Constitutive Expression of Steel Factor Gene by Human Stromal

Constitutive Expression of Steel Factor Gene by Human Stromal Cells By Michael C. Heinrich, Douglas C. Dooley, Alison C. Freed, Louise Band, Maureen E. Hoatlin, Winifred W. Keeble,

Sandra T. Peters, Kirsten V. Silvey, Frederick S. Ey, David Kabat, Richard T. Maziarz, and Grover C. Bagby, Jr

Steel factor (SF), the ligand for c-kit, is an essential regula- tor of normal hematopoiesis, melanogenesis, gametogenesis, and mast-cell growth and development. Hematopoi- etic stromal cells are important sources of SF, because inactivation of SF in mice results in defects in the support function of hematopoietic stromal cells. To identify specific cells that produce, and factors that govern the expression of the different isoforms of SF in human hematopoiesis, we quantified levels of SF mRNA and membrane-bound protein in human stromal cells before and after exposure to recombinant human interleukin (IL)-1 a, a cytokine known to induce the expression of a variety of hematopoietic growth factors. In addition, because stromal cells in long- term bone marrow cultures (LTBMC) are supportive of hematopoietic progenitor cell survival in vitro, while umbilical vein endothelial cells (EC) and diploid fibroblasts (DF) are not, w e also sought to test the hypothesis that SF gene expression would differ in cells from LTBMC when com-

TEEL FACTOR (SF), a recently described hematopoi- S etic growth factor (also known as kit ligand, mast-cell growth factor, and stem-cell factor), is the ligand for the c-kit gene product, an integral membrane protein with a cytoplasmic tyrosine kinase domain.’ SF enhances the in vitro response to growth factors in a wide variety of tissues. For example, exposure of either unfractionated bone marrow mononuclear cells or highly purified CD34+ bone marrow cells to SF, interleukin (IL)-3), and erythropoietin results in a synergistic increase in clonal growth of colony- forming unit-granulocyte-macrophage (CFU-GM) and burst-forming unit-erythroid (BFU-E).2p3 SF also induces proliferation and differentiation of megakaryocyte precursors, and stimulates cytokine production by primary megakaryocyte cultures, as well as megakaryocytic cell lines.”6 In addition, SF stimulates proliferation and maturation of cultured mast and is essential for the survival of primordial germ cells in culture.’*1°

The tissue distribution of cells that express SF is as wide- spread as that of cells that express the c-kit protein,” and includes fibroblasts,” liver cells,” Sertoli cells,’* bone marrow-derived stromal cells,’3 and spleen cells.’4 There is evidence that SF plays a role in development, as SF mRNA has been detected in embryonic nervous tissue, bone, lung, heart, kidney, and ~1acenta.l~ The role ofSF in melanogenesis, gametogenesis, and hematopoiesis is clearly emphasized in mice with specific mutations of either the SF or c-kit gene, as these mice exhibit white spotting, sterility, bone marrow failure, and a profound decrease in tissue mast ~ e l l s . ~ J ~ J ~

The gene for human SF consists of at least eight exons.” Alternative RNA splicing gives rise to two SF transcripts: one that contains sequences representing all exons (exon 6 7 and another, from which exon 6 is excluded (exon 6-).18 SF protein translated from exon 6+ transcripts exists as both membrane-bound and soluble molecules; the predominant soluble protein is produced by proteolytic cleavage of the membrane-bound precursor.” SF protein translated from

pared with EC or DF. Using reverse-transcription polymerase chain reaction amplification (RT-PCR), ribonuclease protection assays (RPA), and Northern blot analysis, SF was found to be constitutively transcribed in EC, DF, and LTBMC. IL-la neither induced accumulation of SF mRNA nor altered the ratio of exon 6+ to exon 6- transcripts in these stromal cells. By Northern blot analysis, the predominant SF mRNA species was shown to be 5.6 kb; a minor population of 3.6 kb was also found. Low levels of membrane-bound SF protein were found to be constitutively expressed by all three types of stromal cells, and were not regulated by IL-la. We conclude that the unique capacity of LTBMC to support in vitro hematopoiesis, when compared with EC or DF, cannot be explained on the basis of qualitative or quantitative differences in SF gene expression in these cells. 0 1993 by The American Society of Hematology.

exon 6- transcripts lacks the major proteolytic cleavage site; as a result it is inefficiently cleaved at an alternative site and resides almost exclusively in the cell membrane,” at least in unstimulated cells.” The cleavage of protein translated from either species of SF transcript can be stimulated by treatment of cells with phorbol ester or the calcium iono- phore A23 187.’’

Membrane-bound SF protein may be of greater physio- logic significance than the soluble form, because murine stromal cells transfected with a human exon 6- SF cDNA sequence have been shown to be more supportive of human hematopoietic progenitors in long-term bone marrow culture (LTBMC) than cells transfected with a human exon 6+ SF cDNA.” Moreover, mutant mice (Sl/Sld), which produce a biologically active soluble SF protein but do not express the membrane-bound SF pr~te in , ’~ , ’ ’ ,~~ suffer from a

From the Division ofHematology and Medical Oncology, Depart- ment of Medicine, and Department of Biochemistry and Molecular Biology, Oregon Health Sciences University, Portland; Medical Ser- vice, Portland Veterans Affairs Medical Center, Portland; and the Pacific Northwest Regional Blood Services, Portland, OR.

Submitted April 24, 1992; accepted March 27, 1993. Supported in part by the National Cancer Institute (CA36306,

DK41933, and DK40566), the Medical Research Foundation of Or- egon, and the Department of Veterans Affairs. M.C.H. is the recipi- ent of an Associate Investigator Award from the Department of Vet- erans Aflairs.

Address reprint requests to Michael C. Heinrich, MD, Division of Hematology and Medical Oncology L-580, Department of Medi- cine, Oregon Health Sciences University, 3181 SW Sam Jackson Park Rd, Portland, OR 97201-3098.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section I734 solely to indicate this fact. 0 1993 by The American Society of Hematology. 0006-4971/93/8203-0026$3.00/0

Blood, VOI 82, NO 3 (August 1). 1993: pp 771-783 771

For personal use only.on April 10, 2019. by guest www.bloodjournal.orgFrom

http://www.bloodjournal.org/

http://www.bloodjournal.org/site/subscriptions/ToS.xhtml

772 HEINRICH ET AL

variety of hematopoietic defects, including macrocytic ane- mia. In addition, these mice are sterile, have reduced num- bers of skin mast cells, and lack pigment, except in the ret- ins. 14,16,19 Membrane-bound SF protein stimulates the proliferation of c-kit receptor-bearing ~ e l l s , ~ ~ ~ ~ ~ ~ ' ~ and may also mediate cell-cell a d h e s i ~ n . ~ , ' ~ , ~ ' , ~ ~ For these reasons, the membrane-bound form is probably the most critical isoform in the intact animal.L43'8-20

Although endothelial cells and fibroblasts stimulated by IL- 1 can support hematopoiesis by expressing multilineage hematopoietic growth f a ~ t o r s , ~ ~ , * ~ uninduced endothelial cell and fibroblast monolayers are less capable of supporting hematopoietic progenitor cell growth and differentiation than stromal cells in LTBMC.25 We therefore sought to test two hypotheses: (1) that IL-l can induce the accumulation of SF mRNA in stromal cells and thereby increase the production of SF protein by these cells; and (2) that the exon 6- SF transcript, which is translated to produce a predominately membrane-bound SF protein, is more prevalent in LTBMC than in endothelial cells or fibroblasts, resulting in increased expression of the membrane-bound SF protein isoform.

SF mRNA expression in human umbilical vein endothelial cells (EC), normal diploid fibroblast (DF), and LTBMC was determined using reverse-transcription polymerase chain reaction amplification (RT-PCR), ribonuclease protection assays (RPA), and Northern blot analysis. E-selectin mRNA was used as a positive (IL- 1 -inducible) SF transcript is constitutively transcribed in EC, DF, and LTBMC, and is not inducible by IL- I a. The ratio of exon 6+ SF transcripts to exon 6- transcripts was identical in the three stromal cell types that were analyzed, and was not altered by treatment of these cells with IL- 1 a. Membrane- bound SF was assessed using fluorescent cell staining. The leukocyte adhesion molecules ICAM- I and E-selectin were used as positive (IL- I-inducible) ~ o n t r o l s . ~ ~ , ~ ~ , ~ ~ Me m- brane-bound SF was present on all three types of stromal cells and was not increased by treatment of these cells with IL-la.

