Mutational Derivatives of PhiC31 Integrase With Increased Efficiency and Specificity

original article

112 www.moleculartherapy.org vol. 17 no. 1, 112–120 jan. 2009

© The American Society of Gene Therapy

ϕC31 integrase is a sequence-specific phage recombi-nase that can recombine two short DNA sequences called attB and attP. The enzyme can also promote genomic integration of plasmids carrying attB into native mamma-lian sequences having partial identity to attP. To increase the efficiency of integration, we mutated the ϕC31 inte-grase gene and screened the mutants in human cells in an assay for higher recombination frequency between attB and attP. We report in this article the isolation of a mutant, P2 that has twice the chromosomal integra-tion frequency of wild-type ϕC31 integrase, at both a preintegrated chromosomal attP site and at endogenous pseudo attP sequences in cultured human cells. In mouse liver, P2-mediated integration provided therapeutic long-term levels of human factor IX that were double those generated by wild-type ϕC31 integrase. We also describe an additional mutant, P3 that combines the mutations of P2 with further changes and possesses an elevated specificity for integration at a chromosomally placed attP site in human cells. Forty-four percent of colonies carrying integration events mediated by P3 have integra-tion at the placed attP site. These mutant integrases are useful for gene therapy and genome modification, and they demonstrate the feasibility of engineering ϕC31 integrase toward more desirable properties.

Received 28 April 2008; accepted 29 September 2008; published online 11 November 2008. doi:10.1038/mt.2008.241

IntroductIonWe have been investigating a unique strategy for gene ther-apy utilizing the ϕC31 integrase. Derived from Streptomyces bacteriophage ϕC31, this enzyme catalyzes precise, unidirectional integration of the phage genome into the bacterial genome.1,2 ϕC31 integrase requires no cofactors and performs efficient recombination between two ~30–40 bp recognition sequences, a phage attachment site, attP, and a bacterial attachment site, attB.3,4 In the context of the mammalian cell environment, ϕC31 inte-grase can not only recombine its own sites, but can also integrate plasmids carrying an attB site into native genomic sequences that bear partial identity to attP, referred to as pseudo attP sites.5 The enzyme recognizes a hierarchy of such sites, dependent on

both DNA sequence and chromosomal context.6 We were able to derive a 28-bp long consensus recognition sequence present at most pseudo attP sites.6 Human cell lines appear to have several hundred potential integration sites, though most integration events occur at only a subset of these sites.6 The number of pseudo attP sites used in vivo in a particular tissue such as liver may be even lower.7 Because ϕC31 integrase requires a significant DNA sequence match to perform recombination, the number of inte-gration sites is orders of magnitude lower than the number of sites accessed by randomly integrating vectors such as retroviruses and transposons. The more restricted integration profile of ϕC31 inte-grase is expected to reduce the risk of insertional mutagenesis, especially because the known ϕC31 integration sites in the human genome are not near known oncogenes.6

Numerous studies have demonstrated the effectiveness of ϕC31 integrase as a gene therapy vector system in animal models and cells in culture.7–19 In addition, several reports have demon-strated the utility of ϕC31 integrase for the efficient production of transgenic animals.20–26 Furthermore, the ϕC31 integrase system is not limited by vector size.22 To date, there have been no reports of immunogenicity or cancer associated with ϕC31 integrase, and even transgenic mice producing ϕC31 integrase are viable, disease-free, and have normal development and fertility.27,28

Despite the successes to date with ϕC31 integrase, it is likely that the properties of the enzyme can be improved. For example, a study of integration in the liver of mice with tyrosinemia type I revealed an integration efficiency of ~4% per transfected cell,8 although this figure may have been depressed due to the pathology of the liver disease.8 It is probable that a significant improvement in integration efficiency is feasible. Similarly, for the purpose of gene therapy it may be advantageous to engineer modified inte-grases with greater integration specificity than the wild-type integrase. In a previous study, we demonstrated that by using DNA shuffling in combination with a genetic screening assay in Escherichia coli, we could create mutant forms of ϕC31 integrase that had an enhanced preference for a preexisting integration site in the human genome.29 However, these enzymes displayed low overall integration efficiency in mammalian cells. The main purpose of the present study was to create altered integrases with increased integration efficiency. To achieve this goal, we developed a genetic screen in human cells to detect enhanced recombination frequency between the attB and attP sites. Mutagenesis focused

*Current address: Invitrogen Corporation, Carlsbad, California, 92008, USACorrespondence: Michele P. Calos, Department of Genetics, M-334, 300 Pasteur Drive, Stanford University School of Medicine, Stanford, California 94305-5120, USA. Email: [email protected]

Mutational Derivatives of PhiC31 Integrase With Increased Efficiency and SpecificityAnnahita Keravala1, Solomon Lee1, Bhaskar Thyagarajan2,*, Eric C Olivares2*, Vanessa E Gabrovsky1, Lauren E Woodard1 and Michele P Calos1

1Department of Genetics, Stanford University School of Medicine, Stanford, California, USA; 2Poetic Genetics, Burlingame, California, USA

http://www.nature.com/doifinder/10.1038/mt.2008.241

mailto:[email protected]

Molecular Therapy vol. 17 no. 1 jan. 2009 113

© The American Society of Gene TherapyImproved Mutants of PhiC31 Integrase

on the N-terminal catalytic domain of the protein,30 where we hypothesized that we might find high-efficiency mutants. This type of screen could also produce mutants with increased binding specificity for attP.

resultsGeneration of improved mutant integrasesLibraries carrying mutant ϕC31 integrase genes were generated by using three different methods. In method one, site-directed mutants were synthesized by using overlapping oligonucleotides and high-fidelity PCR. This method was carried out primarily for alanine-scanning mutagenesis and for combining beneficial mutations. For alanine-scanning mutagenesis, all charged amino acids in the N-terminal catalytic domain (amino acids ~1–150) were replaced with alanine. In method two, error-prone PCR (GeneMorph, Stratagene, La Jolla, CA) was used to generate mutants that had mutations either throughout the integrase gene or localized within the N-terminal catalytic domain. In method

three, mutator strains of E. coli (XL-1 Red, Stratagene) were used to generate mutations throughout the integrase gene.

To screen candidate mutants quickly for presence of func-tional integrases, the mutants were tested for their ability to medi-ate recombination in E. coli between native attB and attP sites on plasmid pFC1. This assay, diagrammed in Figure 1a, constituted a blue-white colony color screen. Integrases having reduced func-tion were identified by their inability to recombine the att sites and delete the lacZ gene and consequent failure to produce white colo-nies. Such mutants were eliminated from further consideration.

