of 47/47
DNA REPLICATION MOLECULAR BIOLOGY DNA replication, transcription

DNA REPLICATION MOLECULAR BIOLOGY – DNA replication, transcription

  • View
    259

  • Download
    15

Embed Size (px)

Text of DNA REPLICATION MOLECULAR BIOLOGY – DNA replication, transcription

  • Slide 1
  • DNA REPLICATION MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 2
  • Figure 5-2 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription REPLICATION FORK 1000 nt / sec !
  • Slide 3
  • Figure 5-14 Molecular Biology of the Cell ( Garland Science 2008) Unwinding and strand separation by DNA helicase MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 4
  • Figure 5-16 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 5
  • Figure 5-3 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 6
  • UDPdeoxyUDPdTTP ADPdeoxyADPdATP GDPdeoxyGDPdGTP CDPdeoxyCDPdCTP dTDP ribonucleotide reductase kinase Methotrexate anti-cancer drug MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 7
  • Figure 5-18c Molecular Biology of the Cell ( Garland Science 2008) DNA polymerase III MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 8
  • replication direction 33 33 5 33 leading strand 33 5 33 lagging strand with Okazaki fragments DNA polymerase synthesizes in 5 3 direction MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 9
  • Figure 5-11 Molecular Biology of the Cell ( Garland Science 2008) DNA polymerase cant start a new strand, it can only elongate from existing one (RNA polymerase can) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 10
  • Figure 5-12 Molecular Biology of the Cell ( Garland Science 2008) polymerase I MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 11
  • Figure 5-19a Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 12
  • Figure 5-19b,c Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 13
  • Figure 5-21 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 14
  • Figure 5-22 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 15
  • Figure 5-6 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 16
  • Figure 5-25 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 17
  • Figure 5-26 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 18
  • Figure 5-34 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 19
  • Problem with the end of the lagging strand:... progressive shortening of chromosomal ends TTAGGGTTAGGGTTAGGGTTAGGG (TTAGGG) 20-HUNDREDS TELOMERES made of repeats SpeciesRepeat Sequence ArabidopsisTTTAGGG HumanTTAGGG OxytrichaTTTTGGGG Slime MoldTAGGG TetrahymenaTTGGGG TrypanosomeTAGGG Yeast(TG) 1-3 TG 2-3 MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 20
  • Figure 5-41 Molecular Biology of the Cell ( Garland Science 2008) TELOMERES ELONGATED BY ACTION OF TELOMERASE MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 21
  • Drosophila uses a different mechanism transposition of retrotransposons Het-A and TART Harald Biessmann MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 22
  • ~ 150 genes control the telomere length in yeast shortening telomeres associated with senescence telomerase highly active in >90% of tumors many adult cell types have detectable telomerase activity, it is highly regulated, fine tuned activity MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 23
  • TAKE IT EASY TO KEEP YOUR TELOMERES LONG! MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 24
  • PROMOTER AATAAA exon 1exon 2exon 3 ATG TAA AAUAAA AUG UAA AAUAAA AUG UAA intron TRANSCRIPTION Pre-mRNA mRNA DNA RNA SPLICING protein TRANSLATION coding sequence MAPSSRGG.. 553 3355 ATGAGA TACTCT ATGAGA RNA template strand OPEN READING FRAME coding strand 5UTR3UTR CAP AAAAA NUCLEUS CYTOPLASM UPSTREAMDOWNSTREAM MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 25
  • Figure 6-21 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 26
  • Figure 6-22a Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 27
  • Table 6-1 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 28
  • TRANSCRIPTION INITIATION MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 29
  • Figure 6-11 (part 1 of 7) Molecular Biology of the Cell ( Garland Science 2008) TRANSCRIPTION START IN PROCARYOTES MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 30
  • Figure 6-12a Molecular Biology of the Cell ( Garland Science 2008) GENE +1 PROMOTER MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 31
  • 553 3355 ATGAGA TACTCT ATGAGA RNA template strand coding strand TERMINATOR MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 32
  • Figure 6-9 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 33
  • Table 6-2 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 34
  • Table 6-3 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 35
  • Figure 6-19 Molecular Biology of the Cell ( Garland Science 2008) CORE PROMOTER MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 36
  • RNA PROCESSING in Eukaryotes AAUAAA AUG UAA AAUAAA AUG UAA intron Pre-mRNA mRNA RNA SPLICING 5UTR3UTR CAP AAAAA MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 37
  • Figure 6-22b Molecular Biology of the Cell ( Garland Science 2008) Capping Eukaryotic mRNA MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 38
  • Figure 6-38 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 39
  • SPLICEOSOME small nuclear RNA (snRNA) + proteins = small nuclear ribonucleoprotein snRNP (snurp) U1-U6 MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 40
  • Figure 6-28 Molecular Biology of the Cell ( Garland Science 2008) snRNAs of snurps recognize 3 sequences 5 splice site branch site 3 splice site MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 41
  • Figure 6-26a Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 42
  • Figure 6-29 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 43
  • Figure 6-30c Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 44
  • Figure 6-36 Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 45
  • Figure 6-31 Molecular Biology of the Cell ( Garland Science 2008) ALTERNATIVE SPLICING MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 46
  • Figure 6-32a Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription
  • Slide 47
  • Figure 6-32b Molecular Biology of the Cell ( Garland Science 2008) MOLECULAR BIOLOGY DNA replication, transcription