Click here to load reader

Replication DnA Dna

  • View
    39

  • Download
    2

Embed Size (px)

DESCRIPTION

Replication DnA Dna. We lose from 30,000-40,000 cells/day……these need to get replaced Before a cell duplicates, it makes an exact copy of its DNA for new cell Double helix “unzips” through an enzyme ( helicase ) that breaks H bonds - PowerPoint PPT Presentation

Text of Replication DnA Dna

  • We lose from 30,000-40,000 cells/daythese need to get replacedBefore a cell duplicates, it makes an exact copy of its DNA for new cellDouble helix unzips through an enzyme (helicase) that breaks H bondsDNA polymerase attaches nucleotides to DNA strand to form complementary strands

  • DNA never leaves the nucleus, is protectedRNA is a copy of DNA that goes out of nucleus to give cell instructions to make proteins3 Main Differences between RNA to DNASingle stranded, smallerContains ribose sugar Contains uracil in place of thymineRibose SugarAdenine: AUracil: UGuanine: GCytosine: C

  • DNA unzips at site of desired gene at promoters (specific base sequence signal for start)RNA polymerase creates a complimentary strand of gene with RNA nucleotidesmRNA leaves nucleus to ribosome for protein synthesis

  • Sometimes in the RNA copy, there are some portions that dont code for the protein (introns)Introns get discarded and remaining portions (exons) of RNA get spliced back together.

  • Messenger RNA (mRNA)- carry info on polypeptide synthesis from nucleus to ribosomesRibosomal RNA (rRNA)- make up subunits that make ribosomesTransfer RNA (tRNA)- bring amino acids to the ribosome and matches them to coded mRNA message

  • Table 14.2Types of RNAType of RNAFunctions inFunctionMessenger RNA(mRNA)Nucleus, migratesto ribosomesin cytoplasmCarries DNA sequenceinformation to ribosomesTransfer RNA(tRNA)CytoplasmProvides linkage between mRNAand amino acids;transfers aminoacids to ribosomesRibosomal RNA(rRNA)CytoplasmStructural component of ribosomes

  • *Ribosome binds to mRNA in cytoplasm

    Genetic code is read in words that are 3 letters long called CODONS

    Each codon codes for an AMINO ACID

  • UCAGUCAGGACUGACUGACUGACUUUUUUCUUAUUGCUUCUCCUACUGAUUAUCAUAAUGGUUGUCGUAGUGpheleuleuilemet (start)valUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGserprothralaUAUUACUAAUAGCAUCACCAACAGAAUAACAAGAAAGAUGACGAAGAGtyrstopstophisglnasnlysaspgluUGUUGCUGAUGGCGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGGcysstoptrpargserargglyFirst BaseThird BaseSecond BaseVirtually all organisms share the same genetic code unity of lifemRNA AMINO ACID CHART

  • As each codon passes through ribosome, tRNA brings the proper amino acids to ribosome to build a polypeptideAnticodon is used to base pair with mRNA codons

  • The polypeptide chain continues to grow until it reaches a stop codon on mRNARibosome releases new polypeptide and mRNA, completing translation

  • TRANSLATIONFigure 10.8BStart codonRNATranscribed strandStop codonTranslationTranscriptionDNAPolypeptideCODONS

  • Figure 10.16ANormal hemoglobin DNAmRNANormal hemoglobinGluMutant hemoglobin DNAmRNASickle-cell hemoglobinVal

  • Mutations are changes in the DNA base sequencecaused by errors in DNA replication or by mutagens (chemical/physical agents)Point mutation involves change in one or a few nucleotides

  • Types of mutationsFigure 10.16BmRNANORMAL GENEBASE SUBSTITUTIONBASE DELETION or INSERTIONProteinMetLysPheGlyAlaMetLysPheSerAlaMetLysLeuAlaHisMissing*FrameshiftMutation (more serious)

  • FRAMESHIFT: Shifts entire sequence over, can result in defective proteinPOINT Mutation- can produce defective protein

  • TAC GCC TGG AAA

    AUG CGG ACC UUUMET ARG THR PHESilent mutation (substitution) because there is more than one codon for each AA

    *Figure: Table 14.2

    Title:Types of RNA.

    Caption:Types of RNA.

    *Figure: 14-07

    Title:The genetic code dictionary.

    Caption:If we know what a given mRNA codon is, how can we find out what amino acid it codes for? This dictionary of the genetic code offers a way. In Figure 14.5, you saw that the codon CGU coded for the amino acid arginine (arg). Looking that up here, C is the first base (go to the C row along the first base line), G is the second base (go to the G column under the second base line) and U is the third (go to the codon parallel with the U in the third base line).

    ****

Search related