Small-scale DNA preparations of plasmids derived from white colonies, carrying functional integrases, were screened for improved function over wild-type integrase in cultured human cells in an extrachromosomal assay. This assay, diagrammed in Figure 1b, quantitatively measured the ability of the candidate integrase mutants to recombine the wild-type attB and attP sites on plasmid pBP-Green. Such recombination inverted or “flipped” the incorrectly oriented CMV promoter on the pBP-Green

attPa

b

attB attL

attL

pFC1-M(from white colony)

pBP-Green

lacZ

attP attB

CMV eGFP

Functional integrasecatalyzes

recombination,“excising” lacZ

Integrase catalyzesrecombination, “flipping”

CMV promoter to expresseGFP

pFC1 pFC1-M

White coloniesCMV CMVlac

CMV lac

lac

Mutantintegrase

Mutantintegrase

Mutantintegrase

Chl

orC

hlor

Chl

or

Kanr

“flipped”pBP-Green

eGFP-expressinggreen cells

attL attR

CMV eGFP

Kanr

+

Figure 1 schematic diagrams of screens used to characterize φc31 integrase mutants. (a) Bacterial prescreen for functional integrases. pFC1 was the recipient plasmid for libraries of mutant integrases. Recombination between the attB and attP sites mediated by a functional mutant inte-grase led to excision of the lacZ gene when transformed into Escherichia coli, giving rise to a white colony on X-gal plates. (b) Mammalian screen for recombination efficiency. Plasmid pFC1-M DNA isolated from white colonies was co-transfected into 293 cells with pBP-Green. pBP-Green carries the eGFP gene and a CMV promoter in the inactive orientation, flanked by attP and attB. Recombination between the att sites, mediated by a functional mutant integrase, “flips” the CMV promoter, allowing eGFP expression, detected and quantified by a fluorescence analyzer.

table 1 Amino acid changes in integrases that showed improved efficiency in the extrachromosomal “flipper” assay

Mutant name Position and nature of amino acid changesa Method used to generate mutants Fold improvement over wild-type integrase

Individual mutants

NM-W20 T7S, V9E, D10V Error-prone PCR 1.6

96W46 T2I, V49I Error-prone PCR 1.4

D40A D40A Alanine scanning 1.2



Combination mutants

P1 T2I, T7S, V9E, D10V, V49I Error-prone PCR 2.1

P2 D40A, D44A, D52A Alanine scanning 1.8

P3 T2I, V6Ab, S7Δb, V9E, D10V, D40A, D44A, V49I, D52A

Error-prone PCR & Alanine scanning 2.3

aNumbers refer to positions in the wild-type 613 amino acid protein. All mutants also carry a 33 amino acid N-terminal fusion sequence, M T M I T P S A Q L T L T K G N K S W S S L V T A A S V L E F A T. bThree base pairs were inadvertently deleted when P3 was synthesized, leading to replacement of V6 with A and deletion of S7.

114 www.moleculartherapy.org vol. 17 no. 1 jan. 2009


plasmid. Therefore, recombination gave rise to eGFP expression, which was monitored by fluorescence. Because a more efficient integrase can recombine more plasmids than a less efficient inte-grase, we used the mean fluorescence intensity of the green cells as a measure of the efficiency of the integrase. Control experi-ments showed that the mean fluorescence intensity of the green cells was not highly sensitive to the amount of integrase plasmid transfected into the cells (data not shown). Eight replicates of the “flipper” assay were performed with each mutant, to more reli-ably detect the expected small improvements in efficiency.

A collection of mutants that showed improved activity was sequenced to determine the location of the mutations. For convenience, and because of the focus on increased efficiency, only mutants that had amino acid changes located in the N-terminal catalytic domain were used. Table 1 shows the best such mutants, which ranged from 1.2- to 1.7-fold improvement in activity over wild type. Several mutants were combined in various configurations to generate a second generation of mutants. The second-generation mutants were synthesized by using overlapping oligonucleotides containing the desired sequences and high- fidelity PCR amplification. Second-generation mutants were tested in the pBP-Green flipper assay. Some of the combinations produced mutants that showed higher catalytic efficiency than either of the parents. The best second-generation mutants, called P1, P2, and P3 and cloned in the pFC backbone (Supplementary Figure S1a), had a 1.8- to 2.3-fold improved activity over wild-type integrase. The P1 mutant was a combination of two individual mutants and had a total of 5 amino acid changes. The P2 mutant combined three individual alanine-scanning mutations, for a total of three amino acid changes. The P3 mutant was a combination of P1 and P2, with an additional unintentional 3 bp deletion and associated amino acid change, for nine changes in the integrase amino acid sequence (Table 1).

An n-terminal fusion sequence is translatedWe wished to examine the efficiency of the mutant integrases in mediating genomic integration of plasmid DNA in mammalian cells. To compare directly the new mutants with the previously characterized wild-type integrase, pCSI, which is in the pCS backbone,4 we first transferred the P1, P2, and P3 integrase genes from the pFC1 backbone to the pCS backbone. During the sub-cloning process, we noticed that a sequence that was part of the bacterial/mammalian promoter in the pFC1 backbone formed a potential translational fusion at the N-terminus of the mutant integrase genes. To determine if this sequence was actually being translated, we cloned the mutant integrases with or without the putative fusion sequence into a pCS backbone such that they were tagged with the hemaglutinin (HA) peptide to permit easy purification of the proteins. pCS-P1-HA, -P2-HA, and -P3-HA carried the fusion sequence, whereas pCS-dP1-HA, -dP2-HA, and -dP3-HA lacked the fusion sequence. To examine the sizes of the mutant integrases, we performed western blot analysis on total HeLa cell lysates isolated 48 hours after transfecting plasmids encoding the HA-tagged integrases. As shown in Figure 2, the mutant integrases with the N-terminal fusion sequence were larger than those without the fusion sequence. The size difference corresponded to the expected 33 amino acids that would result

from translation of the fusion sequence (Table 1). We attempted to further characterize the fusion sequence and verify that it was being translated by Edmund’s N-terminal sequencing. However, the N-terminus appeared to be blocked, possibly by myristoyla-tion, inhibiting the sequencing reaction.

Genomic integration efficiency in Hela cellsWe wished to compare the efficiency of genomic integration in mammalian cells mediated by the mutants versus the wild-type integrase. HeLa cells were co-transfected in triplicate with an attB-containing donor plasmid carrying a neomycin (G418) resis-tance gene and an eGFP gene for analysis of transfection efficiency (pNC-attB, Supplementary Figure S1d)5 and plasmids expressing the mutant integrases pCS-P1, pCS-P2, pCS-P3 (Supplementary Figure S1b), pCS-dP1, pCS-dP2, pCS-dP3 (Supplementary Figure S1c), the wild-type pCSI, or the negative control pCSmI, carrying an inactive integrase,7 and selected for G418. One day after transfection, eGFP analysis indicated comparable transfec-tion efficiency in all the samples. G418 colony numbers revealed that mutant integrases containing the fusion, especially P2, had higher integration efficiencies than the integrases from which the fusion sequence had been removed. In addition, pCS-P2 had an integration frequency that was approximately twofold elevated compared to wild-type ϕC31 integrase (Figure 3).

