Click here to load reader

DNA replication  DNA replication is semi-conservative  DNA polymerases  Replication origins  Assembly of the replication fork Further readings :

  • View
    216

  • Download
    3

Embed Size (px)

Text of DNA replication  DNA replication is semi-conservative  DNA polymerases  Replication origins...

  • Slide 1
  • DNA replication DNA replication is semi-conservative DNA polymerases Replication origins Assembly of the replication fork Further readings : http://www.dnaftb.org/dnaftb/ http://www.dnareplication.net/ 1 ADN 2 ADN 1
  • Slide 2
  • DNA replication is semi-conservative M. Meselson & P Stahl Proc. Nat. Ac. Sci. 1958 2
  • Slide 3
  • 3 The cell cycle Gap 1 DNA Synthesis Mitosis Gap 2 In the resting state (G 0 ), cells do not divide G0G0 3
  • Slide 4
  • 4 DNA synthesis is catalyzed by DNA-dependent DNA polymerases dNTP template strand strand to be synthesized DNA polymerization takes place in the 5 to 3 direction DNA polymerase requires a template and a primer dATP dTTP dCTP dGTP GGATCCTTAGAACCTTGGCCCGGG CCTAGGAATCTTGGAACCGGGCCC DNA polymerase nucleotides GGATC CCTAGGAATCTTGGAACCGGGCCC template primer 5 PP i Stryer et al. Biochemistry, Freeman Edt 4
  • Slide 5
  • DNA replication is catalyzed by a DNA-dependant DNA polymerase in the 5 to 3 direction starting at double strand DNA or at a DNA-RNA hybrid A primase synthesize a RNA primer to initiate replication DNA polymerases are processive : processivity is the number of phosphodiester bonds that a single enzyme is able to catalyze before dissocation DNA replication requires a primase to start dNTP template strand strand to be synthesized 5
  • Slide 6
  • 6 Okazaki fragments RNA primase Leading and lagging strands Size of Okasaki fragments : eukaryotes 200 bp Alberts et al. MBOC, Garland Edt 6
  • Slide 7
  • 7 5 3 dNTP RNA primer 5 3 NTP primase Replication fork DNAPol DNA helicase On the leading strand , DNA is continuously synthesized 7
  • Slide 8
  • 8 5 3 RNA primer dNTP RNA primer 5 3 NTP DNAPol primase 5 3 dNTP RNA primer ligase 5 3 RNA primer RNAse and DNAPol Replication fork DNAPol DNA helicase On the lagging strand , DNA is synthesized discontinuously 8
  • Slide 9
  • 9 The core of the eukaryote replication complex Movies 5.1 (Molecules and Complexes) and 5.4 (Cell functions) Mol. Biol. Cell Linda B. Bloom, University of Florida http://www.med.ufl.edu/IDP/BMB/bmbfacultypages/lindabloom.html Eukaryote cells possesses several DNA polymerases (> 15) nucleus250 kDa DNA primase, lagging strand nucleus170 kDa leading strand nucleus260 kDa lagging strand, DNA repair DNAPol DNAPol DNAPol primase 9
  • Slide 10
  • 10 Main components of the DNA replication complex DNA polymerase primaseprimer RNA synthesis DNA polymerase DNA synthesis, leading+lagging strands Replication protein C*load PCNA on DNA Proliferating cell nuclear antigen (PCNA)sliding clamp ensuring processivity TopoisomeraseAdjusts DNA supercoiling Helicase*Unwinds DNA into strands Replication protein Asingle strand DNA binding protein Flap endonuclease 1removes RNA 5-flap Dna2 RNase H1removes RNA DNA ligase 1joins Okasaki fragments * uses ATP The replisome The catalytic core Maga and Hbscher 1996 Biochemistry 35: 5764-5777 Waga and Stillman 1994 Nature 269: 207-212 Frouin et al. 2003 EMBO reports 4: 666-670 Hbscher and Yeon-Soo Seo 2001 Mol. Cells 12: 149-157 Cyclin A, cyclin B1 Cyclin dependent kinase 1, 2 (CDK1, CDK2) + 11 other proteins Temporal regulation 10
  • Slide 11
  • 11 The central role of PCNA PCNA (proliferating cell nuclear antigen) is a homotrimeric protein that helps DNA polymerase processivity in eukaryotic cells. During the S-phase, it assembles around DNA and form a DNA clamp. PCNA associates with RFC, DNA polymerases and , Fen1/Dna2, Lig1 (+ 15 other proteins !) PCNA is also involved in DNA repair mechanisms At 3 OH end : RFC displaces Pol- and loads PCNA + Pol / At the flap structure : RFA dissociates Pol from PCNA PCNA recruits Fen1/Dna2 which cleaves the flap structure PCNA recruits Lig1 that joins the DNA fragments PDB 1AXC Maga and Hbscher 2003 Journal of Cell Science 116: 3051-3060 11
  • Slide 12
  • 12 Replication is coordinated at replication factories Visualization of DNA replication in living cells using GFP-PCNA FRAP experiments shows that PCNA is stably associated to replication factories Essert et al. 2005 Mol. Cell Biol. 25 : 9350-59 PCNA GFP 12
  • Slide 13
  • 13 Replication is coordinated at replication factories Visualization of DNA replication in living cells using GFP-PCNA FRAP experiments shows that PCNA is stably associated to replication factories Essert et al. 2005 Mol. Cell Biol. 25 : 9350-59 13
  • Slide 14