MATERIALS AND METHODS

Reagents Recombinant human IL-la (3 X IO' U/mg) was generously pro-

vided by Dr Peter Lomedico (Hoffman-LaRoche, Nutley, NJ). IL- la-treated cells were exposed to 2.5 ng/mL of IL-la for 3 to 72 hours. RR 1 / I monoclonal antibody (MoAb) was used to detect the CD54 antigen (ICAM-I"; a gift from Dr Timothy Springer, Har- vard Medical School, Boston, MA). MoAb 12Gl.l was used to detect E-selectin (a gift from Dr Tom Thieme, Epitope, Beaverton, OR). Purified MoAb supernatant (anti-H-2Dk) was prepared from the 15-5-5s hybridoma cell line (ATCC HB24; ATCC, Rockville, MD) and was used as a negative control ant ib~dy.~ ' Polyclonal rabbit serum was obtained from rabbits immunized with recombinant human SF (HuMGF-P1; a gift from Dr Douglas Williams, Immunex, Seattle, WA). Affinity-purified polyclonal goat IgG specific for human SF was obtained from R & D Systems (Minneapo- lis, MN). Normal rabbit serum and fluorescein isothiocyanate (F1TC)-conjugated affinity-purified polyclonal rabbit antigoat IgG antibody were purchased from Sigma (St Louis, MO). FITC-conjugated goat antimouse antibody and goat anti-rabbit antibody were purchased from AMAC (Westbrook, ME).

Plasmids pGEM-4Z E-selectin. A 1,074-bp fragment (bases 562 to

1 ,635)26 of E-selectin (formerly designated ELAM- I)" was isolated following digestion of aH3M ELAM-I with PstI restriction enzyme. This fragment was cloned into a Pstl-digested pGEM-42 plasmid (Promega, Madison, WI) following manufacturer's direc- tions. The aH3M ELAM-I plasmid was a generous gift of Dr Mi- chael Bevilacqua (University of California at San Diego School of Medicine, San Diego, CA).26

pSP72 GAPDH. pHcCAP was sequentially digested with PstI and XbaI restriction enzymes to release a 780-bp fragment of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which was subsequently cloned into a pSP72 plasmid (Promega). pHcGAP contains the cDNA for GAPDH as described by Wu et al,32 and was obtained from ATCC (plasmid no. 57090, ATCC).

This plasmid has a 900-bp insert representing the entire human SF coding sequence (bases 160 to 1,053 using the notation system of Martin et all'). This plasmid was the generous gift of Dr Stewart Lyman (Immunex).

pHuMGF 2.4.

Table 1. PCR Primers ~

Primer Location Exon Strand Sequence (5-31

SF primer^'^ s- 1 28-47 1 sense GGGGGATCCGCGGGAAGCAGGGACAGTGG s-2 730-749 6 antisense s-3 72-91 1 sense CAATGCGTGGACTATCTGCC s-4 730-749 6 antisense GCAACAGGGGGTAACATAAA s-5 269-288 2 sense GCAGGAATCGTGTGACTAAT S-6 388-407 4 sense TGGATAAGCGAGATGGTAGT s-7 1124-1 144 8 antisense TGGGTAGCAAGAACAGATAAA

E- 1 117-137 4 sense ATGATTGCTTCACAGTTTCTC E-2 696-7 16 5 antisense GAAGTTTCCCAGTGGGTGACT E-3 407 -42 7 4 sense GGCTCCAGGTGAACCCAACA A

G- 1 1 1 7-137 4 sense CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCACC G-2 696-71 6 8 antisense

Underlined bases indicate synthetic restriction enzyme recognition sites included to allow cloning of the amplification product

GGGTCTAGAGCAACAGGGGGTAACATAAA

E-Selectin primersZ6 27

GAPDH primers3'




STEEL FACTORS AND STROMAL CELLS 773

pGEM3 y-actin. A 700-bp HindIII-BamHI fragment of human y-actin isolated from plasmid pHFyA-3'UT was cloned into a @EM-3 plasmid (Promega). The pHFyA-3'UT plasmid contains a partial fragment of human fibroblast cytoplasmic y-actin 3' un- translated region (UTR), and was the generous gift of Dr Peter Gunning (Stanford University School of Medicine, Palo Alto, CA).33,34

pGEM-42 SF. Using primers S-1 and S-2 (Table I) , a 72 1-bp fragment of human SF was generated by RT-PCR amplification of EC RNA. Following digestion ofthe RT-PCR product with BamHI and XbaI restriction enzymes, the DNA was cloned into a BamHI/ XbaI-digested pGEM-4Z plasmid. pSFF This plasmid encodes a colinear molecular clone of

Friend spleen focus-forming virus and has been previously de-

pSFF MGF. pHu MGF 2.4 was linearized with BamHI, blunted with Klenow PolI fragment, and further digested with Xhol to release the SF insert (bases 160 to 1,053 using the notation system of Martin et all7). The SF fragment was ligated into a pSFF vector, which had been linearized with EcoR1, then blunted with Klenow Po& fragment, and further digested with XhoI.

Cell Lines EC, used between fourth and tenth passage, were cultured as de-

scribed previo~sly.~~ IL- l stimulation experiments were performed using media that did not contain EC growth factor. Human lung- derived DF (CCD- 1 I Lu, ATCC no. CCL 202) were grown in Dul- becco's modified Eagle's medium (DMEM; GIBCO BRL, Grand Island, NY) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT). Neonatal foreskin fibroblasts (NFF) were isolated as described previ~usly,~~ and grown in DMEM supplemented with 10% fetal bovine serum. JY, a B-lymphoblastoid cell line, was maintained in RPMl supplemented with 10% fetal bovine serum?' Dami, a megakaryoblastic leukemia cell line, was generously pro- vided by Dr Robert Handin (Brigham and Women's Hospital, Bos- ton, MA) and maintained in RPMI supplemented with 10% fetal bovine serum.38 $-2 ecotropic-packaging cells39 and PA12 cells am- photrophic-packaging cellsa were grown in DMEM supplemented with 10% fetal bovine serum. The human transformed T-cell line HUT-78 (ATCCTIB 161) wasgrownin RPMI-1640 supplemented with 10% fetal bovine s e ~ u m . ~ '

Bone marrow was obtained from normal donors at the time of collection for allogeneic transplantation. Following Ficoll- Hypaque (Pharmacia, Piscataway, NJ) separation, low-density cells were seeded into T-175 flasks ( I X 10' cells per flask) containing 50 mL Iscove's modified Dulbecco's medium supplemented with 0.8% 50X MEM amino acids, 0.4% IOOX nonessential amino acids, I% IOOX vitamins, 1% glutamine, I % sodium pyruvate, penicillin and streptomycin (GIBCO BRL), 1 X mol/L hydrocortisone hemi- succinate (Sigma), 1 X mol/L 2-mercaptoethanol (Sigma), 12.5% horse serum (Hyclone), and 12.5% fetal bovine serum.42 After 7 days at 3 7 T , cultures were fed by replacement of half of the medium. Subsequently, cultures received complete media changes at weekly intervals. When cultures reached near confluence (3 to 4 weeks), they were subsequently maintained by trypsinization and subculturing at 2: 1 to 4: 1 ratios. Cells were analyzed between sec- ond and fourth passage. When maintained in this fashion, the stromal layers were fully capable of supporting committed progenitors and long-term culture-initiating cells.43

Retroviral Vector Amplifications Purified pSFF or pSFF MGF plasmid DNA (10 pg) was trans-

fected as a calcium phosphate precipitate, using protocol A as previ-

ously described, into culture dishes that contained a I : I mixture of $-2 and PA 12 cells."

RNA Isolation Total RNA was prepared using the method of Cathala et al.45

Cells were lysed in 5 mol/L guanidine isothiocyanate (GITC Fluka, Ronkonkoma, NY) and the RNA precipitated using 4 mol/L LiCI2. Following precipitation, the pellets were digested with 150 pg/mL proteinase K (Sigma). RNA was purified from the digested, solubi- lized pellets by repeated phenokch1oroform:isoamyl alcohol extrac- tions, followed by two ethanol precipitation steps.

R T-PCR A 20-pL reverse-transcription mixture containing 2.5 pg of RNA

in 1 X PCR buffer (10 mmol/L Tris HCl [pH 8.3],50 mmol/L KCl, 1.5 mmol/L MgCl,, 0.1% gelatin), 1 mmol/L dithiothreitol, 2.5 mmol/L MgCI, (total MgCl, 4 mmol/L), I mmol/L dNTPs (Phar- macia), 40 U RNasin (Promega), 0.2 pg random hexamer primers (GIBCO BRL), and 1 pL of RNase H- MMLV reverse transcriptase (GIBCO BRL) was incubated for 60 minutes at 37"C.46 The reverse-transcriptase enzyme was inactivated by heating the reaction mixture to 95°C for 5 minutes. The cDNA was diluted IO-fold, and 1/40 (5 pL) of each reaction was used for PCR as described by Saiki et al.4' Each 100-pL PCR reaction contained 100 pmol of each primer, 2.5 U of Taq polymerase (AmpliTaq; Perkin Elmer-Cetus, Nonvalk, CT), 200 pmol/L of each dNTP, 10 pL of 1 X PCR buffer, and 5 pL of diluted cDNA. The reactions were amplified in a Coy Model 50 Temp Cycler (Coy Laboratories, Ann Arbor, MI). One PCR cycle consisted of I minute at 94"C, 1 minute at 50°C, and 1 minute at 72°C. Typically, 25 to 35 cycles of amplification were performed. Table 1 lists the nucleotide sequence and cDNA location of the PCR primers used in our studies.

