol III
holoenzyme. The ycomplex is a functional homology of RF-C in eukaryotic cells.
The eukaryotic polymerase clamp protein, PCNA, is a 29-40 kD ring-shaped
homotrimer (Kelman, 1997; Krishna et al., 1994; Kelman and OIDonnell, 1995), which
interacn with pol-6, p o k and RF-C (Tsurimoto and Stillman, 1990; Mossi er al.. 1997;
Lee and Hurwitz, 1990; Burgers, 1991). PCNA functions as a sliding clamp to increase
the pnmer binding and processivity of pol-6 and pol-e (Bauer and Burgers, 1988b; Bauer
and Burgers, 1988a: Prelich and Stillman. 1988). PCNA does not bind to DNA but can
forrn a primer recognition complex with ATP and RF-C (Podust et al., 1995; Lee and
Hurwitz. 1990; Podust et ai.. 1992).
RF-C is a multiprotein complex composed of one large subunit and four small
subunits (Tsurimoto and Stillman. 1989; Uhlmann er al., 1996). The large subunit,
hRFC140 can bind to DNA (Pan et al., 1993), whereas one of the small subunits,
hRFC40, interacts with PCNA (Mossi et al.. 1997; Pan et al.. 1993). hRFC40 and
another subunit, hRFC37, interact respectively with pol-6 and pol-E, and with each other
(Chen et al.. 1992). RF-C enzymatically loads PCNA ont0 DNA in the presence of ATP
(Podust et al., 1995; Lee and Hunvitz, 1990; Podust et al.. 1992; Burgen. 199 1).
F. DNA Polymerases
At the replication origin, the assembled DNA polymerases use one strand of a
DNA duplex as the template and elongate the prirners by catalyzing the polymenzation of
dNTPs into the complementary DNA strand. Some DNA polyrnerases also carry a 3 ' 4 5 '
exonuclease activity to proof-read the process of DNA synthesis. DNA polymerases often
form multisubunit complexes. For example. the holoenzyme of E. coli D N A polymerase
I I I (pol III) is a complex of about 20 subunits (Kornberg and Baker, 1992): a, the
polymerase; E , the 3'45' exonuclease; r, the ssDNA-dependent ATPase; P. the
processivity factor, the ycomplex and the 0 subunit The pol III holoenzyme reconstituted
in vitro is an asyrnrnetric dimer of multiple subunits, which possesses a high processivity
and polymenzation rate close to the iti iiivo rate of fork movernent (Kornberg and Baker,
1992). Pol III is the principal polymerase in the E. coli chromosomal replication (Funnell
et al., 1986).
Eukaryotic cells have at least five DNA polymerases: a, P, y, 6 and e (Wang.
1991; Wang 1996). Four of these are nuclear polymerases, whereas polymerase y is
likely associated with mitochondna DNA replication. Polymerase a (or pol-a:primase) in
human cells is a heterotetrarner which contains four subunits (Plevani et al., 1988;
Copeland and Wang, 1993; Murakami et al., 1986). The largest subunit is the catalytic
180 kD polypeptide. It forms a tight complex with the 48 k D and 58 kD subunits which
carry the pnmase activity (Copeland and Wang, 1991; Melov et al., 1992; Stadlbauer et
al., 1994; Podust et al., 1992). The remaining 70 kD subunit has no identified function.
but it may be necessary for recniiting subunits of pol-a:primase to the replication fork
(Collins et al., 1993; Foiani et al., 1994). Pol-a:pnmase lacks a 3'+5' exonuclease
activity and high processivity. Thus. this enzyme is unlikely the major polymerase during
elongation. Rather. it appears to play a role in initiation, possibly serving as a pnming
enzyme at the replication fork (Waga et al., 1994; Waga and Stillman, 1994).
In contrast, polymerase 6 @oI-6) contains two subunits and a processivity factor,
PCNA, which enhances the processivity of pol-6 (Zhang et al., 1995; Wang. 1996;
Prelich and Stillman. 1988). The larger 124 kD catalytic subunit of pol-6 has an intrinsic
3'+5' exonuclease activity (Simon et al., 199 1; Monison and Sugino, 1994; Zhou et al.,
1996), whereas the srnall 48 kD subunit appears to be necessary for the stimulation by
PCNA (Lee and Hunvitz. 1990; Bravo et al., 1987). POI-6 may function as one of the
major enzymes to elongate both the leading and lagéng strands pnmed by pol-a:pnmase
('surimoto et al., 1990).
Similarly, polymerase E (pol-E) is a heterodimer. which has an intrinsic 3*+5'
exonuclease activity associated with its 225 kD catalytic subunit (Syvaoja, 1990; Kesti et
al., 1993). Pol-& can form a stable complex with replication factor C (RF-C), ATP and
PCNA at the primer terminus (Chen et al., 1992). However, compared with pol-6, pol-E
is insensitive to PCNA stimulation (Syvaoja and Linn, 1989; Lee er al., 199 1). The
function of pol-E dunng replication is not clear; it may play a role in elongation. In
budding yeast, the gene (POL?) coding for the catalytic subunit of pol-E is essential.
Mutations in POL2 caused deficiency in the S-phase checkpoint (Navas et al., 1995),
suggesting that pol-e rnay play a role in monitoring the status of DNA replication (Lee et
al., 199 1 ; Navas et of., 1995).
Polymerase P is a single polypeptide of 40 kD and has no 3'+5' exonuclease
activity (Prasad et al., 1993). Genetic analysis of polymerase gene suggests it does not
play a significant role in chromosomal replication (Zmudzka et al., 1988). but may be
involved in DNA repair ( L e m et al., 1994).
G . Other Factors Involved in DNA Replication
As the DNA polymerase synthesizes new complementary DNA and the replication
fork moves, the RNA primers at the 5' end of DNA fragments (Okazaki fragments) on the
lagging strand need to be removed, and the resulting gaps must be filled and ligated. As
weli, the tonional strain accumulated ahead of the replication fork requires relaxation. The
E. coli DNA polymerase 1 with an intrinsic 5 ' 4 ' exonuclease activity can fulfill the
requirement of Okazaki fragment processing. However, none of the eukaryotic
polymerases has the 5*+3' exonuclease activity (Kunkel and Bebenek 1988; Komberg
and Baker, 1992); instead. a 44 kD exonuclease, FE3Ll. may functionally substitute for
the S+3* exonuclease activity of the E. d i DNA polyrnerase 1 enzyme (Li et al., 1995;
Parks and Graham, 1997). FEN- 1 and RNaseHl rnay act together to process Okazaki
fragments (Turchi et al., 1994; Waga et ai., 1994; Waga and S tillman, 1994). In addition.
DNA ligase 1 is most likely the enzyme used to join Okazaki fragments after processing
(Waga et al., 1994; Waga and Stillman, 1994). Two of the eukaryotic toposornerases,
type 1 and type II, may functionally be involved in the resolution of topological problems
dunng DNA replication (Anderson et ai., 1996; Wang, 1996).
H. DNA Replication Initiation in Cells of Multicellular Eukaryotes
While Jacob and Brenner's replicon model fils nicely to most simple genomes with
bi-directional ongins, mechanistic variations exist. Not surprisingly, when this mode1 was
further applied to complex genomes, especially mammalian chromosomes. results were
controversial at the beginning (Hamlin et al., 1994).
The first problem facing higher eukaryotes is whether they use defined discrete
nucleotide sequences as origins. Evidence in favor of specific initiation came directly from
the identification of a few chromosomal replication origins. For example, a replication
origin was located in a 135 kb region between the 6-globin and P-globin genes of the P- globin gene cluster on human genome (Kitsberg et al., 1993a; Kitsberg et al., 1993b).
Under normal conditions. DNA replication within the 135 kb region was initiated only
from this origin of bidirectional replication (OBR). However, cells from patients with
haemoglobin Lepore syndrome had an 8 kb deletion within this 135 kb region that
includes the OBR. This deletion elirrünated bidirectional replication from this site,
rendering the 135 kb region to be passively replicated from an unidentified distant ongin
(Kitsberg et al., 1993b). This demonstrated directly that there may be cis-regulatory
elements in higher eukaryotic genomes that are responsible for controlling initiation. In
another example, the dihydrofolate reductase (DHFR) locus in Chinese hamster ovary
cells was by far the most intensively studied ongin (Harnlin et al., 1994). The DHFR
domain has been scrutinized by a variety of techniques to define the origin function.
Although the identified initiation zones varied from severai thousand to a few hundred
base pairs depending on individual approaches. results frorn techniques such as in vivo
labelling, leading strand template bias assay, lagging strand assay and a PCR-based assay
indicated the preferential use of two specific sites to initiate DNA replication (He and
Huang, 1997). These two origins were located precisely within the intergenic spacer
region of the DHFR and ZBEZ121 genes (Harnlin et al.. 1994).
However, evidence from two dimensional gel electrophoretic studies did not
always indicate specific initiations (Hamlin er al., 1994). This technique consistently
revealed the existence of multiple sites within a broad range of initiation zones for higher
eukaryotic genomes (Shinomiya and Ina. 1993). For example, the DHFR dornain was
found to contain multiple initiation sites throughout the approximate 55 kb intergenic
region (Hamlin et al., 1994). In addition, when the standard experimental approach that
identified ARS in yeast was used to identify ARS activity in marnmalian cells, it failed to
identify any consensus sequences (Coverley and Laskey, 1994). The problem was not that
too few sequences could replicate; rather, too many replicated. Most DNA fragments
larger than 10 kb from marnmalian chromosomes can provide some ARS activity in
mammalian cells (Coverley and Laskey, 1994), suggesting that D N A length is more
cxitical than specific sequences. The picture became further complicated by an o n f i assay
using a vector with a crippled latent origin of replication (O*) from Epstein-Barr v h s .
Although this cnppled orif c m not replicate autornaticaiiy, it still can be retained within
cells for a period of time. A number of regions from the human genome have been cloned
into this vector to isolate regions that can functionally compensate the cnppled oriP .
However, virtually every fragment tested restored the replication of the crippled oriP to
some extent (Yates et al.. 1985; Heinzel er of., 1991). Subcloning did not identify shorter
specific. functional origins (Heinzel et ai.. 1991). In agreement with these observations. it
has been demonstrateci that when DNA was injected into eggs of Xenopus or added to
exmcts of Xetiop~cs eggs, DNA replication was initiated at a single randornly selected site
within virtually any DNA molecule (Gilbert et al., 1995b; Lee and Leone. 1994),
suggesting that specific sequences may not be necessary for initiation of DNA replication.
Many models have been proposed to resolve the contradictory conclusions in
defining eukaryotic replicons (DeParnphilis, 1993). One commonly accepted explanation
is that DNA replication in eukaryotic cells is initiated at specific sites but, while rnany
sequences can potentially function as origins, selection of an actual initiation site appean
to depend on the chromosome context rather than on specific sequences (Coverley and
Laskey, 1994). For example, a recent experiment demonstrateci that in the nbosomal RNA
gene locus of early Xewpru embryos replication initiated at regular 9 -12 kb interval with
no apparent dependence on specific sequences. However, later in development, when
these rRNA genes were k ing transcribed, initiation sites were restricted to the intergenic
regions. In other words. the specificity in initiation may be imposed by the chromatin
structure (Hyrien et of., 1995). Chromosomal loops may correspond to one replication
unit (replicon) in eukaryotic cells because of their similar sizes (30-100 kb) (Marx, 1995).
Accumulated evidence indicates that attachment to the nuclear scaffold rnay be functionally
essential during replication (Brun et al., 1993). A number of isolated matrix-attachment
sequences are early replicating, and containing A+T-rich sequences, direct repeats and
topoisornerase II consensus elements (Maruniak et al., 1984; Razin et al., 1991)
suggesting that these sites may be easily unwound elements and could be used as sites of
replication initiation.
Another major characteristic of DNA replication in eukaryotes is that initiation of
DNA replication is tightly regulated and coupled with the ceU cycle and ceil differentiation
(Muzi-Falconi et al.. 1996). The replication is time restricted within a window of the S
phase, and regulated to prevent re-initiation within a single ceil cycle (Baker, 1995).
Although the control mechanism is still not clear, it has been hypothesized that initiation of
DNA replication could be replated by a licensing mechanism in which a licensing factor
plays a cenaal role (Blow and Laskey, 1988). This putative licensing factor was proposed
to bind replication origins, serving as a prerequisite for initiation of DNA replication. To
prevent re-initiation, licensing factor must be resuicted from entering the nucleus. Only in
the M phase of a ce11 cycle. when the nuclear envelopes are disassembled, can the
licensing factor enter the nuclei and bind to DNA. DNA replication is initiated from ongins
in the following S phase in the presence of the licensing factor as well as a pre-replicative
complex. On the other hand, the process of DNA replication inactivates al1 Iicensing
factors, preventing it from reinitiating replication within the sarne ceII cycle. Certain factors
such as the products of the minichromosome maintenance (MCM) genes in yeast and the
homologous genes in a wide range of eukaryotes (MCM/Pl gene family) have some
similarity with the putative licensing factor (Chong et al., 1996). They are necessary for
the initiation of DNA replication, and only enter nuclei as cells undego anaphase,
s u g g e s ~ g that these factors rnay play some role in licensing initiation.
Analyses of factors interacting with the chromosomal ongins in S. cerevisiae
identified an origin recognition complex (initiator). This 250 k D complex bound to
sequence A and B1 of ARSs (Bell and Stillman, 1992; Diffley and Cocker, 1992) and
interacted with a cell-cycle-regulated factor. Cdc6 protein in vitro (Liang et al., 1995).
The Cdc6 protein is required for the initiation of DNA replication and is necessary for the
formation and maintenance of a chromatin configuration at origins (Bueno and Russell,
1992). sugesting that Cdc6p may play some role in replating origin function. The mini-
chromosome maintenance proteins. Cdc6p and the ongin recognition complex may f o m a
yeasr pre-replicative complex, which is directly associated with the chromatin and plays a
crucial role in licensing the replication initiation and re-initiation events (Botchan. 1996;
Blow and Laskey. 1988; Yan er al.. 1993; Madine er al.. 1995; Chong et al.. 1995;
Kubota et al.. 1995). The function of the pre-replicative complex rnay be regulated by
cyclin-dependent kinases (CDKs) to couple the initiation of DNA replication wirh the cell
cycle (Su ef al.. 1995; Dahrnann et ai., 1995).
II. DNA Replication Initiation in DNA Viruses
In general. genomic replication of DNA vimses is initiated from well defined cis-
acting elements by specific interaction with viral encoded initiator pro teins. The simpiicity
of this process in terms of Limited factors involved has k e n very helpful in understanding
rnechanisms of DNA replication in both the virai and the host cellular systems; vimses
such as SV40 have been subjects of extensive studies in the past and present. However, as
a group. DNA viruses Vary greatly in the way their genomes are replicated. Some viruses
such as SV40 depend heavily on the host replication system, and have only one or a few
replication factors encoded by the vimses. Other viruses such as herpes simplex viruses
have an almost complete set of v i n l replication factors. and use suategies totally diffcrenr
from the chromosomal replication of their host cells. The genomic replication of some
DNA viruses such as baculoviruses appears to be relatively independent of phases of the
host ce11 cycle, while that of others such as Epstein-Bar virus during latency is very well
coordinated with the proliferation of host cells. Different sirategies in genome replication
may require discrete regulatory rnechanisms for replication initiation. Below are a few
exarnples of different initiation mechanisms used by different DNA vimses.
SV40 The replication of the circular, double-stranded DNA genome of SV40 relies
largely on the host cellular replication system. and requires only one single viral protein,
large T antigen, which interacts with the SV40 ongin to initiate the DNA replication. The
64 bp SV40 ongin core consists of three domains: a 27 bp palindrome that contains
binding sites for viral large T antigen, a 8 bp DNA-unwinding element, and a 17 bp A+T-
rich region with one T-rich and one A-nch srrand (DePamphilis, 1993). Two auxiliary
elements, A u x 4 and Aux-2, contain binding sites for both T antigen and another
nanscription factor. Spl (Kelly. 1988). The auxiliary sequences stimulate the T antigen-
dependent DNA unwinding possibly by the interaction between proteins bound to these
sequences and T antigen (Guo et al.. 1989; Guo et al., 1991; Guo and DePamphiIis.
19%).
Large T antigen is a multiple function protein with DNA helicase and ATPase
activities. Large T antigen cm fonn a cornplex with multiple cellular factors, including pol-
a:primase, PR-A. transcription regulator protein Rb and p53 (Thukral et al.. 1994; Ray et
al.. 1996; Collins and Kelly. 1991). Two hexamers of T antigen specifically interacted
with and bind to the SV40 origin in an ATP-dependent manner (Goetz et ul.. 1988:
Parsons et al.. 1990; San Manin et al.. 1997). This binding leads to DNA unwindins
through T antigen helicase activity (Borowiec et al.. 1990). T antigen hexamers cover the
8 bp DNA-unwinding elernent i n i t i a ~ g DNA melting at nucleotides 5210-5217 (Borowiec
and Hunvitz. 1988). where the transition from discontinuous to continuous synthesis is
located (nucleotide 52 10-52 1 1) (Hay and DePamphilis. 1982). Specific interaction
between T antigen and PR-A recmits RP-A to stabilize the unwound region, whereas the
interaction between T antigen and pol-a:prirnase assembles pol-a:primase onto the
unwound region for the primer synthesis. Once the primers are available. RF-C recognizes
the primer and loads PCNA ont0 the site. Subsequentiy pol-6 was assembled ont0 the
primer site for DNA synthesis (Collins and Kelly, 199 1: Erdile et al.. 199 1 ) .
ADENOVIRUS Adenovirus has a double-stranded, linear genome that is covalently
associated with a terminal protein (TP) at the 5' end of each DNA saand (Stillman, 198 1;
Tamanoi and Stillman, 1982). The replication of the genome starts from its two ends.
Each origin of replication consists of four regions that are located within the inverted
terminal repeat (ITR) of the DNA ends (Challberg and Kelly, 1979). The origin core
sequence contains 18 bp binding sites for two viral proteins. the preterminal protein @TP)
and adenovims DNA polymerase (Ad pol). The core sequence is responsible for the
minimal level of initiation of DNA replication but higher levels of initiation require the
presence of auxiliary sequences. The auxiliary region flanking the core sequence contains
the binding sites for two cellular proteins, nuclear factor I (NFI) and octamer-binding
protein (Oct- 1) or nuclear factor III (NFIII) (Armentero et al., 1994; Coenjaerts et al.,
1994). The binding of the pTP/Ad pol to the origin core sequence and its interaction with
these cellular factors play an important role in the assembly of the adenovhs replication
complex (Challberg and Kelly. 1979).
Catalyzed by adenovirus polymerase, the pTP and the terminal residue form a
covalent linkage, the 3'-OH group of which is used as a primer for the synthesis of the
nascent saand (King and Van der Vliet, 1994). Two cellular transcription factors can
stimulate replication initiation (Hatfield and Hearing. 1993). NFI appears to interact with
Ad pol to stabilize the binding of the pTP/Ad pol heterodirner to the replication ongins
(Amentero et ai., 1994; Coenjaerts and Van der Vliet. 1994). NFIIVOct-1 may stimulate
replication initiation by inducing bending of the DNA at the ongin of DNA replication.
promoring interactions between the various components in the preinitiation complex
(Hagmeyer et al., 1993; Coenjaens et al., 1994). Altematively, direct interaction with the
pTP/Ad pol heterodimer may be responsible for the stimulation.
HERPES VIRUSES During the viral lytic infection, herpes viruses rely largely on their
own replication enzymes. The lytic ongins of herpes simplex virus type 1 (HSV-1) are a
combination of three different origins located within the L (o r i~ ) and the S components
(orisl. oris2) of the genome (Stow, 1982; Kung and Medveczky. 1996; Graham et al.,
1978; Challberg, 1996). The linear double-stranded DNA genome of HSV-1 circularized
upon entry into the host cells, and has been proposed to replicate by a rolling-circle
mechanism (Garber et al., 1993; Skaliter et al., 1996). Interestingly. none of the identifie-
origins seems to be uniquely required for viral DNA replication. Deletion of o r i ~ or both
oris from the viral genorne has little effect on either the viral yield or viral DNA
accumulation in infected cells (Igarashi et al., 1993: Polvino-Bodnar et al., 1987).
suggesting that these origins are functionally redundant.
The sequences of o r i ~ and ons are closely related. Both contain binding sites for a
viral initiator protein, UL9, and an extensive inverted repeat sequence. o r i ~ consists of
two high- and two low-affinity UL9 binding sites adjacent to an A+T-rich sequence of
144 bp that can f o m a perfect palindrome (Lockshon and Galloway, 1988). whereas ons
is a 67-90 bp sequence containing three binding sites for UL9 and a central 18 bp A+T-
rich region. This A+T-nch region may function as a DNA-unwinding element (Challbeg
and Kelly, 1989; Wong and Schaffer. 1991; Harnmarsten et al., 1996; Elias and Lehman,
1988). The core sequence of onS also contains a binding site for a cellular factor, OF-1.
Binding of OF-1 to the origin appears to be -1portant for ongin function in a transient
replication assay (Dabrowski et al., 1994). Mutations that elirninate OF- l binding also
diminish the replication efficiency of origin-containhg plasmids (Dabrowski et al., 1994).
Auxiliary sequences flanking the core sequence contain a number of binding sites for the
cellular transcription factors such as SPI or NF1 (Lockshon and Galloway. 1988;
Dabrowski et al., 1994) and can stimulate the replication eficiency up to at least 50 folds
(Wong and Schaffer. 199 1 ; Dabrowski and Schaffer, 199 1).
Another member of the herpes virus family, human cytomegalovinis (HCMV), has
a more cornplex origin consisting of multiple elements. A 2 kb viral origin was identified
by Li vivo labelling of newly synthesized DNA in the presence of an elongation inhibitor,
gancyclovir (Hamzeh et al., 1990; Anders et al., 1992). The identified origin, which bevs
no homology to any previously identified herpes virus origin contains a core element
consisting of a number of repeats, regions of dyad symmeay and cellular manscription
factor binding motifs (Anders and Punturieri, 1991; Masse et al., 1992). The most
distinguishing feature of the HCMV origin core is the existence of an oligopyrirnidine
stretch (Y block) that is essential for the origin function (Chaltberg, 1996). No HCMV
encoded protein has yet been shown to bind specificaily to this origin sequence.
Herpes simplex virus c m establish a latent infection in postmitotic neurons during
which no viral DNA replication can be detected (Challberg, 1996). However, Epstein-Bm
virus (EBV) replicates during latency in dividing B cells. During latency, EBV replication
relies alrnost entûeiy on the host replication system. Only a single EBV encoded protein.
EBNA 1. functions during replication initiation by its interaction with the latency-specific
replication origin. oriP (Hsieh et al., 1993; Yates er ai.. 1985; Yates and Guan. 199 1;
Yates et al., 1984). oriP consists of two groups of multiple EBNA1 binding sites (Gahn
and Schildkraut, 1989; Harrison et al., 1994). One goup contains four EBNA 1 binding
sites. arranged in a dyad symmehy (DS), while the other goup has an array of twenty 30
bp repeats which are sites for the high-affinity EBNA 1 binding. The 30 bp repeats may be
responsible for the maintenance of the EBV genome in mammalian cells dunng latency
(Krysan et of.. 1989). DNA replication usually stans from the DS region and moves
bidirectionally (Gahn and Schildkraut, 1989; Wysokenski and Yates, 1989; Harrison et
al., 1994). However. replication can aiso initiate from other locations on the viral genome
(Little and Schildkraut, 1995). In Raji cells, an irregular initiation zone covers an expansr
of at least 50 kb (Little and Schildkraut, 1995; Gussander and Adams, l984), suggesting
that EBV might have a sirnilar initiation mechanism as mammalian chromosomes.
III. DN A Replication Initiation in Baculovirus
A. AcMNPV and its Genome
Autographa caiifornicn rnulticapsid nucleopolyhedrovirus (AcMNPV), the most
well-characterized baculovims, belongs to the DNA virus family Boculoviridae, which
consist of a diverse group of viruses pathogenic for anhropods, particularly insects of the
orders Lepidoptera, Hymenoptera. Diptera. Coleoptera, Thysanura and Trichoptera.
(Blissard and Rohrmann, 1990). By far the majonty of baculovims isolates are from the
Lepidoptera. Baculoviruses usually have very resaicted host ranges; each virus member
infects one or few numbers of host species. Productive viral infections occur only in
invertebrates; no member of this family is known to infect vertebrates or plants although
occasionaily virus particles do penetrate cells of these organisms (Ignoffo, 1975; Groner,
1986). However, viral DNA replication or gene aanscnption does not appear to take place
in a non-host ce11 (Ignoffo and Rafajko. 1973; Heimpel. 1966; Bmsca et al.. 1986).
Unlike most baculovinises, AcMNPV has a very unusual host range that includes
at least 32 species in 12 families of insects (Granados and Williams. 1986). Some species,
e.g., Spodoptera jhcgiperda. are highly susceptible to AcMNPV infection. The infected
insect larvae usually die with typical symptorns of the nuclear polyhedrosis disease (Vail
and Jay. 1973). AcMNPV replicates in the infected ce11 nuclei. The viral early gene
expression occurs immediately after entry of the virus into the cells, and is followed by
initiation of viral DNA replication at approximately 6 h post infection u j i a et al., 1979).
The late and very late gene expression follows DNA replication and involves the
production of two phenotypes of progeny vhses . One, responsible for the secondary
infection of the host cells. is the budded virus (BV), which is also the infectious form for
cultured insect cells. The second is the occluded virus (OV) that is occluded in large
crystals of viral polyhedrin protein and is the infectious f o m for host insects (Blissard and
Rohrmann. 1990). The budding of progeny viruses from the nuclear envelope begins at
12 hours post infection. Mature progeny virions appear as early as 12- 18 hours post
infection (Granados and Lawler, 198 1 ; Granados and Williams, 1986).
Mature BVs contain individudy enveloped r d shaped nucleocapsids, within each
of which is packaged the viral genome. Packaged viral DNA is associated with a highly
basic protein, p6.9. The DNA and p6.9 appear to exist in the form of a ughtly wound
helicoid smicture (Revet and Guelpa, 1979; Wilson and Miller. 1986; Wilson er al., 1987:
Wilson, 1988; Wilson and Pnce, 1988), enabling the large supercoiled DNA genome to be
condensed and packaged. The p6.9 protein. however, appears to be not essential for
infectivity since the purified viral DNA is infectious when transfected into insect cells
(Carstens et al., 1980).
The purified viral DNA is a closed circular, double-stranded DNA of 134 kb
(Sumrners and Anderson, 1973; Tjia et al., 1979; Ayres et al., 1994). The complete
nucleotide sequence analysis of AcMNPV DNA reveals an overall A+T content of 59%
and potential capacity for encoding over 150 polypeptides (Ayres et al., 1994). A
distinctive structure of AcMNPV genome is the presence of eight A+T-rich homologous
repeats ( h m ) (hrl, hrla. hr2. hr3. hr4a, hr4b, hr4c and hr5) interspersed around the
genome (Fig. la) (Cochnn and Faulkner. 1983: Guarino and Sumrners. 1986a: Guarino
et al., 1986; Ayres er al., 1994). Each hr contains two to eight highly conserved repeated
sequences of about 72 bp with a 30 bp imperfect palindromes situated at its center. The 30
bp imperfect palindrome has an E c o N site (except h r l c ) ar the rniddle (Guarino et al.,
1986). Because of the syrnrnetric location. the high A+T content and the palindromic
structure. hrs were originally suggested to be viral DNA replication origins (Cochran and
Faulkner. 1983).
B. Baculovirus Putative Replication Origins
Evidence to support the speculation about the ongin function of hrs has corne frorn
studying the replication of bacterial plasmids carrying hrs in baculovirus infected cells
(Pearson et al.. 1992; Kool et al., 1993a; Kool et al., 1993b; Leisy and Rohmann. 1993).
A single palindrome with an essential EcoRI-core site (except hr4c) is sufficient for
supporting plasrnid replication although the number of palindromes seems to affect the
relative replication efficiency (Pearson et al., 1992; Leisy et al .. 1995). In addition, after
40 undiluted serial passages of AcMNPV, sequences flanking hrl , hr3 and hrS were
retained as supennolar fragments in EcoRI digests of defective viral DNA genomes,
suggesting the retention of hrs and flanking sequences in defective viral genomes (Kool et
al., 1993a; Kool et al., 199 1).
In contrast to this observation, after 81 passages of AcMNPV, short non-hr
sequences were retained as multiple repeats in defective genomes. These sequences are
derived mostly from the HiiidIII-K regions of the AcMNPV genome (Lee and Krell.
1992). As well. plasrnids carrying the HindIII-K fragment or regions of the HindIII-K
fragment replicated in the virus infected cells (Kool et al.. 1994b). suggesting that regions
within the HindIII-K fragment rnight also function as the putative orighs. Although there
is no sequence homology with hrs, the HitidIII-K fragment does contain two imperfect
palindromes. an A+T-rich region and several repeated motifs. However. unlike the
palindromes and repeats in hrs, these essential elements in the HindIII-K region do not
initiate DNA replication without auxiliary sequences (Lee and Krell. 1992; Kool et al..
1993b; Kool et al.. 1994b). The identification of the putative origins, both hies and the
HiridIII-K region, suggests that baculovirus may use multiple sites for replication ongins.
In this way. the vins may increase the opponunity for the formation of a preinitiation
cornplex.
In addition to the specific replication of plasrnid DNA containing hrs or the
HiridIII-K fragment in the infected cells, it has also been demonstrated that plasmids
without baculovhs inserts replicated when they were cotransfec ted with viral DNA into
insect cells (Guarino and Sumrners, 1988; Yu, 2990; Kool et al., 1994a; Lu and Miller,
1995). The mechanism of this replication has not k e n investigated and the basis for this
plasmid DNA replication is unknown although it was speculated that this replication rnight
result from the acquisition of hrs by recombination dunng the co~ansfection process
(Kool et al., 1995).
C . Genes Involved in DNA Replication
Genetic studies of temperature sensitive mutants have identified two genes (ie-I
and p143) which are essential or important for the viral DNA replication. A point mutation
within pl43 abolished viral DNA replication at the non-permissive temperature (Gordon
and Carstens, 1984), while a point mutation within ie-I delayed the initiation of viral
DNA replication (Miller et al., 1983). Using a transient replication assay, several other
viral genes that are essential for minimal levels of replication of a hr2-containing plasrnid
have also been identified (Kool et al.. 1995; Kool et al., 1994a). These genes include
dmpol, lef-1. lef--2 , 16-3 and p35. Two genes, i e - and pe38, dthough not essential, are
stimulatory for this replication process (Kool et al.. 1994). The vims also encodes apcna
(proliferating cell nuclear antigen) p n e (O'Reilly et al., 1989; Crawford and Miller,
1988). homoIogous to the rat pcna gene, and a putative alkaline exonuclease gene whose
putative product contains four short conserved domains present in the alkaline exonuclease
of herpes sirnplex vinise-1 (Ayres et al., 1994). However, these genes do not appear to be
necessary or even stimulatory for the replication of hr-containing plasmid in the
cotransfected cells (Kool et al., 1994a).
1. ie- 1 gene
The product IE- 1, of the immediate early ie-l gene. is a multi-functional protein. It
both transactivates the expression of most viral early genes (Guarino and Summers,
1986b), and suppresses the expression of ie-0 and ie-2 (Carson et al., 1991; Kovacs et
al., 1991). When cotransfected with plasmids containing a variety of baculovinis early
gene promoters. ie-l gene activates transcription from these promoters, and this activation
is greatly enhanced in the presence of hrs. IE-1 binds to hrs and it appears that the
dimeriration of IE-1 occurs before its binding to hr palindromes (Rodems and Friesen,
1995). E- 1 is essential for virai DNA replication (Miller et al., 1983; Ribeiro et al., 1994)
and late gene expression (Passarelli and Miller, 1993b). However. it is not clear whether
IE-1 is direcrly involved in the replication initiation process, or simply is required for the
expression of other viral early genes. IE-1 may function as a replication initiator by its
interaction with hrs. Functional dissection of E l identified a transactivation domain in the
N-terminal portion (Guarino and Sumrners, 1986b; Kovacs et al., 1992; Lu and Carstens,
1993) and a DNA binding domain in the C-terminal portion of IE-1 (Guarino and Dong.
199 1; Leisy et al., 1995; Choi and Guarino, 1995a; Choi and Guarino, 1995b).
2. dnopol gene
The product of the baculovinis DNA polymerase gene contains motifs that are
conserved arnong a number of DNA polymerases (Wang. 199 1). This gene is essential for
the replication of the hr-containing plasmid in plasmid cotransfected cells (Kool et al.,
1994a). However, in another slightly different condition, dnupol appears to be
dispensable. This may suggest that under certain conditions host DNA polyrnerases can
functionally complement the viral DNA polymerase (Lu and Miller, 1995). AcMNPV
DNA polymerase could be a glike polymerase since a 3'+ 5' exonuclease activity of
DNA polymerase 6 is tightly associated with the DNA polymerase of B. mori NPV, a
close relative of AcMNPV (Kelly. 198 1; Wang and Kelly, 1983; Mikhailov et al., 1986).
