Expression and Characterization of Human Factor … · Expression and Characterization of Human Factor IX and Factor IX- Factor X Chimeras in Mouse Cl27 Cells* (Received ... Twenty

THE JOURNAL OF BIOLOGICAL. CHEMISTRY Vol. 265, No. 1, Issue of January 5, pp. 144-150,199O 0 1990 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

Expression and Characterization of Human Factor IX and Factor IX- Factor X Chimeras in Mouse Cl27 Cells*

(Received for publication, August 4, 1989)

Shu-Wha Lin$, Kenneth J. Smithill, Dean WelschII, and Darrel W. Stafford+** From the $Department of Biology and Center for Thrombosis and Hemostasis, University of North Carolina, Chapel Hill, North Carolina 27514, the SDepartments of Medicine and Pathology, University of New Mexico School of Medicine and United Blood Services, Albuquerque, New Mexico 87131, and the 11 Department of Pharmacology, Merck Sharp & Dohme Research Laboratories, West Point, Pennsylvania 19486

Human blood clotting factor IX, and two chimeric molecules of factor IX, in which the first epidermal growth factor-like domain or both epidermal growth factor-like domains have been replaced by that of human factor X, have been expressed in mouse Cl27 cells. The recombinants have been purified using a metal ion-dependent monoclonal antibody specific for residues l-42 of human factor IX. All recombinant molecules are activated normally by human factor XIa in the presence of calcium ion. Activation of the factor IX recombinants by factor VIIa-tissue factor appears to be normal for the epidermal growth factor-l exchange but considerably reduced for the construction containing both epidermal growth factor-like domains of factor X. The analysis of y-carboxyglutamic acid residues reveals that all of the purified recombinants are almost fully carboxylated. The extent of aspartic acid hydroxylation at residue 64 is 60% for all recombinants. The chimeric molecule with both epidermal growth factor- like domains from factor X has about 4% normal activity in the activated partial thromboplastin time assay. In contrast, the construct containing the first epider- ma1 growth factor-like domain of factor X shows essentially normal clotting activity. Thus, it is unlikely that this domain is involved in a unique interaction with factor VIII.

Factor IX (Christmas factor) is the zymogen of a serine protease active in normal hemostasis. The enzymatic activity of factor IX requires carboxylation of specific glutamic acid residues in a vitamin K-dependent post translational modifi- cation (l-3). Factors IX, X, VII, and protein C are closely related members of the same family of plasma serine proteases. Evidence supporting the close relationship of this family is the almost complete identity of intron-exon arrange- ment of the genes coding for these proteins (4, 5) and their high degree of amino acid sequence identity. The apparent functional domains of these related proteins closely parallel the exon structure of their genes.

The most easily definable functional domains of these related proteins from amino to carboxyl terminus, respec-

* The costs of uublication of this article were defrayed in part by the payment of page charges. This article must therefore be-hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

ll Supported by a grant from Blood Systems Research Foundation, Scottsdale, Arizona.

**Supported by National Institutes of Health Grant R01 HL38973-03. To whom reprint requests should be addressed: Dept. of Biology, 442 Wilson Hall, UNC-CH; Chapel Hill, NC 27599-3280.

tively, are: the vitamin K-dependent domain containing the modified glutamic acid, y-carboxyglutamic acid (Gla) residues, two epidermal growth factor (EGF)l-like domains, an activation peptide region, and the catalytic domain, which confers the protease function (6,7). The vitamin K-dependent Gla domains consist of approximately the first 40 amino acids of the zymogens. There are 12 Gla residues in factor IX and 11 in factor X. These Gla residues are thought to be respon- sible for the calcium-mediated binding of these coagulation factors to phospholipids or platelets (8, 9). The Gla domains of these proteins are followed by two EGF-like domains (EGF- 1 and -2), named for their similarity to repeats of the EGF precursor. In the first EGF-like domain there is an unusual amino acid residue, identified as /3-hydroxyaspartic acid (Hya). At this single aspartic acid residue normal human factor IX is 26% hydroxylated while factor X is essentially 100% hydroxylated at a comparable site (10, 11). Following the EGF-like domains is the activation peptide region, which is cleaved by limited proteolysis to render the zymogen active. Most of the vitamin K-dependent proteins share little amino acid sequence identity in the activation peptide. Following the activation peptide region is the serine protease domain containing the catalytic triad of histidine, aspartic acid, and serine. This region shares remarkable amino acid sequence similarity with trypsin and chymotrypsin.

The crystal structures of numerous families of proteins have revealed that evolutionarily related proteins with similar primary structures share a similar three-dimensional structure (12, 13). The serine proteases and their zymogens, of which factor IX is one, comprise such a family and have become textbook models of this hypothesis (14-17). The backbones of the serine proteases are essentially identical; most of the sequence changes reside in surface amino acids. Thus, the rationale of the present study was that there is a likelihood that one can exchange homologous domains between factors IX and X without significantly altering the overall three-dimensional structure.