Southern Blot Analysis PCR products were size-fractionated by gel electrophoresis

through 1% to 1.5% agarose, and transferred to nitrocellulose (Schleicher and Schuell, Keene, NH). Nucleic acids were immobilized by UV irradiation (Stratalinker; Stratagene, La Jolla, CA). Prehybridization was performed for 2 hours at 42°C in a solution containing 50% deionized formamide, 5X Denhardt's, 5X SSPE ( I X SSPE = 0.15 mol/L NaCI, 0.01 mol/L NaH,PO,, 0.001 mol/L EDTA), 100 pg/mL sheared salmon sperm DNA, and 0.5% sodium dodecyl sulfate (SDS). Hybridization was performed for 12 to 16 hours at 42°C in prehybridization solution containing 1 X IO6 cpm/ mL of "P-y-adenosine triphosphate (ATP) end-labeled oligonucleo- tide probe4* or random hexamer primed SF cDNA. The membranes were washed in 2X SSC ( I X SSC = 0. I5 mol/L NaCl + 0.01, mol/L sodium citrate)/O. 1 % SDS at room temperature for 30 minutes and then in 0.1 X SSC/O. 1% SDS at 50°C for 30 minutes.

Quantitative RT-PCR Serial dilutions of gel-purified SF or E-selectin plasmid-derived

cDNA, typically 1 pg to 10 ng, were amplified by PCR to generate a standard curve. PCR cycle number was optimized to maintain exponential conditions of amplification. Fifteen-microliter aliquots of the reaction were analyzed by Southern blot technique. Densitome- try was performed using a Bio-Rad Model 620 one-dimensional (1-D) densitometer (Bio-Rad, Rockville Centre, NY).

Least-squares regression was used to fit the densitometry data to the equation: Optical density = slope X log,,(plasmid cDNA in picograms) + intercept. The regression equation was used to predict the relative amount of SF or E-selectin cDNA in simultaneously




774 HEINRICH ET AL

E -S E LE CT 1 N SF GAPDH

I

amplified and Southern blotted samples of reverse-transcribed EC RNA.

R PA RPA were performed as described previously using a commer-

cially available kit (RPA 11; Ambion, Austin. TX).49 In vitro antisense RNA transcripts were uniformly labeled with '2P-n-uridine triphosphate (UTP). T3 RNA polymerase was used to generated SF antisense RNA transcripts from Ncol-digested pHuMGF 2.4. T7 RNA polymerase was used to generate SF antisense RNA transcripts from EcoRldigested GEM-4Z SF. T7 RNA polymerase was used to generate E-selectin antisense RNA transcripts from BamHI-digested pGEM-4Z E-selectin, and GAPDH antisense transcripts from Ncol-digested pSP72 GAPDH. For each experimental condition, 5 to 10 pg of RNA was hybridized with I X IO5 cpm of antisense probe for 16 hours at 45°C in the presence of 80% deionized formamide. 40 mmol/L PIPES (pH 6.4), 400 mmol/L sodium acetate (pH 6.4), and 1 mmol/L EDTA. Following hybridization. the samples were digested with RNase A and RNase TI for I hour at 37°C. The concentration of RNase was optimized for each antisense probe used. SF antisense transcript samples were digested with I .67 U/mL of RNase A and 333 U/mL of RNase TI:

A

Fig 2. Quantitative RT-PCR of EC RNA. (A) PCR standard curve. Serial dilutions of gel purified SF plasmid cDNA (isolated from BamHI/Hindlll-digested pGEM-42 SF) were amplified by PCR using primers S-3 and S-4 (Table 1). Following Southern transfer, the membrane was probed with 32P-y- ATP end-labeled primer S-5 (Table 1). 1 -D densito- metric measurement of product amount was plot- ted versus input plasmid cDNA. Least-squares linear regression was used to determine the best fit for the data. (B) Representative RT-PCR amplification of EC SF mRNA. RNA was isolated from EC treated with I L - l a for 0 , 3 , 6, or 24 hours. RT-PCR and Southern blotting was performed as in (A).

hours. RT-PCR reactions were performed using the following primer pairs (see Table 1): E-selectin (E- l , E-2). SF (S-3, S-4). and GAPDH (G-l, G-2). Am- plification products were visualized by ethidium bromide staining of a 0.9% agarose gel. Control RT- PCR reactions (H,O) were performed without added template. Haelll-digested 6x1 74 DNA frag- ments (GIBCO-BRL) were used as molecular- weight size standards (STDS).

for experiments using an E-selectin or GAPDH antisense transcript, the samples were digested with 5 U/mL of RNase A and 1,000 U/mL of RNase TI. RNase digestion was terminated by inactivation of the enzymes with GlTC followed by ethanol precipitation. Digestion products were subjected to gel electrophoresis using a 7-mol/L urea, 5% polyacrylamide gel.

Norlhern Blot Analwis RNA was size-fractionated on 1% agarose formaldehyde gels and

transferred to nitrocellulose using IOX SSPE as a transfer buffer. Following transfer, the nucleic acids were immobilized by UV irradiation. Membranes were prehybridized, hybridized, and washed as described for Southern blots.24

Indirect Immunofluorescence Before staining, adherent cell lines were released from culture

flasks by incubation with trypsin-EDTA (GIBCO-BRL). Cells were washed in DMEM with 0.02% sodium azide. Harvested cells were incubated with MoAb, rabbit serum, or goat IgG and stained using an FITC-conjugated species-specific antiimmunoglobulin antibody. Surface-stained cells were fixed in 2% paraformaldehyde

SF PCR

Plasmid cDNA (pglreaction)

B

SF





and analyzed by flow cytometry using a FACScan instrument (Bec- ton Dickinson, Mountain View, CA).18 Trypsin-EDTA treatment of cells was shown not to alter indirect immunofluorescent detection of SF, ICAM-I, or E-selectin (data not shown).

RESULTS

EC Express SF mRNA

SF, GAPDH, and E-selectin mRNA from control and IL- I a-stimulated EC were analyzed by RT-PCR (Fig 1). SF transcripts were detectable in equal amounts in both control and IL-la-stimulated EC. In contrast, there was at least %fold more E-selectin RT-PCR product obtained from IL-1-treated EC RNA than from control EC RNA. A similar pattern of induction was seen in RT-PCR reactions using granulocyte-macrophage colony-stimulating factor (GM- CSF) and IL-6 primers (data not shown). GAPDH transcript was present in equal amounts in control or IL-la- stimulated EC. To confirm the notion that IL-1 did not induce accumulation of GAPDH or SF mRNA, experiments were performed with a lower number of amplification cycles. Reducing the number of amplification cycles from 35 to 20 resulted in a decreased amount of amplification product; however, the concentration of GAPDH or SF transcript did not change following exposure of EC to IL- 1 LY, whereas the amount of E-selectin transcript increased dramatically after IL- la treatment (data not shown).

The SF RT-PCR product was transferred to nitrocellulose and hybridized with a random hexamer primer-labeled SF cDNA probe. Following autoradiography, a single band of the size predicted from ethidium bromide staining was seen (data not shown). To further confirm the existence of SF mRNA in EC, the SF RT-PCR product generated using primers S1 and S2 (Table 1) was cloned into a pGEM-4Z plasmid (pGEM-4Z SF) and sequenced using the dideoxy- nucleotide chain termination method.” The RT-PCR product sequence was identical to that reported for human SF (data not shown).”

IL-la Does Not Induce SF Transcript in EC The initial RT-PCR experiments suggested that IL- 1 had

no inductive effect on EC SF mRNA levels. To facilitate analysis of SF gene expression, a quantitative RT-PCR assay for SF mRNA was developed to measure SF transcript in control or IL-la-stimulated EC (Fig 2). There was no significant change in the amount of SF transcript following treatment of EC with 2.5 ng/mL of IL-la for up to 24 hours (Table 2 and Fig 3). (We have previously found this dose of

Table 2. Comparison of RPA and RT-PCR Estimates of EC SF mRNA (expressed as percent of maximal concentration)

P RNA RPA RT-PCR Value

Control 84.8% ? 45.6% (n = 10) 100.0% ? 27.1% (n = 9) .40 Lla, 3 h .99 lL-la, 6 h . 90 lL-la, 24 h .78

87.43% f 48.71% (n = 5) 100.0% + 36.1% (n = 5) 74.4% ? 43.0% (n = 10)

87.3% f 41.7% (n = 7) 97.2% + 31.5% (n = 6) 68.9% ? 37.1% (n = 81

Values (mean 2 SD) are expressed as percent of maximal SF mRNA concentration in control and IL-la (2 5 ng/mL)-stimulated EC A two-tailed Student’s t-test was used to test statistical significance

IL- 1 a to induce maximal production of the hematopoietic growth factors IL-6, GM-CSF, and G-CSF by EC and DF [data not shown], and that the concentration of these gene transcripts i s maximal 2 to 6 hours after IL-la stimula-

RPA analyses were also performed to confirm the RT-PCR assays; the results of these studies were com- pletely congruent. Our quantitative estimates SF transcript were equivalent using solution hybridization and RT-PCR (Table 2).