This concept seems to be supponed by the identification of a viral pcna g n e (Crawford
and Miller, 1988; O'Reilly et al.. 1989). whose product may be a processivity factor
associating with viral DNA polymerase.
3. pl43 gene
The viral pl43 gene is the only gene in addition to ie-I demonstrated to be
essential for viral DNA replication both in vivo and in the transient replication assay (Lu
and Carstens, 1991; Kool et ai., 1994). A point mutation within the open reading frarne of
Pl43 (Methionine to Valine 934) in a temperature sensitive mutant eliminates viral DNA
replication and late gene expression at the non-permissive temperature (Lu and Carstens.
1991). Like IE- 1, Pl43 is a multi-functional protein which also plays a role in the
determination of baculovirus host range (Maeda et al., 1993; Croizier et al., 1994). Pl43
was speculated to be a DNA helicase. The C-terminal region of Pl43 consists of seven
motifs which are conserved among proteins with nucleic acid unwinding activity. while its
amino teminus includes a modifieci leucine zipper motif. P143 also contains a consensus
purine hphosphate binding sequence, a helix-tm-helix structure and a putative nuclear
localization signal. Consistent with its putative role during replication. Pl43 is localized to
the nucleus of infected cells, binds to double-saanded DNA in a sequence non-specific
fashion and is detected in infected cells by 3 hours post infection. well before the time of
initiation of viral DNA replication (Laufs et al., 1997).
4. lef- 1 . 2 . 3 genes
The lef-1, Iej2 and le-3 genes. originally identified as essential for the expression
of viral late genes, are also required for DNA replication in transient replication assays
(Passarelli and Miller, 1993a; Passarelli and Miller, 1993b; Li et al., 1993; Kool et al.,
1994a). The specific functions of lef-I and ief-2 genes in the process of DNA replication
are unknown but LEF-1 interacts with LEF-2 in biochemical assay conditions. suggesting
that they may form functional heteroligomers in the infected cells. LEF-1 contains a
pnmase motif (WVVDAD) which appears to be essential for its function to support DNA
replication. LEF-1 may be a pnmase with LEF-2 as one of its cofactors (Evans et al.,
1997). The product of the lef-3 gene , LEF-3. a single stranded DNA binding protein
(Hang et al., 1995). foms a homotrimer under biochemical assay conditions (Evans and
Rohrmann, 1997).
5. p35, ie-2 and pe38 genes
The p35 gene. shown to be only stimulatory for plasmid DNA replication in one
case, appears to be essential in another (Kool et al., 1994a; Lu and Miller, 1995). These
conflicting observations could be due to variations in experimentai conditions such as
different times in harvesting the infected cells. P35 could be essential since infected cells
may go through a high degree of apoptosis at late stages of infection (3 days post
infection). P35 is an inhibitor of AcMNPV-induced apoptosis in insect cells. The
requirement of P35 for plasrnid DNA replication suggests that the cellular apoptosis may
be induced either by the viral repiication factors or by the replication of the plasmid DNA
itself. The ie-I gene product seems to be one of the factors that can induce the apoptosis
(Pnkhod'ko and Miller, 1996). Other possible roles that P35 may play during DNA
replication are not clear although it also functions as an early gene transcriptional activator
(Gong and Guarino, 1994).
The ie-2 and pe38 gene are functionally involved in the process of stimulating
early gene transcription. The products of both genes uansactivate early gene transcription;
pc38 stimulates the expression of p l43 and ie-2 stimulates the expression of both ie-l
and pe38 gene (Lu and Carstens, 1993; Yoo and Guarino, 1994b; Yoo and Guarino,
1994a). Consistent with their transactivation function, ie-2 and pe38 also stimulate the
DNA replication process in nansient replication assays. Presumably the enhancement in
DNA replication is due to the stimulatory effect of i e - and pe38 on the expression of
replication genes.
6. pctla and putative exonuclease genes
Sequence analysis of baculovims genome revealed the existence of a homologue of
the eukaryotic PCNA gene. The predicted product of the baculovinis pcno gene shares
42% amino acid sequence identity to rat PCNA. However, this gene does not appear to be
essential for DNA replication both in the transient replication assay (Kool et al., 1994a)
and the virus infected cells (Crawford and Miller, 1988). Deletion of this gene from the
viral genorne does not delay the viral DNA replication itt vivo although the viral late gene
expression seems to be delayed (Crawford and Miller. 1988). suggesting that either a host
homologue of potu gene can substitute for its function or the virus DNA polymerase does
not require such a cofactor during DNA replication.
Sequence analysis of the viral genome also revealed the existence of a putative
alkaiine exonuclease gene, whose predicted product contains four short conserved
domains that are present in the alkaline exonuclease of herpes simplex virus (Maninez et
al., 1996). This gene is also not essential for plasmid DNA replication in cotransfected
ceils. No host factor that may be involved in the process of viral DNA replication has yet
k e n identifid
D. Baculovirus DNA Replication and Gene Transcription
Baculovinis gene transcription is categorized into early, late and very late phases.
The process of viral transcription is largely sequential: expression of early genes occun
before virai DNA replication and does not depend on the replication of the viral genome,
while the expression of late and very late genes follows viral DNA replication and requires
complete replication of the viral pnome (Carstens er al., 1979; Rohel and Fauher, 1981;
Huh and Weaver, 1990a).
The virai immediate early genes such as ie-1, i e - orpe38 are the frst genes to be
expressed upon virus infection, and can be expressed in the absence of any vin1 factors
(Guarino and Summers, 1986b; Chisholm and Henner. 1988; Krappa et al., 1991: Yoo
and Guarino. 1994a; Krappa et al., 1995). The products of these immediate early genes
are transcnptional regulators of other viral early genes (Carson er al.. 1988; Yoo and
Guarino. 1994b; Lu and Carstens, 1993). IE-1 appears to be essential for both the gene
transcription and DNA replication (Ribeiro et al., 1994) and these functions are closely
associated with the virai hrs. IE-1 interacts with hrs and this interaction was demonstrated
using gel retardation assays, in which the mobility decrease of the Iir fragments depends
on the expression of the ie- I gene, either from a msfected plasmid carrying the ie-1 gene
or from an N i vitro t~anslation product of the ie-I gene (Choi and Guarino. 199%; Choi
and Guarino, 1995b).
The minimal sequence for IE-1 binding is half of a 30-mer h r palindrome;
however, this minimal binding does not seem ro be functional in both DNA replication and
transcription enhancement (Leisy et al.. 1995; Rodems and Friesen. 1995). A functional
interaction benveen IE-1 and hrs , in both cases, requires the binding of the pre-dimerized
IE-1 to a complete 30-mer h r palindrome (Rodems and Friesen, 1995). As well, the
spacing benveen the dimerized IE- 1 seerns to be important. Small insertions or deletions at
the center of the palindrome result in the loss of activities in both the replication and the ie-
I dependent transactivation (Rodems and Fnesen. 1995).
In contrast to viral early gene expression, viral late p n e expression does not occur
if viral DNA replication is inhibited (Rice and Miller, 1987; Huh and Weaver. 1990b). A
point mutation in the viral pl43 gene of ts8 mutant abolishes both DNA replication and late
gene transcription, while early gene transcription rernains unaffected (Lu and Carstens,
1991; Lu and Carstens, 1992). The mechanism for the switches from viral DNA
replication to late geene expression is not clear.
E. Possible Replication Mechanisms
Analyses of the structure of defective viral genomes carrying the viral HindIII-K
region suggests that baculovims may use a rolling circle mechanism to replicate its
genome. After 81 undiluted serial passages of the virus. the viral genome was analyzed by
pulse field gel electrophoresis and it reveaied that multiple copies of a srnall viral sequence
of less than 2.8 kb were hybndized to the HindIII-K region (Lee and Krell, 1992).
indicating a possible concatemenc DNA structure in the defective genomes. Consistent
with this observation, plasmid DNA canyùig hrs and coreplicating with the viml DNA in
infected cells was in the f o m of a head-to-tail concatemer, a typical product of rolling
circle replication (Leisy and Rohmiann, 1993).
Another aspect related to mechanisms of baculovims DNA replication is the
spontaneous incorporation of host DNA fragments into the viral genome during
replication. Host DNA sequences have been identified by phenotype changes due to
insertions into viral structural genes. For example, when screened for the phenotype of
polyhedra number. baculovirus appears to have a high potential to be converted into few
polyhedra per infected ce11 phenotype (FP). The FP phenotype usuaily arises rapidly and
accounts for 65% of the total virus by the 5th passage, 90% by the 10th serial passage,
and 100% by the 20th passage (Potter et al., 1976; MacKinnon et al., 1974). Even using a
plaque-punfied virus isolate as the original inoculum or using a lower multiplicity of
infection (0.01) to passage vinises, the FP phenotype still steadily rises to 90% by the
20th serial passage (Potter et al., 1976: Wood, 1980).
B iochemical characterization revealed that in most cases, the FP p henotype was
due to the insertion of host cellular sequences into distinct loci on the viral genome. the
HiridIII-1 or the 25k gene region (Fraser and Hink. 1982; Fraser et al., 1983). Eight out of
the nine FP mutants analyzed had the host DNA insertion in this region (Fraser er al..
1983). The inserted host sequences appear to be highly repeated sequences of different
origins. In another case, two FP mutants carried insertions of host DNA in the viral
HimiIII-K region. The host insert in this case was a copia-like transposon element (Potter
and Milier, 1980; Milier and Miller, 1982).
Analyses of baculovirus polyhedra morphology mutants identified M5, a mutant
with one large cuboidal occlusion body per infected ce11 nucleus (Carstens, 1982;
Carstens, 1987). M5 has two 290 bp insens at 2.6 and 46 map units on the viral genome
(Carstens, 1987). These inserts are likely denved from the host genome as well. The
primary sequence of the inserts revealed characteristics similar to the termini of
transposons (Carstens, 1987). The frequent integration of foreign DNAs into the viral
genome may reflect aspects of the viral DNA replication process.
III. Rationale
Research interests in the genorne replication of baculovinises grow with increasing
interests in the application aspects of baculoviruses. As potential biopesticides, naturally
occumng baculoviruses pose no foreseeable hazards to human health or the environment
The virus replication is generally species specific so the nsk to non-target insects is low
(Groner. 1986). However, the relatively slow action of baculovinises as an insecticide (5
to 15 days post infection to kill insects) is one of the major weaknesses. One solution to
this problem is to insen insecticidal genes such as toxins into the viral genome so that the
v ins would kill insects quicker or at least stop insect feeding (Carbone11 et al., 1988;
Chejanovsky et al., 1995; Tomalski and Miller, 1991 ; Stewart et al., 199 1). However, the
release of engineered baculovinises expressing toxins raises concems of potential hazard
to the environment since possible evolvement of the virus host range may bring toxin
genes to other insect species (Coghlan, 1994). Although curren tly no scien tific evidence
backs these womes. future development of new generations of baculovirus pesticides may
need to focus on the viruses themselves and find a way to enhance the virus replication
cycle. Factors involved in the viral genome replication could be one of the targets for
engineering.
Baculovinises have relatively narrow host ranges, but an efficient biopesticide
would infect a broad range of pests, while remaining safe to beneficial insects. Viral
proteins regulating the replication of the viral genome are likely one of the factors that
restrict the productive infection of baculoviruses to certain host cells. For example, the
viral replication factor Pl43 is also a host range determinant (Karnita and Maeda, 1997;
Kondo and Maeda, 1991; Croizier et al., 1994). A single amino acid substitution within
Pl43 (from Ser564 to Asn) extended the host range of AcMNPV to non-permissive B.
mori cells (Kamita and Maeda, 1997). Engineering of baculovinis for a broader host range
would require background information about the viral replication machinery. In addition,
as a safety precaution, interactions of baculoviruses with their hosts, CO-infectants or non-
hosts need to be closely monitored. Knowing the replication strategies of baculovinises
such as under what conditions the unexpected viral DNA replication may occur would add
to our confidence in the safe use of baculovirus pesticides.
Baculovimses have k e n widely used as expression systems particularly due to the
availability of the strong late polyhedrin p n e promoter (Miller et ai., 1982; Smith et ai..
1983). Although not directly involved in the process of late gene expression. genome
replication is a prerequisite for the efficient transcription of late genes. Understanding the
DNA replication mechanism would help to understand replations of the expression of late
genes. The genome replication of bacu!ovirus, albeit crucial to the v h s replication cycle.
is poorly understood. Little is known about how baculovinis replicates or maintains its
genome although large numbers of recombinant baculoviruses have ken. or are being
constructed and propagated in many laboratories.
An essential step in studying baculovinis DNA replication is to identify the ongin
of replication. Interactions between the origin and viral factors would help to identify and
characterize components of the viral replication machinery. As with other DNA vimses,
baculovinis may have a replication machinery with a helicase as its core (Borowiec. 1996;
Hassel1 and Bnnton, 1996; Boehmer and Lehman, 1997). Assembly of the helicase ont0
the origin could be the central issue in the initiation of the viral DNA replication.
Evidence from the infection-dependent replication assays indicates that baculovirus
may use hrs or the HindIII-K region as origins of replication (Pearson et al., 1992; Lee
and Krell. 1992; Washburn and Kushner. 1993). The question remains what feature
determines viral origins; is it a consensus DNA sequence, a common DNA structure such
as a palindrome or something else? Since hrs and HindIII-K region do not share any
sequence homology; the primary DNA sequence is unlikely a comrnon feature specifically
recognized by the replication initiator. Both hrs and HindIII-K region contain
palindromes. but these two types of palindromes function differently in the process of
initiation. A single palindrome within hrs is sufficient for the initiation of DNA replication.
whereas the palindrome within HidII -K is not (Pearson et al., 1992; Lee and Krell,
1992; Washburn and Kushner, 1993). Therefore, selection of initiation site in baculovinis
appears to be a complicated issue. Baculovims has a large genome, and only a small
portion has been scrutinized by the standard replication assay for potentid origin function.
If systematically tested, regions in addition to hrs and HindIII-K might replicate in this
assay. It is necessary to test multiple regions to search for any pcssible common feature
that wouid lead to the DNA replication.
Two of the identified virai replication factors, IE-l and P143, rnay potentially serve
as replication initiaton. Both proteins possess DNA binding activity; IE-1 binds to hrs,
while Pl43 binds to DNA in a sequence non-specific fashion (Rodems and Friesen, 1995;
Laufs et al., 1997). If IE-1 functions as the initiator, hrs would rnost likely be the
replication origins. The initiation of replication by IE-1 may involve the assembly of the
helicase, possibly P143. ont0 hrs. A direct interacaon benveen Pl43 and IE- I might exist.
On the other hand, if Pl43 functions as the initiator, its non-specific binding to DNA
rnight lead to the replication of multiple sequences. Pl43 rnight initiate replication from
specific sites. but the initiation would require the interaction of P l 4 3 with other factors
such as a DNA binding protein with sequence specificity or a structural protein organizing
the conformation of the viral genome. Possible roles of Pl43 and its interaction with other
viral replication factors might hold the key to understanding baculovirus replication
mechanisms.
The overall aim of this study was to investigate aspects of the initiation process of
baculovirus genome replication. Four different objectives were established. First. the
present study was to test whether his and HimiIII-K region were unique sequences
possessing the ability to initiate plasmid DNA replication in the standard replication assoy.
If they were not, multiple viral genomic regions would be scrutinized for additional ongin
function. The identification of alternative putative origins on the viral genome is necessary
before common feature among hrs, HitidIII-K or any other putative origin c m be defined.
This cornmon feature may reflect mechanisms of initiation, and would help to predict an
interaction between die origins and the initiator of the replication. The second objective
was to study the process of plasmid DNA replication in cells coaansfected with the viral
DNA. This process would also be compared with plasmid DNA replication in the infected
ceus. Possible differences in the regdation of initiation in the infected versus cotransfected
cells may reflect regulatory mechanisms involved in the viral DNA replication.
Understanding these mechanisms may eventually help to elucidate the viral replication
machinery. The third objective was to investigate possible interactions between viral
replication factors in the process of initiation. The viral putative helicase protein, P143,
was the focus of this study. Pl43 likely plays a cenaal role in the process of initiation.
The assembly of Pl43 ont0 replication origins may involve direct interaction of Pl43 with
other factors. Detection of this interaction in cells expressing viral replication factors
would help to reveal the organization of the viral replication machinery.
Finally, the fourth objective of this study was to examine the possible mechanism
used by the virus to replicate its DNA. The process of initiation is also closely associated
with the process of DNA replication. For example, T4 uses recombination dunng
replication and includes the use of free 3' ends of the replication intermediates as prirners
for the initiation of DNA synthesis (Mosig and Colowick, 1995; Mosig, 1987).
Examinarion of the mode of the DNA replication of baculovirus could help to elucidate
possible roles of the replication intemediates in the process of initiation. The mode of the
DNA replication would also provide the basis for designing il1 vivo approaches to identify
genuine origins in the future.
In general, results from this study would help to understand how the replication of
the baculovirus genorne is initiated by specific interaction between the virai cis-ac ting
replicators (oripins) and tl-ans-ac~g initiator or initiators.
MATERIALS AND METHODS
A. Cells and Viruses
The Spodopterafrugiperda continuous ce11 line, IPLB-SF-21 (SfX), established
from pupal ovaries of the Fa11 Army Worm (Vaughn et al.. 1977; Knudson and Tinsley,
1974). was maintained at 28'C by passage in TC-100 medium (Gibco-BRL)
supplemented with 10% heat-inactivated (56'C. 30 min) fetal calf serum (FCS) (Gibco-
BRL). Cells with a passage number between 100 to 200 were used in this study.
The Autogropha californico multicapsid nucleopolyhedrovixus (AcMNPV) strain
HR3, a plaque-purified isolate (Brown et al., 1979). was propagated by infection of SC1
ceIl monolayen with the budded virus (BV) (Erlandson er al., 1984) (m.0.i. of 0.01). The
infection was carried out in six-well tissue culture plates (0 35 mm, Coming) or flasks
(75 mm* or 150 mm?. Coming) in a minimal volume covering the ce11 surface area. After
being rocked gently for 1.5 h, the infected monolayers were washed three tirnes with TC-
100 medium. covered with fresh TC-100 supplemented with 10% FCS. and incubated at
28'C und harvesting.
Progeny virus was harvested from the infection supernatant by centrifugation at
380 x g (~orval l@ Econospin, Dupont) for 10 min to remove the ce11 debris. The
supernatant containine virus particles was collected, stored at 4 'C or, further purified by
centrifugation through a 5 ml 20% sucrose cushion (in 10 miM Tris-HC1. 1rnM EDTA. pH
7.5; TE) at 26.000 rpm (SW28, Beckman) for 45 min. The virus pellet was resuspended
in a minimal volume of TE buffer, then loaded onto a 25%-56% sucrose (in TE buffer)
gradient and centrifuged at 30,000 rpm for 90 min (SW60 Ti, Beckrnan). The visible virus
band was collected. diluted with TE buffer and recentrifuged at 30,000 rpm for 30 min
(SW60 Ti). The purified virus pellet was resuspended in TE buffer (Summers and Smith.
1987).
To titrate the progeny viruses, one million cells were seeded in each well of a six-
well plate, then infected with 500 pl of appropriately diluted virus suspension. The
infected cells were washed twice with TC-100 following the 1.5 h adsorption. covered
with 1.5 ml of mixture of TC-100. 10% FCS, 50 pg/ml of gentarnicin (Sigma) and 1.5 %
of melted (cooled to 37'C) low geiling temperature agarose (SEAPLAQUE", FMC Co.).
The plates were incubated at 28'C for 7 to 10 days until the formation of countable plaques
occurred (Brown and Faulkner. 1978). When recombinant viruses ca-g the bacterial
lac2 gene were tiaated, X-gal (5-bromo-4-chloro-3-indolyl-~D-galactosie) (Gibco-
BRL) was added to the agarose overlay in a final concentration of 100 p@d.
B. Cloning and Subcloning Viral DNA Fragments
The EcoRI site was deleted from pUC18 by digestion with EcoRI followed by
incubation with DNA polymerase (Klenow fragment) and reEgation to produce pUC18AE.
DNA fragments of AcMNPV carrying the h r l (HindIII-F), hrla (HindIII-O), hr2 (Psd-
J), hr3 (a 6.2 kb SsrI-HitzdIII fragment of SstI-D), hr4a (KpnI-D), hr4b (a 7.5 kb PsrI-
XbaI fragment of PstI-C) and hr5 (HindIII-Q) regions were directly cloned into
pUC18AE to produce pAchrl, pAchrla, pAcPstJ. pAchr3, pAchr4b and pAchr5. The
KpriI-D clone was further digested with Hi1rdII1. partially digested with EcoRI to retain
the right end 3.5 kb viral kagrnent containing EcoRI-Q and the hr4a region, then blunt
ended with Klenow DNA polymerase and religated to produce pAchr4a. The resulting
plasmids were digested with EcoRI to delete the hr sequences, then incubated with 0.5-1
units of S 1 nuclease (Pharmacia) at room temperature for 30 min in 26.7 mM Tris-HCl,
pH8.0, 30 mM CH3COOK, pH4.6,250 mM NaCl, 267 PM MgCl2, 1rnM ZnSOq, 5%
glycerol. The reaction was stopped by incubation at 65'C for 10 min. The S1 treated
plasmid DNAs were self-ligated to generate pAcAhr2 pAcAhr3, pAcAhr4a and pAcAhr5.
The AcMNPV HindIII-F fragment was cloned into pUC18, then this plasmid was
digested with Cl01 and religated to generate pAcAhrl.
Subclones (pAcHE4.3 and pAcie2pe38) of the left end flanking hrl and a 1.7 kb
EcoRI-ScaI fragment of pAcHE4.3 [pAcHE4.3(ES)] have been previously descnbed (Lu
and Carstens, 1993). The 2.6 kb PstI-N fragment of AcMNPV was cloned into pUC18
to generate pAcPstN (Lu and Cantens, 1993). PstI digestion of pAcHE4.3 released a 1.5
kb PsrI fragment containing the pe38 gene, which was recovered and ligated into PstI
digested pUC18 to generate pAcPE38. A 2.5 kb HindIII-ScaI fragment of pAcHE4.3 was
cloned into pUC18 to produce pAcIE-2. The 1.5 kb HindIII-San fragment frorn pAcPstJ
was cloned into the HitidIII-Soli site of pBSK- to generate pAchr2. The 1.9 kb EcoRI-Q
and 1.4 kb EcoRI-S fragments of AcMNPV were cloned into pBR322 to generate
pAcHE65 and pAcp35. respectively. The 1.8 kb HbidIII-R fragment was cloned into
pUC19 to pnerate pAc39K. A 2.3 kb ScaI-XhoI fragment from pSTCHX-3 (Thiem and
Miller, 1989) was cloned into the SmaI-Safi sites of pUC18 to generate pAclef4. A 3 kb
HiridITI-XbaI fragment from Hindm-E was cloned into the HindITI-XbaI site of pUC18
to generate pAcp47. A 4.7 kb EcoRI-SspI fragment from EcoRI-D was cloned into the
EcoRI-SmaI site of pUC19 to generate pAcp143. A 1.4 kb EcoRI-Nrid fragment from
EcoRl-O was cloned into the EcoRI-SmaI site of pUC19 to generate pAclef1. pAclef2
was constructed by subcloning a 0.9 kb Mid fragment from the EcoRI-I region. The 0.9
kb Mird fragment was blunt-ended with the Klenow fragment of DNA polyrnerase. then
inserted into the SmaI site of pUC19. Plasmids carrying the ie-1 (pAciel). driapol
(pAcdnap) and lef-3 (pAcleD) genes were previously described (Guarino and Summers,
1986b; Tornalski et al., 1988; Li et ai., 1993). A plasmid containing the ie- I gene
promoter linked to the E. coli lac2 pene @IEl-lad) was a gift from Dr. P. Friesen. The
ie-l promoter was deleted from pIE1-IacZ by digestion with Smal and EcoRV and
religation of the 6.8 kb SmoI-EcoRV fragment to produce placZ(0RF). pIE1-P(CH) was
subcloned from pIEl-lac2 by inserting the 558 bp CloI-HincII fragment of the ie-l
promoter region into the ACCI-HindIII site of pBS (Stratagene) by blunt end ligation.
Plasmids pAchrl, pAchrla, pAchr2, pAchr3, pAchr4a and pAchr4b were digested
with EcoRI to elirninate palindromes within each individual hr, then ligated to a 4.0 kb
EcoRI fragment carrying the ie-i promoter driving E. coli lac2 gene (isolated by partial
digestion of pIE l -lac2 with EcoRI) to generate pAcAhrl -1acZ. p AcAhr l a-lac2 pAcAhr2-
IacZ. pAcAhr3-lacZ. pAcAhr4a-lac2 or pAcAhr4b-lacZ. A 4.5 kb HindIII-BamHI
fragment frum plEl-lac2 was cloned into the Bgm-HindIII site of the EcoRI-P fragment
contained in pAcEcoFü-P (vector pUC8 ) to generate pAcEcoRI-P-lacZ.
Various regions of the ie-I promoter were subcloned h m pIE1-P(CH) (3.3 kb).
The 1.1 kb SspI fragment of pIE1-P(CH) was ligated to a 1.8 kb SspI-PvuII fragment of
pIEI-P(CH) to generate plEl-P(CS) (3.0 kb). Digestion of pIEI-P(CH) with AflIII and
religation of the 2.7 kb fragment generated pIE1-P(CA) (2.7 kb). A 0.4 kb PvuII
fragment from plEI-P(CS) was ligated with a 2.4 kb PvuII fragment of pIEI-P(CH) to
generate pIEI-P(CP) (2.8 kb). Digestion of pIEI-P(CH) with NheI and AflII, filling in
with DNA polymerase 1 (Klenow) and ligation generated pIE1-P(CN) (2.5 kb). Digestion
of pIE1-P(CH) with NheI and EcoRI, filling in with DNA polymerase 1 (Klenow) and
ligarion generated pIE1-P(NH) (3.1 kb). Ligation of the 2.4 kb and 0.5 kb PWII
fragments from pIE1 -P(CH) generated PIE 1 -P(PH) (2.8 kb). Digestion of pIE 1 -P(CH)
with Ml141 and EcoRJ followed by filling in with DNA polymerase 1 (Klenow) and ligation
yielded pIE1-P(AH) (2.9 kb). Digestion of pIE1-P(CH) with SspI and religation
generated pIEI-P(SH) (2.2 kb). The 0.3 kb PruII fragment of pIE1-P(NH) was ligated
with a 2.4 kb P\uII fragment of pIE1-P(CH) to generate pIE1-P(NP) (2.6 kb). Digestion
of pIE1-P(PH) with AmII and religation generated pIE1-P(PA) (2.3 kb). Digestion of
pIE1-P(CS) with EcoRI and MluI, filling in with DNA polymerase 1 (Klenow) and
religation generated PEI-P(AS) (2.6 kb).
The expression vector pIElhr/PA, a gift from Dr. P. Fnesen. contains hr5 and the
upstream region of the ie-1 gene (Cartier et al.. 1994). Both p i 4 3 and lef-3 ORFs were
cloned behind the ie-l promoter in this vector. The cloning of PIE 1 hrP143 was descnbed
elsewhere (Liu, 1997). pIElhrLEF3 was cloned by PCR amplification of the lef-3 gene
region in pAclef3 by using two primers: 5' ACGGATCCATGGCGACCAAAAGATCTT
3' and 5' GACAGCCTGATCTGCAATAGGATCCAT 3'. The 1363 bp PCR product
containing the ORF and Poly(A) signal of the Ief-3 gene was digested with BamHI, then
inserted into the B g m site of pIElhr/PA.
The Eschericio coli strain DHSa (Gibioco-BRL) was used as the host strain for
DNA cloning and subcloning. Competent DHSa cells were prepared and mnsformed by
two different methods. In the first method, four to five colonies of bacteria were
inoculated into 30-100 ml of SOB (2% tryptone, 0.5% yeast extract, 8.6 mM NaCl, 2.5
rnM KCI, 10 rnM MgCI2, pH7.0) containing 20 rnM MgS04 and grown at 37 OC for 2.5
to 3 h to an OD6w of 0.7. The cells were pelleted at 4000 rpm (JA-14, Beckman) for 10
min, then washed once in 20 ml of FSB buffer (10 rnM CH3COOK. pH7.5, 45 mM
MgCl2, 10 mM CaC12, 100 mM KCI, 3 mM hexaminecobalt chloride, 10% glycerol) and
resuspended in 4 ml of FSB. The ce11 suspension was mixed with 280 11 of DMSO and
quickly aliquoted and frozen at -70°C (Hanahan, 1983). For transformation, 100 p1 of the
chemically treated ceils, mixed with DNA, was incubated on ice for 30 min, then treated at
45'C for 45 seconds, followed by incubation at 37OC for l h in SOC (SOB plus 20 rnM
glucose). Recombinant colonies were plated on agar plates (0100 mm, Coming) of Luna-
Benani medium (1% tryptone, 0.5% yeast extract, 1% NaCI, pH 7.0; LB) containing 100
j.~/m.i of ampicillin (Sigma). and incubated at 37 OC for 12 to 18 h.
DHSa ceils were aiso transfonned by electroporation. To prepare competent cells,
a single colony of bacteria was inoculated into 10 ml of LB and grown ovemight at 37 OC.
The ovemight culture was inoculated into 1 L of LB medium and incubated at 37 'C for 2
to 3 h to an OD600 of 0.8. Cells were then pelleted by centrifugation at 4000 rpm (JA-14)
for 10 min. The pellet was washed twice with ice cold Hz0 (1 L and 500 ml) and once
with 10% glycerol (in H20) (20 mi), then resuspended in 2 ml of ice cold 10% glycerol (in
H20). The resuspended cells were quickly frozen and stored at -70°C in 50 pI aliquots.
For electroporation. the DNA was first desalted by mixing with 300 pl of 6 M sodium
idodide, 3 pl of glass powder (Vogelstein and Gillespie, 1979) and incubation on ice for
15 min. After cenûifugation at the maximal speed (microcentrifuge. Eppendorf) for 30
seconds, the glass powder was washed twice with 10 mM Tris-HC1,OS mM EDTA. 500
rnM NaCl. 50% ethanol, pH7.4 and the DNA, bound to the glass powder, was eluted
with 20 pl of H 2 0 by incubation at W C for 5 min and centrifugation at the maximal
speed (microcentrifuge, Eppendorf) for 30 seconds. The DNA supernatant was collected
and used for electroporation. Electroporation was perfomed in 0.1 cm cuvettes using an
ElectroPorator (Invitrogen Co.). Cornpeten t cells, mixed with desal ted DNA. were
elecaoporated at 1,50OV, 150 R, 50 pF and 5-8 milliseconds. Transfomed bactena were
resuspended in 1 ml SOC and incubated at 37'C for 1 h, then plated on ampicillin (100
pg/ml) agar LB plates.
To screen for recombinant clones, single colonies of transformants. grown
overnight on ampicillin LB agar plates, were picked and dissolved in single colony
preparation buffer [2% Ficoll. 1% SDS, 0.01% bromphenol blue and 1% sucrose in TBE
buffer (90 m M Tris-borate, 2 rnM EDTA, pH8.3)J. The bacterial lysates were directly
loaded ont0 agarose gels and electrophoresed to detect transfonnants carrying plasmid
DNA.
The alkaline lysis method (Bimboim and Doly, 1979) was used to prepare plasmid
DNA from 1.5 ml (Mini prep) or 100 ml (Maxi prep) of overnight-grown bactenal culture.
Bacteria were pelleted at 4.000 x g for 10 min, then resuspended in 200 p1 (Mini prep) or
10 ml (Maxi prep) of 50 mM Tris-HCI, pH8.0, 10 mM EDTA, 100 p d m l RNase A
(Gibico-BRL) and incubated at room temperature for 5 min. After the addition of 200 pl
(Mini prep) or 10 ml (Maxi prep) of 0.2 N NaOH, 1% SDS, the bactenal suspension was
mixed and irnrnediately precipitated by the addition of 200 pl (Mini prep) or 10 ml (Maxi
prep) of ice cold 3 M CH3COOK, pH 5.5. Following 15 min of incubation on ice. the
precipitated chromosomal DNA complex was removed by centrifugation at 12.000 x g for
30 min. The plasmid DNA contained in the supernatant was directly precipitated by the
addition of 2 volumes of 100% ethanol (Mini prep) or further purifieci by QIAGEN-tip-
500 (Qiagen Inc.) according to the manufacturer's insmiction. The precipitated DNA was
bnefly dried and redissolved in TE buffer.
Al1 clones were confmed by restriction enzyme mapping. Al1 clones carrying hi-
sequence deletions were confmed by DNA sequence analysis
DNA sequencing was performed by the Cortec DNA Service Laboratories, hc. at
Queen's University, Kingston. Ontario. using an AB1 PRISMTM Dye Terminator Cycle
Sequencing Kit (Perkin-Elmer Corporation, California) according to the manufacturer's
instructions.