To obtain preliminary information on the integration sites used by the P2 integrase in human cells, we investigated by PCR whether integration occurred at five previously characterized

1 2 3 4 5

646 aa + HA

613 aa + HA

β-Actin

Figure 2 Western blot demonstrates expression of n-terminal fusion sequence. Each lane contains a HeLa cell extract from cells transfected with the following plasmids expressing an HA-tagged integrase: 1. pCSI-HA; 2. pCS-dP2-HA; 3. pCS-P2-HA; 4. pCS-dP3-HA; 5. pCS-P3-HA. The blot was stained with antibodies that detect the HA tag and β-actin. The lower band in all five lanes is the β-actin loading control.

160

140

120

100

G41

8 co

loni

es

80

60

40

20

0

pCS

I

pCS

ml

pCS

-dP

1

pCS

-P1

pCS

-dP

2pC

S-P

2

*

*

pCS

-dP

3pC

S-P

3

Figure 3 Integration into pseudo attP sites in cultured human cells. (a) HeLa cells received a donor attB neomycin resistant plasmid and a plasmid expressing a wild-type or mutant integrase and were grown under G418 selection for 2 weeks. The average numbers of G418-resistant colonies obtained for each integrase are shown. Values are ± s.e.m. Asterisks denote values that are higher than pCSI at P < 0.05 (Student’s t-test).



pseudo attP sites commonly used by wild-type ϕC31 integrase in human tissue culture cells, at Xq22.1, 21q21.1, 19q13.31, 13q14.11, and 10q21.2.6 HeLa cells were transfected with pNC-attB and either pCSI, pCS-P2, or pCS-dP2, and G418 selection was car-ried out. The cells were either plated undiluted or were diluted 1:2, 1:4, or 1:10, to create populations representing various numbers of clones. PCR analysis was performed on genomic DNA that was isolated from the pools. In undiluted cells, integration at all five pseudo attP sites was detected with wild-type integrase, as well as with the pCS-P2 and pCS-dP2 mutants. Furthermore, when the pooled colonies were serially diluted and examined by PCR, again no obvious differences in specificity for pseudo attP sites were observed between the wild-type and mutant integrases (data not shown). These results, although far from a complete integration profile, suggested similarity in the integration specificity of the P2 mutant and the wild-type ϕC31 integrase.

Integration into a preintegrated chromosomal attP siteTo examine the extent of specificity of the mutant integrases for the wild-type attP site, we used the 293-P3 cell line, which con-tains a randomly integrated expression cassette carrying an attP site and a promoterless zeocin resistance gene.5 Essentially, zeocin resistance is activated only if integration occurs at the attP site, whereas G418 resistance is conferred by all integration events. The selection scheme is described in Figure 4a. 293-P3 was co-transfected in triplicate with pNC-attB and P1, P2, or P3, with or without the N-terminal fusion sequence, and the transfection efficiency was estimated by eGFP expression. After 2 weeks of selection with either G418 and zeocin or G418 alone, the numbers of antibiotic resistant colonies were counted.

The numbers of G418 and zeocin resistant colonies are depicted in Figure 4b. Modest numbers of colonies were obtained with pCSI, indicating a low level of integration at the preintegrated

attB

attP

293-P3 genomic DNA

or

PseudoattP

pCSI,pCS-P1/P2/P3, orpCS-dP1/dP2/dP3

CMV

Mutantintegrase

CMV

pNC-attB

Neor

Neor

attR attL attR attL

eGF

P

Am

pr

eGFP

Integration into attP gives G418r + Zeor colonies Integration into pseudo attP gives G418r colonies

CMV Neor

Zeor

Zeor eGFP CMV

180

160

140

120

100

G41

8 +

Zeo

col

onie

s

80

60

40

20

00

pCS

I

pCS

-dP

1

pCS

-P1

pCS

-dP

2

pCS

-P2

pCS

-dP

3

pCS

-P3

**

*

*

450

400

350

300

250

G41

8 co

loni

es

200

150

100

50

0

pCS

I

pCS

ml

pCS

-dP

1

pCS

-P1

pCS

-dP

2

pCS

-P2

pCS

-dP

3

pCS

-P3

*

*

*

50

45

40

35

30

% In

tegr

ants

at a

ttP

25

20

15

10

5

0

pCS

I

pCS

-dP

3

pCS

-P3

*

*

a

b

c

d

Figure 4 Integration into the preintegrated chromosomal attP site in 293-P3 cells. (a) G418 + Zeocin selection or G418 only selection scheme. 293-P3, a cell line bearing an attP site adjacent to a zeocin resistance gene without a promoter, was co-transfected with pNC-attB and a wild-type or mutant integrase-expressing plasmid. The donor plasmid pNC-attB carries a neomycin resistance gene, an eGFP gene, and a CMV promoter upstream of an attB site. Upon co-transfection, site-specific integration at the attP site would lead to expression of the zeocin resistance gene from the CMV promoter, as well as neomycin (G418) resistance due to the neomycin resistance gene present on the pNC-attB plasmid, rendering the cells resistant to both zeocin and G418. Integration at a pseudo attP site would confer only G418 resistance. (b) 293-P3 cells were co-transfected with pNC-attB and a wild-type or mutant integrase-expressing plasmid and were maintained in selection media containing G418 and zeocin for ~2 weeks. The average numbers of colonies resistant to both G418 + zeocin are shown. All values shown represent the mean ± s.e.m. Asterisks denote values that are higher than pCSI at P < 0.05 (Student’s t-test). (c) 293-P3 cells were co-transfected with pNC-attB and a wild-type or mutant integrase-expressing plasmid and were maintained in selection media containing G418 for ~2 weeks. The average numbers of colonies resistant to G418 are shown. All values shown represent the mean ± s.e.m. Asterisks denote values that are higher than pCSI at P < 0.05 (Student’s t-test). (d) PCR analysis to determine specificity of integration at attP. 293-P3 cells were co-transfected with a G418-resistant attB donor plasmid and either pCSI, pCS-dP3, or pCS-P3. After 2 weeks of selection with G418, ~50 colonies generated by each integrase were picked and individually analyzed by PCR using primers that detect integration at the chromosomal attP site. The percentage of integrants at the attP site is shown. Asterisks denote values that differ from pCSI at P < 0.05 (Student’s t-test).



attP site. Approximately twice as many colonies were obtained with pCS-P2, consistent with increased integration efficiency, but no increased specificity for the attP site. However, pCS-P1 and pCS-P3 both showed a greatly elevated number of colonies having dual resistance, consistent with increased integration specificity at the attP site. pCS-P3 had the highest colony numbers, suggest-ing that it was the most active specificity mutant, with 25-fold more integration at attP compared to the wild-type integrase. The results also suggested that the fusion sequence was benefi-cial in conferring on pCS-P3 an increased ability to integrate at attP (Figure 4b). The numbers of colonies obtained with G418 alone are shown in Figure 4c. The highest integration frequency was obtained with pCS-P2, and the relative rankings of integra-tion efficiencies of the mutants observed in the 293-P3 cells were consistent with those observed in HeLa cells (Figure 3). Based on these results, the calculated targeting ratios to attP (G418r+Zeor colonies/G418r colonies) for pCSI, pCS-P1, pCS-P2, and pCS-P3 in 293-P3 were 0.033, 0.35, 0.037, and 0.437, respectively.

