All lecture materials are produced by the academic staff in the Department of Applied Biology and Chemical Technology of The Hong Kong Polytechnic University for the EMB (Education and Manpower Bureau). They are restricted for educational and non-profit uses only. PTeC (PolyU Technology and Consultancy Company Limited) and EMB jointly own the copyright of all the materials developed, except those under licences and/or there is a pre-existing copyright of the third parties. Both parties shall have an unrestricted, nonexclusive and perpetual right to use the materials without consent from the other party.

Professional Development Courses for Teachers onProfessional Development Courses for Teachers onNSS: Enriching Knowledge for the Biology CurriculumNSS: Enriching Knowledge for the Biology Curriculum

Biotechnology in Forensic ScienceBiotechnology in Forensic Science

Dr Larry ChowDr Larry Chow

Associate Prof.Associate Prof.Dept. of Applied Biology & Chemical TechnologyDept. of Applied Biology & Chemical Technology

Hong Kong Polytechnic UniversityHong Kong Polytechnic University

Degree programme taught: Degree programme taught: B.Sc. (Hons.) in Applied Biology with BiotechnologyB.Sc. (Hons.) in Applied Biology with Biotechnology

DNA fingerprinting in new curriculumDNA fingerprinting in new curriculum

……be aware that societal needs have led to technological advances (e.g. be aware that societal needs have led to technological advances (e.g. DNA DNA fingerprintingfingerprinting (p.24) (p.24)

Students should learn… Students should learn… DNA fingerprintingDNA fingerprinting and students should be able to and students should be able to ….recognize the applications …….recognize the applications …DNA fingerprintingDNA fingerprinting (p. 25) (p. 25)

Use AV materials to illustrate the processes of Use AV materials to illustrate the processes of DNA fingerprintingDNA fingerprinting (p.27) (p.27) Molecular genetics :search for information on the use of Molecular genetics :search for information on the use of DNA fingerprintingDNA fingerprinting in in

forensic science (p.27)forensic science (p.27) Scientific inquiry: analyze and draw conclusions from data (e.g. Scientific inquiry: analyze and draw conclusions from data (e.g. DNA DNA

fingerprintingfingerprinting) (p.27)) (p.27) Appreciate the contributions of various people in biotechnology (e.g……. Alec Appreciate the contributions of various people in biotechnology (e.g……. Alec

Jeffreys – development of Jeffreys – development of DNA fingerprintingDNA fingerprinting) (p.58)) (p.58) Techniques in modern biotechnology (p.59)Techniques in modern biotechnology (p.59)

students should learn…. students should learn…. DNA fingerprintingDNA fingerprinting and its application…. and its application…. Students should be able to…outline the principles of …Students should be able to…outline the principles of …DNA fingerprintingDNA fingerprinting

Suggested learning and teaching activities (p.60)Suggested learning and teaching activities (p.60) Use diagrams, AV or animations to illustrate the processes of …. Use diagrams, AV or animations to illustrate the processes of …. DNA fingerprintingDNA fingerprinting Read articles about the contributions of scientists which have lead to the Read articles about the contributions of scientists which have lead to the

development in genetic engineering (e.g…Alec Jeffreys)development in genetic engineering (e.g…Alec Jeffreys)

In short …In short …

Alec JeffreyAlec Jeffrey Inventor of DNA fingerprintingInventor of DNA fingerprinting

PrinciplesPrinciples Use diagrams or AV to illustrate principleUse diagrams or AV to illustrate principle Analyze resultsAnalyze results Societal needsSocietal needs

DNA fingerprintingDNA fingerprinting

PrinciplesPrinciples Restriction Fragment Length Polymorphism (RFLP)Restriction Fragment Length Polymorphism (RFLP) Multiplex PCRMultiplex PCR

TechniquesTechniques Southern blotSouthern blot PCRPCR Capillary ElectrophoresisCapillary Electrophoresis

Population geneticsPopulation genetics ApplicationsApplications

Alec JeffreysAlec Jeffreys

Molecular geneticistMolecular geneticist Inventor of DNA fingerprintingInventor of DNA fingerprinting Department of GeneticsDepartment of Genetics

University of LeicesterUniversity of LeicesterUKUK

Original papersOriginal papers Jeffreys AJ, Wilson V and Thein SL Jeffreys AJ, Wilson V and Thein SL

(1985) “Hypervariable ‘mini-satellite’ (1985) “Hypervariable ‘mini-satellite’ regions in human DNA” regions in human DNA” Nature Nature 314, 314, 67-7367-73

Jeffreys AJ, Wilson V and Thein SL Jeffreys AJ, Wilson V and Thein SL (1985) “Individual specific (1985) “Individual specific fingerprints of human DNA” fingerprints of human DNA” Nature Nature 316, 76-79316, 76-79

HistoryHistory

PrematureRNA

Exon Exon ExonIntron Intron

Splicing

MaturemRNA

DNA

Transcription

Myoglobin gene

Repetitive sequence within intronRepetitive sequence within intron

ShortShort repeatedrepeated DNA sequence within intron DNA sequence within intron Present in different chromosomal locationsPresent in different chromosomal locations Unknown functionsUnknown functions Polymorphism of repeat lengths among individuals Polymorphism of repeat lengths among individuals

arises from unequal pairing and crossing over between arises from unequal pairing and crossing over between repeatsrepeats

Simple tandem-repetitive regions of DNA (or 'minisatellites')

Exon Exon ExonIntron Intron

Origin of tandem repeats by unequal Origin of tandem repeats by unequal pairing and crossing overpairing and crossing over

http://www.informatics.jax.org/silver/images/figure8-4.gif

Length variation can be generated at tandem repeat loci by unequal pairing and crossing over. This Figure illustrates the general principle behind the generation of DNA variation at tandem repeat loci such as minisatellites and microsatellites. Individual repeat units are represented by boxes. The flanking sites "X" and "Y" allow detection of length variation at the locus, and correspond to nearest flanking restriction sites in the case of minisatellites or targets for PCR primers in the case of microsatellites.