C. Construction of Recombinant Viruses
For the constmction of recombinant viruses, regions containing hrs or the p l 0
gene region were first cloned into plasmids to produce pAchrl, pAchrla, pAchr2,
pAchr3. pAchr4a. pAchr4b and pAcEcoRi-P-lac2 as described above. The hr-containing
plasrnids were then digested with EcoN to destroy hrs. A 4.0 kb EcoRI fragment carrying
the ie-2 promoter driving E. coli foc2 gene (from pIE1-lad) was inserted into the EcoRI
site of hi-S. The resulting plasmids and pAcEcoR1-P-lac2 were then cotransfected
individually with viral DNA into insect cells to generate recombinant vimses (Pennock et
al., 1984). The E. coli P-galactosidase gene (lacz), inserted at each deleted hi- or the p l 0
gene region was expressed from the viral ie-l promoter and used as the selection marker
(reporter) for the selection of recombinant vhses. Progeny virions were harvested three
days after cotransfection and screened and pwified by 4 to 6 rounds of plaque assays. The
p ~ e d vimses were exarnined with restriction digestion and hybridization with a probe of
plasmid DNA carrying lac2 gene.
D. DNA Purification, Electrophoresis and Hybridization
Viral DNA was purifid ffom up to three 150 cm2 flasks (Coming) of infected ceii
supemarants. The budded virus was purified and concentrated by sucrose gradient
centrifugation. The purified virus was resuspended in 475 p1 of TE buffer. After the
addition of 25 pl of 10% SDS, 2 pi of Proteinase K (20 mghi) (Gibco-BRL), the virus
suspension was incubated at W C for lh. nie viral DNA was purified by Iwo extraction
of the suspension with phenol/chloroform fisoamyl alcohol (25: 24: 1). then dialyzing the
aqueous phase against TE buffer over 12 h with 4 changes of buffer.
For the purifilcation of total intracellular DNA, one million Sf2 1 cells. infected with
viruses or transfected with DNA, were pelleted at 6.000 rpm (Microcentrifuge.
Eppendorf) for 5 min. The ce11 pellet was washed once with PBS buffer (80 mM
Na2HP04, 20 m M NaH2P04. 100 mM NaCI, pH7.5), resuspended in 320 pl of
Proteinase K buffer (10 mM Tris-HCI, 5 rnM EDTA, pH7.8, 150 mM KCI. 0.5% SDS)
and incubated at 6S°C for 30 min. After the addition of 150 pl of 10% SDS and 20 pI of
Proteinase K (5 mg/mi), the sample was incubated at 65'C for 30 min, then extracted with
pheno1/cNorofor~isoarnyl alcohol (2524: 1) twice and chloroform/isoamyl alco hol(24: 1)
once. The total intracellular DNA was precipitated with 2 volumes of 100% ethanol and
redissolved in 100 11 of TE buffer (Gross-Bellard et al., 1973).
Purified DNA was electrophorized in 0.6%-0.7% agarose or 5% polyacrylamide
gel in TBE running buffer (90 rnM Tris-borate, 2 rnM EDTA. pH8.3) at 50 V for 3 to 12
h. Pulse field gel electrophoresis was perfonned in 0.7% agarose gel in TBE, at a constant
160 V with variable pulse times of 90 s for the frst 2 h followed by 15 s for the final 20 h.
The clamped homogeneous electric field apparatus @IO-RAD) were used. Following gel
electrophoresis, DNA samples were transferred to Q I A B R A N E ~ ~ nylon membrane
(Qiagen). DNA in agarose gel was transferred onto the membrane by downward capillary
movement with 0.4 N NaOH. DNA in polyacrylamide gel was transferred to the
membrane by electrophoresis in 0.5 x TBE at 50 V for 2 h.
DNA probes for hybridization were prepared by labeliing 35 ng of heat-denatured
DNA (100 'C. 5 min) with 50 jKi of a - 3 2 p - d m (ICN Biomedicals Inc.) by random
priming of DNA with hexadeoxyribonucleotides of random sequences (Feinberg and
Vogelstein, 1983). T'he reaction was carried out in 10 mM Tris-HC1, pH 7.5, 50 mM
NaCl. 10 mM MgCl2, 5 rnM DTT, 20 PM dNTPs (minus dCTP), 5 unitslml of
hexadeoxyribonucleotides of random sequences. and 10 U of the Kienow fragment of
DNA polymerase at 37'C for 30 min (Oligolabelling Kit, Pharmacia-LKB). The un-
incorporated dNTPs was separated from the labelled DNA by gel filtration using
sephedex@-~50 ~ i c k ~ M colurnn (Pharmacia-LKB). The specific activity of probes was
about 1-2 x 109 dpm/pg DNA.
DNA containing filters were prehybridized in 2 x SSC, 1 8 SDS, 135 pg/ml
denatured hemng spem DNA, 10% dextran sulphate at 68'C for 2 h. then hybridized ar
68'C overnight in 2 x SSC, 1% SDS. 100 pg/ml denatured hemng sperm DNA. 8%
dextran sulphate. The hybridized blots were washed three times in 2 x SSC. 0.5% SDS
and three times. 30 min each. in 0.1 x SSC, 0.5 % SDS, then exposed to
REFLECTION~~ Autoradiography fdm (DuPont) for 10 min to one week.
E. Protein Extraction, Electrophoresis and Imrnuno Detection
Total cellular proteins were extracted by direct resuspension of washed ce11 pellets
in sarnpling buffer (62.5 rnM Tris-HCI. pH6.8 at 25°C. 2% SDS, 10% plycerol. 0.0 1%
bromophenol blue, 42 mM DTT ) and heating the suspension at 100°C for 5 min.
Polypeptides €rom ce11 exrncts were separated by elecuophoresis through 10% resolving
(acry1amide:bis-acrylamide, 30:0.8; in 400 mM Tris-HCI. pH8.8, 0.1% SDS, 0.07%
ammonium persulphate. 0.007% TEMED), 4 8 stacking (acry1amide:bis-acrylamide.
30:0.8; in 125 m M Tris-HCl, pH6.8,0.1% SDS. 0.07% ammonium persulphate. 0.007%
TEMED) polyacrylamide gels. and running buffer (25 mM Tris-HCI. pH8.3, 192 mM
glycine and 0.1 % SDS) at 5- 10 mA with constant curent for 2-4 h (Laemmli. 1970). The
gel was stained with Coomassie brilliant blue (0.2%, dissolved in 50% methanol. 7 8
glacial acetic acid) and destained in 5% glacial acetic acid. 10% butanol. All chernicals
used in polyacrylamide p l electrophoresis were purchased from ICN Biomedicals Inc.
Broad range (2-212 kD) protein markers (New England Biolab) were used as the
molecular weight mobility markers.
For immuno detection of viral proteins, monoclonal antibodies àgainst Pl43 (RC-
2) (Laufs et al., 1997), IE-I (a gift from Dr. L. Guarino), LEF-3 (a gift from Dr. L.
Guarino), and P47 (Carstens et al., 1993) were used.
Proteins. separated on polyacrylarnide gel. were uansferred ont0 OPTITRAflM
membrane (Schleicher and Schuell Inc., New Hampshire) by electrophoresis in ETB
buffer (25 mM Tris-HCI, pH 8.3, 192 mM glycine, 0.1% SDS, 10% methanol) at 200
mA for 1.5 h. The membrane was blocked for 1 h at room temperature or ovemight at 4
OC in 5% skimmed milk powder in PBS, 0.1% Tween-20 (PBS-T), then washed three
times with PBS-T and incubated with appropriately diluted pnmary monoclonal antibody
for 1 h at room temperature. After three washes with PBS-T, the membrane was incubated
wi th goat ami-mouse anti body conjugated with horseradish peroxidase (1 : 20,000 dilution
in PBS-T, Jackson ImmunoReseach Laboratories. Inc. Pennsylvania) for 1 h at room
temperature, then washed three times in PBS-T. Immuno reactive proteins were detected
using the ECLTM western blottîng detection solution (Amersham). The cherniluminescence
due to oxidation of luminol, catalyzed by the peroxidase. was recorded on
REFLECTIONTM Autoradiography film (DuPont). If the membrane was reprobed, the
bound antibodies were stripped by submerging the membrane in 100 m M 2-
mercaptoethanol, 2% SDS, 62.5 mM Tris-HCI, pH6.7, and incubating at 55'C for 30
min.
F. Transfection and Replication Assays in SfZl Cells
Sf21 cells (1061, seeded into each well of a six-well plate for 4 h. were washed
three times with TC-100 before transfection. For transfection with only plasrnids. the
washed Sf21 monolayer was incubated with 0.5-2 pg of plasmid DNA. 10 pl of
LipofectinTM (Gibicol-BRL) (for transfection of one plasmid) in a total volume of 1 ml.
When multiple plasmids were used, the cells were mnsfected with 2-5 pg of each
plasmid. 60 pl of DOPE (1.2-dioleoyl-sn-glycero-phosphatidylethne) (Wang et
al., 1996) and TC-100 in a final volume of 0.7 ml at 28°C for 6 h. For cotransfection of
viral and plasmid DNA, 0.5 pg of viral DNA was mixed with 0.5-1 pg of plasrnid DNA
and 10 pl of LipofectinTM in a total volume of 75 pl. The mixture was added to the
washed ce11 monolayer in 1.5 ml of TC-100 and incubated at 28°C for 6 h. After the
removal of the DNA/Lipofectin mixture. cells were washed twice with TC-100. The
transfected cells were overlaid with fresh media w-100 supplemented with 10% FCS)
and incubated at 28°C for 48-72 h. In some cases, the transfected cells were infected with
virus for 1-1.5 h after various times after transfection at room temperature (rn.0.i. of 1).
The aansfected-infected cells were overlaid with fresh media (TC-100 supplemented with
10% FCS) and incubated at 28°C for 48 h (KooI et al., 1993b).
The replication of plasmid DNA in Sf21 cells was monitored by D p d digestion.
Plasmid DNA replicated in Sf2l cells is not methylated at GATC, and therefore is resistant
to DprlI digestion. Total intracellular DNA was digested with Dpn 1 (20 units) for 2-4 h,
the reaction was heat-inactivated at 85°C for 20 min (Pearson et al., 1992; KooI et d.,
1993b).
G . Immunofluorescence Microscopy
Sf21 cells seeded on to a coverslip in a tissue culture peui dish (035 mm,
Coming), were transfected with plasmids or infected with vixus. Eighteen to 24 h post
transfection or infection. the celis were washed with PBS and fixed by oeatment with 10%
paraformaldehyde for 10 min at room temperature, then premeabilized in methanol for 20
min at -20 OC. After washing three times with PBST, the cells were blocked for 1 h in 1%
goat serum (in PBST), then incubated with prirnary antibody for 1 h. Monoclonal
antibodies against Pl43 (RC-2) (1:100 dilution), LEF-3 (1500 dilution) and IE-l
(150,000) were used in this study. Following incubation with prirnary antibody, cells
were washed three tirnes for 5 min with PBST. then incubated for 1 h with 75 pl of goat
anti-mouse IgG conjugated with Oregon Green 488 (Jackson ImmunoResearch
Laboratories. Inc. Pennsylvania) (2 pg/d diluted in 1% goat serum). Following the
incubation, the coverslip was washed three times with PBST. Cell nuclei were stained
before mounting ont0 the slide with DAPI (4*,6-diamidino-2-phenylindole) (Molecular
Probes, Inc. Oregon) or propidium iodide. Both reagents were diluted with Slow Fade
bufferTM (Molecular Probes, Inc. Oregon) to a final concentration of 1 PM, and incubated
for 2 min with cells at room temperature. One drop of Slow ~ a d e m (Molecular Probes,
Inc. Oregon) was placed on the cells and the coverslip was placed face down on a
microscope slide for examination. In double-labelling experiments. the cells were
incubated with the monoclonal antibodies againsi LEF-3 (1500 dilution) for 1 h foilowed
by the goat anti-mouse IgG conjugated with Oregon Green 488 (2pgIrnl diluted in 1 % goat
serum). Then the polyclonal rabbit antiserum against P143, M78.28.2. 1:1000 dilution)
(Laufs et al., 1997) was added, followed by goat-anti rabbit IgG conjugated with
Rhodamine (Jackson ImrnunoReseach Laboratories, Inc. Pennsylvania) (2pg/ml diluted in
1 % goat serum). The stained cells were exarnined by a Leitz Aristoplan microscope (Leitz.
Toronto. ON) using an 13 k i t z band pass filter for Oregon Green 488 detection or an A
Leitz filter for DAPI stain. The confocal imaging of some of the stained cells was
performed on a Meridian confocal microscope using a 530 nm band pass filter for Oregon
Green 488 detection, a 590 nm band pass filter for Rhodamine detection and a 620 nm
band pass filter for propidium iodide stain. Photogaphs were taken on Kodak TMY 5053
film with 25-40 x objective lem. Color images were generated and analyzed with MCID
M4 software (Imaging Research. Brock University. St. Catharines. ON) with 100 x
objective lens.
H. Computer Assisted Data Analysis
The computer program Gene Consiruction Kitm (Textco Inc. New Hampshire)
was used to imitate and predict the actual DNA manipulation and cloning procedure based
on DNA sequences. The program MacvectorTM (Oxford Molecular Ltd.) was employed
for DNA sequence alignment and homology cornparison. X-ray films were scanned using
the Apple Color Onescanner and 0foto@ image program (Light Sources Computer Images
Inc.). The relative intensity of signals on X-ray films was determined using the public
domain computer program NIH Image (version 1.54). For graphic presentation of the
research data, the programs MacDraft version 3.01 (Innovative Data Design Inc.) and
Adobe Photoshop" 4 (Adobe System Inc.) were used.
RESULTS
A. Replication of Plasmids and Recombinant Viruses Carrying hr Deletions
Plasrnids canying baculovims hrs replicate in infected insect cells (Pearson et 01..
1992; Kool et al.. 1993a; Kool et ai., 1993b; Leisy and Rohmann, 1993). These results
suggest that hrs c m function as origins of replication on the viral genome. However. it is
not clear whether the replication of plasrnid DNA in the infected cells is dependent
exclusively on the presence of hrs, because the majority of the viral genorne has not k e n
tested by the transient replication assays. It is possible that regions other than h n may also
possess the ability to support the replication of plasrnid DNA in the infected cells. Indeed,
when a viral genomic region, the HindIII-K region, was tested in the replication assay.
efficient replication was detected (Kool et al., 1994b). These results suggs t that regions
in addition to hrs may serve as sites for replication initiation. To test this hypothesis,
sequences flanking hrs were examined for their replication ability.
A series of viral genornic regions carrying h r deletions were consmicted (Fig. Ib)
and tested in a transient replication assay (Kool et al.. 1993a; Kool et al., 1993b). Plasrnid
pAcAhr?. pAcAhr3 or pAcAhr4a contained sequences flanking hrs plus a single hr
palindrome deleted in the central EcoRI site. whereas pAcAhr5 contained hr j flanking
sequences plus only one half of a single palindrome. The plasmid pAcAhr1 had a complete
dektion of the hrl region from its flanking sequences by CIaI digestion. The replication
ability of these hr deletion plasmids was tested by rransfection of these plasmids into insect
cells and infection of the ceils with virus (m.0.i. of 1) at 6 h post transfection. The infected
cells were harvested 2 days post infection. and total intncellular DNA was punfied and
digested with DptlI to detect the replication of plasmid DNA. No replication of plasmids
pAcAhr3 and pAcAhr5 was detected, while the connol hi-Lcontaining plasmid pAcPstl
showed a strong replication signal (Fig. 2. lanes 1, 4. 7). This demonstrated that
sequences flanking ht-2 and hi5 were not able to compensate for the essentiai role of these
Figure 1. Location of hrs and their flanking sequences on the AcMNPV genome.
(a) AcMNPV EcoRI resmction rnap is s h o w as the linear map on the top. hrs are indicated
by downward arrows. To demonstrate the smicture of hrs. the continuous DNA sequence
(from nucleotide number 26292 to 26454) of hr2 contained within the PstI-J region is
shown. The repeated sequences and 30 bp palindromes (underlined sequences) within hr2
are aiigned and indicated at the bottom. The central EcoRI sites within palindromes are shown as bold undedine letters. (b) AcMNPV HitidIIi, PsrI, SstI and KpA restriction
maps are shown on the top of each panel, with the downward arrows to indicate hrs. The
viral DNA fragments cloned in pAchrl, pAchr2, pAchr3, pAchr4a and pAchr5 are shown
by expansion maps beneath the AcMNPV restriction maps. The cloning sites and the
EcoRI sites on these fragments are indicated by vertical bars. hrs were deleted from these
fragments and the resulting fragments carrying hr deletions and contained in pAcAhr 1.
pAcAhr2. pAcAhr3, pAcAhr4a and pAcAh~-5 are shown by the shoner linear maps below
the expansion maps.
hrl I v LM N I
H i n d i l l
Pst l
Sstl
Kpnl
hr.5 I v
K Q P I IHI I A l I A 2 I I I I (
Ahrl Ahr5
l Sstl y "*Ill
Figure 2. Infection-dependent replication of plasmids containing hr dele- tions.
Sf2 1 cells ( 106) were transfected with 1 pg of hr-deletion plasmid pAcAhrl (lane 3),
pAcAhr2 (lane 4), pAcAhr3 (lane 5) , pAcAhr4a (lane 6), pAchhr5 (lane 7). The same
arnount of pAcPstJ (lane 1 ) or pUC 19 (lane 2) were used in control transfections. Plasrnid
transfected cells were infected with AcMNPV (m.o.i. of 1) at 6 h post uansfection. then total intracellular DNA was purified at 48 h post infection and digested with DpnI plus
SmaI (lanes 1.2, 3,4. 5, 7) or plus KpnI (lane 6) to linearize the replicated plasmid DNA.
After electrophoresis, DNA sarnples were transferred to Qiagen nylon membranes and
hybridized with 32~-labeled pUC 18 DNA. The DpnI resistant fragments are indicated by
arrows.
two hrs in supporting DNA replication. However, deletions of the hrs in pAcAhrl,
pAcAhr3 and pAcAhrla decreased but did not elirninate their ability to replicate (Fig. 2,
lanes 3. 5, 6) , indicating that these h n were not specifically required for plasmid DNA
replication; other sequences in the flanking regions of hrl. hr3 and hr4a could function as
additional initiation sites. These results also indicated that a disrupted palindrome with a
deletion of EcoEU core site (in pAchr2) or half a palindrome (in pAcAh-5) disabled the
ability of hr palindromes to Function as DNA replication origins, consistent with published
data (Leisy et al.. 1995).
Since hr2 and hr5 were essential for the replication of the plasmid DNA in the
infected cells, they rnight be necessary for the replication of the virus in vivo. To test
whether any hr wiis specifically required in vivo, recombinant vimses carrying different hr
deletions were constructed and tested for the ability to replicate in insect cells. Six groups
of recombinant viruses expressing the ZacZ gene were confmed to carry individual
deIetion in either hrl (AclacZAhrl), hrla (AclacZAhrla), hr2 (AclacZAhr2), hr3
(AciacZAhr3). hr4a (AclacZAhr4a) or hr4b (AclacZAhr4b) (data not shown). As an
expenment control to normalize possible effects of the expressed lac2 gene on the virus
growth, a seventh recombinant virus carrying al1 the hrs plus the lac2 reporter gene
inserted into the virai p l 0 gene region was also constructed (AclacZ4PlO).
Sf2 1 cells were infected with these recombinant viruses (m.0.i. of 0.01) ,and titers
of progeny viruses harvested at either 24 or 48 hours post infection were determined
(Table 1, 2). Each viius titer represents the average results of three infections of each virus
and three plaque assays for each infection. The titer of the budded virus carrying specific
hr deletion was compared with that of Ac1acZA.P 10. The results indicated that deletion of
hrl. hrla. hr4a or hr4b from the viral genome had little or no effect on the production of
budded viruses. while deletion of hr2 or hr3 resulted in a marginal increase in the virus
titer (Table 1, 2). These results demonstrated that none of the hrs was essentid for the
Table 1. Production of progeny budded vituses at 24 hour post infection with hr deletion vimses
hr deletion Assay 1 Assay 2 Assay 3 Mean virus (PFUI~I) x t $ ( PFU~I ) x 1 o3 (PFUI~I) x 103 (PFU~I)XIO~ & ç ~ *
AclacZAhrl 3 7 43.6 35.8 34.2 38.6 40.2 36.2 35.2 36.6 36.5 1.92
AclacZAhrla 40.2 36.8 35.8 29.6 34.8 33.8 41 40.2 34.4 36.3 3 . 7
AclacïAhr2 42.8 41 56 32.4 29.8 35.2 44 42 50 41 -5 8.3
AclacZAhr-3 42 42 54 37 45.4 33 42 39.6 41.8 41 -9 5.8
AclacZAhr4a 37.8 31.6 35.2 46.2 32.6 36.8 27.8 28.4 24 33 -4 6 - 6
AclacïAhr4b 35.8 39 33.8 29.6 34.4 35.8 37 34.4 40.2 35 -6 3.1
AclaZAP10 30.2 35.8 33.6 37.4 29 36.2 38.4 40.2 37.8 35.5 3.6
' SD: standard deviation
Table 2. Production of progeny budded vhses at 48 hour post infection with h r deletion vlluses
hr deletion Assay 1 Assay 2 Assay 3 Mean virus (PFUI~I) x 1 o5 (PFUI~I) x 105 [ P F U ~ I ) x 105 ( P F u i m l ) X r ~ ~ ~ S D *
- - - -
AclacZAhrl 34.2 35 32.6 34.2 24.6 33.6 36.2 22.8 34.2 33 3.9
AclacïAhrla 19.8 22 19.6 3 4 23 27.8 56 44 40 31 -8 12.7
AclacZAhR 38 48.6 37.4 38.4 46.8 37.2 44 26.6 42 39.9 6.52
ActacZAhr3 50 36.2 40.6 40.2 40.6 46.8 46 38.2 33.6 41.4 5.3
AclacïAhr4a 30.6 38 33 30.4 39 37.4 50 34.2 37.4 36.7 5 -9
AclacZAhr4b 28.2 21.8 32.6 29.6 31.4 33.2 36.4 38 40.6 32.4 5.6
AclaZAP10 26.2 29.6 27.8 27 31.6 29.4 38.6 44 44 33.1 7.1
' SD: standard deviation
virus replication in vivo, suggesting that the cis-acting function of hrs in the process of
viral DNA replication is redundant.
hrs can also function as aanscription enhancers of the viral early genes in transient
expression assays (Guarino and Summers, 1986a; Guarino and Summers, 1986b). To
determine whether the deletion of specific hrs affected viral early gene expression,
products of viral early genes were compared arnong recombinant vimses. Cells were
infected with individual recombinant virus, then the infected cells were harvested at 24 h
post infection and totd intracellular protein extracts were prepared. The cell extracts were
analyzed by Western immunoblots probed with the IE-1 monoclonal antibody. The
amount of IE- 1 was used to normalize each sample so that an equivalent arnount of IE- 1
contained in each extract was loaded ont0 each lane (Fig. 3, A. lanes 2 to 8).
Subsequently, blots were snipped and reprobed with monoclonal antibodies against P143,
LEF-3 and P47. The amount of each of these proteins was detected by cherniluminescence
and the intensity of each band was compared with the corresponding band present in the
extract of cells infected with AclacZAP10. The extracts of ce1Is infected with AclacZAhr3,
AclaZAhr4a contained a decreased amount of P 143 (Fig. 3, B. lanes 4, 5). the cells
infected with AclacZAhr2, AclacZAhr3 or AclacZAhr4a had a Iower amount of LEF-3
(Fig. 3. C. lanes 4, 5.6) and cells infected with AclacZAhr? or AclacZAhr3 produced Iess
P47 (Fig. 3. D, lanes 5, 6). In conuast, cells infected with AclacZAhrl, AclacZAhrla.
AclacZAhr4b had no apparent reduction in the production of any of these three early
proteins (Fig. 3. lanes 2, 3,7, 8). Since IE-1 was the nomaiized standard, a change in the
amount of IE-1 would also affect the ratio between IE-1 and P143, LEF-3 or P47.
Nevertheless, the data indicated that even a single deletion of hrs such as the deletion of
hl-2. hl-3 or hr4a had a detectable effect on the viral early gene expression il1 i*iito. and
different hrs appeared to affect early gene expression differently.
Figure 3. Effects of individual hr deletions on products of viral early genes.
Sf21 cells were infected with each recombinant virus (m.0.i. of 1) deleted in a specific h r
or the p l 0 gene: AclacZAhrla (lane 8), AclacZAhrl (lane 7), AclacZAhr2 (lane 6),
A c l a c ~ 3 (lane 5), AclacZlyu4a (lane 4), AclacZAhr4b (lane 3), or AclacZAp 1 O (lane 2).
infected cells were harvested at 24 h post infection and whole ce11 extracts were analyzed
by 10% polyacrylamide gel electrophoresis. After electrophoresis, proteins were electrophoreticaily trans ferred onto the nitrocellulose membranes and pro bed with a
monoclonal antibody against IE- 1 (1 :5,000,000 dilution) followed by anti-mouse antibody
conjugated with horseradish peroxidase (1: 20,000 dilution). The reaction was detected by
chemilurninescence. The same detection procedure was performed after the blot being
stripped and reprobed with monoclonal antibody specific for P 143 ( 1 : 1,000), LEF-3
(1:5,000) or P47 (1: 1000). Results of immunoblotting ce11 extracts frorn mock infected
cells is shown in lane 1 (M).
Antibody
IE-1
P l 43
LEF-3
P47
B. Identification of Alternative Origins of Replication
1. Initiation of DNA Replication by Viral Early Gene Regions
The above results indicated that some hi- flanking sequences could substitute for
hrs as putative ongins (Fig. 2). For example, even though hrl was deleted in pAcAhrl:
replication of this plasrnid was stiil detected (Fig. 2. lane 3). To determine the sequences
responsible for the replication activity, specific regions of pAcAhrl were subcloned and
each individual clone was tested in the standard infection-dependenr replication assay.
Both the left and nght hrl flanking regions contained within the HindIII-F fragment
possessed the ability to stimulate DNA replication (data not shown). A detailed dissection
of the plasmid pAcHE4.3 (the hrl left flanking region) identified two regions that
correlated with the non-hr sequence replication. One contained the complete open reading
frame of the p d 8 gene plus 94 bp of upstream sequence (Fig. 4a. lane 3). while the other
contained the complete open reading frame for the ie-2 gene plus 91 bp of upstream
sequence (Fig. 4a. lane 5). Dunng normal virus infection, both of these genes are
expressed immediately after infection, but are also regulated by ie-l (Guarino and
Summers, 1987; Pullen and Friesen, 1995a; Pullen and Friesen, 1995b). Thus, these
experiments demonstrated that regions other than hrs could stimulate plasmid replication in
virus-infected cells and suggested that the presence of early genes may be responsible for
this property.
Therefore. a number of plasmids canying regions of viral early genes were
constructed or chosen and tested for their ability to stimulate plasmid replication.
Surprisingly. almost al1 plasmids canying viral DNA insens expected to be expressed
early after infection were capable of supporting plasrnid replication (Fig. 5 ) - These
plasmids carried a variety of genes (open reading frames plus their upstream regions)
including the E. coli lac2 gene (dnven by the ie-1 promoter), the early 3%. the apoptosis
repressing gene (p35). the immediate early he65, d~iapol, p143. lef-1. lef-3, lef-4. ~ 4 7 .
Figure 4. Infection-dependent replication of plasmids containing DNA sequences flanking the hrl region.
(a) Sf21 cells were transfected with individual plasmid containing DNA fragments h-om
AcMNPV HindlII-F region flanes 1 to 5). Transfected cells were infected with AcMNPV
(rn.0.i. of 1) at 6 h post transfection, then total cellular DNA was purified at 48 h post
infection and digested with DpriI plus HindlII (lanes 1 and 4) or plus Pst1 (lanes 2. 3. 5).
The hybridization were carried out using the sarne condition as outlined in Figure 2. The
position of the DpnI sensitive bands is indicated on the right side of the figure and the DprzI
resistant, replicated bands are indicated by arrows. (b) The physical location of viral DNA
inserts denved from the HindIII-F fragment is schematically presented. Samples in Figure 4 originated from the same gel as in Figure 2. The conaol samples are presented in lanes 1
and 2 of Figure 2
Hindlll Pstl hrl
Scal Pstl EcoRl
Figure 5. Regions containing viral early genes can serve as origins of plasmid DNA replication.
Sf21 cells were transfected with pAchr2 (lane 1). pBSK' (lane 2). pBR322 (lane 3).
pUC19 (lane 4), pIE1-lac2 (lane 5). pAc39K (lane 6). pAcp35 (lane 7), pAcHE65 (lane 8), pAcdnap (lane 9). pAcp143 (lane IO), pAclefl (lane 1 1). pAclef3 (lane 12). pAclef4
(lane 13). or pAcp47 (lane 14) and infected with AcMNPV as described in Figure 2. Total
intracellular DNA was purified and digested with SmaI (lanes 1, 2. 4, 5, 6, 9). PstI (lanes
3. 7. 8, 10, 1 1. 13) or HirldIII (lanes 12, 14) to linearize the total intracellular plasmid
DNA (except pAcp143, lane 10, which has two PstI sites. only the 6.3 kb hybridized) (-
DpnI) or with the same restriction enzymes plus DpnI (+DpnI) to identify replicated
plasrnid DNA. Blotting and hybridization conditions were the same as outlined in Figure 2.
+ Dpnl
- Dpnl
p43 and gta AcMNPV genes (Fig. 5, lanes 5 to 14). The plasrnids used as vectors in the
cloning experiments and which did not carry any viral sequence (PBSK-, pBR322 and
pUC19) were completely negative in the replication assay (Fig. 5, lanes 2 to 4). These
data strongly implicated viral sequences other than hrs which could serve as origins of
replication. The arnount of DpnI-resistant plasrnid DNA varied considerably among the
panel of plasmids used but so did the size of these plasmids. Because larger plasmids
rnight be expected to replicate fewer copies than smaller plasrnids within the same time
period. it was important to determine the initiation eficiency of replication regardless of
plasmid size. Assuming that once DNA replication had initiated. it would continue to
replicate the entire plasmid at a constant rate. Thus, the efficiency of initiation was the
cntical parameter that needed to be exarnined. The replication process was therefore
separated into two steps: initiation and elongation (Table 3). The initiation efficiency (KI)
was expressed as the ratio of initiated (Ro) to uninitiated DNA (U), K1 = [ROI / [U]. The
rate of elongation (KZ) was expressed as the ratio of fully replicated DNA (R) to initiated
DNA (Ro), K2 = [RI / [ROI. Because the rate of replication. once begun. would be
independent of initiation and simply be a function of the length of the DNA to be replicated
(kb) and the supply of essential protein factors necessary for replication (0. K2 would
equal " f " divided by the length of the replicating template (K2 = f / kb). The total
intracellular concentration of each plasmid DNA after replication [Tl would equal [U] plus
[RI. Therefore, K1 = (R kb) / [f (T - R)]. The values for [RI (linearized DprI resistant.
replicated plasrnid) and [Tl (linearized total inh-acellular plasmid DNA including rep licated
and unreplicated plasmids) were determined by densitometer analysis of a variety of
different exposures of three separate replication assay films including those shown in
Figure 5. K1 for each plasmid was calculated for each experiment and averaged assuming
(0 to be 1.0 for a rn.0.i. of 1. The replication efficiency (Kl) of the reporter plasmid
pAchr2 was standardized as 100% and al1 other plasmid KI values were compared with
this value (Table 3). The results of this analysis show that plasmids canying sequences
Table 3. Determination of replication initiation efficiency following standard replication assay
Viral Eady Assay 1 Assay 2 Assay 3
Plasmid ORF* ?romotert kb [R] [q [RI [Tl [RI m K I ave Oh hR
(ha p43. p47, gta
pl43
dnapol
35k
lef-3
lef-4
ie- 1
he65
ie-2
P338
39k
lef- 1
pBR322 4.4 0.00 >IO0 0.00 >IO0 0.00 >IO0 0.00 0.00%
open reading frarnes contained within the viral DNA insert and designated by nurnbers (Ayres el al., 1994).
t promoten located within the viral DNA insert
K 1 ave: average K 1 value calculated from three different replication assays
including Zef-1, pe38.39K and ie-2 replicated at low but detectable Ievels ( l e s than 5% of
the reporter), and plasrnids carrying the he65 gene or the ie-1 promoter replicated at about
1520% of the reporter. Plasmids carrying the lef-3,lef-4, p35 or dnapol genes replicated
with efficiencies between 33-788 of the reporter. Plasmids carrying the pl43 p n e or a
region containing the p47, p43 and gta gene promoter regions replicated as efficiently or
better than the reporter plasrnid. These results clearly indicated that sequences including
viral early genes can efficiently function as DNA replication initiation sites.
2. Initiation of DNA Replication by the ie-I Promoter Region
To identiQ functional domains associated with the ability of early genes to
stimulate DNA replication, one of the replicated plasmids, pIE 1-lac2 was analyzed in
detail. pIEl-lac2 was subcloned into two plasrnids. pIE1-P(CH) and placZ(0RF).
pIE1-P(CH) contained only the 558 bp upstream region of the ie-1 gene, from -546 to +
12 including the transcriptional starting site at + l . while placZ(0RF) lacking the ie-1
promoter region contained the rest part of plEl-lacZ, including the ORF of lac2 gene.
