MA

L

TvoBptse

MA

S(auBma

C

AtCfc

P

Dts

©3

T

icrochimerism Does Not Correlate With Survival of Murine Cardiacllografts

.V. de Moraes, V. Bueno, N. Panajotopoulos, and L.V. Rizzo

ABSTRACT

The development of microchimerism was evaluated at different time points after infusionof a mixed population of bone marrow and spleen cells from (BALB/c � C57Bl/6)F1 micein the presence or absence of a cardiac transplant. Microchimerism was observed in thespleen, bone marrow and thymus of transplanted BALB/c mice even after graft rejection.In the absence of transplantation, donor cells persisted especially in the thymus. Theresults show that despite augmentation of graft survival after donor cell infusion comparedto nontreated controls, the development of microchimerism did not sustain cardiacsemihistocompatible grafts. Moreover, the persistence of donor cells in the thymus in bothsituations suggests a role for this organ in the increased graft survival in our model.

EwWksfwfse

S

Snp5Tt

iBFLP(PIB

DU

HE ROLE OF MICROCHIMERISM in inducing tol-erance to allografts in experimental models is contro-

ersial.1–4 The present study investigated the establishmentf microchimerism in transplanted versus nontransplantedALB/c mice that had received an infusion of a mixedopulation of bone marrow and spleen cells from semihis-ocompatible donors. The correlation between cardiac grafturvival and the presence of microchimerism was alsoxamined in transplanted hosts.

ATERIALS AND METHODSnimals

ix- to 10-week-old BALB/c (H-2d) and (BALB/c � C57B1/6)F1BaB6; H-2d/b) female mice obtained from our own animal facilitiest the University of Sao Paulo were kept in microisolation cagesnder specific pathogen-free conditions. In all experimentsALB/c mice were recipients and BaB6 were donors. The experi-ents were performed following the guidelines for animal use

pproved by the Ethics Committee for Animal Experimentation.

ardiac Transplantation

bdominal vascularized heart transplants were performed hetero-opically according to the technique described by Corry et al.5

ardiac function was evaluated by scoring heart beats at levelsrom �4 (excellent) to 0 (failure), according to the intensity of theardiac impulse.

reparation of Donor Cells

onor spleen and bone marrow cells were mixed (3:2, respec-ively). A single dose of 5 � 106 cells diluted in 300 �L of

erum-free culture medium (DMEM; Gibco, BRL, Rockville, E

2004 by Elsevier Inc. All rights reserved.60 Park Avenue South, New York, NY 10010-1710

ransplantation Proceedings, 36, 1021–1022 (2004)

UA) was injected via the tail vein of recipients. Bone marrow cellsere obtained by flushing the femurs of BaB6 mice with DMEM.ashed cells were tested for viability with trypan blue and then

ept at 4°C in serum-free culture medium until use. A spleen celluspension was prepared by mechanical teasing of the organollowed by lysis of the red blood cells with NH4Cl buffer. Cellsere washed with phosphate-buffer saline, transferred to serum-

ree DMEM, and tested for viability. The appropriate number ofpleen cells were mixed with bone marrow cells for injection. In allxperiments cells were infused 21 days before transplantation.

emiquantitive PCR

pleen, bone marrow cells, thymus, axillary and inguinal lymphodes were harvested from the recipients for DNA extraction usinghenol chloroform. The HPRT was used as control (forward:�GTTGGATACAGGCCAGACTTTGTTG 3�; reverse: 5�GAT-CAACTTGCGTCATCTTAGGC 3�). Conditions for amplifica-

ion were: 30 cycles at 94°C/1 minute; 52°C/2 minutes; 72°C/3

From the Department of Immunology (L.V.M., L.V.R.), Biomed-cal Sciences Institute, University of Sao Paulo, Sao Paulo,razil; Nephrology Division (V.B.), Paulista School of Medicine,ederal University of Sao Paulo (UNIFESP), Sao Paulo, Brazil;aboratory of Transplantation (N.P.), Heart Institute (InCor), Saoaulo, Brazil; Division of Allergy and Clinical Immunology

L.V.R.), LIM 60, University of Sao Paulo Medical School, Saoaulo, Brazil; Fundacao Zerbini (L.V.R.), Sao Paulo, Brazil; and

nstitute for Investigation in Immunology (iii) (L.V.M., L.V.R.),razilian Ministry of Science and Technology, Sao Paulo; Brazil.Address reprint requests to Av Prof Lineu Prestes, 1730

epartment of Immunology, Instituto de Ciencias Biomedicas,niversity of Sao Paulo, Sao Paulo, Brazil CEP 05508-900.