  • 14 There are about 100-1000 replication origins per chromosome Replication origins are recognized by specific protein complexes : ORC origin recognition complex) and MCM (minichromosome maintenance complex) Replication speed : 10-50 bp/s The onset of DNA replication is triggered by cell division cycle dependant kinases (CDK) Replication starts at replication origins ORC : origin replication complex MCM : minichromosome maintenance complex Replisome 1. Activation 2. Extension 3. Termination 14
  • Slide 15
  • DNA repair Molecular origin of DNA mutations General repair mechanisms The p53 protein controls DNA damage at a specific checkpoint of the eukaryote cell cycle 15
  • Slide 16
  • Sources of DNA damage Replication errors: DNA polymerasefrequency 1/10 7 Molecular damages to DNA: OriginDNA damage number/cell.dayPossible repair Exogenoussun (1h/day)T-T dimers6-8.10 4 Y chemicaladducts 10 2 -10 5 N (base modification) radioactivitysingle strand breaks 2-4.10 4 Y (natural double strand breaks ? background) Endogenoustemperature single strand breaks 2-4.10 4 Y free radicalsadducts/breaks 10 4 Y metabolitesadducts 10 2 Y virusesgenome integration ?N transposons ?? 16
  • Slide 17
  • DNA repair mechanisms Damage typeRepair T-T dimers Adducts Single strand breaks Double strand breaks Restriction Excision Synthesis Ligation Excision Recombination Ligation or direct ligation Recognition 17
  • Slide 18
  • The COMET assay to measure DNA damages also called single cell gel electrophoresis (SCGE) 18
  • Slide 19
  • Ames test (Salmonella-his reversion-test ) for mutagenicity This experiment employed six strains of Salmonellatyphimurium histidine auxotroph mutants, deficient in the synthesis of histidine, an amino acid necessary for bacterial growth. The histidine auxotrophs will only grow in a medium containing sufficient histidine supplement. To revert to histidine production (prototrophy), or become his+,a reverse mutation must occur in the original his- mutation (found in one of the genes involving histidine biosynthesis). When plated onto an agar media containing a trace (1/1000 dilution) of histidine, only his+ revertants will grow to form a visible colony. The presence of visible colonies signifies a reverse mutation. Each of the six bacterial strains carries a different type of mutation (Table 1), making it possible to assess the type of mutation caused by the chemical under examination. When a chemical mutagen is introduced into the bacterial population on a filter disc, a higher number of revertants will appear, signalling the chemical causes genetic mutations. The Ames test includes using liver extract to simulate mammalian metabolic activity which may alter non-mutagenic chemicals to become mutagenic. The liver extract is generally obtained from rats treated with Aroclor 1254 to induce the presence of detoxifying enzymes. Brian Krug: Ames Test: Chemicals to Cancer Strain # S. typhimurium Type of Mutation Detected Strain Name 1 TA98 detect frame-shift mutations 2 TA100 detect base pair substitutions 3 TA102 detect excision repair 4 TA104 detect base-pair substitutions 5 TA1534 detect frame-shift mutation 6 TA1530 detect base pair substitutions Inhibition zone growth ring chemical to be tested 19
  • Slide 20
  • Exemple of repair : thymine dimers Tymine dimer repair enzyme : specific DNA endonuclease (induced by UV light) 20
  • Slide 21
  • benzo[a]pyrene (BP) Metabolism et carcinogenicity of Benzo[a]Pyrene benzo[a]pyrene-7,8-dihydrodiol -9,10-epoxide CYP1A1, CYP1A2 epoxide hydrolase the diol epoxide covalently binds to DNA (adduct) Increased DNA mutations & cancer Benzo[a]pyrene is a product of incomplete combustion at temperatures between 300 and 600 C. aromatic molecule (L) Aryl hydrocarbon Receptor AhR AhR-L induction of specific mRNA (AhRE) AhR-L Growth Differentiation Metabolism (toxicity) P450 cytochromes (phase I) : CYP1A1, CYP1A2, CYP1B1, CYP2S1 Phase II enzymes : GST, UGT (detoxification mechanism) translocation to the nucleus AhRE 21
  • Slide 22
  • Shimizu et al. (2000) PNAS 97 : 779-782 Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor Dossier INSERM Dioxines dans lenvironnement. Quels risques pour la sant ? http://ist.inserm.fr/basisrapports/rapport.html Individual susceptibility to xenobiotics. Exemple of CYP genes 22
  • Slide 23
  • DNA recombination : programmed random modifications of the genome ADN1 + ADN2 ADN3 + ADN4 Molecular mechanisms of homologous recombination Site specific recombination Conjugation, mechanism of bacterial parasexuality The VDJ recombination, one of the mechanisms that generate antibody and TCR diversity The crossing-over at meiosis increases genomic diversity in the population Transposons and viruses are mobile DNA/RNA sequences 23
  • Slide 24
  • 1. Homologous recombination Condition : presence of two homologous sequences in adjacent