To measure the integration specificity of pCSI, pCS-P3, and pCS-dP3 for the preintegrated attP site more directly, we analyzed by PCR 50–60 G418-resistant clones generated in 293-P3 by these integrases for integration at the attP site. Genomic DNA was iso-lated, and PCR analysis was carried out to determine the presence or absence of a band diagnostic for integration at attP. As summa-rized in Figure 4d, 5% of the clones (3 of 60) generated by pCSI carried an integration at the preintegrated attP site, whereas 16%

(8 of 50) and 44% (22 of 50) of the clones generated by pCS-dP3 and pCS-P3, respectively, carried integration events at attP. This increase suggested that mutant integrase pCS-P3 had increased its specificity for the attP site.

Integration efficiency in mouse liver in vivoTo determine whether the properties that these mutant integrases exhibited in human cultured cells would translate to a mouse model system, the pCS-P2 and pCS-P3 mutant integrases were tested in vivo in mouse liver studies. Hydrodynamic tail vein injection,31,32 was used to achieve efficient delivery of plasmid DNA to the liver. A donor plasmid, pVFB, carrying the ϕC31 attB site and the human factor IX (hFIX) gene (Supplementary Figure S1e) was co-injected with either pCSI, pCSmI, pCS-P2, or pCS-P3. At various time points, blood was collected and serum hFIX levels were determined by enzyme-linked immunosorbent assay. The results of this study are depicted in Figure 5a. The group that received wild-type ϕC31 integrase (pCSI) displayed a 3.9-fold increase in hFIX levels over the group that received pCSmI (P < 0.05). Mice that were co-injected with mutant integrase pCS-P2 had a significant increase (an average of 1.9-fold from day 28 to day 84) in hFIX levels over pCSI. This result suggested that that the P2 mutant could elevate the level of integration in mouse liver, as it did in cultured human cells. The increased hFIX levels mediated by pCSI and pCS-P2 persisted during the 3-month period of the experiment and represented therapeutic

2,000

1,500

hFIX

(ng

/ml)

1,000

500

00

Naive

Mer

gehF

IXD

AP

I

HBSS pCSml pCSI pCS-P2 pCS-P3

10 20 30 40Days postinjection

50 60 70 80 90

pCS-P2

pCSI

pCS-P3

pCSml

*

*

a

b

Figure 5 Human factor IX expression in mouse liver. (a) Levels of hFIX in mouse serum. Animals were hydrodynamically injected with pVFB and pCSmI, pCSI, pCS-P2, or pCS-P3. Sera from blood samples were assayed by enzyme-linked immunosorbent assay at various time points. Asterisks denote P values of interest that were <0.05. (b) Immunofluorescence staining for human factor IX of mouse liver sections obtained after 3 months. The top row shows DAPI stained nuclei, the middle row shows staining for human factor IX, and the bottom row is a merged image of the top and middle rows. Panel 1, naive control; panel 2, Hank’s balanced salt solution (HBSS) alone; panel 3, pVFB + pCSmI; panel 4, pVFB + pCSI; panel 5, pVFB + pCS-P2; and panel 6: pVFB + pCS-P3.



levels of hFIX. Because the average initial factor IX levels were higher in the pCS-P2 and pCS-P3 groups, we also calculated the percent expression retained at the final time point for each group, compared to the initial values. The groups that received pCSI or pCS-P2 retained ~40% and ~75% of their initial hFIX expres-sion, respectively. In contrast, the animals that were injected with pCS-P3 or pCSmI retained levels that were only ~14% or ~11% of their initial values, respectively. The levels of hFIX generated by pCS-P3 mutant were only 1.5-fold higher than those generated by pCSmI, suggesting a poorer ability of the P3 mutant to medi-ate integration into pseudo attP sites in the mouse genome.

To further analyze the ability of the wild-type and mutant integrases to mediate integration and provide long-term expres-sion of hFIX, we performed immunofluorescence staining on liver sections by using an antibody against hFIX. Figure 5b shows representative liver sections obtained 3 months after injec-tion from mice that were naive, received buffer alone, or received pVFB along with pCSmI, pCSI, pCS-P2, or pCS-P3. At this time point, we expected that little unintegrated plasmid DNA would be present7 and that most hFIX expression was coming from integrated plasmid DNA. These sections revealed that a signifi-cantly higher number of cells stained positive for hFIX in livers that received pCSI, compared to the control group that received pCSmI, as expected. Moreover, P2 gave rise to more cells express-ing hFIX than did the wild-type integrase. This result suggested that P2 had a higher integration efficiency than wild-type ϕC31 integrase. By contrast, the P3 mutant generated a lower num-ber of stained cells. To quantify the percentage of hFIX posi-tive cells, we counted hFIX positive cells and all nuclei visible from the DAPI stain in two separate sections for each integrase. Mice that received pCSmI had about 1.9% (27 hFIX positive cells/1,424 total cells analyzed) of hepatocytes that were positive for hFIX. Much of this signal may be due to random integration of the pVFB plasmid following hydrodynamic delivery of many copies of plasmid DNA into the hepatocytes. In the group that was given pCSI, ~12.4% (201 hFIX/1,616 total) of the hepatocytes were positive for hFIX. The P2 mutant resulted in ~18.5% (293

hFIX/1,579 total) of the cells expressing hFIX. The P3 mutant generated about 4.3% (67 hFIX/1,550 total) positive cells.

Integration at a known pseudo attP site in mouse liverPrevious studies utilizing ϕC31 integrase in the liver and muscles of mice have demonstrated by PCR that the enzyme frequently mediates integration at a genomic pseudo attP site termed mpsL1 that is located on chromosome 2 (refs. 5,7,8,13,14) To investigate whether the mutant integrases also utilized this integration site in the mouse genome, genomic DNA was isolated from the liv-ers of two animals per group, and similar amounts of genomic DNA template were analyzed by PCR for integration of pVFB at the mpsL1 site. PCR bands of the expected size were seen in the positive control lane, as well as in samples from the groups that received pCSI and pCS-P2 (Figure 6a). No band was observed in reactions using DNA from animals that received pCSmI or pCS-P3. The PCR bands from the positive control, pCSI, and pCS-P2 samples were sequenced, and the resulting analysis con-firmed that integration took place at mpsL1 (Figure 6b). Sequence features, including small deletions near the recombination junc-tion that are characteristic of ϕC31-mediated recombination, 5–7 were observed in some instances (Figure 6b).

dIscussIonIn this study, we report the generation of two useful ϕC31 integrase variants. The P2 mutant has double the integration frequency of wild-type integrase, whereas the P3 mutant displays a several-fold improvement in specificity for the attP site. Alanine scanning was a productive technique to generate mutants in a specific domain, whereas error-prone PCR was useful for random mutagenesis throughout a larger area of the gene. The work demonstrated the feasibility of using mutagenesis, in combination with bacterial and mammalian screens, to create and identify altered integrases with increased functionality. Mutagenesis has also been employed successfully to increase the activity of other integration systems in mammalian cells, such as the transposases of the Sleeping Beauty and Himar1 transposons.33–35 Transposases and the related retroviral integrases require little sequence recognition to catalyze integration and therefore insert in a near random manner. To confer sequence specificity on these enzymes, attempts have been made to fuse them with DNA recognition domains to direct integration.36–38 However, to date these efforts have produced little specificity in chromosomal integration. A more efficacious approach has been to fuse zinc-finger DNA-binding domains to endonucleases that can then make a directed double-strand break to stimulate homologous recombination. When a second DNA is introduced to provide a template for recombination, efficient modification of DNA can occur at the site of breakage.39 The ϕC31 integrase system may provide a simpler, single-step method for sequence-specific gene addition.