There are several reasons for choosing factors IX and X for exchanging homologous domains. In addition to the structural similarities mentioned above, the physiological reactions in which they participate are very similar. In the intrinsic path- way, factor X is activated by the factor IXa-factor VIIIa complex. This reaction is analogous to that of the conversion of prothrombin to thrombin by the factor Xa-factor Va complex. Both reactions are at least 100 times faster in the presence of phospholipids and calcium (18, 19).

’ The abbreviation used are: EGF, epidermal growth factor; aPTT, activated partial thromboplastin time; BPV, bovine papilloma virus; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electropbo- resis; MES, 4-morpholineethanesulfonic acid; kb, kilobase.

144

by guest on September 24, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Factor IX and Factor IX-Factor X Chimeras

The EGF-like domains of factor IX are of particular inter- est. The function of these domains in factor IX are unknown, but EGF and other proteins containing EGF-like regions similar to those in factor IX have been shown to be involved in receptor-ligand interactions (for review, see Ref. 20).

Here we report the production of chimeric forms of factor IX with the first EGF-like domain or both EGF-like domains of factor IX replaced by the homologous regions of factor X. The chimeric proteins were expressed in animal tissue cell cultures, isolated, and partially characterized structurally and functionally.

EXPERIMENTAL PROCEDURES

Materials

The following oligonucleotides were used: for correction of the 5’ terminus of factor IX, 5’-GGGGGGGGATCCAGATCTCCACCAT- GCAGCGCGTGAACATGATCATGGCAG; for creation of a factor IX-B&E11 site, 5’-GTATGTTGATGGTGACCAGTGTGAGTCC; for factor IX-&ICI, 5’-GGAAAGAACTGTGAGCTCGATGTAACA- TG; for factor IX-NotI, 5’-GCCATTTCCATGCGGCCGCGTTT- CTGTTTCAC; for factor X-BstEII, 5’-CAAAGATGGTGACCAG- TGTGAGACC; for factor X-SacI, 5’-GGCAAAAACTGTGAGCT- CTTCACACGGAAGC; and for factor X-N&I, 5’-GGGCCCTAC- CCCTGCGGCCGCCAGACCCTGGAACGCAGG. Sal1 and XhoI linkers were purchased from New England Biolahs. DNA polymerase I (Klenow fragment), calf intestine alkaline phosphatase, polynucle- otide kinase, and T4 DNA ligase were obtained from either Bethesda Research Laboratory, New England Biolabs, or Boehringer Mann- heim. ?-Protein A, ‘*‘I-Na, ?S-dATP, and [y-3ZP]dATP were purchased from Amersham Corp. Affi-Prep 10 was obtained from Bio- Rad, Iodobeads from Pierce, and Geneticin (G418) from GIBCO. Human factor IX was purchased from Enzyme Research Laboratory or purified from plasma as described (21). Factor IX-deticient plasma and DEAE-Sepharose CL-6B were obtained from Sigma. Platelin Plus Activator was purchased from General Diagnostics. Human factor XIa was a gift from Dr. D. Monroe (Dept. of Medicine, University of North Carolina at Chapel Hill). Human factor VIIa and crude tissue factor were gifts from Dr. Walter Kisiel (Depts. of

Pathology and Biochemistry, University of New Mexico School of Medicine).

Five monoclonal antibodies to human factor IX were used in this study: A-l, A-4, A-7 (21), 2D5 and IX-30 (generously provided by Dr. H. Reisner, University of North Carolina at Chapel Hill). The amino acid sequences of human factor IX recognized by these antibodies are: A-l, residues 147-153 (activation peptide, see Ref. 22); A-4, residues 180-310 (heavy chain, Ref. 22); 2D5, residues 50-84 (EGF- 1, Ref. 22); 1X-30, residues 111-132 (EGF-2, Ref. 23). A-7 is a Ca’+- dependent conformation-specific antibody that recognizes amino acids l-42 (Gla domain); it fails to bind bovine factor IX.’ All other reagents were of the highest purity commercially available.

Methods

In Vitro Mutagenesis and Construction of the Expression Plasmid- Site-directed mutagenesis was accomplished by the “gapped duplex” method (24). Three oligonucleotides were used simultaneously: IX- BstEII, IX-SacI, and IX-Not1 for mutating factor IX; and X-BstEII, X-SacI, and E-Not1 for factor X cDNA. Each mutated molecule was sequenced by the dideoxy-chain termination method (25) to confirm that the sequence was as expected and that no inadvertent mutations had been introduced. The altered factor IX cDNA was digested with BstEII plus SacI, or BstEII plus NotI, purified, and ligated with BstEII-Sac1 or BstEII-Not1 fragments of factor X, respectively. Fac- tor IX DNA fragments were thereby generated with the EGF-1 domain (or both EGF-1 and EGF-2 domains) replaced with that of factor X. Both DNA fragments were then subcloned into a bovine papilloma virus (BPV) vector (26).