Both plasmids were transfccted into insect cells and tested for the ability to support
plasrnid DNA replication in the presence of virus infection. pIE 1-P(CH) clearly replicated
(Fig. 6a. lane 3), while placZ(0W) did not (Fig. 6a. lane 7). demonstrating that DNA
sequences found within the ie-l promoter region could act as replication initiation sites. To
identify functional motifs within the ie-1 promoter region. a series of plasrnids containing
deletions of the ie- l upstream sequence were constructed (Fig. 6b) and tesred in the
replication assay. Replication of subclones individually containing only one of the five
regions demonstrated that any of these individual regions could suppon DNA replication
but did so weakly (Fig. 6a. lanes 7, 1 1- 14). In contrast, subclones pIE1-P(CS) and
p E 1 -P(NH) replicated almost as efficiently as the whole promoter plasrnid PIE 1 -P(CH),
suggesting replication efficiency increased with increasing size of the promoter region.
Figure 6. The ie-I promoter region can serve as an origin of plasmid DNA replication.
(a) Infection-dependent replication of plasmids carrying AcMNPV ie-l gene promoter
region and its subdomains. Sf2 1 cells were transfected with PIE 1-(CH) (lane 3).
p[E 1 -P(CS) (lane 4), PIE 1-P(CA) (lane 3, pIE 1-P(CP) (lane 6), pIE 1-P(CN) (lane 7).
p E 1-P(NH) (lane 8), pIE 1-P(PH) (lane 9). PEI-P(AH) (lane IO), pIE1-P(SH) (lane 1 l),
pIE1-P(NP) (lane 1 3 , PIE 1-P(PA) (lane 13). plEl-P(AS) (Iane 14), pBSK- (lane 1). or
placZ(0RF) (Iane 2) and infected with AcMNPV as described in Figure 2. Total
intracellular DNA was purified and doubly digested with DpnI plus SmaI (lanes 1, 2) or
XmnI (lanes 3 to 14). Blotting and hybridization conditions are outlined in Figure 2. The
DpnI resistant fragments are indicated on by arrows. (b) Restriction map of the 558 bp ClaI
- HincII fragment containing the ie-l promoter region and the location of the five domains
(1-V) tested in the replication assay are shown. The relative intensity of each DNA band on
X-ray films was measured using the public domain computer program NM Image (version
1.54). Numbers of "cg' represents differences in folds.
b.
Nhel Puvll Afllll S s ~ l Hincll
Size (kW
3.3
3.0
2.7
2.8
2.5
3.1
2.8
2.9
2.2
2.6
2.3
2.6
Replication eff iciency
tl-t
* u
t t
+ +ft
u
* * t t
+ 4
These data indicated that viral early promoter regions could be one of the sequences
responsible for the initiation of plasmid DNA rep lication.
C. Replication of Plasrnid DNA in Cotransfected Cells
One of the earliest attempts to identify origins of DNA replication in baculovims
was to comnsfect insect cells with viral DNA and plasmids carrying different viral DNA
fragments (Guarino and Surnmers, 1988; Yu, 1990; Kool er ni., 1994a; Lu and Miller,
1995). It has been observed that plasmids even in the absence of any insened virai
sequence can be replicated when cotransfected with the viral DNA into Sf21 cells (Yu.
1990; Kool er al., 1994a; Kool et al., 1995). The basis of this plasmid DNA replication is
unknown although it has been speculated that replication may result from the acquisition of
h r sequences following cotransfection (Kool et al., 1995). Another major question derived
from this observation is related to ciifferences in the specificity of plasrnid replication in
conansfected versus infected cells. It is paradoxical that in vims infected cells, plasmid
replication is dependent upon the presence of hrs. regions within HidIII-K or early gene
regions as demonstrated above, whereas in the cotransfected cells, replication of plasmid
DNA appeared to be independent of any specific viral sequences.
1. Plasmid Replication is Independent of Specific Viral Sequences
To investigate the possible reasons that lead to the replication of plasmids in the
cotransfected cells, pUC18, pBSK- or pBR322 was cotransfected with viral DNA into
insect cells. DpriI assays were conducted on samples harvested at 48 h post
cotransfection. The relative replication efficiency of each plasmid was estimated from the
intensity of the hybridization bands on the Southem blot usine the method descnbed
above. For cornparison, the replication of a hr-5-containing plasmid, pAchr5. in the
cotransfected cells was included in the assays. The results demonstrated that pUC19.
pBSK- and pBR322 replicated as efficiently as pAchr5 (Fig. 7, lanes 5 to 12). Since these
vectors did not carrying viral DNA sequences, the fact that they replicated suggested that
Figure 7. Relative replication efficiency of plasmid DIVA in cotransfected insect cells.
Sf21 cells (106) were cotransfected with 0.5 pg of AcMNPV DNA plus 0.5 pg pUC19 (lane 7, 8) or plus equai molar amounts (as pUC19) of pAchr5 ( lane 5. 6). pBSK- ( lane
9. 10 ), pBR322 (lane 11, 12). As experiment controls, the cells were transfected with 0.5 pg AcMNPV DNA (lane 1, 2) or 0.5 pg pUC19 (lane 3, 4), respectiveIy. Total
intracellular DNA was purified after 48 h post cotransfection or transfection and digested
with EcoRI (lanes 2, 4. 6, 8. 10, 12) or EcoRJ plus DprzI (lanes 1, 3, 5, 7, 9, 11). After
electrophoresis, DNA samples were aansferred to Qiagen nylon membrane and hybridized
with 32~-labelled pUC18 DNA. Lambda DNA HirtdIII fragments were used as the
molecular weight markers (kb).
1 Cotransfection with AcNPV DNA
AcNPV PUC pAchr5 PUC pBSK pBR322
+ - + - + + + - + - kb
Dpnl
initiation of plasmid DNA replication in cells cotransfected with viral DNA is different than
in cells infected with virus.
To exclude the possible involvement of hrs in the replication of plasrnid DNA
following cotransfection, a plasmid, denved from pUCl8 where the EcoRI site was
deleted, was constructed (pUCl8AE) and used in cotransfection experiments. If the
replication of pUCl8AE involved the acquisition of his. an essentid EcoRI core site from
h r would be regenerated in pUCl8AE, and possibly accompanied by a size change of the
plasmid DNA. The results reveded that t!!e replicated pUC18AE DNA was resistant to
EcoRI digestion, while linearization of plasmid DNA by PstI resulted in a 2.7 kb band.
indicating that no acquisition of a hr sequence had occurred (Fig. 8). The possible
involvement of other viral sequences in the replication of pUC18AE was also exarnined.
The total intracellular DNA from pUC18AE and viral DNA cotransfected cells was
digested with HLidIII. PstI. SmaI or BamHI. These enzymes were chosen because they
al1 can linearize pUCl8AE into a unit length 2.7 kb fragment. When digested with DpiI
plus these enzymes. the replicated plasrnid DNA did not have detectable change either in
the restriction fragment pattern or DNA size (data not shown). Taken together, the above
results indicared that specific viral sequences were not involved in the initiation of the
plasmid DNA replication in conansfected cells. However. viral genomic DNA was
required for replication. In the absence of viral DNA. plasmid DNA replication was
abolished (Fig. 7, lanes 3, 4). Presumably the viral genomic DNA expressed viral factors
that were essentid. il, tram, for plasmid DNA replication.
2. Plasmid Replication Depends Upon Viral Genes
The above presumption about the role of the viral DNA in providing replication factors
was tested. It would be possible to use cloned viral DNA fragments that express
replication factors to substitute viral genomic DNA in the cotransfection expenment. The
transient expression of the essential viral replication genes from cloned viral fra, =men ts
Figure 8. Replication of plasmid DNA was not due to acquisition of hrs.
SE1 cells (106) were cotransfected with 0.5 pg of AcMNPV DNA plus 0.5 pg pUC18AE
(lanes 1, 2). Total cellular DNA was purified after 48 h post cotransfection and digested
with DpnI plus Pst1 (lane 1) or EcoRI (lane 2). After electrophoresis, DNA sarnples were
transferred to Qiagen nylon membrane and hybridized with 32~-~abe11ed pUC 18 DNA. The
membrane was stripped and reprobed with 32~-labelled AcMNPV DNA. Lambda DNA
HiirdIIl fragments were used as the moiecular weight markers (kb).
Pstl EcoRl Pstl EcoRI
probe: pUC18
would mimic viral genomic DNA in supporting plasmid DNA replication in the
cotransfected cells. Therefore, eight clones containing viral sequences coding for
baculovirus replication genes, including the ie-I. p143. dtlopol. Ief-1. lef-2, lef-3, p35
genes as well as two stimulatory ie-2 and pe38 genes, were used to substitute for viral
pnornic DNA in cotransfection experiments. Because ai i these viral replication genes were
cloned behind their native early promoters, these genes would be transiently expressed
when cotransfected together into insect cells (Kool et al., 1995). Cells cotransfected with
these plasmids plus pUC19 were harvested three days post cotransfection. Total
intracellular DNA was punfied and digested with DpnI. Ir revealed pUC19 replication in
the presence of al1 these genes (Fig. 9, lane 3). Subtracting the stimulatory ie-2 and pc38
genes from the cotransfection mixture did not abolish pUC19 replication although it was
decreased (Fig. 9, lane 11). Removing any one of the essential genes (the rnissing DNA
bands in Fig. 9, lanes 4 to 10, -DpnI) from the cotransfection mixture eliminated plasmid
DNA replication (Fig. 9, lanes 4 to IO), indicating that the replication was not dependent
on any specific viral factor. Rather, replication was supponed by and dependent upon the
presence of a11 seven viral replication factors. In addition, along with the replication of
pUC19, the cotransfected plasmids carrying viral replication genes also replicated (Fig 9.
lanes 2. 3, 11 ), consistent with the replication of multiple sequences in the cotransfected
cells (Fig. 7). In control sarnples. when the cells were transfected with only pUC19 (Fig
9, lane 1) or cotransfected with eight clones in the absence of pUC19 (Fig 9. lane 2). no
DpnI resistant band with the size of pUC19 DNA was detected. These results sitggested
that the DpnI resistant pUC19 band detected in the presence of viral replication essential
genes was not a byproduct from the recombination of the cotransfected plasmids.
D. Conformation of the Replicated Plasrnid DNA in Cotransfected Cells
It has been suggested that baculovirus may use a rolling-circle mechanism to
replicate its genome because plasrnids containing hrs were replicated into high molecular
Figure 9. Replication of plasmid DNA was dependent on products of viral replication genes.
Sf2 1 cells (106) were cotransfected with 1 pg pUC19 plus eight plasmids each expressing
a different viral replication gene (0.5 pg pAcIef3 plus equal molar amounts of pAcie1,
pAcdnap, pAcp 143. pAclef1, pAclef2, pAcp35, pAcie2pe38) (lane 3). The assays were
also carried out in the absence of one of the plasrnids expressing an essentiai viral product.
The subtracted plasmid was pAcie 1 (lane 4), pAcdnap (lane 5). pAcp 143 (lane 6). pAclef 1
(lane 71, pAclef2 (lane 8). pAclef3 (lane 9). pAcp35 (lane 10). or pAcie2pe38 (lane 1 1). As
a conaol, Sf21 cells were also uansfected with 1 pg of pUC19 (lane l), or cotransfected
with only the eight plasrnids expressing replication genes (using the same amounts of DNA
as in lane 3. minus pUC19) (lane 2). The total cellular DNA was purified after 72 h post
transfection or cotransfection and digested with DpnI plus EheI (+ DpnI, lanes 1 to 11) to
Iinearize the replicated plasmid DNA (except pAcIef3) or only digested with EheI (-DpnI,
lanes 1 to 1 1). After electrophoresis. DIVA sarnples were transferred to Qiapn nylon
membrane and hybridized with 3*~-labeled pUC18 DNA. Lambda DNA HirrdnI fragments
were used as the molecular weight markers (kb).
dl i- pUC al1 + pUC
minus
laf3 ie&:.eJ8
minus
al1
+ Dpnl - Dpnl
weight concatemers in virus infected cells (Leisy and Rohrmann, 1993). The concatemenc
structure of the replicated DNA has been used as an indicator for the baculovirus
replication machinery (Martin and Weber, 1997b). To c o n f m that in the cotransfected
cells. plasmid DNA was indeed replicated by the viral replication machinery, the structure
of the replicated pUC19 DNA was examined.
1. High Molecular Weight, Concatemeric Structure of the Replicated Plasmid D N A
Total intracellular DNA from pUC19 and viral DNA cotransfected cells was
digested with DpnI plus different restriction enzymes. HiridIII or Pst1 digested the
replicated plasmid DNA (DpnI resistant) into a 3.7 kb fragment, cornigrating with the
EcoRI digested input pUC19 (Fig. 10. lanes 3.4.5). When digested with only DpA, the
replicated plasrnid DNA rnigrating near the position of the undigested virai genomic DNA
(Fig. 10, lane 6). In cornparison, the undigested input pUC19 DNA (Fig. 10. lane 2)
mignted in the supemoiled ( III ) and relaxed ( 1 ) forms. These results suggested that the
replicated plasrnid DNA might be replicated into high molecular concatemers. To test this,
the total intracellular DNA were digested with DptrI. panially digested with SmuI and
hybridized by southern blotting using a plasmid probe. The hybridization detecred
fragments with sizes around 2.7.5.4, 8.1 and 10.7 kb, suggesting that replicated pUC19
DNA contained multimers including dirners, trimers or temmers (Fip. 1 1).
2. Integration of the Replicated plasmid DNA into Viral Genome
Given that the DpA resistant pUC19 DNA. when undigested with other enzymes,
always comigrated with undigested viral genomic DNA (Fig. 10, lane 6). it was possible
that some pUC19 DNA molecules might integrated into the viral genome. To test this
possibility, total intracellular DNA from pUC19 cotransfected cells was digested with
N d , EagI or M i d . These enzymes were chosen because they digest only the viral
genomic DNA but not the pUC19 DNA. If pUC19 DNA was integrcired into the viral
Figure 10. Conformation of the replicated plasmid DNA following cot ransfection of Sf21 cells.
Sf21 cells were coûansfected with 0.5 pg of AcMNPV DNA plus 0.5 pg of pUC19 (lanes
4 to 9). The total intraceliular DNA was purified after 48 h post cotransfection and digested
with Dpji I (D, lane 6) or DpnI plus HindIII (D+H, lane 4), PsrI (D+P, lane S) , Nor1
(D+N, lane 7), EagI (D+Ea, lane 8), M h I @+M. lane 9). As a control, 1 pg of puRfied.
undigested input AcMNPV DNA (U, lane 1). and 200 pg of undigested (U, lane 2) or
EcoRI digested (E, lane 3 ) input pUC19 were included. After electrophoresis, DNA
samples were transferred to Qiagen nylon membrane and hybridized with 32~-labeled
pUC18 DNA. After the exposure shown on the left, the membrane was stripped and
reprobed with 32~-labeled AcMNeV DNA. Lambda DNA HhdIII fragments were used as the molecular weight markers Rb).
I t $ / 2.! 1 total cellular DNA total cellular DNA
(AcNPV + pUC19)
1 2 3 4 5 6 7 8 9
Probe: pUC18
1 2 3 4 5 6 7 8 9
Probe: AcNPV-DNA
Figure 11. Structure of the replicated plasmid DNA in cotransfected S R I cells.
Sf2 1 cells were cotransfected with 0.5 pg of AcMNPV DNA plus 0.5 yg pUC19. The total
inmacellular DNA was purified after 48 h post cotransfection and completely digested with
DpnI. then partidly digested with SmaI for 15 min, using increasing arnounts of SmuI as
labelled (lanes 1 to 9). After electrophoresis, DNA samples were transferred to Qiagen
nylon membrane and hybndized with 32~-labeled pUCI8. AcMNPV DNA Pst1 fragments
were used as the molecular weight markers (kb).
(Units)
Smal
+ Tetramer (10.7kb)
a+-- Trimer (8.1 kb)
Dimer (5.4kb)
a+ Monomer (2.7kb)
genome. digestion of viral DNA would release pUC 19 DNA from the viral genome. The
released pUC19 DNA would have a different size than its integrated form. This size
change could be detected by gel electrophoresis. On the other hand, if the replicated
pUC19 DNA was isolated from the viral DNA, digestion of viral DNA would not affect
pUC19 DNA. The results revealed that the replicated pUC 19 DNA rnigrated as a smear
ranging from around 4 kb to above 20 kb after digestion (Fig. 10, lanes 7, 8, 9),
suggesting that significant amounts of replicated plasrnid DNA molecules could be
integrated into the virai genomic DNA. Since no particular band of plasmid DNA formed
after digestion, the integration rnay occur at multiple sites around the viral genome or the
integrated pUC 19 DNA may have different sizes or, both.
If integrated, the replicated pUC 19 DNA could be packaged with the viral genomic
DNA into progeny virions. Therefore, the budded viruses produced from the cells
cotransfected with virai DNA plus pUC 19 were harvested and serially passaged undilutely
or by using different multiplicity of infections (from m.0.i. of 0.01 to 10). The viral DNA
from each virus passage was purified. digested with SrnaI and anaiyzed by southern blot
hybridization for the presence of the pUC 19 DNA. A 2.7 kb fragment was detected in al1
viral DNA samples (Fig. 12. lanes 3 to I l), indicating the presence and retention of the
integrated pUC19 DNA within the progeny vinons. In addition. a weak smear of high
molecular weight DNA appeared in each lane of the digested viral DNA. These smears
were likely caused by shon fragments of pUC 19 DNA that was still remained on the viral
DNA after SmaI digestion.
The integration of pUC19 DNA into viral DNA was further confirmed by
restriction digestion and southem blotting anaiysis of the passage 3 (P3) virion DNA (Fig.
13). Restriction enzymes NotI, EagI and MlrcI were used to specifically digest the viral
DNA as mentioned above. After digestion, the replicated pUC19 DNA formed smears on
the gel (Fig. 13, lanes 9, IO), indicating possible integration of the pUC 19 DNA with the
viral DNA. Funhermore. when digested with Sse8387I, a restriction enzyme that
Figure 12. Detection of replicated plasmid DNA in progeny budded virus
particles.
Sf2l cells (106) were cotransfected with 0.5 pg of AcMNPV DNA plus 1 pg of pUC19.
Progeny vinises (lane 3) were harvested at 72 h post cotransfection. then serially passaged
four times (lanes 4, 5, 6, 7) or passaged by using different arnounts of v h s e s (rn.0.i. of
10, lane 8; m.0.i. of 1, lane 9; m.0.i. of O. 1, Iane 10; m.0.i. of 0.0 1, lane 1 1). Budded
virions from each passage supernatant were purified by sucrose gradient centrifugation, the
virion DNA was punfied and doubly digested with SmaI plus DpriI (Ianes 3 to 1 1).
Following agarose gel electrophoresis, the fragments were blotted ont0 Qiagen nylon
membrane and hybndized with 32~4abeled pUC18 probe. SmaI digested plasrnid pUC18 (lanes 1) and SrnaI digested pAchr5 (lane 2) were included as the molecular weight markers
and hybridization controls. The bottom arrow indicates the S m d linearized pUC19 DNA
contained in viral DNA (2.7 kb), whereas the top arrow indicates that short fragments of
the digested pUC19 DNA possibly linked with the viral DNA.
AcNPV + pUC19
height moleculat weight DNA hybridized
+- pUCI9 DNA
Figure 13. Conformation of plasmid DNA packaged into virions.
The passage level three virion DNA, prepared from AcMNPV DNA plus pUC19
cotransfection, was purified and digested with EcoM (E, lane 4). HindIII (H, lane 5) , P sr1
( P . lane 6) . Nor I ( N , lane 8)- EagI (Ea, lane 9), MluI (M. lane 10). Sse8387I (Se, lane
1 l), Sse8387I plus MhiI (M+Se, lane 12), or undigested (U, lane 7). As controls, 1 pg of purified input AcMNPV DNA (lane 1) and 20 pg of undigested (lane 2) or EcoRI digested
(lane 3 ) pUC19 were included. After electrophoresis, DNA sarnples were transferred to
Qiagen nylon membrane and hybridized with 32~4abeled pUC 18 DNA (the left figure).
The membrane was smpped and reprobed with 32~-labeled AcMNPV DNA (the right
figure). Lambda DNA HiridIII fragments were used as the molecular weight markers (kb).
1 2 3 4 5 6 7 8 9 1 0 1 1 1 2
Probe: pUC18
> 01
O a
AcNPV+pUC19 > puci9 L (P3 virion DNA) 5 1 1 M+
1 2 3 4 5 6 7 8 9 1 0 1 1 1 2
Probe: AcNPV-DNA
pUC19
U
AcNPV+pUC19 (P3 virion DNA)
E E H P U N E a M S e S e M+
specificdy cuts only pUC19 DNA but not the viral DNA, the replicated pUCI9 DNA was
resolved into a 2.7 kb fragment plus a high molecular weight DNA band (Fig. 13. lane
1 1). If isolated from the viral DNA. the replicated pUC19 DNA would be resolved into
only one 2.7 kb fragment. Therefore, the appearance of the extra hgh molecuIar weight
DNA band indicated high molecular weight DNA fragments carrying virai and short
plasmid sequences. To confirm the extra high molecular weight DNA band contained viral
DNA, the Sse8387I digested viral DNA was hrther digested with M i d , an enzyme that
digests viral DNA but not pUC19 DNA. The results showed that MluI digestion resolved
the high molecular weight DNA band into a much weaker srnear of DNA bands (Fig. 13.
lane 12), demonstrating that this high molecular weight DNA band consisted of viral DNA
c a q i n g fragments of integrated pUCL9 DNA. This smear also suggested that the
integration sites of pUC19 DNA were possibly dispersed around the viral genome since
no particular DNA band fonned after MlrtI digestion.
The structure of the integrated pUC19 DNA was further examined. Because
digestion of P3 viral DNA with a single enzyme such as EcoRI. HNtmTI or Pst1 released
an intact 2.7 kb p K 1 9 DNA fragment (Fig. 13, lanes 4 to 6). it was possible that some
of the integrated pUC 19 DNA might be in a concatemeric form. Thus. the P3 virion DNA
was panially digested with SmaI using the sarne condition as descnbed in Fig. I 1. pUC 19
DNA fragments of around 2.7. 5.4 and 8.1 kb were detected. suggesting that the p K 1 9
sequences were integrated as concatemers (.Fige 14).
In an attempt to locate the integration sites of pUC19 DNA on the viral genomr,
passage 3 viral DNA was digested with M M to release fragments carrying the integrated
p K 1 9 DNA. The MluI digested viral DNA was then religated. transformed into E. coli
DHSa to selectively ampli@ viral sequences carrying pUC 19 DNA. Recombinant colonies
were selected in the presence of ampicillin (Fig. 15). Each clone should contain viral insert
and a copy of the integrated pUC19 DNA. Thus. the junction sites between the viral DNA
and pUC19 could be mapped by digestion of the cloned DNA with a restriction enzyme
Figure 14. Structure of plasmid DNA integrated into virion DNA.
The passage level three virion DNA, packaged fiom AcMNPV DNA plus puCl9 cotransfection. was purified and partially digested with SmaI for 15 min, using different
amounts of SmaI as Iabelled (lanes 1 to 8). After elecuophoresis, DNA samples were
transferred to Qiagen nylon membrane and hybndized with 32~-labeled pUC18 DNA.
AcMNPV DNA Pst1 fragments were used as the molecular weight markers (kb).
0.0 2.4 (Units) Smal
* Trimer (8.1 kb)
* Dimer (5.4kb)
Monorner (2.7kb)
Figure 15. Strategy for mapping junction sites of pUCl9 to viral DNA.
The HpaII restriction map of pUC19 is shown on the top. pUC19 is presented as a
concatemer. The rnap between two vertical, dashed lines represents one unit of the pUC19
concatemer. The starting nucleotide (number 1) is defined as the first T in
TCGCGCGTITC of pUC19 sequence. The approximate locations of primers used for
DNA sequencing are indicated by black (F22 and Ml 3R) and white (M 13F and R 10 15)
triangles. The left- or right-ward direction of these hiangles indicates the direction of DNA
sequencing h m these primers. The replication origin (on), multiple cloning site (white
box) and the arnpicillin resistant gene (Apr, leftward arrow bar) are indicated. Beneath the
pUC19 map is an exarnple of integration of pUC19 DNA into the viral genome. The
presumed recombination may occur in the HpaiI-D region of pUC19 DNA. To map the
integration sites. the viral DNA (the fine and dashed linesj canying intepted pUC19 DNA
(the bold line) was digested with M M (M), religated and introduced into E. coli. Bacterial
colonies were selected in the presence of arnpicillin. From these colonies plasmid DNA was
punfied, digested with HpoII and separated on polyacrylamide gel. The junction sites
between pUC19 and the viral DNA were identified by analyzing the pattern of the HpoII fragments on the gel. A missing HpaII fragment such as a missing "D" fragment in this
example would indicate possible insertion of viral sequences. The junction sites were then
mapped by sequencing from adjacent primers such as M13R or F22 in this case.
1 integration
Mlul digestion
I re-ligation
transformation
digestion with Hpal l
1. pUC19: Hpal l digestion
2. pUC19 carrying viral insert: Hpall digestion
such as HpaII. which cuts the plasrnid at many sites. Insertion of viral DNA into any
HpaII fragment of the pUC19 DNA would likely cause a DNA size change and this
change could be detected by gel electrophoresis (Fig. 15). Fifty vansformants were
selected and the plasmid DNA was purified, and digested with HpaII. Twenty out of the
50 clones revealed a missing (possibly shifted) Hpan A, B. C or D fragment, and other
three (pM5, pM7 and pM25) showed two missing bands, either the HpaII D and A, B and
H or D and H fragments (Fig. 16), indicating that the junction sites between pUC19 DNA
and AcMNPV DNA were likely located within these HpaII fragments. In addition, two
plasmids (pM33 and pM40) rnay lack the HpaII-H fragment because of a decreased
intensity of the corresponding DNA band on the gel. The HpaII-H and -1 fragments have a
sirnilar molecular weight and formed only one supermolar band on the gel. Thus, a
decrease in the intensity may suggest that one of these two fragments was missing.
Because the H p d - I fragment is located in the ampicillin resistant gene region, which was
unlikely disrupted by insertion (the clones were selected in the presence of ampicillin), the
viral insens were likely in the HpaII-H region. For the rest of the 50 clones. the junction
sites could not be determined by this approach because every HpaII fragment was present
on the gel. If the integrated pUC19 DNA contained in these clones was multimers. these
plasmids would carry repeated copies of HpaII fragments. Therefore, the insertion of viral
DNA into a HpaII fragment would not eliminate any phcular HpuU fiagrnent on the gel.
The junction sites between pUC19 DNA and viral DNA on eight (pM2, pM3,
pM7, pM8, pM12, pM20, pM27, pM46) of these clones were further mapped by
sequencing plasmid DNA using four different primers corresponding to the pUC19
sequence (Fig. 17). The primer M13F (M13/pUC forward primer, from nucleotide
number 364 to 386) and RI015 (from nucleotide number 1035 to 1015) were used to
sequence the region between nucleotides 387 and 1014, whereas the primer M13R
(Ml 3/pUC reverse primer. from nucleotide number 500 to 478) and F22 (frorn nucleotide
number 2 to 22) were used to sequence the region between nucleotides 23 to 477.
Figure 16. HpaII restriction mapping of viral insects on recombinant plasmids.
Recombinant plasmids punfied from 50 selected colonies were digested with HpaII. then
separated on 5% polyacrylarnide gel at 50 V for 3 to 5 h. After electrophoresis, each gel
was stained with ethidium bromide for DNA detection. The migration positions of pUC19 HpaIl fragments and the relative sizes of these fragments are indicated at the left and npht
of each figure. The missing HpaII fragment or fragments detected in each lane are indicated (upward amows) at the bottom of each figure.
t t t t t t t ? A D D A C B B C D
t f t t t t t ? A H C B A D B D
Figure 17. DNA Sequence analysis of the junction sites of pUCl9 to viral DNA.
(a) Strategy for sequence analysis. The HpaIl resmction map of pUC19 is shown on the
top. Below the pUC19 map is shown maps of recombinant plasmids that were detected by
HpaII digestion to carry viral inserts. The possible locations of viral insens on these
plasmids are indicated by downward arrows. The dashed lines indicate regions being
sequenced for the junction sites of pUC19 to viral DNA. The short lines with mowheads
indicate pnmers and directions of sequencing. (b) Nucleotide sequences identified at the
proximity of the junction sites. Each nucleotide sequence is presented as a continuous
sequence in the direction of 5' to 3' Oeft to right direction). The name of each plasmid and
the corresponding primers used for sequencing are indicated at the beginning of the
sequence. Starting from the pUC19 sequence, each identified viral DNA sequence is shown as undertined letters. Positions of the junction nucleotides are indicated by the
numbers above each sequence. These numbers represent the positions of the junction
nucieotides on pUC19 or the AcMNPV genome (Ayres et al., 1994). The bold letters
represent insertion elements which are not aligned with either pUC19 or the viral DNA
sequence. The numbers between slash lines represent numbers of continuous sequences
(nt. nucleotides) which are not presented due to space tirnit.
K L J 1 i b - - -7- - - - - I G I I F I C I l I I I E 1 A
€03 622 CATCGTTGCCAACAA TTTCCAGTCGGGAAACCTGT
The results of the sequencing analysis are summarized in Fig. 17b. Sequencing by these
prirners identified two junction sites on each plasmid. In most junction sites. the pUC19
sequences were followed immediately by AcMNPV genomic DNA sequences frorn either
the (+) or (-) strand. Locations and orientations of these junction viral sequences were
precisely mapped on the viral genome. The predicated integration sites of pUC19 on the
viral genome are illusuated in Fig. 18. In pM12, pM2 and pM20, the two ends of the
pUC19 DNA were linked with different regions of viral DNA which were separated by
around 15 to 50 kb. If integrated into the viral genorne. pUC19 DNA may replace viral
genomic regions between the two integration sites; therefore, the integration may cause
deletions of large genomic regions. In pM8, pM3 and pM27, the pUC19 DNA were
linked with relatively small viral genomic fragments, ranging from 10 kb to 30 kb,
suggesting that pUC19 DNA may form chimencal molecules with these viral sequences.
In pM7, sequencing from the Ml 3F primer identified a viral sequence of 407 bp (frorn
nucleotide 46861 to 47267 of AcMNPV genome) inserted at the position between 478 and
603 of pUC19 DIVA and there was no MIuI site within this 407 bp region. However.
judged from the size of 7 to 8 kb and the fact that there was a Mhd site on pM7 plasmid
(data not shown), pM7 likely carried another unidentified viral insert. In pM46, the two
junction sites were located at the nucleotide 128746 and 74046 on the viral genome, and
the junction viral sequences in both regions were in the direction of the (+) strand of the
viral genome. Because the DNA was sequenced from two different directions using the
primer M13F and R1015, it suggested that sequences within pM46 may have gone
through inversion during recornbination. The actual regions of inversion on the viral
genome can not be predicated from the sequence data.
Cornparison of the sequences around the integration sites did not revenl any
consensus sequences, and no obvious homology was found between the pUC19 and
AcMNPV DNA at the vicinity of the junction sites. In some cases (pM7, pM8, pM12,
pM20, pM27). short sequences were inserted between the pUC19 and viral DNA
Figure 18. Prediction of sites of integration of pUCl9 DNA into the viral genome.
The complete linear. EcoRI restriction map of AcMNPV genome is shown on the top.
Below are predicted defective gnomes due to possible integration of pUC19 DNA into the
viral genome. The predicated genomes are labelleci with the narne of the corresponding
plasmids on which the junction sites from p K 1 9 to viral RNA were determined. The
junction sites between pUC19 and the viral DNA are indicated by the numbers attached to
the junction sites. These numbers represent positions of the junction nucleotides on the
standard AcMNPV genome (Ayres et al., 1994) or pUC19 DNA. In pM7, the dashed lines
represent that some unidentified viral sequences may also present on this plasmid (see tex1
for detail).
AcNPV genome
I l ' a ' k b
O 0.5 10 1 .S 20 2 5 2.7
(Fig. 17b). These sequences did not align with pUC19 or the viral DNA; the ongin of
these sequences was unknown.
To search for any possible conserved feature at the junction sites, eight more
plasmids (pM5, pM9. pM22. pM25, pM33, pM38, pM38. pM45 and pM48) were
sequenced usine the primer M 13F or M 13R (Fig. 19). The sequence data are presented in
Fig. 19b. No consensus or homologous sequences were identified at the junction sites.
consistent with previous observations (Fig. 17). As well. short DNA sequences of
unknown ongin were inserted at the junction between pUC19 DNA and the v d DNA on
sorne plasmids (pM9. pM22, pM25, pM38) (Fig. 19b). Sizes of these inserts vary from 2
bp to 116 bp. Most of these sequences are A+T-rich sequences. The insertion elements
contained in pM9, pM22. pM25 as well as pM7 were aligned with sequences from
different organisms such as human (Aoki et al., 1997). C . elegatis (Wilson et al., 1994).