The coding sequence of ϕC31 integrase encompasses 605 amino acids,1–3 or in the case of the version used here, 613 amino acids. The eight extra amino acids in the 613 amino acid version derived from our decision to use the most upstream of the possible AUG initiator codons, in an effort to ensure full function of the protein.4 The 605–amino acid version of integrase is also

1a

b

2 3 4 5 6

Positivecontrol

attB sequence Genomic sequence (mpsL1)

GCCCTTCGAAGCCGCGGTGCGGGTGCCAGGG:GTGCCC

GCCCTTCGAAGCCGCGGTGCGGGTGCCAGGGCGTGCCC

:TCACACCCAAAGGCCCTATTAATTTAGGGAGCCTCTATT

TTGACACCCAAAGGCCCTATTAATTTAGGGAGCCTCTATT

GCCCTTCGAAGCCGCGGTGCGGGTGCCAGGGCGTGCCC TT:A::CCCAAAGGCCCTATTAATTTAGGGAGCCTCTATT

pCSI

pCS-P2

Figure 6 evidence for integration into a genomic pseudo attP site in mouse liver. (a) PCR was carried out on DNA extracted from liver, using primers that detect the junction between the attB site of pVFB and mpsL1, a preferred pseudo attP site in the mouse genome. Lane 1, liver DNA sample from an injected animal from another experiment, previously shown to have attB-plasmid DNA integrated at mpsL1; lane 2, primers alone; lane 3, liver that received pVFB and pCSmI; lane 4, liver that received pVFB and pCSI; lane 5, liver that received pVFB and pCS-P2; and lane 6, liver that received pVFB and pCS-P3. (b) PCR bands from lanes 1, 4, and 5 were excised, purified, TOPO-cloned, and sequenced. The sequences depicted begin in attB and join genomic DNA within the mpsL1 site. The TT core crossover sequence is in bold, and “:” represents small deletions seen in the crossover region.



active and has been used in studies that employ the integrase mRNA, such as in construction of transgenic mice40 and flies.20 The shorter version probably corresponds to the native protein, based on alignment with other serine integrases, which share a high degree of sequence similarity in their N-terminal catalytic domain.30 The serine required for catalytic function resides at amino acid 12 in the 605 version and at amino acid 20 in the 613–amino acid version used here.

The P1 mutant integrase was constructed by combining 2 individual first-round mutants that were obtained by error-prone PCR (Table 1). Although these mutations are all in the catalytic domain of the ϕC31 integrase, they seem to improve specificity of the enzyme at recognizing the placed attP site in the cultured human cells. The P2 mutant carries three mutations that change charged residues to alanines, all well within the predicted ~150–amino acid catalytic domain30 of ϕC31 integrase (Table 1). Among serine recombinase family members, the atomic structure has been solved to date for the gamma–delta resolvase41 and recently for the catalytic domain of the TP901-1 integrase.42 Based on amino acid sequence similarities and structural predictions, ϕC31 integrase may share a similar three-dimensional structure in the catalytic domain. It is plausible that the amino acid changes in P2, as they are in proximity to the catalytic serine residue, could influence the activity of the enzyme.

A 33–amino acid sequence fortuitously translated from the lac control region appears to be required, in concert with the amino acid changes, for the increased activity of the P2 protein (Figure 3). Secondary structure prediction programs suggest that the fusion sequence can form an alpha helix, which may increase stability of the P2 protein. Therefore, this fusion region may be acting as a stabilizer sequence, in the context of the three amino acid changes present in P2. The fusion is also somewhat beneficial in the P3 mutant, which is derived from P2. Why this fusion region has less impact on improving the activity of P1 is not clear.

Mutant integrase P3 resulted from combining the three amino acid changes present in P2 with the five amino acid changes of P1, in addition to an inadvertent 3-bp deletion and associated amino acid change (Table 1). Although the first two positions affected in P1 are probably not present in the native ϕC31 integrase protein, they still may provide benefit in the context of these mutants. Without individually testing the effect of each mutation, we cannot be sure of the effects of a particular change. Our results imply that the P3 integrase may be relatively poor at recognizing pseudo attP sites, especially those in the mouse genome (Figures 3 and 5), but may have an increased affinity for the native attP sequence. Biochemical studies may be able to clarify this fea-ture. P3 seems to combine the higher catalytic activity of the P2 mutant with the higher attP recognition specificity provided by P1 (Figure 4b).

All of the changes in P1 and P3 are encompassed within the predicted catalytic domain, which may seem surprising for a speci-ficity mutant. Serine integrases are postulated to contain a separate, more C-terminal DNA-binding domain that plays a major role in recognition of the att sites.30 However, it is clear that some DNA recognition must also reside in the catalytic domain, which pre-sumably becomes closely apposed to the central core sequences of the att sites when the crossover reaction takes place.41–43

P1 and P3 represent specificity mutants, whereas P2 appears to represent a simple raised efficiency mutant (Figures 3 and 4b). The P2 efficiency mutant clearly continues to recognize the mpsL1 hotspot in the mouse liver genome (Figure 6), as well as at least five common hotspots in the human genome (data not shown). After a single hydrodynamic injection of plasmids encoding the P2 integrase and hFIX, nearly 20% of mouse hepa-tocytes produced therapeutic levels of hFIX 3 months after the gene therapy treatment (Figure 5). From the increase in hFIX levels and hFIX positive cells, it appears that P2 is significantly more efficient than the wild-type enzyme at catalyzing the inte-gration reaction. A portion of the higher transgene expression in the mouse liver obtained with P2 could occur if this mutant sometimes mediated multiple integrations of the donor plasmid into a given cell, compared to the single integration event/cell typical of the wild-type enzyme.6 and this should be studied. We cannot rule out that P2 may have acquired specificities to novel pseudo sites. To ascertain the integration specificity of P2 and to establish the utility of P2 in gene therapy, analysis of a large col-lection of its integration sites must be performed. Studies in cell culture do not necessarily predict which integration sites will be preferred in vivo,7 probably due to chromosomal context effects influenced by transcription patterns.6 Therefore, the most accu-rate method to predict the integration specificity of P2 in human gene therapy would be to analyze the integration sites used by the integrase in the desired target organ in a primate study. We understand the need for such studies and plan to carry them out employing massively parallel sequencing to analyze integration sites.44

Because of the limited ability of the P3 integrase to recognize pseudo attP sites, it is not likely to be useful for gene therapy. However, P3 will be useful when heightened specificity for the attP site is desired, such as in manipulation of cell lines and trans-genic animals into which a wild-type attP site has been integrated as a recombination target.20,21,27 Because of this likely limitation in use of P3, we have not characterized its integration profile at pseudo attP sites. Nevertheless, P3 provides proof of principle that it is possible to obtain derivatives of ϕC31 integrase that have a high level of specificity for one sequence in the human genome. New, more powerful screens, together with increased biochemi-cal understanding of the enzyme, should yield a useful series of improved integrases in the future.