Cell Culture and Transfection by the CaPO, Method-Mouse Cl27 cells were grown in Dulbecco’s modified Eagle’s medium supplement with 10% fetal calf serum (growth medium). Transfection was performed using the calcium phosphate coprecipitation method (27). Twenty rg of BPV-factor IX DNA and 2 pg of pSV2-neo (28) were used to transfect cells grown in 60-mm dishes. Two days after transfection, cells were passaged, and grown with growth medium containing 600 pg/ml G418 for selection. Two to 3 weeks later, the surviving foci were screened with a filter-immunoassay (29) using monoclonal antibody A-l. Positive clones were isolated with cloning cylinders and grown to confluence in the presence of 10 pg/ml vitamin K. Culture supernatants were then measured for the amount of carbox-

’ K. Smith, unpublished observation.

I EGF-LI~o Domain

KGY”DGDPCE?NPC?NGG 131 141 151 161 171

“m,” yw”.:. CDWA 121

0 - TTYTCCAAPCAPTAYCTNCAYCCNGAYCAPTGYGAPEEEAAYCCNTGYLLLAAYGGNGGN

TAC-GTA(SnaB1) GCCNNNN’NGGC(BBl1)

FIG. 1. Strategy for domain exchange. Panel A depicts the back translation of human factor IX protein sequence to ambiguous sequence and the latent restriction sites within the en- coded region. The question marks occur in the sequences at the sites of leucine (LLL) or serine (EEG) codons. In panel B the alignment of amino acid sequences of factors X and IX is shown. The iden- tities in the regions chosen for creating restriction sites by in vitro mutation are indicated.

CT-MKAC(Acc1) TTT-AAA(AhaII1)

G-TCCAC(Sal1) GDCCHC(Sdu1)

GTY-PAC( Hind11 1 GPGCY-C(Hgl.lII)

G-GTNACC(BstEII) GGN-NCC(NlaIV)

GCN-NCC(NlaIV) G’GATCC(BamH1)

B FX- Bsl E II

ANSF-LEEHKKCHLERECHEETCSYEEAREVFEDSDKTNEFUNKYKDGDOCETSPCGNGG :: ::: : :::::::: :: :::::::: : ::: : :::::: :: : :

f IX - YNSCKLEEFVGGNLERECnEEKCSFEEAREVFENTERTTEFWKQYVDGDQCESNPCLNGG 10 20 30 40 50

sot I KCKDGLGEYTCTCLEGFEGKNCELFTRKLCSLDNGDCDPFCHEEQNS----VVCSCARGY

: : : . . SCKDDINStE~Y~PF~ICEKNCdiDYTCNIK--~~R~~~~~K---~~AD~K~~~~CTE~~

70 00 90 100 110

YOI I TLADNCKACIPTCPYPCGKP-------

:: : : : : : ::: RLAENQKSCEPAVPFPCGRV-------

120 130


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


MMSV enhancer

MMT

FIG. 2. Physical map of the recombinant plasmid pBPV- IX(s). Full length factor IX cDNA (2.8 kb) is shown in black. The regions which were modified are open and are bounded by the B&E11 and Not1 sites. The expression vector contains the complete BPV genome (7.94 kb) ligated to a fragment of the plasmid pML 2 (2.63 kb), which contains a bacterial origin of replication and an ampicillin resistance gene. The factor IX cDNA is flanked 5’ by a mouse metallothionein promoter (0.6 kb) and the Moloney murine sarcoma virus enhancer (0.375 kb), and 3’ by the SV40 polyadenylation recognition sequences (0.85 kb).

ylated factor IX by immunoradiometric assay using antibody A-7. Clones expressing a high level of carboxylated factor IX were estab- lished as cell lines for further analysis.

Polyacrylamide Gel Electrophoresis and Immunoblotting (Western Blotting)-SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was performed as described (30). Following electrophoresis, the proteins were visualized by staining with Coomassie Brilliant Blue or subjected to immunoblotting (30). When A-7 was used for immunoblotting, 5 mM CaC& and 1 mM MgCI, were included in all the buffers (31).

Zodination of Protein-One-hundred pg of monoclonal antibody was labeled with lz51-Na using Iodobeads according to the manufac- turer’s instructions (Pierce Chemical Co.). The radioactively labeled antibody was separated from free iz51 on a Sephadex G-25 column.

~mmunoradiometric Assay-Three monoclonal antibodies (A-l, A- 4, and A-7) were used in this analysis, as described previously (31). These assays show no cross-reactivity with bovine factor IX in culture supernatants. A-4 was used at an appropriate dilution in 50 mM NaHC03, pH 8.5, to coat the 96-well microtiter plate. Samples con-

FIG. 3. Western blot and SDS- PAGE analysis of purified recombinant factor IX. Purified recombinant factor IX was subjected to SDS-PAGE. Panel A shows a protein blot of two concentrations each of plasma (400 and 100 ng) and recombinant (600 and 100 ng) factor IX. In panel B a Coomassie- stained gel of 5 pg each of plasma and recombinant factor IX is shown. Lane M shows the molecular weight marker.

taining factor IX were diluted in 150 mM NaCI, 20 mM Tris-Cl, (pH 7.2), (TBS) and 0.1% ovalbumin, and subsequently added to the wells. After incubation at 4 “C overnight, second antibodies A-l or A-7, labeled with **‘I, were added at 1 x lo5 cpm/well. A-7 was diluted in the presence of 5 mM CaCl, and 1 mM MgCI,. Unbound radioactive antibodies were removed after 4 h incubation and the radioactive content of each well was measured.