Regulation of E-selectin, a known IL-1 -inducible gene, was also analyzed using quantitative RT-PCR and RPA (Ta- ble 3). As previously described, E-selectin mRNA levels increased nearly 100-fold in EC stimulated with IL-l01.~~9*~ Solution hybridization and quantitative RT-PCR produced equivalent measurements of E-selectin transcript. The differential kinetics of SF and E-selectin transcript accumulation following IL- 1 a stimulation are graphically depicted in Fig 3. These results confirm that IL-la has no impact on SF transcript levels in EC. Equal loading of RNA in the E-selectin and SF RPA studies was confirmed by performing addi- tional RPA analyses using a GAPDH antisense probe (data not shown). To address the possibility that a longer period of IL- l a treatment might stimulate SF mRNA accumulation, we treated EC with IL-la for 0 to 72 hours and measured SF and GAPDH transcript concentrations by RPA or Northern blot analysis. In these extended treatment experiments, IL- 1 a had no effect on SF transcript levels (Table 4).

Expression of SF by Fibroblasts and LTBMC Adherent Cells

We and others have previously noted similar patterns of expression of hematopoietic growth factors by EC, DF, and LTBMC.5”56 Therefore, RPA and RT-PCR analyses of RNA prepared from DF and LTBMC were performed to determine whether these cell types also expressed constitutive SF transcript. The concentration of SF transcript was similar in these three stromal cell types (Fig 4). As was the case for EC, no significant effect of IL- 101 on DF or LTBMC expression of SF transcript was found.

Alternatively Spliced SF mRNAs

Our previous RT-PCR studies of SF transcripts used an antisense primer (S-4; Table 1) complementary to exon 6, thereby amplifying only exon 6+ SF transcripts. To discrimi- nate between exon 6+ and exon 6- transcripts, RT-PCR of stromal cell RNA was performed using a primer pair (S-6 and S-7; Table 1 ) whose amplification product spanned exons 4 through 8. Using this primer pair, exon 6+ transcripts were amplified to generate a 757-bp product, whereas exon 6- transcripts were amplified to yield a 673-bp fragment. These amplification products were resolved by 1.5% agarose gel electrophoresis, and the relative product amounts determined by Southern blot analysis. Both species of SF transcript were constitutively expressed in EC, DF, and LTBMC (Fig 5). In all three stromal cell types studied, there was a predominance of exon 6+ transcripts, and no significant difference was found in the ratio of exon 6+ to exon 6- transcripts between the three types of stromal




776

140 140

120 120

100'

80

60

40-

20

0

-

HEINRICH ET AL

-

- - Fig 3. Differential effect of IL-la on E-selectin

and SF mRNA accumulation in EC. RNA was isolated from EC treated with IL-la (2.5 ng/mL) for 0, 3, 6, or 24 hours. SF and E-selectin mRNA levels were determined by quantitative RT-PCR as described in Fig 2. The results, expressed as percent

. a - ' * a " '

IL-1 Stimulation (hours)

cells analyzed (Table 5). Exposure of these cells to IL- 1 a had no effect on the ratio of exon 6+ to exon 6- transcripts. Similar results were obtained by RPA using a probe that spanned exon 6 (data not shown).

Northern Blot Analysis of SF Transcripts Northern blot analyses were performed to allow measure-

ment of SF transcript size. At least two species of SF transcript were found expressed in EC (Fig 6A). The most prevalent SF transcript had an estimated size of 5.6 kb. The smaller transcript, which accounts for only 15% of total SF mRNA detected, had an estimated size of approximately 3.6 kb. No effect of IL- 1 a on SF transcript amount was seen by Northern blot analysis. In contrast, E-selectin mRNA accumulated substantially after IL- 1 a stimulation (Fig 6B). Both of these SF transcripts were also present in DF (Fig 7).

"Ping-Pong" AmpliJcation of Retroviral Vector Containing Human SF cDNA

Because there are no standard methods for quantification of SF, we sought to validate our immunofluorescence ap- proach using cells expressing high levels of human SF. To accomplish this, we developed a retrovirus that contained the human full-length SF cDNA. Retroviral vectors become efficiently amplified after they are transfected into cocultures of cells (eg, J/-2 and PA12 fibroblasts) that package retroviruses into distinct host-range envelope^.^^.^^^^ The J/-2 cell line releases a virus with an ecotropic host range,39 whereas the PA12 packaging cell line releases virions with an amphotropic host range.40 Since the virions from either

sent the mean values 2 SDs of six to nine experiments for SF and seven experiments for E-selectin.

cell type are c ros s - in fe~ t ious ,~~~~~ a back-and-forth ("ping- pong") process of infectious amplification ensues until a large proportion of the cells express virally derived proteins. Insertion of a gene of interest into the retroviral vector results in a high level of expression of recombinant protein by cells in this coculture system. Ping-pong amplification has been previously used to achieve high-level protein production of human growth hormone,44 as well as murine erythro- p ~ i e t i n . ~ ~ . ~ ~ We used the ping-pong amplification system to induce expression of human SF by cells that were initially devoid of human SF protein (murine retroviral packaging cell lines $2 and PA 12).

Amplified cocultures transfected with pSFF (# MOCK) or pSFF MGF ( J / SF), were analyzed for SF protein expression by indirect immunofluorescence using rabbit or goat antisera to human SF. As shown in Fig 8, J / MOCK cells had no detectable membrane-bound human SF protein, whereas J / SF cells expressed high levels of membrane- bound SF protein. Similar results were obtained using purified polyclonal goat antihuman SF IgG (data not shown). Expression of human SF mRNA by J / SF, but not by J / MOCK cells, was confirmed by Northern blot analysis (data not shown).

To confirm the specificity of our immunofluorescence assay for SF protein, we analyzed three lymphohematopoi- etic cell lines (Dami, JY, and HUT-78), which were found to lack detectable SF transcript in an RT-PCR assay. There

Table 4. Effect of Prolonged Incubation of IL-la on EC SF mRNA Concentration

RNA SF mRNA P Value

Table 3. Comparison of RPA and RT-PCR Estimates of EC E- Selectin mRNA (expressed as percent of maximal concentration)

RNA RPA RT-PCR Value P

EC control 98.3% k 32.1 (n = 4) ND EC IL-1 a, 24 hours .86 EC IL-1 a, 48 hours .64 EC IL-1 a, 72 hours .88

97.8% k 50.4 (n = 4) 100.0% +- 47.4 (n = 4) 84.7% t 40.6 (n = 4)

Control 1.8% i 4.0% (n = 10) 1 .O% t 0.3% (n = 7) .53 IL-la, 3 hours .99 IL-la, 6 hours 85.1%? 29.9% (n = 10) 89.4%? 27.7% (n = 7) .77 IL-la, 24 hours 22.5% ? 18.9% (n = 8) 11.8%? 7.4% in = 7) .17

100.0% t 18.2% (n = 10) 100.0% * 24.7% (n = 7)

Values (mean + SD) are expressed as percent of maximal E-selectin mRNA concentration in control and IL-1 a (2.5 ng/mL)-stimulated EC. A two-tailed Student's t-test was used to test statistical significance.

SF mRNA concentration was measured by RPA or Northern blot analysis. Values (mean ? SD) are expressed as percent of maximal SF mRNA concentration in control and IL-la (2.5 ng/mL)-stimulated EC. A two- tailed Student's I-test was used to test statistical significance. For statistical testing, the mean SF mRNA concentration of each experimental condition was compared with the SF mRNA concentration in control EC.





I'

Fig 4. Expression of SF mRNA in EC, DF, and LTBMC. RNA was isolated from control or 11-1 a-treated EC, DF, and LTBMC. EC and LTBMC were treated with IL-1 U for 3 hours, DF were treated for 12 hours. RT-PCR was performed using primers S-3 and S-4 (Table 1). Following Southern transfer, the membrane was probed with 32P- ?-ATP end-labeled primer S-5.

was no difference in immunofluorescence of these cells when stained with either goat- or rabbit-produced anti-SF antibody or with control antibody (data not shown).

Constitutive Expre.ssion by Stromal Cells

of Membrane-Bound SF Protein

EC, DF, and LTBMC were analyzed for the presence of membrane-bound SF using indirect immunofluorescence as described above. All three types of stromal cells express low but reproducibly detectable amounts of membrane- bound SF protein (Fig 8). Higher levels of membrane- bound SF protein were found in NFF and other skin-derived fibroblasts than in lung-derived fibroblasts (DF), EC, or LTBMC (Fig 8, and data not shown). Similar results were obtained using purified polyclonal goat anti-human SF IgG (data not shown).

Fig 5. Expression of exon 6+ and exon 6- SF transcripts in stromal cells. RNA was isolated from control or IL-1 +treated EC (0, 3, 6, and 24 hours), DF (6 hours), or LTBMC (4 hours). RT-PCR was performed using primers S-6 and S-7 (Table 1). Using this primer pair, exon 6+-containing transcripts were amplified to generate a 757-bp product, whereas exon 6- transcripts were amplified to yield a 673-bp fragment. Following Southem transfer, the membrane was probed with a random hexamer-primed BamHI/Hindlll SF cDNA fragment isolated from pHuMGF 2.4.