MAterIAls And MetHodsPlasmids. Plasmid pFC1 (Figure 1a) was used as the recipient plasmid for cloning libraries of mutant integrases for use in the prescreen in bacteria (see Supplementary Material and Methods).

pFC1-M (Supplementary Figure S1a) carried mutant integrase candidates that were assayed in the mammalian screen by using the plasmid pBP-Green (Figure 1b) (see Supplementary Materials and Methods).

Plasmids pCSI (pCMVInt),4 expressing wild-type ϕC31 integrase, and pCSmI,7 containing a nonfunctional integrase gene, have been described. pCS-P1, pCS-P2, and pCS-P3 (Supplementary Figure S1b), as well as pCS-dP1, pCS-dP2, and pCS-dP3 (Supplementary Figure S1c) were constructed by cloning integrases P1, P2, P3, dP1, dP2, and dP3 from the pFC-P1, pFC-P2, pFC-P3 plasmid (Supplementary Figure S1a) into the pCS7 backbone. The “d” signified deletion of the N-terminal fusion sequence (see Supplementary Material and Methods).



The plasmid pNC-attB5 (Supplementary Figure S1d) was used for in vitro cell culture assays in mammalian cells. This donor plasmid carried the ϕC31 attB site positioned 3′ of a CMV promoter, the eGFP gene, and a neomycin resistance gene.

The pVFB donor plasmid (Supplementary Figure S1e), used for mouse liver studies, was generated by cloning a human factor IX mini-gene under the hAAT promoter7,45 into the pVax plasmid (Invitrogen, Carlsbad, CA) (see Supplementary Materials and Methods for plasmid construction).

Bacterial screen for functional integrase mutants. To perform the bacterial prescreen, mutant integrase genes were cloned into a pFC1 vector, trans-formed into E. coli, and plated on LB-agar plates containing chlorampheni-col and X-gal. After overnight incubation at 37 °C, plates were screened for the presence of blue and white colonies (Figure 1a).

Mammalian screen for improved integrase mutants. White colonies from the bacterial screen were picked and plasmid DNA purified from them using the QiaPrep8 Turbo Miniprep Kit (Qiagen, Valencia, CA). Twenty-five nanogram of this plasmid DNA, along with 25-ng pBP-Green (Figure 1b), were transfected into 293 cells in 96-well plates using FuGENE 6 (Roche, Palo Alto, CA). Each mutant was transfected into 8 wells of a 96-well plate containing 293 cells. A negative control (pFC1) and the wild-type integrase (pFC1-WT, generated by cloning the wild-type ϕC31 integrase into pFC1) were also transfected into 8 wells of each plate to provide a comparison for the mutants. Three days after transfection, cells were analyzed for eGFP expression using a Guava PCA-96 Analyzer (Guava Technologies, Hayward, CA). The mean fluorescence intensity was used as an indicator of efficiency of the mutant integrases.

Integrase protein analysis. HA-tagged versions of the wild-type and integrase mutants were generated (see Supplementary Materials and Methods). Total cell lysates were prepared from HeLa cells transfected with pCSI-HA, pCS-dP2-HA, pCS-P2-HA, pCS-dP3-HA, and pCS-P3-HA, and integrase expression levels were determined by western blot analysis (see Supplementary Materials and Methods).

Chromosomal integration assays. Fifty to seventy percent confluent HeLa cells in 6-well plates were co-transfected, in triplicate, with 20 ng pNC-attB donor plasmid and 980 ng of plasmid expressing the mutant integrases (pCS-P1, pCS-P2, pCS-P3, pCS-dP1, pCS-dP2, and pCS-dP3), the wild-type pCSI or the negative control pCSmI, carrying the inac-tive integrase using 3 μl FuGENE 6 as the transfection reagent according to the manufacturer’s instructions. The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Carlsbad, CA) containing 4 mmol/l L-glutamine and supplemented with 9% fetal bovine serum (Gibco) and 1% penicillin–streptomycin (Gibco). Twenty-four hours after transfection, the cells from each well were trypsinized and seeded onto four 100-mm plates. Seventy-two hours after the transfection, the medium was replaced with DMEM containing 1.25 mg/ml G418 (Invitrogen), and selective pressure was maintained for 14–17 days, after which the colonies were counted.

293-P3 cells5 were used to test the ability of mutants to integrate at an attP site placed in the chromosomes. 293-P3 cells at 70% confluence in 6-well plates were transfected in duplicate with 20 ng pNC-attB donor plasmid and 980 ng of plasmids expressing the mutant integrases (pCS-P1, pCS-P2, pCS-P3, pCS-dP1, pCS-dP2, and pCS-dP3) using 3 μl FuGENE 6. The cells from each well were trypsinized and seeded onto two 100-mm dishes and cultured in complete DMEM for 24 hours, after which drug selection was initiated. The 293-P3 cells on one 100-mm dish from each transfection were selected by using a combination of 350 μg/ml of G418 and 100 μg/ml of zeocin (Invitrogen), whereas the cells on the second 100-mm dish were selected using 350 μg/ml of G418 alone. During selection, cells were maintained at 37 °C in a CO2 incubator and were supplied with fresh selection medium every 2–3 days

until well-isolated colonies could be seen, usually a period of 14–17 days, after which the colonies were counted.

Integration site analysis in cultured human cells. To demonstrate genomic integration at pseudo attP sites mediated by pCS-P2 and pCS-dP2 mutant integrases, 50–60% sub-confluent HeLa cells in 6-well plates were transfected using FuGENE 6 with 20 ng pNC-attB and 980 ng pCS-P2 or pCS-dP2. Twenty-four hours after transfection, the cells in each well were trypsinized, diluted 1:1, 1:2, 1:4, and 1:10, and seeded onto 100-mm plates. Twenty-four hours later, selection was carried out at 37 °C in a CO2 incubator using complete DMEM containing 1.25 mg/ml G418. After 14 days, colonies were trypsinized, and ~250 colonies were pooled from the undiluted plate, 130 colonies from the 1:2 diluted plate, 60 colonies from the 1:4 diluted plate, and 25 colo-nies from the 1:10 diluted plate. These colonies were allowed to grow to confluency in complete DMEM. Genomic DNA was isolated using the DNeasy Blood & Tissue kit (Qiagen). Two hundred nanogram of this genomic DNA was used as a template for PCR amplification with prim-ers designed to detect integration at five of the most frequently observed integration sites for ϕC31 integrase in the human genome.6 The amplified bands were excised, TOPO-cloned, and sequenced for verification.