Purification of Recombinant Factor IX-Factor IX was purified using batch adsorption to DEAE-Sepharose CL-6B as described (32). Ten to I5 liters of the cultured supernatant was collected, adjusted to pH 6.5 with 0.1 M citric acid, and adsorbed to 100 ml of DEAE- Sepharose CL-6B (preequilibrated in 50 mM MES, pH 6.5) per liter of media supernatant. After extensive washing, factor IX was eluted with 600 mM NaCl, 50 mM MES, pH 6.5. Fractions containing factor IX as determined by immunoradiometric assay with antibody A-7 were pooled, centrifuged at 30,000 rpm for 1 h, and then filtered through a 0.4~pm Millipore nitrocellulose membrane. The filtrate containing factor IX was diluted to 150 mM NaCl, 20 mM MgC12, 20 mM Tris-Cl, pH 7.2, and applied to a column containing the conformation-specific monoclonal antibody A-7 coupled to Affi-Prep 10 at 3-5 mg/ml. After washing the column extensively with 20 mM Tris- Cl, pH 7.2, 0.05% Tween 20, 100 mM NaCI, 20 mM MgCl*, and then washing with 20 mM EDTA in TBS. Peak fractions were assayed by immunoradiometric assay, pooled, and concentrated in either of two ways: with an Amicon microconcentrator (Centricon 30) in the presence of bovine serum albumin or on a DEAE-Sephadex A-50 column in the absence of bovine serum albumin.

Actiuation by Factor XZa-The activation of 0.6-l fig normal human factor IX or purified recombinant factor IX by human factor XIa in the presence of 5 mM CaC& was performed at an enzyme to substrate ratio of 1:20 (w/w). Aliquots were withdrawn at intervals and subjected to SDS-PAGE analysis. Following electrotransfer of proteins to nitrocelldlose membranes, factor IXa was imaged with A- 7.

Actiuation of Recombinunts by Factor VIIa and Tissue Factor-The experiment was carried out as described by Osterud and Rapaport (33). Approximately 1 pg of each recombinant was reacted with purified human factor VIIa at an enzyme to substrate ratio of 1:50. Tissue factor was from a crude human brain extract and was added at 1:lO (v/v) to the reaction mixture. Aliquots were removed at intervals and subjected to SDS-PAGE. After electrotransfer, Western blotting was performed and factor IX was detected with iodinated A- 7 as described above.

Clotting Assay-One-stage activated partial thromboplastin time (aPTT) assays were performed as described (30). The ability of the proteins to correct the clotting time of factor IX-deficient plasma was calculated from a standard curve derived with pooled normal human plasma, assuming that the plasma factor IX concentration is 5 pg/ ml.

Amino Acid Sequencing and Analysis of the Gla and @-Hydroxyas-

6 _-. A Plasma Recombinant

IX %t Kdal 12 34 M Plasma IX Recombinant IX,,

*

97 - b. 66 - wb#

45 - Ins

31 - M.

21 - .-.

14 -


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


A mAb: Al 2\

C mAb: 2DS

II ‘il * 0

I, +

D mAb: IX20

FIG. 4. Western blot analysis of purified recombinant factor IX and its chimeric derivatives. The different chimeric proteins (and controls) were denatured and reduced prior to SDS-PAGE and electrotransfer. Panel A shows the reaction with antibody Al, specific for residues 147-153 of the activation peptide of human factor IX. In panel B the reaction with the antibody A7, specific for residues 1-42 of human factor IX, is shown. Panel C depicts the reaction with antibody 2D5, specific for residues 50-84 of the first EGF-like domain of human factor IX. Panel D exhibits the reaction with antibody 1X30, specific for residues 111-132 of the second EGF-like domain of human factor IX.

partic Acid (Hya) Levels-This was carried out according to Przysiecki and Friedman et al. (34).

In Vitro Mutagenesis and Construction of Mutated Factor IX Mol- ecules-our original factor IX cDNA was missing the first 15 nucleotides. To express normal factor IX, site-directed mutagenesis was used to restore the missing codons. In addition, unique BamHI and BglII sites and the eukaryotic translation consensus sequence CCACC (35) were introduced. Thus, the sequence GGATCCAGATCTCCACC was introduced into the cDNA immediately upstream of the first ATG of the leader sequence of factor IX. This reconstructed full length cDNA was used for factor IX expression. Our strategy for exchanging homologous domains was to create unique restriction enzyme sites without altering the amino acid sequence. This was accomplished by back-translating the amino acid sequences of factors IX and X into ambiguous DNA sequences using the computer program of Little and Mount (36). The ambiguous DNA sequences were then examined for iatent restriction enzyme cleavage sites using the same program. Fig. 1A depicts an example of the possible restriction