Drosophiia mekmiogaster (Themen et ai., 1995). yeast (de Zarnaroczy and Bemardi.
1986) etc.. Some of these aligned sequences were repeated sequences such as telomenc-
repeat-like intemal eliminated sequence (TelIESs) (Klobutcher. 1995). or sequences fiom
mitochondrial DNA (de Zarnaroczy and Bemardi. 1986) (Fig. 20). suggesting that these
insertion sequences were likely derived from the host insect cells. Insertion of unknown
sequences has also k e n observed on the genome of defective viruses (Carstens. 1987:
Kool et al.. 199 1). Similady, insertions were found at the junction sites between two
different regions of the viral genomic DNA (Cÿrstens. 1987; Kool et d, 1991; Carstens.
1982), suggesting that a common mechanism may be involved in acquisition of these
sequences.
Mechanisms of plasmid DNA replication observed in the above replication assays
could be closely related to biochernical properties of the viral replication machinery.
Further understanding these mechanisms would require a thorough biochemical
characterization of the viral replication proteins such as their ability to interact or react with
DNA, as well as to interact with other cellular or viral replication proteins.
Figure 19. Sequence analysis of the junction sites of pUC19 to viral DNA.
(a) Smtegy for sequence analysis. The HpaII restriction map of pUC19 is shown on the
top. Below the pUC19 map is shown maps of recombinant plasmids that were detected by
HpaII digestion to cany viral inserts. The possible locations of viral inserts on these
plasmids are indicated by downward arrows. The dashed lines indicate regions being
sequenced for the junction sites of pUC19 to viral DNA. The short lines with arrowheads
indicate primers and directions of sequencing. (b) Nucleotide sequences identified at the
proximity of the junction sites. Each nucleotide sequence is presented as a continuous
sequence in the direction of 5' to 3' (Ieft to nght direction). The name of each plasmid and
the corresponding primers used for sequencing are indicated at the beginning of the
sequence. Starting from the pUC19 sequence, each identified viral DNA sequence is
shown as underlined letters. Positions of the junction nucleotides are indicated by the
numbers above each sequence. These numbers represent the positions of the junction
nucleotides on pUC19 or the AcMNPV gnome (Ayres et al., 1994). The bold letters
represent insertion elements which are not aligned with either pUC19 or the viral DNA
sequence. The numbers between slash lines represent numbers of continuous sequences
(nt, nucleotides) which are not presented due to space Limit.
K H L J
pM45 Y - i B 1 G I I F i C ! ! 1 I I € 1 A + on Ml* -
Am
K H L J
pM48 L - E ~ 1 B I G I I F I C I l I I I E I A f-- on < t
Ml* &f
5 ' 464 164 pM9: Mï3R- CATGA/ /276 nt//GGTGCACTCTCAGTACAATC GTATTATTTATPATATATTATTATTATTTCG
TATTCAMCMTATATTAAACTATTATMTATACATATATTTATACACCTATCTWTTM 58631 58640
MCACAMTCACTGCATATATATACCT TAGCACTTGCCTTCTTCCAT
5 ' 398 814 pMZ2: M13F- ATTCG// 392 n t //CGCACGAUGAACATGTGAG GTGTTGGMCTGGTTATACA-TATTTGT
ATTTATGTCMTATATACMGATATTACCTCATMTCTTGTTTATMCMGATTATGAGCA 67287 67306
TGCTGTAMTTGTGTMTTTATATATlLA TMTCACATGAATGTTGTGA
464 451 9896Z CATGATTACGCCAA ATCAllAAGCCGTTTGATTTAAMCTATCAGTMC GTCGTTTATGCTGGA
Figure 20. Nucleotide sequence alignment between the insertion elements and multiple cellular sequences
The insertion elements idenw~ed at the junction sites on recombinant plasmids are presented
on the top of each panel. Each aligned cellular sequence is indicated by the locus name of
the sequence in the Entrez database provided by NCBI (National Center for Biotechnolow
Information). The aligned nucleotides are indicated by uppercase letters. whereas the
mismatched nucleotides are indicated by lowercase letters.
P M ~ 5 : ATCAAAAGCC GTTTGATTTA AAACTATCAG TAAC
HSTRILPROM : AAAAGCC G T T T a T T T A AAAaTA HSAC002064 : ATgAAAAcCa GTGTGtcTTA AAACTATCtG TA MO02 6 54 : TaAtAAGaC GTTTGATTTA AAAaTATaAa aAA
F m R m : Eumdn mRNA f o r translin prornoter (Aoki et al., 1 9 9 7 ) . HSAC002064: Human BAC clone RG016304 from chromosome 7q21- MO02654 : Carassius auratus alpha 1 tubulin gene.
: AGAAAGGTAG AATAAAAATA TCCCTTTTAT ATTCCGCAAC CTAATAACGC
CELC39D10 : A-TA TCCCTTaTAa ATTCCGgAAC aTtAaA EUPMIC3 : TAG A A T W T A TCC t tcTTAT HSU91321 : AGGgAG AAgAAAAATA TCCCTTT
CELt39D10 : CaenorWicis e1egm.s cosmid C39D10 (Wilson et al., 1994) . EUPMïC3 : -Fuplotes c r a s s u s G f micronucfearsequence (Klobutcher, 1 9 9 5 ) . HSU91321 : Human chromosome 16p13 BAC clone CIT987SK-363E6.
pH9 : GTATTATTTA TTATXTATTA TTATTATTTC GTATTCAAAC MTATATTPA
YSCMTCGO3 : TATTATTaA TTATATATTA TTATaAaTcC a T YSCMTATPSA : TATTtTTTA TT tTATATTA TTATTATT YSCMTCG13 : TATa tTTTA T a tATTATTA TTATT
YSCWi'CG03 : Yeast mitochondrion =ans fec genes (de Zamaroczy and B e r n a = & , 1986 . YSmATPSÀ: Y e a s t mitochondrial o x i 3 gene (de Zamaroczy and B a r d i , 1986 1 . YSCMKG13 : Sacchdrromyces cerev=siae m i tochondrion oxi3 g-e .
pM2 2 : GTGTTGGM-CT GGTTATACAT GTATTTGTAT TTATGTCMT ATATAC-:AGA TATTA
HSL184D6 : Euman DNA sequence f r c m cosmid L184d6, tiuntington's Disease Region, c-komosome 4pl6.3 .
DR020DClOZ: grosophila melanoçaszer ENA sequ-ce. CMU43582 : Drosophila rnelanoçzsr=er !&nase suppressor of ras (Thez r i e? ec al., 1995)
E. Possible Interaction of Viral proteins in Initiation of DNA Replication
The following sections presents an attempt to analyze possible interactions of the
viral replication proteins in the process of DNA replication. Results from the plasmid DNA
replication studies demonstrated that seven viral replication proteins (IE- 1. P143, DNA
polymerase, LEF- 1, LEF-2, LEF-3, P35) were essential and sufficient to initiate plasrnid
DNA replication in comsfected cells. These viral factors are iikely involved in formin$ a
replicaiion complex. Interactions between some of these proteins may regulate the process
of replication initiation. Because Pl43 appears to be very important for virai DNA
replication but little is known about its biochernical function. P 143 was used to identify
possible interactions with other proteins. Pl43 was predicted to function as a helicase (Lu
and Carstens. 1991) and may fom complexes with other viral replication factors,
especially a replication initiator. Identification of this possible complex would be an
important step towards understanding regulation of replication initiation.
1. Different Intracellular Localization of Pl43 and XE-L in Cells Co- producing Pl43 and IE-l
Since baculovirus replicates in the nucleus and Pl43 is essential for viral DNA
replication, Pl43 was expected to be localized in the nuclei of infected cells. To determine
the intracellular Iocalization of P143, AcMNPV infected cells ( m.0.i. of IO), harvested at
18 to 24 hours post infection, were stained with monoclonal antibody against Pl43 (RC-
2) followed by goat anti-mouse antibody coupled with Oregon Green. Pl43 was found
predominately in the nuclei of the infected celis (Fig. 21, A l , A2). confirrning the
specuiation of nuclear Iocalization of P 143. Since the viral DNA is infectious (Carstens et
al., 1980). Sf21 cells were also transfected with purified AcMNPV DNA. Again Pl43
was localized in the nuclei of the transfected cells (Fig. 21, BI , B2), demonstrating that
the process of transfection mimics the process of infection in Iocalizing functional Pl43 to
the nucleus. In the control cells transfected with only herring sperm DNA, no fluorescence
Figure 21. Intracellular localization of Pl43 o r IE-1 in infected or transfected Sf2 1 cells.
SC1 cells were infected with virus (rn.0.i. of 10) (A), nansfected with viral DNA (B), or
cotransfected with plasmids pAciel plus pAcp143 (C. D). Eighteen to 24 h post infection
or transfection the cells were fixed, labelled with monoclonal antibody against Pl43 or IE-
1. The conventionai epifluorescence images of the cells labelled with anti-Pl43 (A l . B1 C 1) or ami-IE- 1 @ 1) are shown. The same ceIls were stained for DNA (chromosomes)
with DAPI (A2, B2. C2, D2). Bar. 10 pm.
was observeci in any part of the cells (data not shown), indicating that the monoclonal
antibody RC-2 reacted specifically to Pl43 under the assay conditions
The nuclear localization of Pl43 could be mediated by Pl43 itself or it may be the
result of a interaction between Pl43 and some other proteins. To test this, two different
plasmids, one expressing the p l 4 3 and another expressing the ie-l gene were
cotransfected into cells. Both PI43 and E- 1 were expressed from their native promoters.
These two genes were expected to be expressed in the cotransfected cells. When the
cotransfected cells were stained with RC-2, Pl43 was found exclusively in the cytoplasm
(Fig. 21, Cl. C2 ), demonsnating that Pl43 itself did not have the ability to self-locaiize
into the nucleus and that IE-1 could not facilitate the nuclear localization of P143.
However, IE- 1 was localized in the nucleus (Fig. 2 1, D 1, D2). Although the cotransfected
cells were not double-labelled with two antibodies against P 143 and IE- 1. two facts
strongly suggested that Pl43 and IE-1 localized differently in the sarne cell. First, when
the cotransfected cells were stained with RC-2 or monoclonal antibody against 1E-1
respectively, there was always a roughly equal percentage (10-20%) of cells k ing stained.
suggsting that the positively stained cells in both cases were likely the same popularions
of cells. Because staining of Pl43 in the cotransfected cells was dependent on the presence
of the cotransfected ie-I gene (see results below). the cells positively stained by RC-2
must contain IE-1. Second. the cytoplasmic localization of Pl43 and the nuclear
localization of IE- 1 were predominant in stained cells. Therefore, different intracellular
localization of Pl43 and I L 1 suggested that a direct interaction between Pl43 and IE- 1
was unlikely in the cotransfected cells.
2. The Ability of the Viral Replication Factors to Facilitate the Nuclear Localization of Pl43
Previous data have shown that cotransfection of the appropriate plasmids expressing seven
viral replication genes result in transient replication of plasrnid DNA (Fig. 9). It was
possible that plasmid DNA replication would occur in the nucleus in the presence of these
seven viral proteins. P143, as one of these viral proteins, would be localized in the
nucleus. The localization of Pl43 was examined in cells cotransfected with eight plasrnids
expressing the pnes encoding IE- 1, DNA polymerase, P 143, LEF- 1. LEF-2, LEF-3,
P35, IE-2 and PE38. In these plasmids, al1 viral genes were cloned behind their
indigenous promoters. When coaansfected together into insect cells, these genes are
expressed and function to support DNA replication (Fig. 9). The cotransfected cells were
immuno-stained for P143. In the cells, Pl43 was found predorninately in the nuclei (Fig.
22, A 1, A2). This suggested that in the presence of these viral replication proteins, Pl43
was transported to the nucleus. These results also confmed that in the presence of al1 the
products of the viral replication genes, DNA replication likely occurred in the nucleus,
mimicking the DNA replication process occuning in the infected cells.
The ability of each individual replication protein to facilitate the nuclear localization
of Pl43 was further investigated by sequentially subtracting each plasrnid from the
cotransfection mixture. When pAcdnap, pAclefl, pAclef2, pAcp35 or pAcie2pe38 was
individually removed from the cotransfection mixture, Pl43 was found in the nucleus
(Fig. 22, B. C. D. E, F), suggesting that these factors were not essential for Pl43 nuclear
localization. In conuast, when pAclef3 was removed, Pl43 was predominately localized
in the cytoplasm (Fig. 22, G1, G2). Thus LEF-3 may be one of the factors essential for
the nuclear localization of P143. When pAciel was not included, no fluorescence was
detected (data not shown), suggesting that in the absence of IE- 1 , the expression of P 143
€rom its indigenous promoter was eliminated or greatly reduced confirming previous
results (Lu and Carstens, 199 1).
Since only one plasrnid was subtracted from the cotransfection mixture each time,
it was possible that the nuclear localization of Pl43 depended on the presence of LEF-3
plus any one or a few of the other viral proteins. LEF-3 alone may not have the ability to
promote the nuclear localization of P143. Therefore, only three plasrnids, pAcp143,
pAclef3 and pAcie1, were cotransfected into insect cells. Nuclear localization of Pl43 was
Figure 22. Intracellular localization of Pl43 in SC21 cells transiently
expressing viral replication genes.
Sf2 1 cells were cotransfected with plasmids pAcie 1. pAcp 143, pAcdnap, pAclef 1,
pAclef2, pAclef3, pAcp35, pAcie2pe38 minus one of the foliowing plasmids: A. none; B,
pAcdnap; C, pAclefl; D. pAclef2; E, pAcp35; F, pAcie2pe38; G, pAclef3. To demonstrate
that LEF-3 might be sufficient to mediate the nuclear localization of P143, the ceils were
also comsfected with only three plasmids pAcie1. pAcp 143 and pAclef3 (H). Eighteen to
24 h post cotransfection the cells were fixed and labelled with a monoclonal antibody to
P143. The conventional epifluorescence images of Sf21 cells labelled with antibody to
P 143 are shown (A 1. B 1 to Hl) dong with the same cells stained for DNA (chromosomes)
with DAPI (A2. B2 to HZ). Bar, 10 Pm.
observed in every ce11 expressing Pl43 (Fig. 22, Hl, H2). As expected, when pAclef3
was subtracted, P 143 remained cytoplasmic, whereas when pAcie 1 was subtracted. no
fluorescence from the RC-2 staining of coûansfected cells was detected (data not shown).
These results indicated that LEF-3 was the viral replication factor essential and likely
sufficient for the aanspon of Pl43 into the nucleus.
3. Pl43 and LEF-3 coIocalize in the nucleus
Since IE-1 alone can not mediate the transport of Pl43 (Fig. 21. C. D), but it may
assist LEF-3 in localizing Pl43 to the nucleus. The presence of the necessary IE- 1 in the
cotransfection mixtures clouded the possible role of IE-1 in mediating nuclear localization
of P143. Thus. both the p 14.3 and lef-3 genes were cloned behind the ie- I gene promoter
so that the expression of these genes from the ie-I promoter would depend solely on host
cellular factors. Cells transfected with pAcIElhrP143 produced a novel protein that reacted
specifically with RC-2 and had a similar size with Pl43 from the infected cells, whereas
cells transfected with pAcIE lhrLEF-3 produced a protein reacting with the monoclonal
antibody against LEF-3 (Fig. 23). This protein had also a molecular weight corresponding
to LEF-3 in the infected cells. As expected. cells cotransfected with both pAcIE l hrP143
and pAcIE 1 hrLEF-3 produced two novel proteins corresponding to Pl43 and LEF-3
respectively in the infected cells. As a contrast, no signal was seen in cells transfected with
the cloning vector pIE 1 hr/PA.
The intracellular localization of Pl43 was examined in cells transfected with
pAcIE 1 hrP143 or cotransfected with pAcIE 1 hrP 143 and PACE 1 hrLEF-3 (Fig. 24). In the
ce11 transfected with pAcIE 1 hrP143 alone, Pl43 was exclusively localized in the
cytoplasm (Fig. 23. A 1 to A4). whereas in the ce11 cotransfected with pAcIE 1 hrP143 plus
pAcIEl hrLEF-3. Pl43 was detected in the nucleus (Fig. 24, B 1 to B4). LEF-3 alone is
sufficient to mediate the nuclear localization of P143.
Figure 23. Detection of Pl43 and LEF-3 in Sf21 cells transfected with pIElhrP143 andlor pIElhrLEF-3.
Sf21 cells were transfected with plasmid pIElhrP143 (lane 2), pIElhrLEF-3 (lane 3)
individually, or cotransfected with pIEl hrPlQ plus p E l hrLEF-3 (lane 4). As controls,
the cells were transfected with the cloning vector pIEl hr/PA (lane 1) or cotransfected with
pIElhr/PA plus pIElhrP143 (lane 5). To detect the expression of Pl43 and LEF-3, the
cells were harvested at 24 h post transfection or comsfection and whole cell extracts were
analyzed by 10% polyacrylamide gel electrophoresis. After electrophoresis, proteins were
electrophoretically transferred ont0 the nitrocellulose membranes and probed with a monoclonal antibody against LEF-3 (1 5,000 dilution) followed by anti-mouse antibody (1 :
20.000 dilution) conjugated with horseradish peroxidase. The reaction was detected by
cherniluminescence. The same detection procedure was performed after the blot being
stripped and reprobed with monoclonal antibody specific for Pl43 (1: 1,000). Results of
immunoblotting ce11 extracts from infected cells (rn.0.i. of 10. 12 h post infection) are
shown in lane 6. The position of Pl43 and LEF-3 and the relative mobility of protein
standard are indicated on the right and left of the figure respectively.
Figure 24. LEF-3 rnediated nuclear colocalization of Pl43 and LEF-3 in Sf21 cells,
Sf2l cells were transfected or cotransfected with plasmids, harvested at 24 h post
transfection or cotransfection, and labelled with antibodies against Pl43 or LEF-3. The confocal laser scanning images from the same ce11 or cells are presented in eacn panel. In
panel A, the ce11 transfected with pIEl hrP143 was labelled with monoclonal antibody to
Pl43 (A3) and stained for chromosomes (A2) with propidum idode. The whole ce11 image
is shown in A l , while a merged image of A2 and A3 is shown in A4. Panel B shows the
image of whole cells (B 1) conansfected with pIEl hrP143 and PIE 1 hrLEF-3. stained for
chromosomes (B2), and labelled with monoclonal antibody to Pl43 (B3), along with a
rnerged image (B4) of B2 and B3. in panel C, the cells were transfected with pIE lhrLEF-
3, labelled with a monoclonal antibody to LEF-3 (C3) and stained for chromosomes (C2). The whole ce11 and the merged image are shown in C 1 and C4 respectively. Panel D shows
a ce11 (Dl) cotransfected with pIElhrP143 and pIElhrLEF-3. double-labelled with a
polyclonal antibody against Pl43 (D2) and a monoclonal antibody against LEF-3 (D3). dong with a merged image (D4) of D2 and D3. Bar, 10 Pm.
The LEF-3 mediated nuclear localization of Pl43 rnay involve a direct interaction
between LEF-3 and P143. which would lead to the colocalization of these two proteins in
the nucleus. Therefore, the intracellular localization of LEF-3 was also exarnined. In the
cells transfected with only pAcIElhrLEF-3, staining with monoclonal antibody against
LEF-3 revealed that LEF-3 was in the nucleus (Fig. 24, C l to C4), suggesting that LEF-3
alone was capable of localizing itself to the nucleus. Cells cotransfected with
p AcIE 1 hrLEF-3 and pAcIE 1 hrP143 were double-labelled with a monoclonai antibody
against LEF-3 and a rabbit polyclonal antibody against Pl43 (Laufs et al.. 1997). The
staining of cells with monoclonal antibody against LEF-3 was foilowed by goat anti-
mouse antibody conjugated with Oregon Green, whereas the rabbit polyclonal antibody
against PI43 was followed by goat anti-rabbit antibody conjugated with Rhodamine. The
labelled cells were then analyzed by a confocal laser scanning microscope using two
different filters to visualize the fluorescence due to Rhodamine and Oregon Green.
Representative cells are shown in Fig. 23, Dl-D4. In the same cell, staining with Pl43
polyclonal antibody revealed a diffuse nuclear labelling of Pl43 (red fluorescence due to
Rhodamine) and sraining with LEF-3 monoclonal antibody revealed a similar labelling
pattern (green fluorescence due to Oregon Green). The rnerging of the two images in D4
of Fig. 23 gave an image (orange) showing an overlapping of the red and green colors.
These results indicated that Pl43 and LEF-3 colocalized in the nucleus. In the control
samples. when the cells were transfected with only the cloning vector pIEl hr/PA. staining
of the cells with monoclonal antibody against LEF-3 did not produce any background
stain, whereas staining with polyclonal antibody against Pl43 produced only a very low
cytoplasmic background. These results strong suggest that LEF-3 interacts with Pl43 to
form a complex which is transported into the nucleus.
DISCUSSION
The current literature suggests that baculovirus homologous regions are very
important, as transcription enhancers of viral early genes and ongins of replication. The
replication of plasmid DNA in the presence of hn suggested that baculovirus may have
multiple initiation sites for genomic replication. Multiple initiation is a mechanism used in
the replication of chromosomal DNA in eukaryotic cells and the genome replication of
some DNA vimses such as herpes vimses. One of the advantaps of using multiple sites
may be to increase the chances for the formation of a preinitiation complex and thus
increase the speed of replication cycle. Initiation of DNA replication from multiple sites
usually involves the interaction of one common initiator protein with multiple ongins
rather than the use of multiple initiators to interact with multiple ongins. In baculovirus.
because hrs have highly homologous and repeated sequences, different hrs would be
recognized by the sarne initiator protein, likely IE-1. However, it was puzzling that
regions within the HimiIII-K fragment also replicated efficiently in the replication assays
although this region does not share sequence homology with hrs (Kool et al., 1994b). The
differences between hrs and HimiIII-K in terms of requirement for minimal sequences for
supporting DNA replication sugpsted that these two regions could be recognized by
different initiator proteins. Baculovinis may have more than one replication initiator or,
unidentified mechanisms may be involved in the initiation of baculovirus DNA replication.
To clarify the confusion. it became imponant to identify other viral sequences that might
possess the ability to support DNA replication. Then, a possible comrnon ground for these
sequences to function as origins of replication could be deducted. As a first step, it was
necessary to test whether or nor there were other sequences on the viral genome that could
functionally substitute hrs in the transient replication assay.
A. Roles of hrs in DNA Replication
The results shown in Fig. 2 demonstrated that in addition to hrs, sequences
flanking hr l , hr3 and hr4a dso possessed the ability to initiate DNA replication in the
infected cells. These data suggest that hrs do not specifically function as the replication
origins and other sequences can functiondy substitute h n in supporthg DNA replication.
Regions flanking hrl were selected and analyzed in detail. At least two regions were
identifid to carry the ability to support plasrnid DNA replication. One contains the viral
pe38 gene, while the other region carries viral ie-2 gene. Although these two regions do
not share sequence homology with hrs or the Hindm-K fragment, both pe38 and ie-2 are
viral early genes. The ability of these two early genes to support plasrnid DNA replication
could be simply due to the fact that they are early genes. Therefore, a wide variety of
regions canying viral early genes were tested in the replication assay. The results indicated
that almost al1 plasrnids carrying early viral genes replicated and some (pAcp143 and
pAcp47) replicated to higher levels than the h R reporter plasrnid (Table 3), indicating that
baculovims replication origins might be more complex and widespread on the genome
than originally suggested (Kool et al., 1995).
The hr deletions were further introduced into the viral genomes individually to test
whether any of hrs was essential or important for the replication of the virus itt vivo.
Recombinant viruses carrying h r deletions in either hrla, hrl, hr2, hr3, hr4a, hr4b were
consmcted and tested for the ability to replicate in Sf21 cells. CeIls were infected with
each h r deletion virus, then the production of the progeny virions was measure after virus
replication. Consistent with a previous result involving deletion of hrS from the viral
genome (Rodems and Fnesen, 1993), deletions of al1 hrs (except hr4c) individually
appeared to have Iittle or no effect on the production of the progeny viruses. Therefore,
none of the hrs is used by baculovims as a unique site for replication initiation.
The function of hrs in replication initiation appears to be correlated with their
function as the transcriptional enhancer in the transient expression assay. pAcAhr2 has one
palindrome with a disrupted EcoRI core site, whereas pAcAhr5 has only half of the 28-
mer palindrome. Both plasmids failed to replicate in the replication assay (Fig. 2).
suggesting that the complete sequence of the hr palindrome is important for its function as
the replication origin. In cornparison, the minimal sequence requirernent for the enhancer
function of hr.5 is also the 28-mer palindrome (Rodems and Friesen, 1995). Half a
palindrome or a palindrome with a deleted central EcoRI site disabled the function of hn
as the transcription enhancer (Rodems and Friesen, 1995; Leisy et al., 1995). The
minimal functional sequence of h n for the processes of replicaaon and transcription is
sirnilar, suggesting these two processes may be intimateiy connecteci.
The involvement of hrs in the transcription of viral early genes has been
demonstrated in vivo by deleting hr5 from the viral genome, which decreased the
transcription of the viral p35 gene around one fold (Rodems and Friesen, 1993). Effects
of hr deletions (except hr4c) on products of viral early genes such as IE- 1, P143, LEF-3
or P47 were examined in this study. The results suggest that each individual h r affects
specific sets of early genes, and different hrs affect early genes differently. For exarnple,
the deletion of hr-2 affected the relative amount of P47, LEF-3 but not P143. On the other
hand, the deletion of hr4a affected P 143 and LEF-3, but not P47. The deletion of hr3
decreased the ratio between IE-1 and al1 these three proteins, while the deletion of hrla,
hrl, hr4b had no apparent effect. The correlation between an individual hi- and its action
on particular early genes appears to be cornplex, reflecting multiple factors such as the
relative location of the h r and the early genes, and the overall genetic organization of the
genome.
While deletions of a single hi- affected early gene aanscription, the effect on virus
replication was minimal. This could be due to the insignificance of each individual h r
deletion on overail gene transcription, or the virus may have some balancine mechanisms.
When the expression of some genes is negatively affected by h r deletions, the expression
of other genes may be enhanced. It would be important to introduce more than one h r
deletions hto the viral genome. These multiple hr deletions rnay have a strongeer effect on
the process of viral gene transcription or DNA replication. which may be easily
distinguishable and would help to define specific functions of krs in the process of viral
DNA replication and gene uanscnption. However, it is not clear whether deletion of more
than one hr at the same tirne would abolish or gready affect baculovirus replication. The
situation will be more complex when multiple hrs are deleted since the same sequences
within hrs serve as both the putative ongins and the early gene transcription enhancers.
Impaîring either function may affect both. Nevertheless, the deletion of each individual hr
from the viral genome and the replication of these deletion mutants in vivo demonstrate.
for the first time. that hn are redundant in their function as the putative replication origins.
Funher functional analysis of hrs by multiple deletions will use the data and techniques
established in the study of single k deletions.
B. DNA Replication Initiation and Early Gene Transcription
The results shown in Fig. 5 demonsmted that plasmids carrying a senes of viral early
genes replicated in the infected cells. One of the replicated plasmids. pIEl- lad. was
analyzed in detail for possible reasons leading to the replication. Only the ie-l promoter
region could initiate DNA replication. A detailed deletion analysis of the ie-l promoter
region did not identify any specific sequence that was responsible for the DNA replication.
Maximal replication was observeci only in the presence of al1 the sub-regions of the ie-l
promoter (Fig. 6).
The ie-1 promo ter region shares no sequence homology with previou sly described
origins. It contains one 24 base pair imperfect palindrome within region N. but deletion of
this region did not abolish replication (Fig. 6a. lanes 7 and 9 to 11). Region 1, II and V
contain three A+T-rich domains (55 to 67% A+T over 70 to 119 nucleotides), but the
replication of the lower A+T content region IV (46% A+T over 169 nucleotides). as well as
the fact that one A+T-rich domain between I and II is disrupted. did not support a specific
role for these A+T-nch domains in replication.
Analysis of the replication negative plasmids pAcAhr2 and pAcAhr5 reveaied that they
also contain regions of approximately 140 nucleotides which are about 80% A+T. All of
the control plasmids lacking viral inserts also contain regions with high A+T content (74%
A+T over 100 nucleotides), but they were completely negative in the replication assays.
Therefore, high A+T content regions are not sufficient to impart replication ability, while
retaining an early promoter region intact appeared to be important in determinhg maximal
replication abili ty. The replication of different su b-regions within the ie- 2 promo ter
suggested that the replication ability does not directly correlate with transcriptional
activation but rather appears to indicate the potential role that these regions play in binding
transcription factors pnor to early transcription.
The ie-l promoter region 1, which contains the TATA and CAAT box sequences.
known to be essential for accurate initiation of transcription (Blissard et al., 1992; Guarino
and Smith, 1992; Pullen and Friesen, 1995a). is not essential for replication. In addition,
dthough the upstream regions of the ie-I promoter, including regions II to V in this study,
may be non-essential for transcnption irz vivo, they can enhance ie-l expression when
transfected into cells (Pullen and Fnesen. 1995b). suggesting that other transcription factor
binding sites likely exist within these regions. Evidence suggesting that these regions carry
regdatory elements responsive to host ce11 factors (Pullen and Friesen, 1995b) has also
k e n reponed. Therefore, these data in baculovirus are in agreement with other studies in
which the presence of binding sites for a range of cellular transcription factors near the
SV40 ongin of replication stimulates viral DNA replication but does not correlate with their
ability to stimulate transcription (Hoang et al.. 1992).
A comelation between manscription and DNA replication has been demonstrated in
several other eukaryotic systems (for a review, see Heintz, 1992). The uanscnption
activator NF1 , which specifically prevents repression of SV40 DNA replication by
chrornatin assembly, stimulates DNA replication 20-fold in vivo (Cheng and Kelly.
1989). The transcription factors VP16, GALA and P53 c m bind to the large subunit of
replication protein A. s t i m u l a ~ g polyornavinis DNA replication by exening an influence
on a very early stage of the initiation process such as initiation complex assembly (He et
al., 1993; Li and Botchan. 1993). The fact that a single je-1 promoter or its subdomain. as
well as a number of other early gene regions of AcMNPV, when present in plasmids, can
lead to DNA replication suggests that the processes of baculovirus gene transcription and
replication rnay be intimately connected: (1) the binding of transcription factors pnor to
transcription initiation, especially transcription of early genes. rnay expose the DNA to the
replication machinery. allowing for initiation of DNA replication following transcription.
(2) the interaction between transcription factors and the virus replication machinest rnay
facilitate the assembly of replication factors necessary for DNA replication. (3) facton that
recognize early viral promoters rnay inhibit or dislodge nucleosomes, allowing access to
DNA domains that then function as replication ongins.
The conformation of a plasmid can affect its transcriptional activity during a
transient expression assay. Supercoiling of plasmids is crucial for maximum transcription
activity (Parvin and S harp, 1993). Coincidentally, linearization of a supercoiled h r
containing plasmid completely abolished the replication ability of the plasmid in the
infection-dependent replication assay (Kool er al., 1993b). Because prolonged storage of
plasmids or repeated extraction of the plasmid DNA with phenol c m greatly reduce the
DNA's replication efficiency (unpublished data), DNA conformation rnay be an important
cnterion for both transcriptional and replication activation.
Using the standard plasmid based replication assay, a number of other regions of
the genome which c m also function as putative DNA replication ongins were identified.
However. the possibility that more DNA elements rnay also be involved in this process
can not be excluded. The situation is rerniniscent of the widely used yeast ARS high-
frequency transformation assay which successfully identified the first eukaryotic
chrornosomal ongin of replication, ARSI, and later, many other yeast ARS elements
(Stinchcomb et al., 1979; Smhl et al., 1979; Newlon, 1988). However, subsequently,
using a variety of approaches, it was revealed that while all yeast chromosornal origins are
ARS elements, not al1 ARS elements function as ongins in the yeast chromosome
(Fanpan and Brewer, 1991). Furthermore, not al1 yeast ongins can initiate replication at
the same time (Fangman and Brewer, 1991). The selection of each individual ongin
appears to also be controlled by the context of the chromosome structure. The data in this
thesis demonstrate that many different regions of the baculovirus genome can initiate
plasmid DNA replication in v h s infected cells. It remains to be determineci which of these
sequences function as genuine origins of replication during the vins replication cycle.
Future studies may need to use in vi~ro approaches to identify the genuine origins of
replication. Approaches such as in r~iipo labelling of viral DNA synthesis in the presence
of an inhibitor of eiongation or using a temperature sensitive mutant defective in elongation
at non-permissive temperature would be invaluable.