To demonstrate specific integration at a preintegrated attP site in the human genome, 60–70% confluent 293-P3 cells were transfected in a 6-well plate with 20 ng of donor plasmid pNC-attB and 980 ng of pCSI or mutant integrase-expressing pCS-P3 or pCS-dP3 using 3 μl FuGENE 6. Twenty-four hours after transfection, the cells in each well were split to two 100-mm plates. Forty-eight hours after transfection, selection was begun using media containing 350 μg/ml G418. After 14–17 days of selection to ensure well-isolated colonies, each colony was individually trypsinized, transferred to one well of a 6-well plate, and each clone was allowed to grow to confluency. Fifty clones were picked for each integrase transfection and genomic DNA was isolated using the DNeasy Blood & Tissue kit. Integration at the attP site was scored by PCR amplification of 200 ng of genomic DNA using primers designed to detect the junction created by recombination between the attP site placed in the genome and the attB site present in the donor plasmid (see Supplementary Materials and Methods).

Hydrodynamic injection in mouse livers. Eight-week-old female C57/BL6 mice were purchased from Charles Rivers Laboratories (Wilmington, MA) and housed in the Stanford Research Animal Facility. Animals were acclimatized for 3–4 days before experimentation. The animal protocol was approved by the Stanford University Animal Use and Care Committee, based on NIH guidelines. Each experimental group consisted of 5–8 mice. Twenty microgram pVFB donor plasmid and 20 μg pCSmI, pCSI, pCS-P2, or pCS-P3 in 1.8 ml of Hank’s balanced salt solution (Gibco) were hydrodynamically injected over 6–8 seconds using a 3 ml Luer-Lok syringe (Becton Dickinson; Franklin Lakes, NJ) with a 27½-G needle (Becton Dickinson) via the tail vein. In addition, two animals were injected with Hank’s balanced salt solution alone, and two animals were used as naive controls. To dilate the tail vein, the mice were kept under a heat lamp for 3–7 minutes before injection.

Detection of human factor IX by enzyme-linked immunosorbent assay. For quantification of hFIX, whole blood was collected retroorbitally from the mice at various time points. The blood samples were allowed to clot for 2 hours at room temperature or overnight at 2–8 °C before centrifuging for 20 minutes at ~2,000g. The serum was removed and stored at ≤−20 °C. The level of hFIX in serum was determined by using an enzyme-linked immunosorbent assay protocol7 (see Supplementary Materials and Methods). The data were analyzed using the Microplate Manager III Macintosh data analysis software.

Integration site analysis in mouse liver. Three months after injection, animals were killed and the livers collected. Genomic DNA was



obtained from the livers as previously described.46 Integration into the mouse genome was confirmed by PCR analysis at the mpsL1 site (see Supplementary Materials and Methods). The PCR product was subjected to agarose gel electrophoresis to detect a band corresponding to the expected size of 290 bp.

Immunofluorescence microscopy. Three months after hydrodynamic injec-tion, animals were killed and their livers were harvested. Immunofluorescence staining using anti-hFIX was carried out (see Supplementary Materials and Methods). Fluorescent images were obtained using a Zeiss microscope.

Statistical analysis. Data were analyzed using the Microsoft Excel graphing and statistical program. The Student’s t-test assuming unequal variances was performed to determine significant differences between groups. P value of <0.05 was considered statistically significant.

suPPleMentArY MAterIAlFigure S1. Plasmids.Materials and Methods.

AcKnoWledGMentsThis work was supported in part by NIH grant HL68012 to M.P.C. L.E.W. was funded by grant CA09302 from the NCI, DHHS. We thank William J. Rutter for encouragement and support. M.P.C. is an inventor on Stanford-owned patents covering φC31 integrase and has an equity interest in Poetic Genetics.

reFerences1. Kuhstoss, S and Rao, RN (1991). Analysis of the integration function of the

Streptomycete bacteriophage ϕC31. J Mol Biol 222: 897–908.2. Rausch, H and Lehmann, M (1991). Structural analysis of the actinophage ϕC31

attachment site. Nucleic Acids Res 19: 5187–5189.3. Thorpe, HM and Smith, MC (1998). In vitro site-specific integration of bacteriophage

DNA catalyzed by a recombinase of the resolvase/invertase family. Proc Natl Acad Sci USA 95: 5505–5510.

4. Groth, AC, Olivares, EC, Thyagarajan, B and Calos, MP (2000). A phage integrase directs efficient site-specific integration in human cells. Proc Natl Acad Sci USA 97: 5995–6000.

5. Thyagarajan, B, Olivares, EC, Hollis, RP, Ginsburg, DS and Calos, MP (2001). Site-specific genomic integration in mammalian cells mediated by phage ϕC31 integrase. Mol Cell Biol 21: 3926–3934.

6. Chalberg, TW, Portlock, JL, Olivares, EC, Thyagarajan, B, Kirby, PJ, Hillman, RT et al. (2006). Integration specificity of phage ϕC31 integrase in the human genome. J Mol Biol 357: 28–48.

7. Olivares, EC, Hollis, RP, Chalberg, TW, Meuse, L, Kay, MA and Calos, MP (2002). Site-specific genomic integration produces therapeutic factor IX levels in mice. Nat Biotechnol 20: 1124–1128.

8. Held, PK, Olivares, EC, Aguilar, CP, Finegold, M, Calos, MP and Grompe, M (2005). In vivo correction of murine hereditary tyrosinemia type I by ϕC31 integrase -mediated gene delivery. Mol Ther 11: 399–408.

9. Ortiz-Urda, S, Thyagarajan, B, Keene, D, Lin, Q, Fang, M, Calos, MP et al. (2002). Stable nonviral genetic correction of inherited human skin disease. Nat Med 8: 1166–1170.

10. Ortiz-Urda, S, Keene, D, Lin, Q, Calos, MP and Khavari, P (2003). ϕC31 integrase-mediated nonviral genetic correction of junctional epidermolysis bullosa. Hum Gene Ther 14: 923–928.

11. Chalberg, TW, Genise, H L, Vollrath, D and Calos, MP (2005). ϕC31 integrase confers genomic integration and long-term transgene expression in rat retina. Invest Ophthalmol Vis Sci 46: 2140–2146.

12. Keravala, A, Portlock, J, Nash, JA, Vitrant, DG, Robbins, PD and Calos, MP (2006). PhiC31 integrase mediates integration in cultured synovial cells and enhances gene expression in rabbit joints. J Gene Med 8: 1008–1017.

13. Bertoni, C, Jarrahian, S, Wheeler, TM, Li, Y, Olivares, EC, Calos, MP et al. (2006). Enhancement of plasmid-mediated gene therapy for muscular dystrophy by directed plasmid integration. Proc Natl Acad Sci USA 103: 419–424.