enzyme recognition sites that can be created in human factor IX cDNA in the EGF-1 domain without changing the amino acid sequences. The restriction site for BstEII was chosen because it is unique, and the amino acid sequences of factors IX and X was identical in the selected regions. As demonstrated in Fig. lB, there is a Asp-Gly-Asp-Gln-Cys sequence in both factors IX and X at residues 47-51 (46-50 in factor X) at the amino terminus of the EGF-1 domain. The nucleotides coding for this sequence can be converted to a sequence cleavable by BstEII. Between the EGF-1 and -2 domains of factors IX and X there is a common Glu-Leu at residues 83-84 and 82-83, respectively. The codons for these amino acids were converted to a unique Sac1 site. At the carboxyl terminus of the EGF-2 domain a unique Not1 site was generated at residues 132-133 (Cys-Gly) of both factors IX and X. These three restriction sites were used to generate two factor IX cDNA fragments containing EGF-1 from factor X (BstEII-Sac1 fragment) or both EGF-1 and -2 from factor X (BstEII-Not1 fragment). These two modified DNA fragments and the wild-type factor IX were inserted into the BPV vector (Fig. 2), and the resultant expression plasmids pBPV-IXtx.pn, and pBPV- IXcxecs+P), as well as pBPV-IX,, were used for transfection.

Expression and Purification of Normal and Mutated Factor IX- Cl27 cells were cotransfected with each expression plasmid and a pSV2-neo plasmid, which allowed selection of the transformants with an antibiotic, Geneticin (G418). The surviving clones that expressed factor IX were identified by a filter immunoassay, using iz51-labeled A-l antibody. Individually isolated clones were grown to confluence in growth media supplemented with 10 fig/ml of vitamin K. The cultured supernatant was then measured for the secretion of carboxylated factor IX by immunoradiometric assay using iodinated antibody A-7. Considerable variation in the level of carboxylated factor IX secreted by different foci was found among different isolates transfected with the same plasmid construction. The expression level of the carboxylated factor IX varied from 50 to 150 ng/lO” cells/24 h. This amount compares well with the amounts of active IX reported by other workers (37-40). Total DNA was also extracted from pBPV- IX,-transfected cells and analyzed by Southern blotting. There were about 250 episomal copies of the expression plasmids/cell detectable by this method (data not shown).

Cells secreting the highest level of carboxylated factor IX were expanded and each recombinant factor IX was isolated from lo-15 liters of cultured media. An aliquot of the purified normal recombinant was subjected to SDS-PAGE and analyzed by staining with Coomassie Blue (Fig. 3B) or electrotransferred to nitrocellulose paper followed by probing with antibody A-l (Fig. 3A). The wild-type recombinant migrated as a single band and the mobility is equivalent to that of plasma IX. Analysis of the purified chimeric molecules by Coomassie Blue or silver staining also revealed a single band of the proper size. Amino acid sequence analysis confirmed that greater than 95% of each of the three recombinant proteins had the amino- terminal sequence expected of the zymogen. Less than 5% of the purified recombinants still retained the propeptide. Additionally, we used two other monoclonal antibodies specific for the first or second EGF-like domains of human factor IX to further verify the identity of the purified chimeric proteins. The result is shown in Fig. 4. As recombinant factor IX molecules were recognized by A-l and A-7 (Panels A and B, respectively); only wild-type or plasma factor IX could react with 2D5, a monoclonal antibody recognizing the EGF-1 of human factor IX (22). The failure of the two chimeric proteins IXcxepn, and IXcxepn+2) to be recognized by 2D5 confirms that the two recombinant factor IXs contain the altered EGF-1 domain (panel C). These proteins were also allowed to react with monoclonal antibody 1X-30, which recognizes the carboxyl portion of EGF-2 of human factor IX (23). Although the reactivity was weaker compared with that of the above three antibodies, it is clear that all but recombinant IX~Xegfl+a were able to demonstrate equal intensity (panel D).

Activation of Recombinant Factor IX-The activation of the various forms of recombinant factor IX by factor XIa and factor VIIa-tissue factor complex was compared with that of plasma factor IX. The time course was followed and the activation products were analyzed by immunoblotting using monoclonal antibody A-7, which recognizes the light chain of factor IX. Fig. 5 depicts the activation by factor XIa in the presence of Ca*+. The signals for the intact factor IX decreased with a concomitant increase of signals for the light chain. The heavy chain in not detected by this antibody. It is concluded that the activation pattern of the recombinants was similar to that of the plasma factor IX.

Activation of the recombinants by factor VIIa-tissue factor is shown in Fig. 6. Recombinant factor IX, and factor IX,xeti, were


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

148 Factor IX and Factor IX-Factor X Chimeras

IXCXegfI) ixwt FIG. 5. Activation of purified re-

IX(Xegfl+2) plasma IX I , I I 1

combinant wild-type and chimeric 0’ 3’ 6’ IO’ 20’ 60’ 0’ 3’ 6’ IO 20’ 60’ 0’ 3, 6’ IO’ 20’ 60’ 0’ 3’ 6’ IO’ 20’ 60’

factor IX by factor XIa. Aliquots of 1.2 pg of each protein were activated by factor XIa in the presence of 5 mM CaCl* at a substrate to enzyme ratio of 2O:l. At each time point samples were added to a

F IX zymogen - 7

solution of 1% SDS, 5 rnM EDTA, and 4% fl-mercaptoethanol and frozen at -70 “C until analysis by SDS-PAGE Following electrophoresis, the samples were electroblotted to nitrocellulose and reacted with metal ion-specific monoclonal antibody A7, which reacts specif- ically with residues l-42 of human factor

light - ‘W es-h 4 I . I N ,

chain IX.