757 bp

673 bp

IL-la Does Not Alter SF Membrane-Bound Protein Expression bv Stromal Cells

To determine whether IL- I treatment would increase SF membrane-bound protein expression, we treated EC and NFF with IL- 1 a for 0 to 48 hours. Levels of SF protein and the leukocyte adhesion molecules ICAM- 1 and E-selectin were determined by immunofluorescence (Fig 9). SF membrane-bound protein does not increase following treatment of EC with IL- I a. In contrast, E-selectin protein is undetectable in unstimulated EC, but treatment of EC with IL-la resulted in a marked increase in E-selectin protein at 4 hours, with a return to nearly undetectable levels at 24 and 48 hours (Fig 9, and data not shown). ICAM-1 protein is present in low but detectable amounts in unstimulated EC, and treatment of EC with IL- I a resulted in an increase in ICAM-I protein after only 4 hours, with a greater induction seen at 24 and 48 hours. SF membrane-bound protein was not increased by treatment of NFF with IL-la. E-selectin protein is not expressed by fibroblasts?6 but the time course of IL-l induction of ICAM-I protein in NFF was the same as in EC. Similar results were obtained with lung-derived fibroblasts (data not shown).

DISCUSSION

Using three separate methods, we have determined that EC, DF, and LTBMC constitutively transcribe the SF gene and express membrane-bound SF protein. IL-1 a, known to induce the expression of a variety of cytokines, interleukins, hematopoietic growth factors, and adhesion molecules including IL- 1 ,60 IL-6:' 1L-8,62.63 GM-CSF,23.64 G-CSF,24.65 E- selectin:6 VCAM-I ,66.67 and ICAM- l ,28.68 does not induce SF mRNA accumulation. Soluble SF protein synergizes with G-CSF, GM-CSF, IL-I, IL-3, and IL-6 in in vitro hematopoietic cell colony growth a s ~ a y s . ~ * ~ * ~ ~ * ' ~ Therefore, the constitutive expression of SF by stromal cells likely contributes to the ability ofthese cells to support hematopoiesis not only in the steady-state, but also duringconditions ofinflam- matory stress.

The c-kit and c+ms gene products are members of the receptor tyrosine kinase family, and display a high degree of structural and genetic h~mology.~' The ligands for these receptors, SF and M-CSF, respectively, enhance cellular growth and/or differentiati~n.~.~' Binding ofcognate ligands

SF




778 HEINRICH ET AL

Table 5. Comparison of Exon 6+ to Exon 6- SF Transcripts in Human Stromal Cells

Cell TvDe ~~

Ratio of Exon 6’ to Exon 6- SF mRNA

EC LTBMC DF

3.50 5 1.58 (n = 20) 2.90 IT 1.34 (n = 12) 3.52 2 1.58 (n = 12)

RT-PCR was performed with primers S-6 and S-7 (Table 1) using RNA from unstimulated EC, DF, or LTBMC. Following Southern transfer, the membranes were probed with a random hexamer-labeled SF cDNA (BamHI/Hindlll fragment from pHuMGF 2.4). Following autoradiography, 1 -D densitometry was used to determine the amount of exon 6’ (757 bp) and exon 6- (673 bp) amplification products. Data are expressed as the ratio of exon 6’ RT-PCR product to exon 6- RT-PCR product. Values represent the mean 2 SD.

to the c-kit or c+ms receptor may activate similar signal transduction pathways, as the ectopic expression of the c- .fins protein in c-kit mutant (W phenotype) murine mast cells can complement the mutation-induced defects in mast-cell function.73

Although there is little primary sequence amino acid homology between M-CSF and SF,13 the predicted protein ter- tiary structure and spatial arrangement of the functional domains of these molecules suggests a common structural framework that may account for the similarities in the biology of these growth factors. In both the M-CSF and the SF genes, exons 2 through 5 encode a cytokine domain helix- loop framework, exon 6 encodes a prolinefserine-rich vari- able spacer chain that contains the preferred proteolytic cleavage site, and exon 7 encodes a tether chain that includes the transmembrane segment.74

Both M-CSF and SF nuclear RNAs are differentially spliced to give rise to different i~oforms.’~*’’~~ The M-CSF exon 6 spacer chain sequence can be removed during splicing (M-CSFa transcript), or be spliced in and translated to yield a 298- or 1 16-amino acid spacer chain (M-CSFP and M-CSFy transcripts, respecti~ely).~~.’~ All three M-CSF transcripts are translated to yield different-sized membrane- bound M-CSF proteins, which may be proteolytically cleaved to produce biologically active soluble M-CSF.76.77 The protein translated from the 4-kb M-CSFP transcript undergoes rapid proteolytic cleavage and thus exists almost exclusively as a soluble protein. In contrast, the protein translated from M-CSFa mRNA is cleaved slowly and exists predominantly as a membrane-bound molecule.77 M- CSF, like SF, is biologically active as both a soluble and a membrane-bound p r ~ t e i n . ’ ~ * ’ ~ * ~ ~ The proteolytic cleavage of M-CSF membrane-bound protein has been shown to be accelerated by treatment of M-CSF expressing cells with phor- bo1 esters in a similar fashion as that of cells that express SF

As is the case with M-CSF, translation of alternatively spliced SF mRNA has been reported to produce either a predominately membrane-bound (from exon 6- transcripts) or predominately soluble (from exon 6+ transcripts) SF pr~te in . ’~ . ’~ , ’~ Our experiments confirmed the constitutive expression of both species of SF transcript in EC, DF, and LTBMC.

“Competitive” RT-PCR provides an accurate determina-

tion of the initial ratio of PCR target sequences when the predominant species is present in less than a IO-fold molar excess and when PCR conditions allow exponential amplifi- c a t i ~ n . ~ ~ * ~ Using primers S-6 and S-7 (Table I) , the ratio of exon 6+ and exon 6- SF transcripts was determined using

5600 bp -

3600 bp -

I . B

C

0 W

0 W

SF

y-ACTIN

Fig 6. Northern blot analysis of EC RNA. RNA was isolated from EC exposed to either control medium or 11-1 U for 4 hours. Twelve micrograms of RNA from each condition was analyzed by Northern blot. (A) SF mRNA. The membrane was hybridized with a random hexamer-primed BamHI/HindlIl fragment of SF cDNA isolated from pHuMGF 2.4. The predominant species of SF has a molecular weight of 5,600 bases, and the minor species has a MW of 3,600 bases. (8) E-selectin mRNA. Following hybridization with the SF cDNA probe, the membrane was stripped and rehybridized with a Pstlpsrl fragment of E-selectin cDNA isolated from pGEM-42 E- selectin. (C) y-Actin mRNA. Following hybridization with the E-selectin probe, the membrane was stripped and hybridized with a Psrl/BamHI fragment of y-actin cDNA isolated from pGEM3 y-actin.





EC DF

5600 bp -

3600 bp -

SF

Fig 7. Northem blot analysis of SF expression in EC and DF. Twenty-five micrograms of RNA from EC or DF was loaded per lane. The membrane was hybridized with a random hexamer- primed BamHI/Hindlll fragment of SF cDNA isolated from pHuMGF 2.4. Equal loading of the lanes was verified by stripping the membrane and rehybridizing with a Pstl/BamHI fragment of y-actin cDNA isolated from pGEM3 y-actin (data not shown).

competitive RT-PCR. All three types of stromal cells contained both SF transcript species, and had similar exon 6’ to exon 6- ratios of approximately 3:l. The ratios obtained from our RT-PCR and RPA studies are similar to those obtained using RPA to analyze SF splicing in various murine and human tissue^.'^.'^.^^

There are at least two species of SF transcripts detectable by Northern blot analysis of EC and DF RNA. The larger species has a size of approximately 5.6 kb, which is consis- tent with the estimates obtained from analysis of the human SF cDNA sequence and by previous Northern blot analyses.” The alternative usage of exon 6 during SF splicing does not explain the presence of two SF transcripts detected by Northern blot studies, as exon 6 contains only 84 bp, and exclusion of only exon 6 during splicing would not produce a SF transcript almost 2 kb smaller than the predominant SF transcript. M-CSF transcripts that use different 3’ non- coding sequence exons have been described.’’ Although it is possible that the smaller 3.6-kb transcript seen on Northern blot may arise from alternative splicing of the SF 3’ UTR, given the similarities in biology of SF and M-CSF, the nucleotide sequence and biologic significance of the 3.6 kb SF transcript species remains unknown.

Others have found constitutive expression of SF mRNA by human EC and bone marrow-derived reticulofibroblas-

toid cells. In these studies. an inductive effect of IL- 18 on SF mRNA concentration was reported. However. quantitative analysis of SF mRNA concentration was not performed, nor was SF protein measured.86 Using RT-PCR and North- ern blot and RPA analyses. we were unable to confirm any effect of IL-la on SF mRNA concentration in EC, DF, or LTBMC, nor could we measure any effect of IL- I a on the amount of membrane-bound SF protein expressed by EC, NFF, or DF. Because the sensitivity of our studies was such that less than a twofold change in SF mRNA concentration would have been detectable, and because the effect of IL-1 a on mRNA levels of E-selectin and protein levels ofcell-associated ICAM-1 and E-selectin were identical to previous report^,^^.^'*'^ we conclude that IL-la does not induce SF gene expression in the cells we tested. Nor is there evidence that IL-la and IL-18 are different in this regard. We have previously found identical effects of IL-1 a and IL-I8 on EC and DF gene expression of GM-CSF, G-CSF, IL-18, IL-6, and E-selectin. Additionally, in a limited series of experiments, treatment of EC with IL-18 had no effect on the concentration of SF mRNA (data not shown).