C. Possible Mechanisms of Initiation of Viral DNA Replication
One major paradox in defining baculovirus DNA replication origins is the
observation that al1 plasrnids, even those not canying viral sequences, replicate when
co~ansfected with viral DNA into insect cells (Guarino and Summers, 1988; Yu, 1990;
Kool et al., 1994a; Lu and Miller, 1995). However, it was not known whether this non-
specific replication is initiated by the viral replication machinery or by cellular replication
proteins. The possible reason that led to the replication of multiple sequences in the
cotransfected cells were investigated. The results indicate that plasmids lacking viral
sequences are capable of replication and this replication is independent of the presence of
baculovirus DNA sequences such as hrs in cis, but is dependent on the presence of viral
replication genes in tram (Fig. 7, 8, 9). Seven genes are necessary and sufficient to
initiate plasmid DNA replication. Therefore, baculovinis replication machinery can
potentially initiate DNA replication from multiple sequences, including non-viral
sequences under certain circurnstances.
The replication of the plasmid DNA in cotransfected ceiis could be due to
integration. Indeed. some of the replicated plasmid DNA was integrated into the virai
genome (Fig. 10). However, the smicniral difference between the replicated plasmid DNA
(Fig. 1 1) and the input plasrnids (Fig. 10, lane 2) did not support the hypothesis that the
replication was passively iniaated from the plasrnid DNA because of its integration into the
viral genome. The majority of the replicated plasrnid DNA was concatemeric, while rnost
of the input plasmid DNA was monomeric (fom 1 and III), suggesting that the replicated
plasmid DNA must have gone through at least one round of self-replication. In addition.
an estimation of the integration rate (see below) shows that only 1&25 % of the replicated
plasmid DNA in the cotransfected cells was intepiteci into progeny virion DNA. The rest
of the replicated plasmid DNA was not covalently Iinked to viral DNA. Therefore, the
replication of plasmid DNA in cownsfected cells appears to be an autonomous process
independent of the initiation events of the viral genome. The integration of plasrnid DNA
into the viral genome likely results from CO-replication and non-homologous
recombination of plasrnid DNA and the viral genome.
The replication of plasmid DNA in cells cotransfected with baculovirus DNA is
reminiscent of results showing that all exogenous naked DNA molecules including a wide
range of bacterial plasmids and bacteriophage genorne, when injected into intact Xempus
eggs or incubated in egg exwcts, replicated efficiently (Harland and Laskey, 1980;
Mechali and Kearsey, 1984). When intact nuclei fiom Chinese hamster ovary cells were
added to the same egg extract, replication initiated specifically at or near authentic ongins
of replication (Gilbert et al., 1993; Gilbert et al., 1995a). These experiments indicate that
some feature of nuclear structure. for example matrix attachment regions, can impose
selective initiation sites on DNA that would otherwise initiate randomly. Therefore,
patterns of replication in eukaryotes might be imposed by chromosome suucture coupled
with DNA sequence (Coverley and Laskey, 1994).
The results of plasmid DNA replication in cotransfected versus infected cells
appear to support this point of view. In baculovirus infected cells, plasmid DNA
replication requires specific putative origin sequences such as hrs. HindIiI-K or viral early
gene regions, while in cotransfected cells it does not. suggesting that a structural factor
rather than primary sequences rnay regulate the specificity of the initiation process.
As a working hypothesis to resolve the paradox observed in different transient
replication assays. a mode1 (Fig. 25) is proposed, suggesting that the specificity of
baculovinis replication initiation is determined by features of chromatin stnicniie. It has
been dernonstrated that plasmids transfected into eukaryotic cells are assembled into
chromatin structure constituting cellular histones, and this assembly process can occur in
the absence of DNA replication (Gruss et al., 1990). Therefore, it is possible that
plasmids are also assembled into chromatin structure following their transfection into
insect cells. The transfected cells are further infected with vimses and specific viral
transcription factors such as IE- 1 and replication proteins such as Pl43 are expressed. If
the plasmid contains binding sites (such as viral promoter regions or h r sequences)
recognized by the early viral proteins, binding of these factors could disrupt the chromatin
structure and expose the DNA to replication proteins. If no viral factor binding sequences
are present, the chromatin structure could prevent replication proteins from interacting with
the plasmid DNA, effectively repressinp replication. The assembly of the replication
proteins ont0 DNA may simply require binding factors to open the chromatin smcture. In
this case, the specificity of replication initiation would be based directiy on the presence of
recognizable binding sequences. On the other hand. following cotransfection of the
purified, naked plasmid DNA and viral DNA. the replication proteins rnay directiy
assemble ont0 the naked plasmid DNA pnor to formation of the chromatin structure.
initiating nonspecific DNA replication.
Figure 25. Mode1 of plasmid DNA replication in insect cells.
When nansfected into cells, plasmid DNA forms a chromatin smcture which affects the
way the plasmid is recognized as a template for virus-induced replication. In this model. plasrnids canying a viral DNA insen would be recognized by viral transcription factors,
whose binding would open up the chmat in structure, senting as a platfonn for assembly
of the replisome and initiation of replication (i). Otherwise, a complete chroma.tin smicture
could preclude the assembly of the replisome (ii). If the plasmid DNA was introduced into
cells followed shortly by virus infection, there would not be enough tirne to form a
complete chromatin smicnire so the virus replisome could assemble on any naked region of
plasmids and initiate replication (iii). This conclusion is supported by data in Figure 26, lanes 2-4. where pUC18 (without any viral insert ) replicated when vims infection occurred
within four hours after transfection. If plasmid and viral DNA were cotransfected into ceus,
the immediately synthesized proteins of the viral replisome could assemble on any naked
plasmid DNA and initiate replication (iv). These concIusions are supponed by data in
Figure 26, lane 1.
transfection infection
1. + 1, 6
6h
Plasmid replication
No plasmid - replication 6h
iii.
6 8
iv. cotransfection Plasmid
replication
O-I- : a - Nucleosome
/--1 1 -
0 \
I \ 1 Plasmrd I
AcNPV ; I - ! ~ replicat ion \
V I I U 3 L C p 1 1 3 u l l l e
\ I
0 '---/' 1 - 1
AcMNPV virions l
i 7 - I
-. . . DNA binding protein(s) 1
Figure 26. Replication potential of piasmid DNA changes with tirne after transfection.
Sf21 cells were cotransfected for 2 h with 1 pg AcMNPV DNA plus 2 pg pAchr2 (a. lane 1) or 1 pg AcMNPV DNA plus 2 pg pUC18 @, lane 1). For infection-dependent transient
replication assays, 2 pg pAchr2 (a, lanes 2-6) or 2 pg pUC18 (b. lanes 2-6) was incubated for 2 h with cells, then monolayen were washed irnmediately, infected with virus (m.0.i of 1) at 2,3,4,5 or 6 h (lane 2 to 6 , respectively) after aansfection (adding DNA to cells was
time zero). Total cellular DNAs were purified at 72 h post cotransfection or 48 h post virus
infection and digested with D p d and SmaI. Blotting and hybridization conditions were as outlined in Figure 2.
& I1 c transfection t infection
a. &' 8 2h 3h 4h 5h 6h
c 8 @
b. c transfection + infection g
This mode1 was tested by infecting cells at several time points early after
transfection of plasrnid into cells with the aim of detecting some plasrnids with immature
chromatin structures (replication competenr). Replication of pUC18 DNA was detected
following infection with AcMNPV at 2. 3 or 4 h after transfection. However. no
replication of pUC18 DNA was detecrable after 5 h post transfection (Fig. 26b). Plasrnid
containing the ht-2 region was recognized as a template and replicated at al1 urnes after
transfection (Fig. 26a). Although there is no direct evidence yet, it is likely that after 5 h.
the aansfected pUC 18 DNA is smicturally altered and is no longer recognizable by viral
replication proteins. This concept will be testable once i ~ i i7itr-O replication assays for
baculovirus are available.
The replication of plasmid DNA in cotransfected cells depends on seven viral genes
whose products include two double-stranded DNA binding proteins LE- 1 and P143. It is
not clear how the DNA binding function of these two proteins is related to the initiation of
DNA replication in the cotransfected cells. Apparently IE-1 is a sequence specific DNX
binding protein. recognizing multiple E l binding sites in hrs (Choi and Guarino. 1995b).
If IE-1 functions as the initiator in the ongin recognition cornplex. hi-s would function as
the origins and Se expected ro repticate specifically. or at least more strongly thm non-viral
sequences. However. the data presented in this study indicate that hrs do not replicate
specifically. nor do they enhance replication in the cotransfected cells. In addition. IE- 1
rnay not cany the ability to directly interact with the purative Iielicase Pl13 and mediate the
assembly of Pl43 ont0 the origins to iniriate DY4 replication. When Pl43 and IE-1 were
CO-produced in insect celis. they localized differently within the cells (Fig. I l 1. Pl43
localized in the cytoplasrn. while IE-1 localized in the nucleus. suggesting that thsse two
proteins may not interact directly in the comnsfected cells. Therefore. assembly of Pl 43
ont0 origins may be accomplished by recognition of a DNA smicture created by the bindins
of IE- 1 to the origins. rather than by a direction interaction between Pl33 and IE- 1.
On the other hand, the putative helicase Pl43 has been shown to be a sequence non-
specific double-saanded DNA binding protein (Laufs et of., 1997). Ir is tempting to
speculate that without the repression of a chromatin structure. Pl43 may bind to any DNA
sequence in the nucleus. From this sense, assembly of Pl43 onto DNA would rely less on
the ability of an initiator protein to specifically interact with Pl43 and more on the ability of
a viral or cellular factor to dislodge a chromatin-smicture possibly formed onto ongin
sequence. As long as the viml or cellular factors cany the ability to dislodge the chromatin-
structure and present naked DNA to P143, they may have the ability to initiate DNA
replication in the presence of the viral replication machinery. Accordingly, sequences
carrying the binding sites for these viral or cellular factors rnight function as ongins in the
infected ceUs.
A recent report describing the replication of the SV40 ongin in insect cells supports this
hypothesis (Martin and Weber, 1997b). When a plasrnid canying the SV40 origin was
transfected into insect cells and then the celis were infected with a recombinant baculovirus
expressing SV40 large T antigen, the plasmid replicated. The replication of the plasmid
depended on the presence of the SV40 origin, infection of baculovinis and the expression
of T antigen. The replicated plasmid consisted of high molecular weight concatemers which
undenvent significant levels of homologous recombination during replication. These data
are consistent with an AcMNPV rather than a SV40 directed mode of DNA synrhesis. It is
very likely that the replication of the SV40 origin in insect cells was completed by the
baculovinis replication machinery with T antigen only playing a role dunng initiation.
Although T antigen is the initiator in the replication of the SV40 genome in human cells, it
was unlikely that specific interaction between T antigen and baculoviral factors supported
the replication of the SV40 origin in insect cells. Rather, T antigen in this case may sirnply
disrupt the chromatin structure on the plasmid by its binding to the SV40 ongin, which in
tum could expose plasmid DNA to P143. The non-specific binding of Pl43 to the SV40
ongin may eventually lead to its repiication by the baculovirus replication machinery.
If P l43 has helicase activity, binding of Pl43 to an origin could lead to DNA
unwinding, which would facilitate the assembly of other replication factors such as the
single-srranded DNA binding protein ont0 the origin. Indeed, evidence presented in this
study demonstrated that Pl43 likely interacted with the viral single-stranded DNA binding
protein, LEF-3 (Fig. 23, 24). Pl43 and LEF-3 probably existed as a complex in the
nucleus since Pl43 alone was excluded from entering the nucleus. If Pl43 binds to DNA
directly in the nucleus, it would bnng LEF-3 to the binding site. Once the DNA duplex was
opened by P143. LEF-3 would stabilize the opened region by its binding to the single-
stranded region. which. in mm, would facilitate the assembly of other replication factors
such as the pnrnase complex or the DNA polymerase for DNA synthesis.
D. Recombination and Viral DNA Replication
Analysis of the products of DNA replication in the cotransfected cells indicated that
baculovinis incorporated a significant arnount of replicated plasmid DNA into its genome,
which was then packaged into progeny virions (Fig. 12). Cornparison of the percentage of
the replicated plasmid DNA contained in the vinons versus that in the couansfected ceils
would roughly reflect the incorporation rate. Presumably, once integrated, the replicated
plasmid DNA in the cotransfected cells would have the equal possibility of k ing packaged
into virions as the viral genomic DNA. Any unintegated plasmid DNA may be excluded
from packaging due to lack of a packaging signal sequence. Every microgram of purified
virion D N A contained 50-100 pg of replicated plasmid DNA (Fig. 13. lanes 3, 7),
whereas intracellularly for every microgram of viral DNA, there was 400-500 pg of
replicated plasmid DNA (Fig. 10). Therefore. at least 10-25 % of the replicated plasrnid
DNA in the cotransfected cells appeared in the progeny vinons, and was likely in the
integated fom. Accounting for possible exclusion of sorne integrated plasmid DNA from
packaging, the integration rate would be higher. The DNA packaging system could
exclude some defective viral genomes carrying plasmids, or some virai genomes with
excessive sizes due to plasmid integration. Nevertheless. the integration of plasmid DNA
was so prominent that it was easily detectable by resaiction digestion and hybndization of
the total invacellular DNA. The MIuI digestion of the total innacellular DNA greatly
aitered the pattern of the replicated plasrnid DNA on the gel due to the covalent attachent
of plasmid DNA to the viral DNA (Fig. 10). The efficient recombination of the replicated
plasmid DNA into the viral genorne suggests a high degree of involvement of illegitimate
recombination in the process of baculovhs DNA replication. These data are consistent
with other observations that the bacterial transposon Tn5, when inserted into the
baculovirus genome as an indicator for recombination, exhibits high levels of Tn5
inversion, a stmng indication for recornbination (Martin and Weber, 1997a).
The results presented here also demonstrate the presence of concatemers of
replicated plasmid DNA. in agreement with a previous observation suggesting that the
baculovims may use rolling-circle mode to replicate its DNA. However. the efficient
inteption of the replicated, concatemeric plasmid DNA into the viral genome suggests a
more complex mode of replication that may involve recombination. In the HSV-1 DNA
replication, while the concatemenc f o m of replicated viral DNA was easily detectable,
newly replicated virai DNA was composed of highly branched. complex networks. The
HSV-1 DNA replication process is more complex than a simple rolling-circle mode1 of
replication (Bataille and Epstein, 1995; Bataille and Epstein. 1994; Zhang et al.. 1994;
Severini et al., 1996; Severini sr al., 1994). Therefore, cautions must be taken in
interpreting data related to the structure of plasrnid DNA replicated in baculovirus infected
cells.
It is not clear how the process of baculoviral DNA replication promotes
incorporation of plasrnid DNA into the virai genome or whether the recombination process
and the replication initiation processes are directly linked. Such a mechanism has been
demonstrated in the bacteria phage T4 where the free 3' DNA ends of recombination
intermediates invade neighbouring genomes and serve as the primers for the initiation of
DNA replication (Mosig and Colowick, 1995; Mosig, 1987). Baculovirus DNA may use
such a mechanism to replicate its DNA at a late stage of replication when multiple genomes
are replicating in one single ceU. Some of the replication i n t e d i a t e s may have fkee DNA
ends that invade regions of neighbouring genomes.
Analysis of the integration sites of plasmid DNA revealed that plasmid DNA was
linked with different regions of the viral DNA, some of which were separated by as much
as 50 kb. These data suggest that non-homologous recombination between plasrnid DNA
and viral DNA could lead to deletion of large portions of the viral genome. It has also been
demonstrated that genomes of defective baculovinises carried large deletions of the viral
genome (Carstens. 1987; Carstens, 1982; Kool er al., 1993a; Kool et al., 199 1 ) . A
similar mechanism of non-homologous recombination could be responsible for the
pneration of defective genomes in both cases.
The plasmid replication. recornbination and integration in coaansfected cells may
suggest a way by which baculoviruses have acquired non-homologous DNA sequences
from host cells dunng evolution. For instance. the viral genes encoding PCNA and
ubiquitin may derive from the cellular homologues by such a mechanism. The few
polyhedra (FP) high frequency mutants certainly have cellular repeated sequences inserted
into the viral 25k gene region (Fraser et al., 1983: Bauser et of., 1996; Wang et al., 1989;
Miller and Miller. 1982). As suggested by the results in Fig. 17, the cellular sequences
may integrate into multiple sites around the viral genome. The viral 2% gene mutation has
a detectable selection marker, related to the polyhedra morphology. If more selection
markers were available, more integration sites would Iikely be revealed. For example. in
the polyhedra morphology mutant M5, two identical host cellular repetitive sequences of
290 bp were found inserted at the 2.6 and 46 map unit regions (Carstens, 1987),
supgesting that cellular sequences can be inserted at multiple locations on the viral
genome.
Cellular inserts in baculovirus usually consist of repeated or transposon like
elements, which suggest that the high integration efficiency may simply be due to their
repeated nature. For exarnple, the TE-D transposable element that inserted in the HinàIII-
K region of AcMNPV genome has approximately 50 copies dispersed throughout the host
T. ni genome (Miller and Miller, 1982). These elements have higher chances of integration
than unique cellular sequences. An alternative explanation is that these repeated or
transposon-like elements c m somehow isolate thernselves fiorn the cellular genome during
virus infection, and are replicated by the virus replication machinery and inegrated.
The observation of random integration of the plasmid DNA could lead to the
development of a new tool for the identification of functional viral genes or sequences
such as the viral packaging signal sequences. For example, cotransfection of viral DNA
with plasmids containing the E. coli mini-F origin would promote the integration of rnini-
F into numerous locations on the viral genomes. This integration may disrupt or delete
some functional p n e s or sequences. On the other hand, viral genomes containing the
mini-F insens would replicate in bacteria cells when aansfecteed into E. coli. The E. coli
amplified defective viral genomes could be re-transfected into insect cells for
charactenzation. Any disruption or modification of the normal functions of the virus could
be correlated with a rnini-F insertion in a particular location on the viral genome.
The observation of the efficient integration of plasrnid DNA into the viral genome
raises concems regarding the safety of using baculovirus as a biopesticide. Some of the
cellular homologues of oncogenes or retrovirus-like repeated sequences, as well as
genomes of baculovirus CO-infectants, may integrate into the baculovinis genome during
virus replication. These elements would be persisrently maintained in the population of
vimses as implicated in the studies of the plasmid DNA replication. integration and
packaging. The consequences of the integration of these foreign elements would cenallily
deserve close attention.
E. Conclusions
Replication of plasrnids carrying hr deletions indicated that h n did not function
specifically as the putative origins. Consistent with these data, recombinant viruses
carrying individual hr deletions replicated nomally even though these vimses contained
altered levels of products of viral early genes. In addition, plasmids carrying a series of
viral early p n e s replicated in the infected cells, suggesting that the cis-acting elements
required for the replication of the viral genome may be more widely dispersed on the viral
genome than onginally suggested (Pearson et ai., 1992). These data also implicated a
possible connection between replication initiation and gene transcription in baculovinis.
Replication of plasmid DNA in cells cotransfected with viral DNA was a contrast to
that in the infected cells. Multiple sequences replicated in the cotransfected cells and the
replication did not depend on the presence of specific viral sequences in cis. Rather, the
presence, in tram, of seven viral genes was essential and sufficient to initiate DNA
replication. These data suggest that the selecrion of a particular site of initiation rnay not be
determined directly by the primary DNA sequences. Other factors such as a chromatin-like
smicture on the viral genome may replate the process of initiation.
Analysis of DNA conformation revealed the existence of high molecular weight
concatemers of the replicated plasmid DNA, suggesting that a rolling-circle mode of DNA
replication may be involved. Ten to 25% of the replicated plasmid DNA was integrated
into the viral genome at multiple locations and this integntion may generate large deletions
on the viral genome. No particular sites or sequences were preferentially used for
integration, suggesting that a rnechanism of non-homoIogous recombination could be
involved. Therefore. the process of DNA replication in baculovinis must be prone to
generation of defective genomes, which have also been abundantly demonswted by others
(Carstens, 1987; Kool et al., 1993a; Kool et al., 1991).
Two viral proteins, E l and P143, rnay function as replication initiators by direct
interaction with the viral DNA during initiation. Due to an essential role of Pl43 during
replication, localization of Pl43 into the nucleus and assernbly of it ont0 viral DNA rnay
be vital for the initiation of DNA replication. Among the seven viral proteins required for
DNA replication, the single-stranded DNA binding protein LEF-3 was essential and
sufficient to mediate the nuclear localization of P143. LEF-3 and Pl43 colocdized in the
nucleus. suggesting that these two proteins rnay exist as a complex in the infacted celis. In
contrast, other vual proteins such as IE-1. LEF-1, LEF-2, DNA polymerase and P35 did
not cary the ability to mediate the nuclear localization of P143, suggesting that a direct
interaction between Pl43 and these viral factors may not exist. Pl43 has been
demonstrated to bind double-stranded DNA in a sequence non-specific fashion (Laufs et
al., 1997). which was implicated in this study to be responsible for the replication of
multiple sequences in the cotransfected cells. Direct interaction between the complex of
Pl43 and LEF-3 and the viral DNA rnay play a central role in the initiation of viral DNA
replication.
Together. regulation of the initiation of DNA replication in baculovinis appears to
be a complicated issue. The cis-acting elements that rnay be involved in the initiation of
DNA replication consist of a variety of different viral sequences including hrs (Pearson et
nl.. 1992). HhdIII-K (Lee and Krell. 1992) and regions containing viral early genes.
Although the replication initiator has not k e n identified, the putative helicase Pl43 was
implicated to play an important role in the initiation of DNA replication. Possible
replations such as restriction of specific viral sequences to be approachable by Pl43 rnay
determine certain specific sites to be used as genuine origins of replication. Understanding
the mechanism of initiation rnay have a broad implication in engineering and safe use of
baculovinis as an eficient biopesticide.
REFERENCES
Allen. G. C.Jr. and Komberg, A.(1991). Fine balance in the regulation of DnaB helicase by DnaC protein in replication in Escherichia coli. J . Ëiol. Chem. 266, 22096- 22 10 1 .
Anders, D. G.. Kacica, M. A., Pari, G., and Puntuneri, S. M.(1992). Boundaries and structure of human cytomegalovinis oriLyt, a cornplex origin for lytic-phase DNA replication. J . Virol. 66, 3373-3384.
Anders, D. G. and Punturien, S. M.(1991). Multicomponent ongin of cytomegalovinis lytic-phase DNA replication. J. Virol. 65,931-937.
Anderson, A. H., Bendixen. C., and Westergaard, 0.(1996). DNA replication in e~tkaryotic cells (DeParnphilis, M . L., Ed.) Cold Spring Harbor Laboratory Press, New York- 587-618.
Aoki, K., Ishida, R., and Kasai, M.(1997). Isolation and characterization of a cDNA encoding a translin-like protein, TRAX. FEBS Lett. 401, 109- 1 12.
Arai, K. -1.. Low, R.. Kobori, J.. Shlomai, J., and Kornberg, A.(l98 1). Mechanism of dnaB protein action V. Association of dnaB protein. protein nt, and other prepnming proteins in the pnmosome of DNA replication. J . Biol. Chem. 256.5273-5280.
Armentero, M. -T., Horwitz, M.. and Mermod. N.(1994). Targeting of DNA polymerase to the adenovirus origin of DNA replication by interaction with nuclear factor 1. Proc. Narf. Acad. Sci. USA 91, 11537-11541.
Ayres, M. D.. Howard. S. C.. Kuzio. J.. Lopez-Ferber, M., and Possee. R. D.(1994). The complete DNA sequence of Autographa califoniica nuclear polyhedrosis virus. Virology 202, 586-605.
Baker, T. A.(1995). Replication arrest. Celf 80. 52 1-524.
Bataille, D. and Epstein, A.(1994). Herpes simplex virus replicative concatemers contain L components in inverted orientation. Virology 203.384-388.
Bataille, D. and Epstein, A. L.(1995). Herpes simplex v h s type 1 replication and recombination. Biochimie 77, 787-795.
Bauer, G. A. and Burgers, P. M. J.(1988a). Protein-protein interactions of yeast DNA polymerase III with marnmalian and yeast proliferating ce11 nuclear antigen (PCNA)/cyclin. Biochim. Biophys. Acta 951, 274-279.
Bauer. G. A. and Burgers, P. M. J.(1988b). The yeast analog of mammalian cyclin/proliferating-ce11 nuclear antigen interacts with marnmalian DNA polymerase 6. Proc. Natl. Acad. Sci. USA 85, 7506-75 10.
Bauser, C. A-, Elick, T. A., and Fraser, M. J.(1996). Characterization of hitchhiker, a transposon insertion frequently associated with baculovinis FP mutants derived upon passage in the TN-368 ce11 line. Virology 216,235-237.
Bell, S. P. and Stillman, B.(1992). ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein cornplex. Nature 357, 128- 134.
Bernstein, J. A. and Richardson, C. C.(1989). Characterization of the helicase and primase activities of the 63-Da component of the bacteriophage TI p n e 4 protein. J . Biol. Chem. 264, 13066- 13073.
Bimboim, H. C. and Doly, J.(1979). A rapid aikaiine extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, 15 13- 15 10.
Biswas, E. E., Chen, P. -H., and Biswas, S. B.(1993). DNA helicase associated with DNA polymerase a: Isolation by a modified immunoaffinity chromatography. Biochemistry 32, 13393- 13398.
Btissard, G. W.. Kogan, P. H., Wei, R., and Rohrmann, G. F.(1992). A synthetic early promoter fiom a baculovirus: Roles of the TATA box and conserved start site CAGT sequence in basal levels of transcription. Virology 190, 783-793.
Blissard, G . W. and Rohrmann, G. F.(1990). Baculovinis diversity and rnolecular biology. Ami. Rev. Entornol. 35, 127- 155.
Blow. J. J. and Laskey, R. A.(1988). A role for the nuclear envelope in connolling DNA replication within the ce11 cycle. Norwe 332, 546-548.
Bochkarev, A.. Pfuetzner, R. A., Edwards, A. M., and Frappier, L.(1997). Structure of the single-stranded-DNA-binding domain of replication protein A bound to DNA. Narrtre 385, 176-181.
Boehmer, P. E. and Lehman, 1. R.(1997). Herpes simplex virus DNA replication. Ami. Rev. Biochent. 66, 347-384.
Borowiec, J. A.(1996). DNA replicotiori in eukaryoric cells (DePamphilis, M. L.. Ed.) Cold Spring Harbor Laboratory Press, New York. 545-574.
Borowiec, J. A., Dean, F. B., Bullock, P. A., and Hurwitz, J.(1990). Binding and unwinding--How T antigen engages the SV40 origin of DNA replication. C e l l 6 0 , 181-184.
Borowiec, J. A. and Hurwitz, J.(1988). Localized melting and structural changes in the SV40 origin of replication induced by T-antigen. EMBO J . 7,3 149-3 158.
Botchan, M.(1996). Coordinating DNA replication with ce11 division: Current status of the licensing concept. Proc. Natl. Acad. Sei. USA 93, 9997-10000.
Bravo, R., Frank, R.. Blundell, P. A., and Macdonald-Bravo. H.(1987). Cyclin/PCNA is the auxillary protein of DNA polymerase-delta. Nufure 326, 5 15-5 17.
Brosh, R. M.,Jr. and Matson, S. W.(1996). A partiaily fûnctional DNA helicase II mutant defective in forming stable binary complexes with ATP and DNA - A role for helicase motif III. J. Biol. Chem. 271, 25360-25368.
Brown, M., Crawford, A. M., and Faulkner, P.(1979). Genetic analysis of a baculovhs Autographa californica nuclear polyhedrosis virus. 1. Isolation of temperature- sensitive mutants and assonment into complementation groups. J . Virol. 31, 190-1 98.
Brown, M. and Fauikner, P.(1978). Plaque assay of nuclear polyhedrosis vimses in cell culture. Appl. Environ. Microbiol. 36, 31-35.
Brun, C., Surdej, P., and Miassod, R.(1993). Relationship between scaffold-anached regions, sequences replicating auronomousIy in yeast, and a chromosomal replication origin in the Drosophila rDNA. Exp. Ce11 Res. 208, 104-1 14.
Brusca, J., Summers, M.. Couch, I., and Courtney, L.(1986). Aurographa californico nuclear polyhedrosis v h s efficiently eneters but does not replicate in poikilothermic vertebrate cells. Intervirol. 26, 207-222.
Bueno, A. and Russell, P.(1992). DuaI functions of CDC6: A yeast protein required for DNA replication also inhibits nuclear division. EMBO J. 11, 2 167-2 176.
Burgers, P. M. J . ( W 1). Saccharomyces cer-evisiue replication factor C. II. Formation and activity of complexes with the proliferating ce11 nuclear antigen and with DNA polymerases 6 and CE. J. Biol. Chem. 266, 22698-22706.
Campbell, J. L.(1993). Yeast DNA replication. J. Biol. Chem. 268, 2526 1-25264.
Carbonell, L. F., Hodge, M. R., Tomaiski, M. D., and Miller, L. K(1988). Synthesis of a gene coding for an insect-specific scorpion neurotoxin and atternpts to express it using baculovirus vectors. Gene 73, 409-418.
Carson, D. D., Guarino, L. A., and Summers, M. D.(1988). Functional mapping of an AcNPV immediately early gene which augments expression of the IE- 1 tram-activated 39K gene. Virology 162,444-451.
Carson, D. D., Summers, M. D., and Guarino, L. A.(1991). Transient expression of the Alrtographa califortzica nuclear polyhedrosis virus immediate-early gene, IE-N, is regulated by three viral elements. J. Vir-ol. 65,945-95 1.
Carstens. E. B.(1982). Mapping the mutation site of an Autogropha colifonlica nuclear polyhedrosis virus polyhedron morphology mutant J . Virol. 43, 809-8 18.
Carstens, E. B.(1987). Identification and nucleotide sequence of the repions of Autographa colifornica nuclear polyhedrosis virus genome camying insertion elements from Spodoptera frugiperda. Virology 161, 8- 17.
Carstens, E. B., Lu, A. L., and Chan, H. B.(1993). Sequence, transcriptional mapping, and overexpression of p47, a baculovinis gene regulating late gene expression. J . Virol. 67, 25 13-2520.
Carstens, E. B., Tjia, S. T., and Doerfler, W.(1979). Infection of Spodoptera frugiperda cells with Autographa californica nuclear polyhedrosis virus. 1. Synthesis of inmacellular proteins after virus infection. Virology 99,386-398.
Carstens, E. B., Tjia, S. T., and Doerfler, W.(1980). Infectious DNA from Autographa califorwka nuclear poly hedrosis virus. Virology 101, 3 1 1-3 14.
Cartier, J. L., Hershberger, P. A., and Fnesen, P. D.(1994). Suppression of apoptosis in insect cells stably transfected with baculovirus p35: Dominant interference by N- terminal sequences p351-76. J. Virol. 68,7728-7737.
Challberg, M.(1996). DNA replication in eukaryoric cells (DeParnphilis, M . L., Ed.) Cold Spnng Harbor Laboratory Press, Cold Spnng Harbor, NY. 721-750.
Challberg, M. D. and Kelly, T. J.(1979). Adenovims DNA replication in vitro. Proc. Natl. Acad. Sci. USA 76, 655-659.
Challberg. M. D. and Kelly. T. J.(1989). Animal virus DNA replication. Arin. Rev. Biochem. 58, 671-717.
Challberg. M. D. and Kelly, T. J. J.(1979). Adenovinis DNA replication in vitro: origin and direction of daughter swnd synthesis. J. Mol. Biol. 135, 999-1012.
Chase, J. W. and Williams, K. R.(1986). Single-stranded DNA binding proteins required for DNA replication. Anri. Rev. Biochem. 55, 103-136.
Chejanovsky, N., Zilberberg, N., Rivkin, H., Zlotkin, E., and Gurevitz, M.(1995). Functional expression of an alpha anti-insect scorpion neurotoxin in insect cells and lepidopterous larvae. FEBS Lett. 376, 18 1 - 184.
Chen, M., Pan, 2. -Q., and Hurwitz, J.(1992). Studies of the cloned 37-kDa subunit of activator 1 (replication factor C) of HeLa cells. Proc. Natl. Acad. Sci. USA 89, 521 1- 5215.
Cheng, L. and Kelly, T. J.(1989). Transcriptional activator nuclear factor 1 stimulates the replication of SV40 minichromosomes in vivo and in vitro. Ceil 59,541-55 1.
Chiang. C. -S., Xu, Y. -Ce, and Bremer, H.(1991). Role of DnaA protein during replication of plasmid pBR322 in Escherichia coli. MGG 225,435-442.
Chisholm, G. E. and Henner, D. J.(1988). Multiple early aanscripts and splicing of the Aictographa californica nuclear polyhedrosis virus IE-1 gene. J. Viro1.62. 3193- 3200.
Choi, J. and Guarino, L. A.(1995a). A temperature-sensitive IEI protein of Autogropha californica nuclear polyhedrosis virus has altered transactivation and DNA binding activities. Virology 209, 90-98.
Choi, J. and Guarino. L. A.(1995b). The baculovirus transactivator E l binds to viral enhancer elements in the absence of insect ce11 factors. J. Virol. 69,4548-455 1.
Choi, J. and Guarino, L. A.(1995c). Expression of the 1El transactivator of Azltographa coiiforriicu nuclear polyhedrosis virus during viral infection. Viroiogy 209, 99-107.
Chong, J. P. J.. Mahbubani, H. M., Khoo, C. -Y., and Blow, J. J.(1995). Purification of an MCM-containing complex as a component of the DNA replication licensinp system. Nature 375, 41 8-42 1.