FIX zymcgen - @& am%

FIG. 6. Activation of purified recombinants by factor VIIa and tissue factor. One pg of each recombinant was reacted with purified factor VIIa at a substrate to enzyme ratio of 5O:l (molarity) and partially purified tissue factor from human brains at a final concentration of 10% (v/v). At each time point, an aliquot was withdrawn, and the reaction was stopped by adding 1% SDS, 5 mM EDTA, and 4% fi-mercaptoethanol (final concentration), and boiling for 10 min. The reaction mixtures were analyzed by SDS-PAGE followed by electrotransfer and Western blotting. The protein blot was probed with ““I-A-7 antibody.

activated similarly to plasma factor IX. Recombinant factor IX,xegrltJ, exhibited a different activation pattern with the consistent presence of an intermediate and a reduced amount of the light chain.

Analysis of Coagulation Activity of the Recombinants-The coagulation activities of the purified recombinant molecules were determined by the one-stage aPTT assay. Table I depicts specific activities of each recombinant from two separate preparations, one purified in the absence of bovine serum albumin and the other in the presence

of 100 pg/ml of bovine serum albumin. As shown in the third column, the specific activity of factor IX,xeerl) was 192 units/mg and wild-type factor IX was 234 units/mg. This result suggests that both proteins are fully active since the specific activity of normal plasma factor IX is taken to be about 200 units/mg. A separate preparation of all the recombinants was analyzed for the number of Gla residues and the extent of hydroxylation of aspartic acid. The specific activity measured with this preparation was somewhat lower for both wild-type factor IX (171 units/mg) and chimeric factor IXcx.gh, (151 units/mg). This preparation was concentrated on a DEAE-Sephadex column in the absence of carrier protein and subsequently frozen and thawed before the activity was measured, which may explain the lower activity. A repetition of the experiment with a third preparation of the purified recombinants confirmed the higher activity values shown in column 3 (data not shown).

In order to rule out the possible contamination of factor IXa in the purified factor IX preparation that could contribute to an artifac- tually high clotting activity, we performed the nonactivated partial thromboplastin time assay. Although this assay was capable of de- tecting 30 rig/ml of factor IX, factor IXa was not detected by this technique or by protein blotting.

Only 4 units/mg of activity was found when factor IXcxepa+Pj was used in an aPTT assay, indicating that this chimeric molecule containing both EGF-like domains from factor X has essentially no clotting activity. A slower rate of activation cannot explain the reduced activity because fully activated factor IX,xean+2, still had no clotting activity when measured by the nonactivated partial thromboplastin time assay. The Gla analysis shown in Table I indicates that wild-type recombinant factor IX contains 9 Gla residues/m01 of factor IX. This is comparable to plasma factor IX, which has 9.8 Gla/ mol as measured by the same technique (34, 41). Chimeric factor IXtx,,c, contained 8.7 while factor IXtxegfli2) contained 8.6. The analysis for /!-hydroxylation demonstrated 0.6 residues of P-hydroxyaspartic acid in the three recombinants in spite of the differences of the EGF-1 domains, the target of hydroxylation.

TABLE I Specific actiuities, r-carboxyglutamic acid, and P-hydroxyaspartic acid contents

Asp quantitation on high performance liquid chromatography. RIA, radioimmunoassay; BSA, bovine serum albumin.

Protein Specific Protein Specific Sample Activity” via activity Activity* via activity Gla/mol Hya/mol

RIA via RIA Aspb via Asp unrts P&! unitslmg units rf! unitsfmg

IXwt 192 817 234 47.8 280 171 8.98, 8.94 0.65, 0.69 IX,se,n, 45.8 238 192 7.2 46 151 8.76, 8.69 0.64, 0.65

IXtXeCfl+21 2.6 558 4.7 0.5 97 5 8.61, 8.66 0.62, 0.61 Plasma IX 205' 9.91, 9.65 0.25, 0.25

’ Measured with purified recombinant factor IXs containing BSA. A pooled normal human plasma was used to obtain standard curves for both RIA and aPTT. The results were collected from multiple experiments. One unit of factor IX is defined as that amount of activity present in 1 ml of normal human plasma.

* Measured with purified recombinant factor IXs which did not contain BSA. ’ The amount of total protein was measured by the Bradford method.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Factor IX and Factor IX-Factor X Chimeras 149

DISCUSSION REFERENCES

Our purpose was to create factor IX molecules altered in their interaction with the other components of the coagulation system. To circumvent the problems inherent in site-directed mutagenesis in the absence of crystal structure, we elected to exchange homologous domains of closely related proteins that interact with different cofactors. It is our assumption that proteins prepared in this manner should fold correctly and have altered substrate and cofactor specificity. Our observa- tions of normal activation by factor XIa and, in one case, normal clotting activity indicate that this was achieved. The existence of a hemophilia B patient whose defect is an apparent deletion of exon d (42) further argues for this approach rather than deletion of domains, as the patient’s factor IX, in contrast to the domain exchange experiments reported here, is inactive.