-mail: lvrizzo@icb.usp.br

0041-1345/04/$–see front matterdoi:10.1016/j.transproceed.2004.03.053

1021

ma(vwt7mUpefiSLt1

R

Mmttit((wbbw

dipioaobocsrhpacl

R

1

1

1

2

TBS

after th

1022 MORAES, BUENO, PANAJOTOPOULOS ET AL

inutes. Microchimerism was detected by the presence of themplified product between the exons 5 and 6 of the H-2b geneforward: 5�AAACCTCCTCAGGCGCCGGCCCGCCC3�; re-erse: 5�GGGCTGGGGCTCAGTCCTGGGGAAGAA3�). DNAas denatured for 2 minutes at 94°C and the amplification condi-

ions were 28 cycles at 94°C/20 segments; 59°C/30 segments;2°C/45 segments. Amplifications were performed in 20 �L with 10mol/L Tris chloride (pH 8.3), 2 mmol/L MgCl2, 100 �L dNTP, 1/�L of Taq polymerase, and 0.1 �mol/L oligonucleotides. The

roducts of the PCR reaction were run in agarose gel (1.2%) andthidium bromide was added for ultraviolet visualization. Quanti-cations were performed by densitometry analyses using an Alphacan Imaging Densitometer (Alpha Innotech Corporation, Saneandro, Calif, USA) and normalized by signals generated from

he actin bands. Semiquantitative data were calculated considering.0 as the value for maximum amplification product.

ESULTS AND DISCUSSION

icrochimerism was detected in the spleen and bonearrow for up to 42 days after cell infusion and persisted in

he thymus throughout the evaluation period. Cardiacransplantation performed 21 days after donor cell admin-stration also showed that microchimerism persisted in thehymus for at least 56 days (35 days after transplantation)Table 1). Grafts were rejected within a mean survival timeMST) of 18 days whereas the MST in nontreated controlsas 11 days. The intensity of the bands in the thymus andone marrow on day 56 was decreased compared to theand on day 35 (approximately 50% and 90%, respectively),hereas, in the spleen microchimerism was no longer

Table 1. Microchimerism Levels* in Organs From BALB/cSemia

Organ

Transplanted hosts

35 42 49

hymus 1.0 0.73 0.47one marrow 1.0 0.43 0.14pleen 1.0 0.98 0.70

*Semiquantitative data was calculated considering 1.0 as the value for maxi**Recipients were transplanted with cardiac semicompatible grafts 21 days

etected. Donor cells were not present in the lymph nodesn any situation. According to these data two importantoints can be included. First, microchimerism was sustained

n all evaluated organs except lymph nodes in the presencef the graft; in this condition donor cells were observed forlonger period than in nontransplanted recipients. More-

ver, microchimerism was not associated with graft survivalecause rejection occurred independently of the presencef semiallogeneic cells. The other point is that in bothonditions the persistence of donor cells in the thymusuggests that this organ offers a nonaggressive microenvi-onment for these cells. Although tolerance to allograftsas been reported to be associated with the elimination ofotentially alloreactive T cells by the encounter with thelloantigen in the thymus,6,7 this does not seem to be thease in our model because rejection occurred as a nonre-ated phenomenon.

EFERENCES

1. Ko S, Deiwick A, Jager MD, et al: Nat Med 15:1292, 19992. Noris M, Cugini D, Casiraghi F, et al: J Am Soc Nephrol

2:2815, 20013. Shirasugi N, Adams AB, Durham MM, et al: J Exp Med

69:2677, 20024. Ota H, Gotoh M, Ohzato H, et al: Transplantation 67:165,

9995. Corry RJ, Winn HJ, Russel PS: Transplantation 16:343, 19736. Staples PJ, Gery I, Waksman BH: J Exp Med 123:127, 19667. Posselt AM, Barker CF, Tomaszewski JE, et al: Science

49:1293, 1990

Transplanted or Not With (BALB/c � C57B1/6)F1 Cardiacfts**

s after donor cell infusion

Nontransplanted hosts

56 35 42 49 56

.48 1.0 0.55 0.58 0.20

.08 1.0 0.64 0.02 0.0

.0 1.0 1.26 0.0 0.0

mplification product. Data were obtained from pooled animals.e administration of donor cells.

Micellogra

Day

000

mum a