In summary, EC and DF that do not support hematopoi-

I LTBMC-AC

Fluorescence Intensity

Fig 8. Cytduorometric analysis of stromal cells. Cells were stained using polyclonal rabbit antihuman SF (-) and FITC-conjugated goat antirabbit antibody. Normal rabbit serum and FITC- conjugated goat antirabbit antibody were used as a control (----). Stained cells were analyzed with a Becton-Dickinson FACScan instrument. Stromal cells analyzed: + SF (coculture of +-2 and PA1 2 cells transfected with pSFF MGF), + MOCK (coculture of +-2 and PA1 2 cells transfected pSFF), NFF6 (neonatal foreskin fibroblasts), 11 -Lu (DF), EC, and LTBMC adherent cells (LTBMC-AC). Similar results were obtained using polyclonal goat antihuman SF antibody and FITC-conjugated rabbit antigoat antibody.




HEINRICH ET AL

CONTROL IL-1 4h IL-1 24h

EC SF

EC CAM-1

NFF SF

,,,,,,, l , , m r l

I

Fig 9. Effect of IL-la on stromal cell membrane-bound SF, E-selectin, and ICAM-1 . EC and NFF were treated with IL- l a (2.5 ng/mL) for 0. 4. or 24 hours. Membrane-bound SF li_ ,,,., ",'- was detected by indirect immunofluorescent staining using polyclonal rabbit anti-human SF (-) and FITC-conjugated

*-__ goat antirabbit antibody. Nor- mal rabbit serum and FITC-conjugated goat antirabbit antibody was used as a control

, I ( - - - - ) for SF analysis. Mem- : : I t

I : I !

1 : , , / I : : brane-bound ICAM-1 was de- , , tected by indirect immunofluo-

rescent staining using RR1/1 MoAb (-) and FITC-conjugated goat antimouse antibody. Membrane-bound E-selectin (-) was detected by indirect immunofluorescent staining using 1261 .I MoAb and FITC-

antibody. 15-5-5s MoAb and FITC-conjugated goat antimouse antibody (----) were

.-- -.- --_

EC

z - 4 kq ,,,,," , , , , , , , "',"

E-SELECTIN 5 % - iii

-

._

E -._ In ,,,.,,,,,), 'lrrml ,.,,,_ l , r rml

NFF ICAM-1 li: ,,,,,,,,,,, rrnni bA , , , . , , , , , , , m"l h,,,"y- :: 1 ,

4 1

I , , I ! I

*. ..-

, ' I conjugated goat anti-mouse

- _ _ _ I--__

100 lo1 lo2 i o 3 io4 loo lo1 10' io3 io4 100 lo1 lo2 103 104 used as a control for ICAM-1

Fluorescence Intensity and E-selectin measurement.

etic progenitor cell growth in long-term culture, as well as mixed stromal cells from LTBMC that do support progenitor growth, constitutively transcribe SF mRNA. IL-la does not induce the accumulation of SF mRNA in any of these cell types. In addition, the ratio of exon 6+ to exon 6- SF transcript is identical between these cell types and is not altered by exposure of stromal cells to IL- 1 a. Integral membrane SF is constitutively expressed by stromal cells and is not regulated by IL-la. All three types of stromal cells studied expressed similar amounts of SF membrane-bound protein, although somewhat higher levels were found in skin- derived fibroblasts. Therefore, while the production of SF by stromal cells in LTBMC clearly contributes to the ability of these cells to support hematopoiesis," the uniquely supportive function of LTBMC compared with EC or DF cannot be explained by differences in SF gene expression.

ACKNOWLEDGMENT

The authors are indebted to Brenda Wilkinson, Keaney Rath- bun, Barbara Oppenlander, and Pam Spurgin for their technical

assistance. We thank Ruth Weidenaar for her help in preparation of the manuscript. The authors thank Lynn Kitagawa and Michael Moody for their help in preparing the figure illustrations.

REFERENCES

1. Zsebo KM, Williams DA, Geissler EN, Broudy VC, Martin FH, Atkins HL, Hsu RY, Birkett NC, Okino KH, Murdock DC, Jacobsen FW, Langley KE, Smith KA, Takeishi T, Cattanach BM, Calli SJ, S u s s S: Stem cell factor is encoded at the SI locus of the mouse and is the ligand for the c-kit tyrosine kinase receptor. Cell 63:213, 1990

2. McNiece IK, Langley KE, Zsebo KM: Recombinant human stem cell factor synergises with GM-CSF, G-CSF, IL-3 and Epo to stimulate human progenitor cells of the myeloid and erythroid lin- eages. Exp Hematol 19:226, 1991

3. Bemstein ID, Andrews RG, Zsebo KM: Recombinant human stem cell factor enhances the formation of colonies by CD34+ and CD34+1in- cells, and the generation of colony-forming cell progeny from CD34'lin- cells cultured with interleukin-3, granulocyte colony-stimulating factor, or granulocyte-macrophage colony-stimulating factor. Blood 77:2316, 1991





4. Avraham H, Vannier E, Cowley S, Jiang S, Chi S, Dinarello CA, Zsebo KM, Groopman J E Effects of the stem cell factor, c-kit ligand, on human megakaryocytic cells. Blood 79:365, 1992

5. Bruno E, Bride11 RA, Cooper RJ, Brandt JE, Hoffman R: C-kit ligand Its effects on in vitro human megakaryocytopoiesis. Blood 78:307a, 1991 (suppl 1, abstr)

6. Avraham H, Scadden DT, Chi S, Broudy VC, Zsebo KM, Groopman JE: Interaction of human bone marrow fibroblasts with megakaryocytes: Role of the c-kit ligand. Blood 80:1679, 1992

7. Tsai M, Takeishi T, Thompson H, Langley KE, Zsebo KM, Metcalfe DD, Geissler EN, Galli SJ: Induction of mast cell proliferation, maturation, and heparin synthesis by the rat c-kit ligand, stem cell factor. Proc Natl Acad Sci USA 88:6382, 1991

8. Tsai M, Shih LS, Newlands GF, Takeishi T, Langley KE, Zsebo KM, Miller HR, Geissler EN, Galli SJ: The rat c-kit ligand, stem cell factor, induces the development of connective tissue-type and mucosal mast cells in vivo. Analysis by anatomical distribution, histochemistry, and protease phenotype. J Exp Med 174: 125, 1991

9. Dolci S, Williams DE, Ernst MK, Resnick JL, Brannan CI, Lock LF, Lyman SD, Boswell HS, Donovan PJ: Requirement for mast cell growth factor for primordial germ cell survival in culture. Nature 352:809, 1991

IO. Godin I, Deed R, Cooke J, Zsebo K, Dexter M, Wylie CC: Effects of the steel gene product on mouse primordial germ cells in culture. Nature 352307, 1991

1 1. Keshet E, Lyman SD, Williams DE, Anderson DM, Jenkins NA, Copeland NG, Parada LF: Embryonic RNA expression patterns of the c-kit receptor and its cognate ligand suggest multiple functional roles in mouse development. EMBO J 10:2425, 1991

12. Rossi P, Albanesi C, Grimaldi P, Geremia R: Expression of the mRNA for the ligand of c-kit in mouse Seaoli cells. Biochem Biophys Res Commun 176:910, 1991

13. Anderson DM, Lyman SD, Baird A, Wignall JM, Eisenman J, Rauch C, March CJ, Boswell HS, Gimpel SD, Cosman D, Wil- liams DE: Molecular cloning of mast cell growth factor, a hema- topoietin that is active in both membrane bound and soluble forms. Cell 63:235, 1990

14. Flanagan JG, Chan DC, Leder P Transmembrane form of the kit ligand growth factor is determined by alternative splicing and is missing in the Sld mutant. Cell 64: 1025, 1991

15. Matsui Y, Zsebo KM, Hogan BL: Embryonic expression of a haematopoietic growth factor encoded by the S1 locus and the ligand for c-kit. Nature 347:667, 1990

16. Russell ES: Hereditary anemias of the mouse: A review for geneticists. Adv Genet 20:357, 1979

17. Martin FH, Suggs SV, Langley KE, Lu HS, Ting J, Okino KH, Moms CF, McNiece IK, Jacobsen FW, Mendiaz EA, Birkett NC, Smith KA, Johnson MJ, Parker VP, Flores JC, Pate1 AC, Fisher EF, Erjavec HO, Herrera CJ, Wypych J, Sachdev RK, Pope JA, Leslie I, Wen D, Lin C-H, Cupples RL, Zsebo KM: Primary structure and functional expression of rat and human stem cell factor DNAs. Cell 63:203, 1990