1.

2.

3.

4.

5. 6.

Fryklund, L., Borg, H., and Andersson, L. 0. (1976) FEBS Lett. 65,187-189

Olsen, R. E., and Suttie. J. W. (1978) Warn. Horm. (N.Y.) 59- 108’

Gallop, P. M., Lian, J., and Nauschka, P. (1980) N. Engl. J. Med. 302.1460-1466

7.

Yoshiiake, S., Schach, B. G., Foster, D. C., Davie, E. W., and Kurachi, K. (1985) Biochemistry 24,3736-3750

Furie, B., and Furie, B. C. (1988) Cell 53,505-518 Katayama, K., Ericsson, L., Entield, D., Walsh, K., Neurath, H.,

Davie, E. W., and Titani, K. (1979) Proc. N&l. Acid. Sci. U. S. A. 76,4990-4994

Anson, D. S., Choo, K. H., Rees, D. J., Giannelli, F., Gould, K., Huddleston. J. A.. and Brownlee. G. G. (1984) EMBO J. 3, 1053-1060

Aspartic acid residue 64 of the EGF-1 domain of factor IX is normally incompletely hydroxylated (10, 11) while that of factor X is completely hydroxylated. A consensus sequence has been identified in the EGF regions that appears to be necessary for hydroxylation (12). We therefore expected that factor IXcx,pn, might be fully hydroxylated. This was not the case as all constructions appeared to be hydroxylated to the same extent in this expression system. It will be necessary to express the factor X gene in the same cells and determine its percent hydroxylation to resolve this problem.

8.

9.

10.

11.

12.

13.

14. 15.

16.

Jackson, C. M., and Nemerson, Y. (1980) Annu. Reu. Biochem. 49, 765-811

Skogen, W. F., Esmon, C. T., and Cox, A. C. (1984) J. Biol. Chem. 259, 2306-2310

Friedman P. A., and Przysiecki, C. T. (1987) Znt. J. Biochem. 19, 1-7

Stenflo, J., Lundvall, A., and Dahlback, B. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,368-372

Dayhoff, M. D. (1976) Atlas of Protein Sequences and Structure 5 (Supp. 2), 195

Craik, C. S., Rutter, W. J., and Fletterick, R. (1983) Science 220, 1125-1129

The chimeric molecule with both EGF-like domains of factor X was not readily activated by factor VIIa-tissue factor and had a much reduced activity. The activation by factor XIa appeared to be normal. However, to determine if the lower clotting activity could be due to a slower activation rate by factor XIa, we activated factor Xcxepn+2) and tested its activity in a partial thromboplastin time assay. The completely activated factor IXcxegfl+P) exhibited comparable reduced activity. Unless one involves the, to us, unlikely theory that the activation is occurring at a different site, then it is apparent that the EGF-2 domain is critical for some aspect of coagulation. The assignment of a function to EGF-2 requires additional experiments, but we will not be surprised if it has a specific role in binding to factor VIII.

17.

18.

19. 20.

21. 22.

Rogers, J. (1985) Nature 315,458-459 Fersht, A. (1985) Enzyme Structure and Mechanism, W. H.

Freeman and Company, New York Olsson, G., Lindqvist, O., Peterson, T. E., Magnusson, S., and

Scottmp-Jenson, L. (1979) Vitamin K Metabolism and Vitamin K Dependent Proteins, p. 817

Magnusson, S., Peterson, T. E., Scottrup-Jenson, L., and Claeys, A. (1975) Proteases and Biological Control (Reich, L., Rifkin, D., and Shaw, E., eds), pp. 123-149, Cold Spring Harbor Lab- oratorv. Cold Snrinz Harbor. NY

Mertens; ‘K., and&Ber%ina, R. M. (1984) Biochem. J. 223, 607- 615

Jackson, C. M., and Suttie, J. W. (1977) Prog. Hemut. 9, 333-359 Appella, A., Weber, I. T., and Blasi, F. (1988) FEBS Z&t. 231, l-

4

It has been proposed that the EGF-1 domain of factor IX interacts with factor VII (37). This role for the EGF-1 domain was suggested because proteins after site-directed mutagenesis of residues 47 and 49 (37) resulted in a factor IX with reduced interaction with factor VIII, just as a naturally occurring factor IX mutation at residue 47 also exhibits reduced interaction (43). The solution structure of EGF has been determined by two-dimensional NMR and the first EGF-like domain of factor IX has been modeled from the EGF structure (44, 45). The model predicts that the sequence DGDQC (residues 47-51 in factor IX) might be stabilized into a three layer ~3 sheet by the presence of calcium. The DGDQC sequence is conserved in factors IX, X, VII, and protein C, however, and is therefore likely to have an important structural function not related to the specificity of binding to a cofactor or receptor. It seems unlikely that factors IX and X, which must bind simultaneously to factor VIII, would interact at the same site on factor VIII. We therefore reject as unreasonable the possibility that the EGF-1 domains of factors IX and X are so similar that they are completely interchangeable.