Chong, J. P. J., Thomrnes, P., and Blow, J. J.(1996). The role of MCM/Pl proteins in the licensing of DNA replication. Trends Biochem. Sei. 21, 102- 106.
Cochran. M. A. and Faulkner, P.(1983). Location of homologous DNA sequences interspersed at five regions of the baculovims AcMNPV genome. J. Virol. 45. 961- 970.
Coenjaerts, F. E. J. and Van der Vliet, P. C.(1994). Early dissociation of nuclear factor 1 from the origin during initiation of adenovirus DNA replicarion studied by origin immobilization. Nrtcleic Acids Res. 22, 5235-5240.
Coenjaerts, F. E. J., Van Oosterhout, J. A. W. M., and Van der Vliet. P. C(1994). The Oct-1 POU domain stimulates adenovirus DNA replication by a direct interaction between the viral precursor terminal protein-DNA polymerase complex and the POU homeodomain. EMBO J. 13, 540 1-5409.
Coghlan, A.(1994). Will the scorpion gene run wild? New Scientist 142 No. 1931. 14-15.
Collins, 1. and Newlon, C. S.(1994). Chromosomal DNA replication initiates at the same origins in meiosis and mitosis. Mol. Cell. Biol. 14, 3524-3534.
Collins, K. L. and Kelly. T. J.(1991). Effects of T antigen and replication protein A on the initiation of DNA synthesis by DNA polymerase a-primase. Mol. Cell. Biol. I l , 2108-21 15.
Collins. K. L., Russo, A. A. R, Tseng. B. Y.. and Kelly, T. J.(1993). The role of the 70 kDa subunit of human DNA polymerase a in DNA replication. EMBO J. 12. 4555-4566.
Copeland, W. C. and Wang. T. S. -F.(1991). Catalytic subunit of human DNA polymerase a overproduced frorn baculovirus-infected insect cells. Structural and enzymological characterization. J. Biol. Chem. 266.22739-22748.
Copeland, W. C. and Wang. T. S. -F.(1993). Enzymatic characterization of the individual rnamrnalian pnmase subunits reveals a biphasic mechanism for initiation of DNA replication. J. Biol. Chem. 268. 26 179-26 189.
Coverley. D. and Laskey. R. A.(1994). Regulation of eukaryotic DNA replication. A m . Rev. Biochem. 63. 745-776.
Crawford. A. M. and Miller, L. K(1988). Charactenzation of an early gene accelerating expression of late genes of the baculovirus Autographa califorriica nuclear polyhedrosis virus. J. Virol. 62, 2773-2781.
Croizier. G., Croizier. L.. Argaud, O., and Poudevigne, D.(1994). Extension of Autographa califorrzic~ nuclear polyhedrosis virus host range by interspecific replacement of a short DNA sequence in the pl43 helicase gene. Proc. Natl. Acad. Sci. USA 91. 48-52.
Dabrowski, C. E.. Carmillo. P. J., and Schaffer. P. A.(1994). Cellular protein interactions with herpes simplex virus type 1 oriS. Mol. Cell. Biol. 14. 254-2555
Dabrowski. C. E. and Schaffer, P. A.(1991). Herpes simplex virus type 1 origin-specific binding protein: ois-binding properties and effects of cellular proteins. J . Vb-of. 65. 3140-3150.
Dahmann. C., Diffley, J. F. X., and Nasmyth, K. A.(1995). S-phase-promoting cyclin- dependent kinases prevent re-replication by inhibiting the transition of replication origins to a pre-replicative state. Current Biology 5 , 1257- 1269.
de Zarnaroczy, M. and Bemardi, G.(1986). The pnmary structure of the mitochondrial genorne of saccharomyces cerevisiae-a review. Gerie 47, 155- 177.
DePanphilis. M. L.(1993). Eukaryotic DNA replication: Anatomy of an ongin. A m . Rev. Biochem. 62, 29-63.
Diffley. J. F. X. and Cocker. J. H.(1992). hotein-DNA interactions at a yeast replication origin. Natiu-e 357, 169- 172.
Diffley. J. F. X.. Cocker. J. H., Dowell. S. J., and Rowley, A.(1994). Two steps in the assembly of complexes at yeast replication origins in vivo. Cell78,303-3 16.
Domreiter, L, Copeland, W. C., and Wang, T. S. -F.(1993). Initiation of simian virus 40 DNA replication requires the interaction of a specific domain of human DNA polyrnerase a with large T antigen. Mol. Cell. Biol. 13,809-820.
Egelman, E. H., Yu, X., Wild, R., Hingorani, M. M., and Patel, S. S.(1995). Bacteriophage T7 helicaselprimase proteins form rings around single-stranded DNA that suggest a general structure for hexameric helicases. Proc. Natl. Acad. Sci. USA 92, 3869-3873.
Elias, P. and Lehman, 1. R.(1988). Interaction of origin binding protein with an origin of replication of herpes simplex virus 1. Proc. Natl. Acad. Sei. USA 85,2959-2963.
Erdile, L. F., Heyer, W. -D., Kolodner, R., and Keily, T. J.(l99 1). Characterization of a cDNA encoding the 70-kDa single-stranded DNA-binding subunit of human replication protein A and the role of the protein in DNA replication. J . Biol. Chem. 266, 12090-12098.
Erlandson, M. A., Skepasts, P.. Kuzio, J., and Carstens, E. B.(1984). Genornic variants of a temperature-sensitive mutant of Autogropha californica nuclear polyhedrosis virus containing specific reiterations of viral DNA. Vincr Res. 1,565-584.
Evans, J. T., Leisy, D. J., and Rohrmann, G. F.(1997). Characterization of the interaction between the Baculovinis replication factors LEF-l and LEF-2. J . Virol. 71. 31 14-31 19.
Evans, J. T. and Rohrmann, G. F.(1997). The baculovirus single-stranded DNA binding protein, LEF-3. forms a homotrimer in solution. J . Virol. 71, 3574-3579.
Fangman, W. L. and Brewer. B. J.(1991). Activation of replication origins within yeast chromosomes. Atitirr. Rev. Cell Biol. 7 , 375-402.
Feinberg, A. P. and Vogelsiein, B.(1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Analytical Biochemistry 132, 6- 13.
Fien, K. and Stillman, B.(1992). Identification of replication factor C from Saccharomyces cerevisiae: A component of the leading-strand DNA replication complex. Mol. Cell. Biol. 12, 155- 163.
Fciani, M., Marini, F., Gamba, D., Lucchini, G., and Plevani, P.(1994). The B subunit of the DNA polymerase a-primase complex in Saccharomyces cerevisiae executes an essential function at the initial stage of DNA replication. Mol. Cell. Biol. 14, 923-933.
Fraser, M. J. and Hink, W. F.(1982). The isolation and characterization of the MP and FP variants of Galleria rnellortella nuclear polyhedrosis virus. Virology 117, 366-378.
Fraser, M. J., Smith. G. E., and Summers, M. D.(1983). Acquisition of host ce11 DNA sequences by baculoviruses: Relationship between host DNA insertions and FP
mutants of Autwra~ha californicg and -a nuclear polyhedrosis vims. J . Virol. 47, 287-300.
Fuller, R. S., Funnell, B. E.. and Komberg, A.(1984). The dnaA protein complex with the E.coli chromosomal replication origin (oriC) and other DNA sites. Cell38, 889- 900.
Funnell, B. E., Baker, T. A., and Komberg, A.(1986). Complete enzymatic replication of plasmids containing the origin of the Exchenchia coli chromosome. J. Biol. Chem. 261, 5616-5624.
Gahn, T. A. and Schildkraut, C. L.(1989). The Epstein-Barr virus origin of plasrnid replication, oriP, contains both the initiation and temllnation sites of DNA replication. Cell 58, 527-535.
Garber, D. A., Beverley, S. M., and Coen, D. M.(1993). Demonstration of circularization of herpes simplex virus DNA following infection using pulsed field gel electrophoresis. Virology 197,459-462.
Georgaki, A.. Tuteja, N., Sturzenegger, B., and Hübscher, U.(1994). Calf thymus DNA helicase F, a replication protein A copurifying enzyme. Nucleic ~ c i d s Res. 22, 1128- 1 134.
Gilbert, D. M., Miyazawa, H., and DePamphilis, M. L.(1995a). Site-specific initiation of DNA replication in Xerzopus egg extract requires nuclear structure. Mol. Cell. Biol. 15, 2942-2954.
Gilbert, D. M., Miyazawa, H., and DePamphilis, M. L.(1995b). Site-specific initiation of DNA replication in xenopus egg extract requires nuclear structure. Mol. Cell. Biol. 15, 2942-2954.
Gilbert, D. M., Miyazawa, H., Nallaseth. F. S., Onega, J. M., Blow. J. J., and DePamphilis, M. L.(1993). Site-specific initiation of DNA replication in metazoan chromosomes and the role of nuclear organization. 58,475-485.
Gille, H. and Messer, W.(I99 1). LocaIized DNA melting and structural pertu bations in the origin of replication. oriC, of Escherichia coli iri vitro and in vivo. EMBO J . 10, 1579-1584.
Goetz, G. S., Dean, F. B., Hurwitz, J., and Matson, S. W.(1988). The unwinding of duplex regions in DNA by the Simian v h s 40 large tumor antigen-associated DNA helicase activity. J . Biol. Chem. 263,383-392.
Gomes, X. V.. Henricksen, L. A., and Wold, M. S.(1996). Proteolytic mapping of human replication protein A: Evidence for multiple structural domains and a conformational change upon interaction with single-stranded DNA. Biochemisrry 35, 5586-5595.
Gong, M. and Guarino, L. A.(1994). Expression of the 39k promoter of Autographa californico nuclear polyhedrosis virus is increased by the apoptotic suppressor P35. Virology 204, 3 8-44.
Gorbalenya, A. E. and Koonin, E. V.(1989). One more conserved sequence motif in helicases. Nucleic Acids Res. 16, 7734.
Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P., and Blinov, V. M.(1989). Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genornes. Nucleic Acidr Res. 17, 47 13-4730.
Gorbalenya, A. F. and Koonin, E. V.(1993). Helicases: amino acid sequence cornparisons and structure-function relationships. Current Opinion in Sfructural Biology 3, 419-429.
Gordon, J. D. and Carstens, E. B.(1984). Phenotypic characierization and physical mapping of a temperature-sensitive mutant of Autographa californica nuclear polyhedrosis virus defective in DNA synthesis. Virology 138.69-8 1.
Graham, B. J., Bengali, 2.. and van de Woude, G. F.(1978). Physical map of the origin of defective DNA in herpes simplex virus type 1 DNA. J. Virol. 25,878-887.
Granados, R. R. and Lawler, K. A.(1981). In vivo pathway of Autographa califomica baculovirus invasion and infection. Virology 108. 297-308.
Granados, R. R. and Williams, K. A.(1986). The biology of bacu~ovin~ses (Granados, R. R. and Federici, B. A., Eds.) CRC Press Inc., Boca Raton,Florida. 89-108.
Graves-Woodward, K. L. and Weller, S. K.(1996). Replacement of ~ 1 ~ 8 1 5 in helicase motif V dters the single-stranded DNA-dependent ATPase activity of the herpes simplex virus type 1 helicase-primase. J. Biol. Chem. 271, 13629- 13635.
Greenfeder, S. A. and Newlon, C. S.(1992). A replication map of a 61 kb circular derivative of Saccharomyces cerevisiae chromosome I I I . Mol. Biol. Ce l l3 , 999- 101 3.
Groner, A.(1986). The biology of baculoviruses, Volitrne I (Granados. R . R. and Federici, B. A., Eds.) CRC Press Inc., Boca Raton, Fl.. 177-202.
Gross-Bellard, M., Oudet, P., and Chambon. P.( 1973). Isolation of high-molecular- weight DNA from mamrnalian cells. Ercr. J. Biocheni. 36, 32-38.
GNSS. C., Gutierrez, C., Burhans, W. C., DePanphilis, M. L., Koller. T., and Sogo, J. M.(1990). Nucleosome assernbly in mamrnalian cell extracts before and after DNA replication. EMBO J. 9, 29 1 1-2922.
Guarino, L. A. and Dong, W.(1991). Expression of an enhancer-binding protein in insect cells msfected with the Autographa californica nuclear polyhedrosis virus El gene. J . Virol. 65, 3676-3680.
Guarino, L. A., Gonzalez, M. A., and Sumrners, M. D.(1986). Complete sequence and enhancer function of the homologous DNA regions of Autogrupha caiifornica nuclear polyhedrosis virus. J. Virol. 60, 224-229.
Guarino, L. A. and Smith, M.(1992). Replation of delayed-early gene transcription by dual TATA boxes. J. Virol. 66,3733-3739.
Guarino, L. A. and Sumrners, M. D.(1986a). Interspersed homologous DNA of Autographa californica nuclear polyhedrosis virus enhances delayed-early gene expression. J . Virol. 60, 2 15-223.
Guarino, L. A. and Summers, M. D.(1986b). Functional mapping of a uans-activating gene required for expression of a delayed-early gene. J . Virol. 57. 563-57 1.
Guarino, L. A. and Summers, M. D.(1987). Nucleotide sequence and temporal expression of a baculovims regulatory gene. J. Virol. 61,209 1-2099.
Guarino, L. A. and Sumrners, M. D.(1988). Functional mapping of Aurographa californica nuclear polyhedrosis virus genes required for Iate gene expression. J. Virol. 62, 463-47 1.
Guo, 2. -S. . Gutierrez, C., Heine, U., Sogo, J. M., and DeParnphilis, M. L.(1989j. Origin auxiliary sequences can facilitate initiation of sirnian virus 40 DNA replication in vitro as they do in vivo. Moi. Celi. Biol. 9, 3593-3602.
Guo, 2. -S., Heine. U., and DePamphilis, M. L.(1991). T-antigen binding to site I facilitates initiation of SV40 DNA replication but does not affect bidirectionality. Nrrcieic Acids Res. 19, 708 1-7088.
Guo, 2. S. and DeParnphiIis, M. L.(1992). Specific transcription factors stimulate simian virus 40 and polyomavirus origins of DNA replication. Mol. Cell. Biol. 12, 2514- 2524.
Gussander, E. and Adams, A.(1984). Electron microscopie evidence for replication of circular Epstein-Barr vims genomes in latentiy infeckd Raji cells. J. vil-oi. 53, 549- 556.
Gutierrez, C., Guo, 2. -S., Roberts, J., and DePamphilis, M. L.(1990). Simian virus 40 origin auxiliary sequences weakly facilitate T-antigen binding but strongly facilitate DNA unwinding. Mol. Ceil. Biol. 10, 17 19-1728.
Hagmeyer, B. M., Konig, H., Herr, I., Offringa. R., Zantema, A., Van der Eb, A. J., Herrlich, P., and A n p l , P.(1993). Adenovirus E1A negatively and positively
modulates transcription of AP- 1 dependent genes by dimer-specific regulation of the DNA binding and transactivation activities of Jun. EMBO J. 12,3559-3572.
Hall, M. C. and Matson, S. W.(1997). Mutation of a highly conserved arginine in motif IV of Escherichia coli DNA helicase I I results in an ATP-binding defect. J . Biof. Chem. 272, 18614-18620.
Hamlin, J. L., Mosca, P. J., and Levenson, V. V.(1994). Defining ongins of replication in mammalian cells. Biochimica et Biophysica Acta: Reviews on Cancer 1198, 85- 111.
Harnrnarsten, O., Elias, P., and Stow, N. D.(1996). Charactenzation of a binding site for the herpes simplex virus type 1 UL9 origin-binding protein within the UL9 gene. J. Gen. Virol. 77, 969-976.
Hamzeh, F. M., Lietman, P. S., Gibson, W., and Hayward, G. S.(1990). Identification of the lytic origin of DNA replication in human cytomegalovirus by a novel approach utilizing ganciclovir-induced chah termination. J. Virol. 64.6 184-6 195.
Hanahan, D.(1983). Stuàies on transformation of Escherichia coli with plasrnids. J . Mol. Biof. 166, 557-580.
Hang, X., Dong, W., and Guarino, L. A.(1995). The lef-3 gene of Autogropha califor~lica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein. J . Virol. 69, 3924-3928.
Harland, R. M. and Laskey, R. A.(1980). Regulated replication of DNA microinjected into eggs of Xenopus laevis. Ce11 2 1. 76 1-77 1.
Harrison, S., Fisenne, K., and Hearing. J.(1994). Sequence requirements of the Epstein- Barr virus latent origin of DNA replication. J. Virol. 68, 191 3- 1925.
Hassell, J. A. and Brinton, B. T.(1996). DNA replication il1 eukoryotic cells (DePamphilis, M . L., Ed.) Cold Spnng Harbor Laboratory Press, New York. 639- 678.
Hatfield, L. and Hearing, P.(1993). The NFIWOCT-1 binding site stimulates adenovhs DNA replication in vivo and is functionally redundant with adjacent sequences. J. Vil-01. 67, 393 1-3939.
Hay. R. T. and DePamphilis, M. L.(1982). Initiation of SV40 DNA replication in vivo: Location and structure of 5' ends of DNA synthesized in the on region. Ce11 28,767- 779.
He, J. K. and Huang, L.(1997). Growth inhibition of human papillomavirus 16 DNA- positive mouse tumor by antisense RNA transcribed from U6 promoter. Cancer Research 57, 3993-3999.
He, 2.. Bnnton, B. T.. Greenblatt, J., Hassell, J. A., and Ingles, C. J.(1993). The transactivator proteins vp16 and gal4 bind replication factor a. Cell 73, 1223- 1232.
Heimpel. A. M.(1966). Exposure of white mice and guinea pigs to the nuclear polyhedrosis of the cabbage looper, Tnch~plusia ni. J . Invertebr. Parhol. 8,98402.
Heintz, N. H.(1992). Transcription factors and the control of DNA replication. Curr. Opin. Ce11 Biol. 4,459-467.
Heinzel, S. S., Krysan, P. J., Tran, C. T., and Calos. M. P.(1991). Autonomous DNA replication in human ceus is affected by the size and the source of the DNA. Mol. Cell. Biol. 11 , 2263-2272.
Hoang, A. T.. Wang. W., and Gralla, J. D.(1992). The replication activation potential of selected RNA polymerase iX promoter elements at the Simian Virus 40 origin. Mol. Cell. Biol. 12, 3087-3093.
Hodgman, T. C(1988). A new superfamily of replicative proteins. Nature (London) 333, 22-23.
Hsieh, D. -J., Camiolo, S. M., and Yates, J. L.(1993). Constitutive binding of EBNAl protein to the Epstein-Barr virus replication origin, oriP, with distonion of DNA structure dunng latent infection. EMBO J. 12,4933-4944.
Huh. N. E. and Weaver, R. F.(1990a). Categorizing some early and late transcripts directed by the Autogropha califonlica nuclear polyhedrosis virus. J. Geri. Vil-01.71. 21 95-2200.
Huh. N. E. and Weaver, R. F.(1990b). Identifying the RNA polymerases that synthesize specific transcnpts of the Autogropha califonzicu nuclear polyhedrosis virus. J. Gen. Virol. 71 , 195-201.
Hyrien, O., Maric, C., and Méchali, M.(1995). Transition in specification of embryonic metazoan DNA replication origins. Scietlce 270, 994-997.
Igarashi. K., Fawl, R.9 Roller, R. J., and Roizman, %.(1993). Construction and propenies of a recombinant herpes simplex virus 1 lacking both S-component origins of DNA synthesis. J . Virol. 67, 2123-2132.
Ignoffo, C. A.(1975). Bac~tZoviruses for insect Pest control: sufery comiderarions (Summers, M . , Engler, R., Falcon, L. A., and Vail, P.. Eds.) Amencan Society for Microbiology, Washington, DC. 52-57.
Ignoffo, C. M. and Rafajko, R. F.(1973). In vitro attempts to infect primate ce11 lines with the nucleopolyhedrosis vins of Heliothis. J. Invertebr. ~a tho l . 20. 32 1- 325.
Jacob, F., Brenner, S., and Cuzin, F.(1964). On the regulation of DNA replication in bacteria Coid Spring Harbor Symp. Quunt. Biol. 28,329-348.
Jezewska, M. J. and Bujalowski, W.(1996). Global conformational transitions in Escherichia coli primary replicative helicase DnaB protein induced by ATP, ADP, and single-stranded DNA binding - Multiple conformational, States of the helicase hexamer. J. Biol. Chem. 271,4261-4265.
Jezewska, M. J., Kim, U. S.. and Bujalowski, W.(1996). Binding of Escherichia coli primary replicative helicase DnaB protein to single-stranded DNA. Long-range allostenc conformational changes within the protein hexamer. Biochernistry 35, 2129-2145.
Kamita, S. G. and Maeda. S.(1997). Sequencing of the putative DNA helicase-encoding p n e of the Bombyx rnori nuclear polyhedrosis vins and fine-mapping of a region involved in host range expansion. Gerie 190, 173-179.
Kelly, D. C.(1981). Baculovhs replication: Stimulation of thymidine kinase and DNA polymerase activities in Spodoptera ffugiperda cells infected with Trichoplusia ni nuclear p;olyhedrosis virus. J. Gen. Virol. 52, 313-319.
Kelly, T. J.(1988). SV40 DNA replication. J . Bioi. Chem. 263, 17889- 17892.
Kelman, Z(1997). PCNA: Smcture, functions and interactions. Oncogetle 14, 629-640.
Kelman, 2. and OtDonnell, M.(1995). Smictural and functional similarities of prokaryotic and eukaryotic DNA polymerase sliding clamps. N~icleic Acids Res. 23, 36 13-3620.
Kenny, M. K., Lee, S. -H., and Hurwitz. J.(1989). Multiple functions of human single- stranded-DNA binding protein in simian vims 40 DNA replication: Single-suand stabilization and stimulation of DNA polymerases a and 6. Proc. Natf. Acad. Sci. USA 86, 9757-9761.
Kesti, T., Frantti, H., and Syvaoja, J. E.(1993). Molecular cloning of the cDNA for the catalytic subunit of human DNA polymerase E. J . BioL Chem. 268, 10238- 10245.
Kim, Y. T. and Richardson, C. C.(1993). Bactenophage T7 gene 2 J protein: An essential protein for DNA replication. Proc. Natl. Acad. Sci. USA 90, 10 173- 10 177.
King, A. J. and Van der Vliet, P. C.(1994). A precursor terminal protein-trinucleotide intermediate during initiation of adenovirus DNA replication: Regeneration of molecular ends i~r vitro by a jumping back mechanism. EMBO J. 13,5786-5792.
Kitsberg, D., Selig, S., Brandeis, M., Simon, I., Keshet, I., Driscoll, D. J., Nicholls, R. D., and Cedar, H.(1993a). Allele-specific replication timing of i m p ~ t e d gene regions. Nartrre 364, 459-463.
Kitsberg, D., Selig, S., Keshet, L, and Cedar, K(1993b). Replication structure of the human beta-globin gene domain. Nature 366,588-590.
Klobutcher, L. A.(1995). Developmentally excised DNA sequences in euplotes crussur capable of fomiing G quartets. Proc. Natl. Acad. Sei. USA 92, 1979- 1983.
Knudson, D. L. and Tinsley, T. W.(1974). Replicating nuclear polyhedrosis virus in a continuous ce11 culture of Spodoptera frugiperda: Purification, assay of infectivity and growth charactenstics of the virus. J. Virol. 14.934444.
Kondo, A. and Maeda, S.(1991). Host range expansion by recombination of the baculovinises Bombyx mori nuclear polyhedrosis virus and Aurographa caiiforrzica nuclear polyhedrosis virus. J. Virol. 65,3625-3632.
Kool, M., Ahrens, C. H., Goldbach, R. W., Rohnnann, G. F., and Vlak, J. M.(1994a). Identification of p n e s involved in DNA replication of the Autogropha califtornica baculovims. Proc. Narl. Acad. Sci. USA 91, 1 12 12- 1 12 16.
Kool, M., Ahrens, C. H., Vlak, J. M.. and Rohrmann, G. F.(1995). Replication of baculovims DNA. J . Getz. Virol. 76, 2103-21 18.
Kool, M., Goldbach, R. W., and Vlak, J. M.(1994b). A putative non-hr ongin of DNA replication in the HirrdIII-K fragment of Autographa califorriico multiple nucleocapsid nuclear polyhedrosis virus. J . Gen. Virol. 75, 3345-3352.
Kool, M.. Van den Berg, P. M. M. M., Tramper, J., Goldbach, R. W., and Vlak, J. M.(1993a). Location of two putative origins of DNA replication of Aitrographa califor-riica nuclear polyhedrosis virus. Viroiogy 192, 94- 10 1.
Kool, M., Voeten, J. T. M., Goldbach, R. W.. Tramper, J., and Vlak, J. M.(1993b). Identification of seven putative origins of A urographo californica multiple nucleocapsid nuclear polyhedrosis vims DNA replication. J. Gen. Virol. 74, 2661- 2668.
Kool, M., Voeten, J. T. M., Goldbach, R. W., and Vlak. J. M.(1994c). Functional mapping of regions of the Aurographa californica nuclear polyhedrosis virai genome required for DNA replication. Virology 198,680-689.
Kool, M., Voncken, J. W., Van Lier, F. L. J., Tramper, J., and Vlak, J. M.(1991). Detection and analysis of Aittographa californica nuclear polyhedrosis virus mutants with defective interfenng properties. Virology 183.739-746.
Koonin, E. V.(1993). A common set of conserved motifs in a vast variety of putative nucleic acid-dependent ATPases including MCM proteins involved in the initiation of eukaryotic DNA replication. Nucfeic Acids Res. 21, 254 1-2547.
Kornberg, A. and Baker, T. A.(1992). DNA replication, W.H.Freeman and Company, New York.
Kovacs, G. R., Choi. J., Guarino, L. A., and Surnmers, M. D.(1992). Functional dissection of the Autographa californica nuclear pol yhedrosis virus immediate-early 1 transcriptional regulatory protein. J. Virof. 66,7429-7437.
Kovacs, G. R.. Guarino, L. A., and Summen. M. D.(1991). Novel regulatory properties of the IEl and IEO transactivators encoded by the baculovinis Autogropha californica mu1 ticapsid nuclear polyhedrosis virus. J. Virof. 65,528 1-528 8.
Kowalski, D. and Eddy, M. J.(1989). The DNA unwinding elernent: A novel, cis-acting component that facilitates opening of the Escherichia coli replication ongin. EMBO J. 8, 4335-4344.
Krappa, R.. Behn-Krappa. A., Jahnel. F., Doerfîer, W., and Knebel-Morsdorf, D.(1992). Differential factor binding at the promoter of early baculovirus gene PE38 during viral infection: GATA motif is recoinized by an insect protein. ~ . - ~ i r o f . 66. 3494-3503.
Krappa, R.. Roncarati, R., and Knebel-Morsdorf, D.(1995). Expression of PE38 and IE2, viral members of the C3HC4 finger family, dunng Baculovhs infection: PE38 and XE2 localize to distinct nuclear regions. J. Virol. 69, 5287-5293.
Krishna, T. S. R., Kong, X. -P., Gary, S., Burgers, P. M., and Kunyan, J.(1994). Crystal structure of the eukaryotic DNA polymerase processivity factor PCNA. Ce11 79, 1233-1243.
Krysan, P. J., Haase, S. B., and Calos, M. P.(1989). Isolation of human sequences that replicate autonomously in human celis. Mol. CelI. Biol. 9. 1026- 1033.
Kubota, T.. Katayama, T., ho, Y., Mizushima, T., and Sekimizu, K.(1997). Conformational transition of DnaA protein by ATP: Sûuctural analysis of DnaA protein. the initiator of Escherichia coli chromosome replication. Biochem. Biophys. Res. Cornrnrr~t. 232, 130- 135.
Kubota, Y., Mimura, S., Nishimoto, S., Takisawa, H., and Nojima, H.(1995). Identification of the yeast MCM3-related protein as a component of Xenopus DNA replication licensing factor. Celf81,601-609.
Kung. S. H. and Medveczky, P. G.(1996). Identification of a herpesvirus Saimin cis- acting DNA fragment that permits stable replication of episomes in transformed T cells. J. Virol. 70, 1738- 1744.
Kunkel, T. A. and Bebenek, K(1988). Recent studies of the fidelity of DNA synthesis. Biochim. Biophys. Acta 951, 1-15.
Kuriyan. J. and OtDonnell. M.(1993). Sliding clamps of DNA polymerases. J. Mol. Biol. 234, 9 15-925.
Laernrnli, U. K.(197O). Cleavage of stmctural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227,680-685.
Laufs, S., Lu, A., ArreII, L. K., and Carstens, E. B.(1997). Autographa californica nuclear polyhedrosis virus pl43 gene product is a DNA-binding protein. Virology 228, 98-106.
LeBowitz, J. H. and McMacken, R.(1986). The Escherichia coli dnaB replication protein is a DNA helicase. J. Biol. Chem. 261,4738-4748.
Lee, H. Y. and Krell, P. J.(1992). Generation and analysis of defective genomes of Autographa californica nuclear polyhedrosis virus. J. Virol. 66,4339-4347.
Lee, P. W. and Leone, G.(1994). Reovinis protein sigma 1: from cell attachment to protein oligomerization and folding mechanisrns. BioEssays 16. 199-206.
Lee, S. -H. and Hurwitz, J.(1990). Mechanism of elongation of primed DNA by DNA polyrnerase 6, proliferating ceIl nuclear antigen, and activator 1. Proc. Nd. Acad. Sci. USA 87, 5672-5676.
Lee, S. H., Pan. 2. Q., Kwong, A. D., Burgers, P. M., and Hunvitz, J.(1991). Synthesis of DNA by DNA polymerase E irr vitro. J . Biol. Chem. 266, 22707-22717.
Leem, S. H., Ropp, P. A., and Sugino, A.(1994). The yeast Saccharomyces cerevisioe DNA polymerase IV: Possible involvernent in double strand break DNA repair. Nucleic Acids Res. 22, 30 1 1-301 7.
Leisy. D. J., Rasmussen, C., Kim, H. -T., and Rohrmann, G. F.(1995). The Ai<rographa califoniica nuclear polyhedrosis virus homologous region la: Identical sequences are essential for DNA replication activity and transcnptional enhancer function. Virology 208. 742-752.
Leisy, D. J. and Rohrrnann. G. F.(1993). Characterization of the replication of plasrnids containhg hr sequences in baculovinis-infected Spodopterajhigiperda cells. Virology 196, 722-730.
Li, R. and Botchan, M. R.(1993). The acidic transcriptional activation domains of VP16 and p53 bind the cellular replication protein A and stimulate in vitro BPV-1 DNA replication. Cell73, 1207- 122 1 .
Li, X., Tan, C. -K., So, A. G., and Downey. K. M.(1992a). Purification and characterization of 6 helicase from fetai calf thymus. Biochemistry 31,3507-3513.
Li, X., Yoder, B. L., and Burgen, P. M. J.(1992b). A Saccharomyces ce)-evisioe DNA helicase associated with replication factor C. J. Biol. Chem. 267, 25321-25327.
Li,
Li,
X. Y.. Li. J., Hamngton, J.. Lieber. M. R.. and Burgers, P. M. J.(1995). Lagging suand DNA synthesis at the eukaryotic replication fork involves binding and stimulation of FEN- 1 by proliferating ce11 nuclear antigen. J . Biol. Chem. 270.22109- 221 12.
Y.. Passarelli, A. L., and Miller. L. K.(1993). Identification. sequence. and transcriptional mapping of lef-3. a baculovirus gene involved in late and very late gene expression. J. Virof .67. 5260-5268.
Liang. C.. Weinreich, M., and Stillman, B.(1995). ORC and Cdc6p interact and d e t e d e die frequency of initiation of DNA replication in the genome. Ce11 81,667- 676.
Little, R. D. and Schildkraut, C. L.(1995). Initiation of latent DNA replication in the Epstein-Barr virus genome can occur at sites other than the pnetically defined ongin. Mol. Cell. Biol. 15, 2893-2903.
Liu, G.(1997). Site-directed mutagenesis of the Autographa californica multicapsid nuclear polyhedrosis virus (AcMNPV) P143: Effects on viral DNA replication. Ph.D. thesis. Queen's University, Kingston. Ontario.
Lockshon, D. and Galloway. D. A.(1988). Sequence and structural requirements of a herpes simplex viral DNA replication origin. Mol. Cell. Biol. 8,401 8-4027.
Lonmer. H. E., Wang, E. H., and Prives, C.(1991). The DNA-binding propenies of polyomavirus large T antigen are altered by ATP and other nucleotides. J. Virol. 65, 687-699.
Lu, A. and Carstens, E. B.(1991). Nucleotide sequence of a gene essential for viral DNA replication in the baculovirus A utogr-opho colifonrica nuclear poly hedrosis virus. Virology 181. 336-347.
Lu, A. and Carstens, E. B.(1992). Transcription analysis of the EcoRI D region of the baculovirus Autographa califonlica nuclear polyhedrosis virus identifies an early 4- kilobase RNA encoding the essential pl43 gene. J. Virol. 66,655-663.