18. Toksoz D, Zsebo KM, Smith KA, Hu S, Brankow D, Suggs SV, Martin FH, Williams DA: Support of human hematopoiesis in long-term bone marrow cultures by murine stromal cells selectively expressing the membrane-bound and secreted forms of the human homolog of the steel gene product, stem cell factor. Proc Natl Acad Sci USA 89:7350, 1992

19. Huang EJ, Nocka KH, Buck J, Besmer P: Differential expression and processing of two cell associated forms of the kit-ligand: KL-1 and KL-2. Mol Biol Cell 3:349, 1992

20. Brannan CI, Lyman SD, Williams DE, Eisenman J, Ander- son DM, Cosman D, Bedell MA, Jenkins NA, Copeland NG: Steel-

dickie mutation encodes a c-kit ligand lacking transmembrane and cytoplasmic domains. Proc Natl Acad Sci USA 88:467 I , 199 1

21. Adachi S, Ebi Y, Nishikawa S, Hayashi S, Yamazaki M, Kasugai T, Yamamura T, Nomura S, Kitamura Y: Necessity of extracellular domain of W (c-kit) receptors for attachment of murine cultured mast cells to fibroblasts. Blood 79:650, 1992

22. Kaneko Y, Takenawa J, Yoshida 0, Fujita K, Sugimoto K, Nakayama H, Fujita J: Adhesion of mouse mast cells to fibroblasts: adverse effects of Steel (SI) mutation. J Cell Physiol 147:224, 1991

23. Segal GM, McCall E, Bagby GC: Erythroid burst-promoting activity produced by interleukin 1 -stimulated endothelial cells is granulocyte-macrophage colony-stimulating factor. Blood 72: 1364, 1988

24. Zsebo KM, Yuschenkoff VN, Schiffer S, Chang D, McCall E, Dinarello CA, Brown MA, Altrock B, Bagby GC: Vascular endothelial cells and granulopoiesis: Interleukin 1 stimulates release of G-CSF and GM-CSF. Blood 71:99, 1988

25. Bagby GC, Jr, Heinrich MC: Vascular endothelial cells and hematopoiesis: Regulation of gene expression in human vascular endothelial cells. Hematol Pathol 5:93, 1991

26. Bevilacqua MP, Stengelin S, Gimbrone MA, Seed B: Endo- thelial leukocyte adhesion molecule 1: An inducible receptor for neutrophils related to complement regulatory proteins and lectins. Science 243: 1160, 1989

27. Segal GM, Smith TD, Heinrich MC, Ey FS, Bagby GC Jr: Specific repression of granulocyte-macrophage and granulocyte colony-stimulating factor gene expression in Interleukin- 1 stimulated endothelial cells with antisense oligodeoxynucleotides. Blood 80:609, 1992

28. Dustin ML, Springer TA: Lymphocyte function-associated antigen- 1 (LFA- 1) interaction with intercellular adhesion molecule-1 (ICAM-I) is one of at least three mechanisms for lymphocyte adhesion to cultured endothelial cells. J Cell Biol 107:321, 1988

29. Pober JS, Lapierre LA, Stolpen AH, Brock TA, Springer TA, Fiers W, Bevilacqua MP, Mendrick DL, Gimbrone MA: Activation of cultured human endothelial cells by recombinant lymphotoxin: comparison with tumor necrosis factor and interleukin 1 species. J Immunol 138:3319, 1987

30. Ozato K, Mayer N, Sachs DH: Hybridoma cell lines secret- ing monoclonal antibodies to mouse H-2 and Ia antigens. J Im- munol 124:533, 1980

3 1. Bevilacqua M, Butcher E, Furie Barbara, Furie Bruce, Galla- tin M, Gimbrone M, Harlan J, Kishimoto K, Lasky L, McEver R, Paulson J, Rosen S, Seed B, Siegelman M, Springer T, Stoolman L, Tedder T, Varki A, Wagner D, Weissman I, Zimmerman G: Selec- tins: A family of adhesion receptors. Cell 67:233, 1991

32. Tso JY, Sun XH, Kao TH, Reece KS, Wu R: Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: Genomic complexity and molecular evolution of the gene. Nucleic Acids Res 13:2485, 1985

33. Gunning P, Ponte P, Okayama H, Engel J, Blau H, Kedes L Isolation and characterization of full length cDNA clones for human a-, b-, and gamma-actin mRNAs: Skeletal but not cytoplasmic actins have an amino-terminal cysteine that is subsequently removed. Mol Cell Biol 3:787, 1983

34. Erba HP, Gunning P, Kedes L: Nucleotide sequence of the human gamma cytoskeletal actin mRNA: Anomalous evolution of vertebrate non-muscle actin genes. Nucleic Acids Res 145275, 1986

35. Hoatlin ME, Kozak SL, Lilly F, Chakraborti A, Kozak CA, Kabat D: Activation of erythropoietin receptors by Friend viral gp55 and by erythropoietin and down modulation by the murine Fv-2' resistance gene. Proc Natl Acad Sci USA 87:9985, 1990

36. Bestwick RK, Kozak SL, Kabat D: Overcoming interference




782 HEINRICH ET AL

to retroviral superinfection results in amplified expression and transmission of cloned genes. Proc Natl Acad Sci USA 85:5404, I988

37. Shipley GD, Keeble WW, Hendrickson JE, Coffey RJ, Jr. Pittelkow M R Growth of normal human keratinocytes and fibroblasts in serum-free medium is stimulated by acidic and basic fibroblast growth factor. J Cell Physiol 138:5 1 1 , 1989

38. Greenberg SM, Rosenthal DS, Greeley TA, Tantravahi R, Handin RI: Characterization of a new megakaryocytic cell line: The Dami cell. Blood 72:1968, 1988

39. Mann R, Mulligan RC, Baltimore D: Construction ofa retrovirus packaging mutant and its use to produce helper-free defective retrovirus. Cell 33:153, 1983

40. Miller AD, Law M-F, Verma IM: Generation of helper-free amphotropic retroviruses that transduce a dominant-actin, meth- othrexate-resistant dihydrofolate reductase gene. Mol Cell Biol 5:431, 1985

41. Gootenberg JE, Ruscetti FW, Mier JW, Gazdar A, Gallo RC: Human cutaneous T cell lymphoma and leukemia cell lines produce and respond to T cell growth factor. J Exp Med 154: 1403, 1981

42. Meagher RC, Salvado AJ, Wright DG: An analysis of the multilineage production of human hematopoietic progenitors in long-term bone marrow culture: evidence that reactive oxygen in- termediates derived from mature phagocytic cells have a role in limiting progenitor cell self-renewal. Blood 72:273, 1988

43. Dooley DC, Law P: Detection and quantitation of long-term culture-initiating cells in normal human peripheral blood. Exp He- matol20:156, 1992

44. Kozak SL, Kabat D: Ping-pong amplification of a retroviral vector achieves high-level gene expression: Human growth hormone production. J Virol64:3500, 1992

45. Cathala G, Savouret JF, Mendez B, West BL, Karin M, Mar- tial JA, Baxter J D A method for isolation of intact, translationally active ribonucleic acid. DNA 2:329, 1983

46. Kawasaki ES: Amplification of RNA, in Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds): PCR Protocols. A Guide to Meth- ods and Applications, San Diego, CA, Academic, 1990, p 2 I

47. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487, 1988

48. Torelli G, Marasca R, Luppi M, Selleri L, Ferrari S, Narni F, Maiano MT, Federico M, Ceccherini-Nelli L, Bendineli M, Mon- tagnani G, Montorsi M, Artusi T: Human herpesvirus-6 in human lymphomas: Identification of sequences in Hodgkin's lymphomas by polymerase chain reaction. Blood 77:2251, 1991

49. Treisman R: Transient accumulation of c-fos RNA following serum stimulation requires a conserved 5' element and c-fos 3' sequences. Cell 42:889, 1985

50. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 745463, 1977

5 1. Reith AD, Ellis C, Lyman SD, Anderson DM, Williams DE, Bernstein A, Pawson T: Signal transduction by normal isoforms and W mutant variants of the kit receptor tyrosine kinase. EMBO J 10:2451, 1991

52. Segal GM, McCall E, Stueve T. Bagby GC: Interleukin I stimulates endothelial cells to release multilineage human colony- stimulating activity. J Immunol 138:1772, 1987

53. Sironi MF, Brevario F, Proserpio P, Biondi A, Vecchi A, Damme JV, Dejana E, Mantovani A: IL- I stimulates IL-6 production in endothelial cells. J Immunol 142:549, 1989

54. Lee M, Segal GM, Bagby GC: Interleukin-I induces human

bone marrow-derived fibroblasts to produce multilineage hematopoietic growth factors. Exp Hematol 15:983, 1987

55. Broudy VC, Kaushansky K, Harlan JM, Adamson JW: In- terleukin 1 stimulates human endothelial cells to produce granulocyte-macrophage colony-stimulating factor and granulocyte colony-stimulating factor. J Immunol 139:464, 1987