Smith, K. J., and Ono, K. (1984) Z’hromb. Res. 33,211-224 Frazier, D. L., Smith, K. J., Cheung, W. F., Ware, J., Lin, S. W.,

Thompson, A. R., Reisner, H., Bajaj, S. P., and Stafford, D. W. (1989) Blood, in press

23.

24.

25.

26.

McGraw, R., Frazier, D., de Serres, M., Reisner, H., and Stafford, D. W. (1986) Blood 67, 1344-1348

Kramer, W., and Fritz, H. J. (1988) Methods Enzymol. 154,350- 367

27.

SangeF, F., Nicklen, S., and Coulson, R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467

Sarver, N., Ricca, G. A., Hood, M., Link, J., Tarr, G. C., and Drohan, N. (1985) Papillomaviruses: Molecular and Clinical Aspects, pp. 515-527, Alan R. Liss, Inc., New York

Graham, F. L., and van der Eb, A. J. (1973) Virology 52, 456- 461

28. Berk, A. J., and Sharp, P. A. (1978) Proc. Natl. Acad. Sci. 7% S. A. 75, 1274-1278

29. McCracken, A. A., and Brown, J. L. (1984) Biotechniques 2,82- 81

30. Lin; S.-W., Dunn, J. J., Studier, F. W., and Stafford, D. W. (1987) Biochemistry 26.5267-5274

31. Smith, K. J., Thompson, A. R., McMullen, B. A., Frazier, D., Lin, S. W.. Stafford. D.. Kisiel. W.. Thibodeau. S. N.. Chen. S.-H.. and Smith, L. F. (1987) Blood 70, 1006-1613

32. Menache, D., Behre, H. E., Orthner, C. L., Nunez, H., Anderson, H. D., Triantaphyllopoulos, D. C., and Kosow, D. P. (1984) Blood 64, 1220-1227

The observation that factor IXcXegfl) has approximately normal activity appears to rule out the suggestion that the function of EGF-1 of factor IX is a specific interaction with factor VIII (37,43). The alternative suggestion that the EGF- 1 domain of factor IX is involved in binding to the endothelial cell receptor is currently under investigation.

33. Osterud, B., and Rapaport, S. I. (1977) Proc. Natl. Acad. Sci. U. 5’. A. 74, 5260-5264

34. Przysiecki, C. T., Staggers, J. E., Ramjit, H. G., Musson, D. G., Stern, A. M., Bennett, C. D.. and Friedman. P. A. (1987) Proc. Natl. kad. &i. U. S. A. 84,‘7856-7860

35. Kozak, M. (1984) Nucleic Acid Res. 12, 857-872 36. Little, J. W., and Mount, D. W. (1984) Gene (Amst.) 32,67-73


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

150 Factor IX and Factor IX-Factor X Chimeras

37. Rees, D. J. G., Jones, I. M., Handford, P. A., Walter, S. J., Esnouf, 41. Friedman, P. A., and Przysiecki, C. T. (1987) Int. J. Biochem.

M. P., Smith, K. J., and Brownlee, G. G. (1988) EMBO J. ‘7, 19,1-7 2053-2061 42. Vidaud, M., Chabret, C., Gazengel, C., Grunebaum, L., Cazenave,

38. Kaufman, R. J., Wasley, L. C., Furie, B. C., Furie, B., and J. P., and Goossens, M. (1986) Blood 68,961-963 Shoemaker, C. B. (1986) J. Biol. Chem. 261,9622-9628 43. McCord, D. M., Monroe, D. M., and Roberts, H. R. (1988) Blood

39. Busby, S., Kumar, A., Joseph, M., Halfpap, L., Insley, M., Berk- 72, 302 (Abstr. 1120)

ner, K., Kurachi, K., and Woodbury, R. (1985) Nature 316, 44. Cooke, R. M., Wilkinson, A. J., Baron, M., Pastore, A., Tappin,

271-273 M. J., Campbell, J. D., Gregory, H., and Sheard, B. (1987) Nature 327, 339-341

40. de la Salle, H., Altenburger, W., Elkhaim, R., Dott, K., Dieterle, A., Drillien, R., Cazenave, J. P., Tolstoshev, P., and Lecocq, J.

45. Montelione, G. T., Wuthrich, K., Nice, E. C., Burgess, A. W., and Scheraga, H. A. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,5226-

P.(1985) Nature 316,268-270 5230


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

S W Lin, K J Smith, D Welsch and D W Staffordchimeras in mouse C127 cells.

Expression and characterization of human factor IX and factor IX-factor X

1990, 265:144-150.J. Biol. Chem.

http://www.jbc.org/content/265/1/144Access the most updated version of this article at

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/265/1/144.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/content/265/1/144

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;265/1/144&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/265/1/144

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=265/1/144&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/265/1/144

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/265/1/144.full.html#ref-list-1

http://www.jbc.org/

Documents

Expression and Characterization of Human Factor … · Expression and Characterization of Human Factor IX and Factor IX- Factor X Chimeras in Mouse Cl27 Cells* (Received ... Twenty