14. Portlock, JL, Keravala, A, Bertoni, C, Lee, S, Rando, TA and Calos, MP (2006). Long-term increase in mVEGF164 in mouse hindlimb muscle mediated by phage phiC31 integrase after nonviral DNA delivery. Hum Gene Ther 17: 871–876.

15. Quenneville, SP, Chapdelaine, P, Rousseau, J and Tremblay, J (2007). Dystrophin expression in host muscle following transplantation of muscle precursor cells modified with the phiC31 integrase. Gene Ther 14: 514–522.

16. Quenneville, SP, Chapdelaine, P, Rousseau, J, Beaulieu, J, Caron, NJ, Skuk, D et al. (2004). Nucleofection of muscle-derived stem cells and myoblasts with ϕC31

integrase: stable expression of a full-length-dystrophin fusion gene by human myoblasts. Mol Ther 10: 679–687.

17. Ishikawa, Y, Tanaka, N, Murakami, K, Uchiyama, T, Kumaki, S, Tshuchiya, S et al. (2006). Phage phiC31 integrase-mediated genomic integration of the common cytokine receptor gamma chain in human T-cell lines. J Gene Med 8: 646–653.

18. Thyagarajan, B, Liu, Y, Shin, S, Lakshmipathy, U, Scheyhing, K, Xue, H et al. (2008). Creation of engineered human embryonic stem cell lines using phiC31 integrase. Stem Cells 26: 119–126.

19. Keravala, A, Ormerod, BK, Palmer, T and Calos, MP (2008). Long-term gene expression in phiC31 integrase-modified mouse neural progenitor cells. Neurosci Methods 173: 299–305.

20. Groth, AC, Fish, M, Nusse, R and Calos, MP (2004). Creation of transgenic Drosophila by using the site-specific integrase from phage ϕC31. Genetics 166: 1775–1782.

21. Bateman, JR, Lee, AM and Wu, CT (2006). Site-specific transformation of Drosophila via phiC31 integrase-mediated cassette exchange. Genetics 173: 769–777.

22. Venken, K, He, Y, Hoskins, RA and Bellen, HJ (2006). P[acman]: A BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314: 1747–1751.

23. Bischof, J, Maeda, RK, Hediger, M, Karch, F and Basler, K (2007). An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrase. Proc Natl Acad Sci USA 104: 3312–3317.

24. Allen, BG and Weeks, DL (2005). Transgenic Xenopus laevis embryos can be generated using phiC31 integrase. Nat Methods 2: 975–979.

25. Nimmo, DD, Alphey, L, Meredith, JM and Eggleston, P (2006). High efficiency site-specific genetic engineering of the mosquito genome. Insect Mol Biol 15: 129–136.

26. Calos, MP (2006). The phiC31integrase system for gene therapy. Curr Gene Ther 6: 633–645.

27. Belteki, G, Gertsenstin, M, Ow, DW and Nagy, A (2003). Site-specific cassette exchange and germline transmission with mouse ES cells expressing the ϕC31 integrase. Nat Biotechnol 21: 321–324.

28. Raymond, CS and Soriano, P (2007). High-efficiency FLP and ϕC31 site-specific recombination in mammalian cells. PLoS ONE 2: e162.

29. Sclimenti, CR, Thyagarajan, B and Calos, MP (2001). Directed evolution of a recombinase for improved genomic integration at a native human sequence. Nucleic Acids Res 29: 5044–5051.

30. Smith, MC and Thorpe, HM (2002). Diversity in the serine recombinases. Mol Microbiol 44: 299–307.

31. Zhang, G, Budker, V and Wolff, JA (1999). High levels of foreign gene expression in hepatocytes after tail vein injections of naked plasmid DNA. Hum Gene Ther 10: 1735–1737.

32. Liu, F, Song, YK and Liu, D (1999). Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA. Gene Ther 6: 1258–1266.

33. Yant, SR, Park, J, Huang, Y, Mikkelsen, JG and Kay, MA (2004). Mutational analysis of the N-terminal DNA-binding domain of Sleeping Beauty transposase: critical residues for DNA binding and hyperactivity in mammalian cells. Mol Cell Biol 24: 9239–9247.

34. Zayed, H, Izsvak, Z, Walisko, O and Ivics, Z (2004). Development of hyperactive sleeping beauty transposon vectors by mutational analysis. Mol Ther 9: 292–304.

35. Keravala, A, Liu, D, Lechman, ER, Wolfe, D, Nash, JA, Lampe, DJ et al. (2006). Hyperactive Himar1 transposase mediates transposition in cell culture and enhances gene expression in vivo. Hum Gene Ther 17: 1006–1018.

36. Bushman, F (2002). Targeting retroviral integration? Mol Ther 6: 570–571.37. Tan, W, Dong, Z, Wilkinson, TA, Barbas, CF 3rd and Chow, SA (2006). Human

immunodeficiency virus type 1 incorporated with fusion proteins consisting of integrase and the designed polydactyl zinc finger protein E2C can bias integration of viral DNA into a predetermined chromosomal region in human cells. J Virol 80: 1939–1948.

38. Yant, SR, Huang, Y, Akache, B and Kay, MA (2007). Site-directed transposon integration in human cells. Nucleic Acids Res 35: e50.

39. Santiago, Y, Chan, E, Liu, P, Orlando, S, Zhang, L, Urnov, FD et al. (2008). Targeted gene knockout in mammalian cells by using engineered zinc-finger nucleases. Proc Natl Acad Sci USA 105: 5809–5814.

40. Hollis, RP, Stoll, SM, Sclimenti, CR, Lin, J, Chen-Tsai, Y and Calos, MP (2003). Phage integrases for the construction and manipulation of transgenic mammals. Reprod Biol and Endocrinol 1: 79–90.

41. Yang, W and Steitz, TA (1995). Crystal-structure of the site-specific recombinase gamma-delta resolvase complexed with a 34 bp cleavage site. Cell 82: 193–207.

42. Yuan, P, Gupta, K and Van Duyne, GD (2008). Tetrameric structure of a serine integrase catalytic domain. Structure 16: 1275–1286.

43. Grindley, ND, Whiteson, KL and Rice, PA (2006). Mechanisms of site-specific recombination. Ann Rev Biochem 75: 567–605.

44. Wang, GP, Ciuffi, A, Leipzig, J, Berry, CC, Bushman, FD (2007). HIV integration site selection: analysis by massively parallel pyrosequencing reveals association with epigenetic modifications. Genome Res 17: 1186–1194.

45. Miao, CH, Ohashi, K, Patijn, GA, Meuse, L, Ye, X, Thompson, AR et al. (2000). Inclusion of the hepatic locus control region, an intron, and untranslated region increases and stabilizes hepatic factor IX gene expression in vivo but not in vitro. Mol Ther 1: 522–532.

46. Laird, P, Zijderveld, A, Linders, K, Rudnicki, M, Jaenisch, R and Berns, A (1991). Simplified mammalian DNA isolation procedure. Nucleic Acids Res 19: 4293.

Documents

Mutational Derivatives of PhiC31 Integrase With Increased Efficiency and Specificity