56. Koeffler HP, Gasson J, Tobler A: Transcriptional and post- transcriptional modulation of myeloid colony-stimulating factor expression by tumor necrosis factor and other agents. Mol Cell Biol 8:3432, 1988

57. Weiss R: Genetics of retroviruses, in Weiss R, Teich N, Var- mus H, Coffin J (eds): RNA Tumor Viruses. New York, NY, Cold Spring Harbor, 1982, p 209

58. Weiss R: Retrovirus receptors and their genetics, in Lonberg- Holm K, Philipson L (eds): Virus Receptors, Part 2: Animal Vi- ruses. London, UK, Chapman & Hall, 198 1, p 187

59. Li J-P, DAndrea AD, Lodish HF, Baltimore D: Activation of cell growth by binding of Friend spleen focus-forming virus gp55 glycoprotein to the erythropoietin receptor. Nature 343:762, 1990

60. Warner SJ, Auger KR, Libby P: Interleukin 1 induces interleukin 1.11. Recombinant human interleukin I induces interleukin 1 production by adult human vascular endothelial cells. J Immunol 139:1911, 1987

61. Loppnow H, Libby P: Adult human vascular endothelial cells express the IL6 gene differentially in response to LPS or ILl . Cell Immunol 122:493, 1989

62. Strieter RM, Kunkel SL, Showell HJ, Remick DG, Phan SH, Ward PA, Marks RM: Endothelial cell gene expression of a neutrophil chemotactic factor by TNF-alpha, LPS, and IL-16. Science 243:1467, 1989

63. Matsushima K, Morishita K, Yoshimura T, Lavu S, Kobayashi Y, Lew W, Appella E, Kung H, Leonard EJ, Oppenheim JJ: Molecular cloning of a human monocyte-derived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by interleukin 1 and tumor necrosis factor. J Exp Med 167:1883, 1988

64. Bagby GC, Shaw G, Heinricb MC, Hefeneider S, Brown MA, DeLoughery TG, Segal GM, Band L: Interleukin-I stimulation stabilizes GM-CSF mRNA in human vascular endothelial cells: preliminary studies on the role of the 3' AU rich motif. Prog Clin Biol Res 352:233, 1990

65. Fibbe WE, Daha MR, Hiemstra PS, Duinkerken N, Lurvink E, Ralph P, Altrock BW, Kaushansky K, Willemze R, Falkenburg JH: Interleukin 1 and poly(r1)' poly(rC) induce production ofgran- ulocyte CSF, macrophage CSF, and granulocyte macrophage CSF by human endothelial cells. Exp Hematol 17:229, 1989

66. Masinovsky B, Urdal D, Gallatin WM: IL-4 acts synergisti- cally with IL-10 to promote lymphocyte adhesion to microvascular endothelium by induction of vascular cell adhesion molecule- 1. J lmmunol 145:2886, 1990

67. Rice GE, Munro JM, Bevilacqua M P Inducible cell adhesion molecule 1 10 (INCAM-1 IO) is an endothelial receptor for lym- phocytes. A CDI I/CDl8 independent adhesion mechanism. J Exp Med 171:1369, 1990

68. Kyan Aung U, Haskard DO, Poston RN, Thornhill MH, Lee TH: Endothelial leukocyte adhesion molecule- 1 and intercellular adhesion molecule-l mediate the adhesion of eosinophils to endothelial cells in vitro and are expressed by endothelium in allergic cutaneous inflammation in vivo. J Immunol 146:521, 1991

69. Tsuji K, Zsebo KM, Ogawa M: Enhancement of murine blast cell colony formation in culture by recombinant rat stem cell factor, ligand for c-kit. Blood 78: 1223, 1991

70. Muench MO, Schneider JG, Moore MAS: Interactions among colony-stimulating factors, IL- 1 0, IL-6, and kit-ligand in the





regulation of primitive murine hematopoietic cells. Exp Hematol 20:339, 1992

7 I . Qiu F, Ray P, Brown K, Barker PE, Jhanwar S, Ruddle FH, Besmer P: Primary structure of c-kit: Relationship with CSF-I/ PDGF receptor kinase family-Oncogenic activation of v-kit in- volves deletion of extracellular domain and C terminus. EMBO J 7:1003, 1988

72. Ralph P, Sampson Johannes A: Macrophage growth and stimulating factor, M-CSF. Prog Clin Biol Res 338:43, 1990

73. Dubreuil P, Forrester L, Rottapel R, Reedijk M, Fujita J, Bernstein A: The c-fms gene complements the mitogenic defect in mast cells derived from mutant W mice but not mi (microphthal- mia) mice. Proc Natl Acad Sci USA 88:234 I , 199 1

74. Bazan JF: Genetic and structural homology of stem cell factor and macrophage colony-stimulating factor. Cell 65:9, 199 I

75. Cerretti D, Wignall J, Anderson D, Tushinski RJ, Gallis BM, Stya M, Gillis S, Urdal DL, Cosman D: Human macrophage-colony stimulating factor: Alternative RNA and protein processing from a single gene. Mol Immunol25:761, 1988

76. Cerretti DP, Wignall J, Anderson D, Tushinski RJ, Gallis B, Cosman D Membrane bound forms of human macrophage colony stimulating factor (M-CSF, CSF-I). Prog Clin Biol Res 352:63, 1990

77. Rettenmier CW, Roussel MF: Differential processing of colony-stimulating factor I precursors encoded by two human cDNAs. Mol Cell Biol 85026, 1988

78. Stein J, Borzillo GV, Rettenmier CW: Direct stimulation of cells expressing receptors for macrophage colony-stimulating factor (CSF- 1) by a plasma membrane-bound precursor of human CSF- 1. Blood 76: 1308, 1990

79. Stein J, Rettenmier CW: Proteolytic processing of a plasma membrane-bound precursor to human macrophage colony-stimulating factor (CSF-1) is accelerated by phorbol ester. Oncogene 6:601, 1991

80. Gilliland G, Pemn S, Blanchard K, Bunn H F Analysis of cytokine mRNA and DNA: Detection and quantitation by competitive polymerase chain reaction. Proc Natl Acad Sci USA 87:2725, 1990

8 I . Wang AM, Doyle MV, Mark D F Quantitation of mRNA by the polymerase chain reaction. Proc Natl Acad Sci USA 86:9717, 1989

82. Porcher C, Malinge M-C, Picat C, Grandchamp B: A simpli- fied method for the determination of specific DNA or RNA copy number using quantitative PCR and an automatic DNA sequencer. Biotechniques 13: 106, 1992

83. Huang SZ, Rodgers GP, Zeng YT, Schechter AN: Diagnosis of thalassemia using cDNA amplification of circulating erythroid cell mRNA with the polymerase chain reaction. Blood 78:2433, 1991

84. Hibi K, Takahashi T, Sekido Y , Ueda R, Hida T, Ariyoshi Y, Takagi H: Coexpression ofthe stem cell factor and the c-kit genes in small-cell lung cancer. Oncogene 6:229 I , 199 1

85. Ladner NB, Martin GA, Noble JA, Nikoloff DM, Tal R, Kawasaki ES, White TJ: Human CSF- I : Gene structure and alternative splicing of mRNA precursors. EMBO J 6:2693, 1987

86. Aye MT, Hashemi S, Leclair B, Zeibdawi A, Trudel E, Hal- penny M, Fuller V, Cheng G: Expression of stem cell factor and c-kit mRNA in cultured endothelial cells, monocytes and cloned human bone marrow stromal cells (CFU-RF). Exp Hematol 20523, 1992

87. Pober JS, Lapierre LA, Stolpen AH, Brock TA, Springer TA, Fiers W, Bevilacqua MP, Mendrick DL, Gimbrone MA, Jr: Activa- tion of cultured human endothelial cells by recombinant lymphotoxin: Comparison with tumor necrosis factor and interleukin 1 species. J Immunol 138:3319, 1987

88. Pober JS: Effects of tumour necrosis factor and related cytokines on vascular endothelial cells. Ciba Found Symp 13 1 : 170, 1987

89. Collins T, Williams A, Johnston GI, Kim J, Eddy R, Shows T, Gimbrone MA, Bevilacqua MP: Structure and chromosomal location of the gene for endothelial leukocyte adhesion molecule 1. J Biol Chem 266:2466, 199 1

90. Ercolani L, Florence B, Denaro M, Alexander M: Isolation and complete sequence of a functional human glyceraldehyde-3-phosphate dehydrogenase gene. J Biol Chem 263: 15335, 1988




1993 82: 771-783

Ey and D KabatMC Heinrich, DC Dooley, AC Freed, L Band, ME Hoatlin, WW Keeble, ST Peters, KV Silvey, FS Constitutive expression of steel factor gene by human stromal cells

http://www.bloodjournal.org/content/82/3/771.full.htmlUpdated information and services can be found at:

Articles on similar topics can be found in the following Blood collections

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

Copyright 2011 by The American Society of Hematology; all rights reserved.Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American


http://www.bloodjournal.org/content/82/3/771.full.html

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

http://www.bloodjournal.org/site/subscriptions/index.xhtml





Documents

Constitutive Expression of Steel Factor Gene by Human Stromal