Lu, A. and Carstens, E. B.(1993). Immediate-early baculovirus genes transactivate the p 143 gene prornoter of Autographa califorrrica nuclear polyhedrosis virus. Virology 195, 710-718.
Lu, A. and Miller. L. K(1995). The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication. J. Virol. 69.975-982.
Lu, Y. B., Ratnakar, P. V. A. L., Mohanty, B. K., and Bastia, D.(1996). Direct physical interaction between DnaG primase and DnaB helicase of Escherichio coli is necessary for optimal synthesis of primer RNA. Proc. Nad. Acad. Sci. USA 93. 12902-12907.
MacKinnon. E. A., Henderson, J. F., Stoltz, D. B.. and Faulkner, P.(1974). Morphogenesis of nuclear polyhedrosis virus under conditions of prolonged passage in vitro. J. Ulrrastruct. Res. 49. 419-435.
Madine, M. A., Khoo, C. -Y., Mills. A. D., and Laskey. R. A.(1995). MCM3 cornplex required for ceIl cycle replation of DNA replication in vertebrate cells. Nature 375, 42 1-424.
Maeda, S., Karniîa, S. G., and Kondo, A.(1993). Host range expansion of Autographa californicci nuclear polyhedrosis virus (NPV) following recombination of a 0.6- kilobase-pair DNA fragment originating from Bombyx mon' NPV. J . Virol. 67,6234- 6238.
Marahrens. Y. and Stillman. B.(1992). A yeast chromosomal origin of DNA replication defined by multiple functional elements. Science 255,8 17-823.
Marians. K. J.(1992). Prokaryotic DNA replicaûon. A m . Rev. Biochern. 61, 673-7 19.
Marszalek. J. and Kaguni. J. M.(1994). DnaA protein directs the binding of DnaB protein in initiation of DNA replication in Escherichia coli. J. Biol. Chem. 269.4883-4890.
Manin. D. W. and Weber, P. C.(1997a). DNA replication promotes high-frequency homologous recombination during Autographa californica multiple nuclear polyhedrosis v h s infection. Virol. 232. 300-309.
Martin, D. W. and Weber. P. C.(1997b). Replication of sirnian virus 40 ongin-containing DNA during infection with a recombinant Ailtogr-apha califonlica multiple nuclear polyhedrosis virus expressing large T antigen. J . Virol. 71. 501-506.
Martinez, R., Sarisky, R. T.. Weber. P. C., and Weller, S. K.(1996). Herpes simplex virus type 1 alkaline nuclease is required for efficient processing of viral DNA replication intermediates. J. Virol. 70,2075-2085.
Martinez, R., Shao. L., and Weller, S. K(1992). The conserved helicase motifs of the herpes simplex virus type 1 ongin-binding protein UL9 are important for function. J. Virol. 66, 6735-6746.
Maruniak. J. E., Brown, S. E., and Knudson. D. L.(1984). Physical maps of SfMNPV baculovirus DNA and its genomic variants. Virology 136,221-234.
Marx, J.(1995). Frontiers in biology: Chromosomes How DNA replication originates. Scierzce 270, 1585- 1587.
Masse. M. J. O., Karlin, S., Schachtel, G. A.. and Mocarski. E. S.(1992). Hurnan cytomegalovims ongin of DNA replication (oriLyt) resides within a highly complex repetitive region. Proc. Natl. Acad. Sci. USA 89.5246-5250.
Matson, S. W., Bean, D. W., and George, J. W.(1994). DNA heiicases: enzymes with essential roles in al1 aspects of DNA metabolism. BioEssays 16, 13-22.
Matson, S. W., Tabor, S., and Richardson, C. C.(1983). The gene 4 protein of bacteriophage 77. J. Biol. Chem. 258, 140 17- 14024.
Mechali. M. and Kearsey, S.(1984). Lack of specific sequence requirement for DNA replication in Xenopus eggs compared with high sequence specificity in yeast. Cell 38, 55-64.
Melendy, T. and Stillman, B.(1993). An interaction between replication protein A and SV40 T antigen appears essential for pnmosome assembly during SV40 DNA replication. J. Biol. Chem. 268, 3389-3395.
Melov, S., Vaughan. H., and Coaerill. S.(lW2). Molecular characterisation of the gene for the 180 kDa subunit of the DNA polymerase-pnmase of Drosophila melanogaster. J. Cell Sci. 102, 847-856.
Mendelman, L. V., Notarnicola, S. M., and Richardson, C. C.(1993). Evidence for distinct primase and helicase domains in the 63-kDa gene 4 protein of bacteriophage T7. Characterization of a nucleotide binding site mutant. J. Biol. Chem. 268. 27208- 27213.
Messer, W., Seufert, W., Schaefer, C., Gielow, A., Hartmann, H., and Wende, M.(1988). Functions of the DnaA protein of Escherichia coli in replication and transcription. Biochim. Biophys. Acta 951, 35 1-358.
Middleton. T. and Sugden. B.(1992). EBNAl can link the enhancer element to the initiator element of the Epstein-Barr virus plasrnid origin of DNA replication. J. Virol. 66, 489-495.
Mikhailov, V. S.. Marlyev. K. A.. Ataeva, J. O., Kullyev, P. K.. and Atrazhev. A. M.(1986). Characterization of 3' - 5' exonuclease associated with DNA polymerase of s i k w o m nuclear polyhedrosis virus. Nucleic Acids Res. 14. 384 1-3857.
Miller, D. W. and Miller. L. K(1982). A virus mutant with an insertion of a copia-like transposable element. Nature (London) 299, 562-564.
Miller, L. K., Miller, D. W., and Adang, M. J.(1982). Genetic Engineering in eukaryo~s: NATO advanced study Iristirutes Series A (Lurquin. P . F. and Kleinhofs, A., Eds.) Plenum Press, New York. 89-98.
Miller. L. K., Trimarchi, R. E., Browne, D., and Pennock, G. D.(1983). A iernperature- sensitive mutant of the baculovims Alitogrophu caf~orr~ica nuclear polyhedrosis virus defective in an early function required for further gene expression. Virology 126,376- 380.
Mitas, M., Chock, J. Y., and Chrïsty, M.(1997). The binding-site sizes of Escherichia coli single-stranded-DNA-binding protein and mamrnalian replication protein A are 65 and greater than or equal to54 nucleotides respectively. ~ ~ u c h e m i c d Jounial324, 957-96 1 .
Momson, A. and Sugino, A.(1994). The 3'-->5' exonucleases of both DNA polymerases 6 and CE participate in correcting errors of DNA replication in Saccharomyces cerevisiae. Mofecular and General Genetics 242, 289-296.
Mosig, G.(1987). The essential role of recombination in phage T4 growth. Ann. Rev. Genet. 21, 347-371.
Mosig, G. and Colowick, N.(1995). DNA repLication of bactenophage T4 in vivo. Methods Enzymo f . 262, 587-604.
Mossi, R., Jhsson, 2. O., Ailen, B. L., Hardin, S. H., and Hübscher, U.(1997). Replication factor C interacts with the C-terminal side of proliferating cell nuclear antigen. J. Biof. Chem. 272, 1769-1776.
Muritkami, Y., Wobbe, C. R., Weissbach, L., Dean, F. B., and Hurwitz, 3.(1986). Role of DNA polymerase alpha and DNA pnmase in simian virus 40 DNA replication in vitro. Proc. Nad. Acad. Sci. USA 83, 2869-2873.
Muzi-Falconi, F., Brown, G. W., and Kelly, T. 5.(1996). DNA replication: Controlling initiation during the ceii cycle. Current Biofogy 6,229-233.
Navas, T. A.. Zhou, Z., and Elledge, S. J.(1995). DNA polymerase CE links the DNA replication machinery to the S phase checkpoint. Cell80.29-39.
Nethanel, T. and Kaufmann, G.(1990). Two DNA polymerases may be required for synthesis of the
lagging DNA strand of sirnian v h s 40. J. Virol. 64, 5912-591 8.
Newlon, C. S.(1988). Yeas t chromosome replication and segregation. Micr-obiological Reviews 52, 568-60 1.
Notamicola, S. M., Mulcahy, H. L., Lee, J., and Richardson, C. C.(1997). The acidic carboxyl terminus of the bacteriophage T7 gene 4 heIicase/pnmase interacts with T7 DNA polymerase. J . Biol. Chem. 272, 18425- 18433.
OIReilly, D. R., Crawford, A. M., and Miller, L. K(1989). Viral proliferating ce11 nuclear antigen. Nature (London) 337,606.
Ozawa, K., Dean, F. B., Chen, M., Lee, S. -H., Shiratori, A., Murakami, Y., Sakakura, T., Hurwitz, J., and Eki, T.(1993). Mapping of the 70 kDa, 34 kDa, and 1 1 kDa subunit genes of the human multimeric single-suanded DNA binding protein
(hSSB/RPA) to chromosome bands 1 7 ~ 1 3 . lp35p36.1, and 7p21-p22. Ce21 Structure and Function 18, 22 1-230.
Pan, 2. -Q., Chen, M., and Hunvitz, J.(1993). The subunits of activator 1 (replication factor C) carry out multiple functions essentiai for proliferating-ce11 nuclear antigen- dependent DNA synthesis. Proc. Nat/. Acad. Sci. USA 90,6-10.
Parks, R. J. and Graham. F. L.(1997). A helper-dependent system for adenovinis vector production helps define a lower limit for efficient DNA packaging. J. Virol. 71.3293- 3298.
Parsons, R., Anderson, M. E., and Tegtmeyer, P.(1990). Three domains in the simian virus 40 core ongin orchesnate the binding, melting, and DNA helicase activities of T antigen. J . Virol. 64, 509-518.
Parvin, J. D. and Sharp, P. A.(1993). DNA topology and a minimal set of basal factors for transcription by RNA polyrnerase II. Ce11 73,533-540.
Passarelli, A. L. and Miller, L. K.(1993a). Identification and characterization of lef-1. a baculovinis gene involved in late and very Iate gene expression. J . Virol. 67, 3481- 3488.
Passarelli, A. L. and Miller, L. K(1993b). Three baculovinis genes involved in Iate and very Iate gene expression: ie-1, ie-n, and ief-2. J . Virol. 67, 2 149-2 158.
Passarge, E.(1995). A DNA helicase in full BIoom. Nature Getietics 11, 356-357.
Pearson, M.. Bjornson. R., Pearson, G., and Rohrmann, G.(1992). The Autogropha califor-tiica baculovinis genome: Evidence for multiple replication origins. Science 257, 1382-1384.
Pennock, G. D., Shoemaker, C., and Miller, L. K(1984). Suone and regulated expression of Eschenchia coli beta-gdactosidase in insect cells with a baculovinis vector. Mol. Cell. Biol. 4 , 399-406.
Plevani, P., Foiani, M., Falconi, M. M., Piuagalli, A., Santocanale, C., Francesconi, S., Valsasnini, P., Cornedini, A., Piatti, S., and Lucchini, G.(1988). The yeast DNA polymerase-primase complex: Genes and proteins. Biochim. Biophys. Acra 951. 268-273.
Podust. L. M., Podust, V. N., Sogo, J. M., and Hübscher, U.(1995). Mammalian DNA polymerase auxiliary proteins: Anaiysis of replication factor C-catalyzed proliferating ce11 nuclear antigen Ioading onto circular double-stranded DNA. Mol. Cell. Biol. 15, 3072-3081.
Podust, V. N., Vladimirova, O. V., Manakova, E. N., and Lavnk, 0. L(1992). Eukaryotic DNA primase appears to act as oligomer in DNA-polymerase-a--primase cornplex. Eur-. J. Biochem. 206, 7-13.
Polvino-Bodnar, M., Orberg, P. D.. and Schaffer, P. A.(1987). Herpes simplex virus type 1 oriL is not required for v h s replication or for the establishment and reactivation of latent infection in mice. J* Virol. 61, 3528-3535.
Potter, K. N., Faulkner, P., and MacKinnon, E. A.(1976). Strain selection during senal passage of Trichoplusia ni nuclear polyhedrosis virus. J. Virol. 18. 1040- 1050.
Potter. K. N. and Miller, L. K(1980). Animal Virus Genetics (Field, B. N. and Jaenisch, R., Eds.) Academic Press, New York, 71-80.
Prakash, S., Sung, P.. and Prakash, L.(1993). DNA repair genes and proteins of Saccharomyces cerevisiae. A m . Rev. Genet. 27, 33-70.
Prasad, R., Widen, S. G.. Singhal. R. K., Watkins, J., Prakash. L., and Wilson. S. H.(1993). Yeast open reading frame YCR14C encodes a DNA P-polymerase-like enzyme. Nucfeic Acids Res. 21, 530 1-5307.
Prelich. G. and S tillman, B.(1988). Coordinated leading and lagging snand synthesis dunng SV40 DNA replication in vitro requires PCNA. Ceil 53. 1 17-126.
Prikhod'ko, E. A. and Miller, L. K.(1996). Induction of apoptosis by Baculovirus transactivator IE 1. J. Virol. 70,7 1 16-7 124.
Pullen, S. S. and Friesen. P. D.(1995a). The CAGT motif functions as an initiator element during early transcription of the baculovirus msregulator ie-1. J . Virol. 69, 3575-3583.
Pullen, S. S. and Friesen. P. D.(1995b). Eariy transcription of the ie-l transregulator p n e of Autogi-~pha californica nuclear polyhedrosis virus is regulated by DNA sequences within its 5' noncoding leader region. I. Virol. 69, 156- 165.
Rao, H., Marahrens. Y., and Stillrnan, B.(1994). Functional conservation of multiple elements in yeast chrornosomal replication. Mol. Cell. Biol. 14. 7643-7651.
Rao. H. and Stillman, B.(1995). The origin recognition com~lex interacts with a biuartite DNA binding site within yeast rep1icators.- Proc. ~ o t i . Acad. Sci. USA 92,2224- 2228.
Ray, S., Anderson, M. E., and Tegtrneyer, P.(1996). Differential interaction of temperature-sensitive simian virus 40 T antigens with tumor suppressors pRb and p53. J. Virol. 70, 7224-7227.
Razin, S. V., Vassetzky, Y. S., and Hancock, R.(1991). Nuclear matrix attachment regions and topoisornerase II binding and reaction sites in the vicinity of a chicken DNA replication ongin. Biochem. Biophys. Res. Commun. 177, 265-270.
Revet, B. M. J. and Guelpê B.(1979). The genome of baculovirus infecting Tipula paludosa (Meig.) (Diptera). A high molecular weight closed circular DNA of zero superhelix density. Virology 96, 633-639.
Ribeiro, B. M., Hutchinson, K., and Miller, L. K(1994). A mutant baculovinis with a temperature-sensitive IE- 1 msregulatory protein. J. Virol. 68. 1075- lO84.
Rice, W. C. and Miller, L. K(1987). Baculovinis transcription in the presence of inhibitors and in nonpermissive Drosophila cells. Virus Res. 6, 155-172.
Rodems, S. M. and Friesen, P. D.(1993). The hr5 transcnptional enhancer stimulates early expression from the Aurographa californica nuclear polyhedrosis virus geenoome but is not required for virus replication. J. Virol. 67,5776-5785.
Rodems, S. M. and Friesen, P. D.(1995). Transcnptional enhancer activity of hr5 requires dual-palindrome half sites that mediate binding of a dimenc f o m of the baculovirus transregulator 1 ' 1 . J. Virol. 69, 5368-5375.
Rohel, D. 2. and Faulkner, P.(1984). Time courre analysis and mapping of Aurographo californica NPV transcnpts. J . Virol. 50,739-747.
Rowley. A., Cocker, J. H., Hanvood, J., and Diffley, J. F. X.(1995). Initiation complex assembly at budding yeast replication origins begins with the recognition of a bipartite sequence by limiting amounts of the initiator, ORC. EMBO J. 14,263 1-2641.
Rowley, A., Dowell, S. I., and Diffley, J. F. X.(1994). Recent developrnents in the initiation of chromosomai DNA replication: A complex picture emerges. Biochim. Biopltys. Acta Gerre Srrzict. Expr. 12 1'1, 239-256.
Sarnitt, C. E., Hansen, F. G., Miller, J. F., and Schaechter, M.(1989). In vivo studies of DnaA binding to the origin of replication of Eschcrichia coli. EMBO J . 8,989-993.
San Martin, M. C., Gruss, C., and Carazo, J. M.(1997). Six molecules of SV40 large T antigen assemble in a propeller-shaped particle around a channel. J. Mol. Biol. 268, 15-20.
Santocanale, C., Locati, F., Falconi, M. M., Piseri, A., Tseng, B. Y., Lucchini, G., and Plevani, P.(l992). Overproduction and functional anal ysis of DNA primase subunits from yeast and mouse. Ge~ie 113, 199-205.
Saraste, M., Sibbald, P. R., and Wittinghofer, A.(1990). The P-Ioop-common motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15,430-434.
Seki, M., Enomoto, T., Eki, T., Miyajima, A., Murakami, Y., Hanaoka, P., and Ui, M.(1990). DNA helicase and nucleoside-5'-triphosphatase activities of polyoma virus large tumor antigen. Biochemisry 29, 1003- 1009.
Severini, A.. Morgan, A. R., Toveii. D. R., and Tyrreli, D. L. J.(1994). Smdy of the structure of replicative intermediates of HSV-1 DNA by pulsed-field gel electrophoresis. Virology 200.428-435.
Severini, A.. Scraba, D. G., and Tyrrell, D. L. J.(1996). Branched structures in the intracellular DNA of herpes simplex v h s type 1. J . Virol. 70,3 169-3 175.
Shinomiya, T. and Ina, S.(1993). DNA replication of histone gene repeats in Drosophila melanogaster tissue culture cells: Multiple initiation sites and replication pause sites. Mol. C d . Bioi. 13, 4098-4106.
Siegal, G., Turchi, J. J., Jessee, C. B., Myers, T. W.. and Bambara. R. A.(1992). A novel DNA helicase from calf thymus. J. Biol. Chem. 267, 13629-13635.
Simon, M., Giot, L., and Faye, G.(1991). The 3' to 5' exonuclease activity Iocated in the DNA polymerase 6 subunit of Saccharomyces cerevisiae is required for accurate replication. EMBO J . 10, 2 165-2 170.
Skaliter, R., Makhov, A. M., Griffith, J. D., and Lehman. 1. R.(1996). Rolling circle DNA replication by extracts of herpes simplex v h s type 1-infected human cells. J. Virol. 70, 1 132-1 136.
Smith, G. E., Summers, M. D., and Fraser, M. J.(1983). Production of the human beta interferon in insect cells infected with a baculovims expression vector. Mol. Cell. Biol. 3, 2156-2165.
Stadlbauer. F., Brueckner, A.. Rehfuess, C.. Eckerskom, C., Lottspeich. F.. Forster, V., Tseng, B. Y., and Nasheuer, H. -P.(1994). DNA replication irz vitro by recombinant DNA-polymerase-a-pnmase. Ewopean Joiirrzal of Biochemisrry 222, 78 1-793.
S teger, G.. Ham, J., and Yaniv, M. (19%). E2 proteins: Modulators of papillomavirus transcription and replication. Merhods Enzymol. 274, 173- 185.
Stewart, L. M. D., Hirst, M., Ferber, M. L., Merryweather, A. T., Cayley. P. J., and Possee. R. D.(1991). Construction of an improved bacuIovims insecticide containing an insect-specific toxin pne. Narwe 352, 85-88.
Stillman, B. W.(1981). Adenovirus DNA replication ir~ rirro : a protein linked to the 5' end of nascent DNA stmnds. J . Moi. Biol, 40,467-490.
Stinchcomb, D. T., Stnihl, K., and Davis, R. W.(1979). Isolation and characterisation of a yeast chromosomal replicator. Nature 282, 39-43.
Stow. N. D.(1982). Location of an origin of DNA replication within the TRs/IRs repeated region of the herpes simplex vinis type 1 genome. EMBO J. 1, 863-867.
Stnihl. K., Stinchcomb. D. T.. Scherer, S., and Davis, R. W.(1979). High-frequency transformation of yeast: Autonomous replication of hybrid DNA molecules. Proc. Natl. Acad. Sei. USA 76, 1035- 1039.
Su, T. T., Follette, P. J.. and O1Farre1l, P. H.(1995). Qualifying for the license to replicate. Cell 81, 825-828.
Summers. M. D. and Anderson, D. L.(1973). Characterization of nuclear polyhedrosis virus DNAs. J. Virol. 12, 1336-1346.
Summers, M. D. and Smith. G. E.(1987). A manual of methods for baculovirus vectors arzd insect ce[/ culture procediires. Texas A&M University. College Station.
Syvaoja, J. and Linn. S.(1989). Characterization of a large form of DNA polymerase 6 from HeLa cells that is insensitive to proliferating ce11 nuclear antigen. J . Biol. Chem. 264, 2489-2497.
Syvaoja, J. E.(1990). DNA polymerase E: The latest member in the farnily of rnarnmalian DNA polymerases. BioEssays 12, 533-536.
Tarnanoi, F. and Stillman, B. W.(1982). Function of adenovims terminal protein in the initiation of DNA replication. Proc. Nari. Acad. Sci. USA 79, 222 1-2225.
Theis, J. F. and Newlon, C. S.(1994). Domain B of ARS307 contains two functional elements and contributes to chromosomal replication origin function. Mol. Cell. Biol. 14, 7652-7659.
Therrien, M., Chang, H. C., Solomon, N. M., Karim, F. D., Wassarman, D. A.. and Rubin. G. M.(1995). KSR, a novel protein kinase required for RAS signal transduction. Cell83, 879-888.
Thiem, S. M. and Miller, L. K(1989). A baculovirus gene with a novel transcription pattern encodes a with a zinc finger and a leucine zipper. J. ~ i r o i . 63. 4489-4497.
Thommes, P., Ferrari, E.. Jessberger, R., and Hubscher, U.(1992). Four different DNA heiicases from calf thymus. J. Biol. Chem. 267,6063-6073.
Thornmes, P. and Hubscher, U.(1990). DNA helicase from calf thymus. Purification to appearent homogeneity and biochemical characterization of the enzyme. J. Biol. Chem. 265, 14347- 143%.
Thukral, S. K., Blain, G. C., Chang, K. K. H., and Fields, S.(1994). Distinct residues of human p53 implicated in binding to DNA, simian virus 40 large T antigen, 53BP1. and 53BP2. Mol. Cell. Biol. 14, 8315-8321.
Thommes, P. and Hübscher, U.(1992). Eukaryotic DNA helicases: Essential enzymes for DNA transactions. Chromosoma 101, 467-473.
Tjia, S. T., Carstens, E. B., and Doerfler, W.(1979). Infection of Spodoptera fmgiperda cells with Autogropha californicn nuclear polyhedrosis virus. II. The virai DNA and the kinetics of its replication. Virology 99,391-409.
Tomalski, M. D. and Miller, L. K(1991). Insect paralysis by baculovims-mediated expression of a mite neurotoxin gene. Namre 352, 82-85.
Tomalski, M. D., Wu, J., and Miller, L. K.(1988). The location, sequence, transcription, and regulation of a baculovirus DNA polymerase gene. Virology 167.59 1-600.
Tsurimoto, T., Faixman, M. P., and Stillman, B.(1989). Sirnian virus 40 DNA replication in vitro: Identification of multiple stages of initiation. Mol. CeIl. Biol. 9, 3839-3849.
Tsurimoto, T., Melendy, T., and Stillman, B.(1990). Sequential initiation of lagging and leading strand synthesis by two different polymerase complexes at the SV40 DNA replication origin. Nature (London) 346, 534-539.
Tsurimoto, T. and Stillman, B.(1989). Purification of a cellular replication factor, RF-C, that is required for coordinated synthesis of leading and lagging strands dunng simian virus 40 DNA replication in vitro. Mol. Cell. Biol. 9,609-619.
Tsurimoto, T. and Stillman, B.(1990). Functions of replication factor C and proliferahng- ce11 nuclear antigen: Functional similarity of DNA polyrnerase accessory proteins from human cells and bactenophage T4. Proc. Nat!. Acad. Sci. USA 87, 1023-1027.
Tsunmoto, T. and Stillman, B.(1991a). Replication factors required for SV40 DNA replication in vitro. II. Switching of DNA polymerase a and 6 during initiation of leading and lagging strand synthesis. J . Biol. Chem. 266, 1961-1968.
Tsurimoto, T. and Stillman, B.(1991b). Replication factors required for SV40 DNA replication irl r~itro. 1. DNA structure-specific recognition of a primer-template junction by eukaryotic DNA polymerases and their accessory proteins. J. Biol. Chem. 266, 1950- 1960.
Turchi, J. J., Huang, L., Murante, R. S., Kim, Y., and Bambara, R. A.(1994). Enzymatic completion of mammalian lagging-strand DNA replication. Proc. Natl. Acad. Sci. USA 91, 9803-9807.
Tuteja, N. and Tuteja, R.(1996). DNA helicases: The long unwinding road. Nature Genetics 13, 11-12.
Uhlrnann, F., Cai, J. S., Flores-Rozas, H., Dean, F. B., FinkeIstein, J., OiDonnell, M., and Hurwitz, J.(1996). In vitro reconstitution of human replication factor C from its five subunits. Proc. Natl. Acad. Sci. USA 93, 6521-6526.
Vail, P. V. and Jay, D. L.(1973). Pathology of a nuclear polyhedrosis virus of the alfalfa looper in altemate hosts. J . Invertebr. Porhol. 21, 198-204.
Vaughn, J. L., Goodwin, R. H., Tompkin, G. L., and McCawley, P.(1977). The establishment of mo insect ce11 lines from the insect Spodoptera frugiperda (Lepidoptera:Noctuidae). In Vitro 13, 2 13-2 17.
Vogelstein, B. and Gillespie, P.(1979). Preparative and analytical purification of DNA from agarose. Proc. Nat!. Acad. Sci. USA 76, 615-6 19.
Wîga, S., Bauer, G., and Stillman. B.(1994). Reconstitution of complete SV40 DNA replication with purified replicarion factors. J . Biol. Chem. 269, 10923- 10934.
Waga, S. and Stillman, B.(1994). Anatomy of a DNA replication fork revealed by reconstitution of SV40 DNA replication i>i vitro. Narwe 369, 207-2 12.
Wahle, E.. Lasken, R. S., and Kornberg, A.(1989a). The dnaB-dnaC replication protein complex of Escherichia coli. I I Role of the complex in mobilizing dnaB functions. J. Biol. Cheni. 264, 2469-2475.
Wahle, E., Lasken, R. S., and Komberg, A.(1989b). The dnaB-dnaC replication protein cornplex of Escherichia coli. 1. Formation and properties. J. Biol. Chem. 264, 2463- 2468.
Wang, D., Jing, N. H., and Lin, Q. S.(1996). Stearylamine liposome as a new efficient reagent for DNA transfection of eukaryotic cells. Biochem. Biophys. Res. Commun. 226, 450-455.
Wang, H. H., Fraser, M. J., and Cary, L. C.(1989). Transposon mutagenesis of baculoviruses: Analysis of TFP3 lepidopteran transposon insertions at the FP locus of nuclear polyhedrosis vhses . G w e 81, 97-108.
Wang, J. C(1996). DNA topoisomerases. Ami. Rev. Biochem. 65, 635-692.
Wang, T. S. -F.(1991). Eukaryotic DNA polymerases. Ann. Rev. Biochem. 60, 513- 552.
Wang, T. S. -F.(1996). DNA replication ijz ezikaryotic c e h (DePanphilis, M. L.. Ed.) Cold Spnng Harbor Laboratory Press, New York. 46 1-494.
Wang, X. and Kelly, D. C(1983). Baculovinis replication: Purification and identification of the Trichoplicsia n i nuclear polyhedrosis virus-induced DNA polymerase. J. Gen. Vir-01-64, 2229-2236.
Washburn, B. K. and Kushner, S. R.(1993). Characterization of DNA helicase II from a rcvrD252 mutant of Escherichia coli. J. Bacterio!. 175, 341 -350.
Wilson, M. E.(1988). A synthetic peptide to the predicted 6.9K mnslation product of the HindUI-H/EcoRI-D region of the AcNPV genome induces antibodies to the basic DNA-binding protein. Virus Res. 9, 2 1-3 1.
Wilson, M. E., Mainprize, T. H., Friesen, P. D., and Miller, L. K.(1987). Location, transcription, and sequence of a baculovirus gene encoding a srnall arginine-rich polypeptide. 3. Virol. 61-66 1-666.
Wilson, M. E. and Miller, L. K(1986). Changes in the nucleoprotein complexes of a baculovinis DNA during infection. Virofogy 151,315-328.
Wilson, M. E. and Price, K. H.(1988). Association of Autographa californica nuclear polyhedrosis virus (AcMNPV) with the nuclear ma&. Virology 167,233-241.
Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., Bunon, J., Connell, M., Copsey, T., Cooper, J., and et al, (1994). 2.2 Mb of contiguous nucleotide sequence from chromosome III of c. elegans. Nature 368, 32-38.
Wold, M. S.(1997). Replication protein A: A heterotrimeric, single-süanded DNA-binding protein required for eukaryotic DNA metabolism. Ann. Rev. Biochern. 66,61-92.
Wold, M. S. and Kelly, T.(1988). Purification and characterization of replication protein A, a cellular protein required for in vitro replication of simian virus 40 DNA. Proc. Nati. Acad. Sei. OSA 85, 2523-2527.
Wong, S. W. and Schaffer, P. A.(W 1). Elements in the transcriptional regulatory region flanking herpes simplex virus type 1 oi-iS stimulate origin function. /. Vii-0l.65~2601- 2611.
Wood. H. A.(1980). Isolation and replication of an occlusion body deficient mutant of the Arrtogropho califon~ica nuclear polyhedrosis virus. Viralogy 105, 338-344.
Wysokenski, D. A. and Yates, J. L.(1989). Multiple EBNAl-binding sites are required to fom an EBNA 1-dependent enhancer and to activate a minimal replicative origin within oriP of Epstein-Barr virus. J . Virol. 63, 2657-2666.
Yan, H., Merchant, A. M.. and Tye, B. K(1993). Ce11 cycle-regulated nuclear localization of MCMZ and MCM3, which are required for the initiation of DNA synthesis at chromosomal replication origins in yeast. Gelles Dev. 7,2149-2160.
Yasuda, S. and Hirota, Y.(1977). Cloning and mapping of the replication origin of Escherichia coli. Proc. Nati. Acad. Sci. USA 74, 5458-5462.
Yates, J., Warren, N., Reisman, D., and Sugden, B.(1984). A cis-acting element from the Epstein-Barr genome that permits stable replication of recombinant plasrnids in latently infected cells. Proc. Natl. Acod. Sei. USA 81, 3806-38 10.
Yates, J. L. and Guan, N.(1991). Epstein-Barr virusdenved plasmids replicate only once per ce11 cycle and are not amplified after entry into celis. J. Virol. 65,483488.
Yates, J. L., Warren, N., and Sugden, B.(1985). Stable replication of plasmids denved from Epstein-Barr vins in various mamrnalian ce1Is. Nature (London) 313, 8 12-8 15.
Yoo, S. and Guarino, L. A.(1994a). Functional dissection of the ie2 gene product of the baculovims Autographa californica nuclear polyhedrosis virus. viroLgy 202, 164- 173
Yoo. S. and Guarino, L. A.(1994b). The Autogropha californica nuclear polyhedrosis virus iel gene encodes a transcriptional regulator. Virology 202,746-753.
Yu, H.(1990). Gene expression and replication of AcMNPV in cultured insect cells, Queen's University, Kingston, Ont..
Zhang, J., Tan, C. -K., McMullen, B., Downey, K. M., and So, A. G.(1995). Cloning of the cDNAs for the small subunits of bovine and human DNA polymerase 6 and chromosomal location of the human gene. Genornics 29. 179- 186.
Zhang, X., Efstathiou. S., and Simmons, A.(1994). Identification of novel herpes sirnplex virus replicative intermediates by field inversion gel electrophoresis: Implications for virai DNA amplification strategies. Virology 202. 530-539.
Zhou, J. Q., Tan, C. K., So, A. G., and Downey, K. M.(1996). Purification and characterization of the catalytic subunit of human DNA polymerase 6 expressed in baculovinis-infected insect cells. J. Biol. Chem ,271,29740-29745
Zhu. L. and Weller, S. K(1992). The six conserved helicase motifs of the UL5 gene product, a component of the herpes simplex virus type 1 helicase-pnrnase, are essential for its function. J . Virol. 66, 469-479.
Zmudzka, B. Z., Fornace, A., Collins, J., and Wilson, S. H.(1988). Charactenzation of DNA polymerase P mRNA: Cell-cycle and growth response in cultured human cells. Nucleic Acids Res. 16, 9587-9596.
Zyskind, J. W. and Smith, D. W.(1986). The bacterial origin of replication, oriC. Ce11 46, 489-490.
IMAGE NALUATION TEST TARGET (QA-3)
APPLIED IMAGE. lnc - = 1653 East Main Street - -* - - Rochester. NY 14609 USA -- -- - - Phone: 71 W482-0300 -- -- - - Fax: 71 61288-5989
Q 1993. A q p t i i Image. Inc.. All Rights Rrtserved