Mini. versus microcomputerMini. versus microcomputer

Mini is small…………. but micro is smaller

Mini. versus microsatelliteMini. versus microsatellite

No. of repeats varies among individualsNo. of repeats varies among individuals VNTR (VNTR (VVariable ariable NNumber of umber of TTandem andem RRepeats)epeats)

Minisatellites Minisatellites MicrosatellitesMicrosatellites

MinisatellitesMinisatellites Repeat unit length – 6-100 basesRepeat unit length – 6-100 bases Two to several hundred repeats at each minisatellite Two to several hundred repeats at each minisatellite Thousands of different minisatellites scattered throughout the Thousands of different minisatellites scattered throughout the

genome, but often clustered near the end of the chromosomes – genome, but often clustered near the end of the chromosomes – the telomeres the telomeres

MicrosatellitesMicrosatellites Repeat unit length: 1-7 basesRepeat unit length: 1-7 bases 5 to 100 repeats at each microsatellite 5 to 100 repeats at each microsatellite Thousands of different microsatellites, randomly scattered Thousands of different microsatellites, randomly scattered

throughout genome throughout genome

http://www.wellcome.ac.uk/en/genome/genesandbody/hg07f006.html

Example of minisatelliteExample of minisatellite

http://perso.wanadoo.fr/svt.ronsard/svt.ronsard/empreintes/seq1.gif

GTATACACACATATACATATATATRepeats of

Example of minisatelliteExample of minisatellite

http://www.bioinfo.rpi.edu/~bystrc/courses/biol4540/lecture24/img006.jpg

Imperfect tandem repeat of AGGATTTT

Examples of microsatelliteExamples of microsatellite

CACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACA (CA)(CA)2424

AATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATG (AATG)(AATG)2828

Minisatellites in ONE personMinisatellites in ONE person

Similar yet different among minisatellitesSimilar yet different among minisatellites DNA SequenceDNA Sequence Length of repeatsLength of repeats

Similar minisatellites, but different length of repeats

Different minisatellites: different DNA sequence

Minisatellites in DIFFERENT individualsMinisatellites in DIFFERENT individuals

Repeat Repeat lengthlength

1010 1010 3030 1212 1010 4040

Repeat Repeat typetype

AA BB CC DD CC BB

Repeat Repeat lengthlength

1010 3232 1515 1212 1818 2020

What is DNA fingerprinting?What is DNA fingerprinting?

Genetic profilingGenetic profiling A scientific testing process allowing positive identification A scientific testing process allowing positive identification

between individual DNAbetween individual DNA Alec Jeffreys discovered that minisatellite repetitive DNA Alec Jeffreys discovered that minisatellite repetitive DNA

sequences among individuals are: sequences among individuals are: Highly polymorphicHighly polymorphic

Different repeat lengths among individualsDifferent repeat lengths among individuals Stable within the lifetimeStable within the lifetime Inheritable to offspringsInheritable to offsprings Measurable by common techniquesMeasurable by common techniques

VNTR may be used as a barcode for individualsVNTR may be used as a barcode for individuals Restriction Fragment Length Polymorphism (RFLP)Restriction Fragment Length Polymorphism (RFLP)

DNA fingerprintingDNA fingerprinting

A technique for providing profiles of DNA fragments A technique for providing profiles of DNA fragments (resulting from digestion with restriction enzymes) that (resulting from digestion with restriction enzymes) that characterize a genome.characterize a genome.

The genome is scattered with minisatellites, regions of The genome is scattered with minisatellites, regions of DNA consisting of tandem repeats of short base sequence DNA consisting of tandem repeats of short base sequence which can show extensive variation in the number of which can show extensive variation in the number of repeats, leading to multi-allelic variation and high degrees repeats, leading to multi-allelic variation and high degrees of heterozygosity. The extreme level of variation renders of heterozygosity. The extreme level of variation renders minisatellite or VNTR loci invaluable as genetic markers.minisatellite or VNTR loci invaluable as genetic markers.

The use of the polymerase chain reaction (PCR) to amplify The use of the polymerase chain reaction (PCR) to amplify hypervariable loci, including very short tandem-repetitive hypervariable loci, including very short tandem-repetitive microsatellites, has greatly increased the sensitivity of DNA microsatellites, has greatly increased the sensitivity of DNA typing systems and the ability to type degraded human typing systems and the ability to type degraded human DNA.DNA.

Oxford dictionary of biochemistry & molecular biology

Restriction Fragment Length Polymorphism (RFLP)Restriction Fragment Length Polymorphism (RFLP)

Type II Restriction enzyme or restriction Type II Restriction enzyme or restriction endonucleaseendonuclease A group of enzymes, produced by bacteria, that A group of enzymes, produced by bacteria, that

cleave molecules of DNA internally at specific cleave molecules of DNA internally at specific base sequencebase sequence

EcoEcoRI restriction enzymeRI restriction enzyme

5’ GAATTC 3’3’ CTTAAG 5’

↓

↑

5’ G AATTC 3’3’ CTTAA G 5’

RFLPRFLP

EcoRI EcoRI

EcoRI EcoRI

Longer restriction fragment length

Shorter restriction fragment length

Detection of restriction fragment length

by Southern blot

Note: Restrictions enzymes may be located within the VNTR, thereby giving multiple bands

Southern blotSouthern blot

http://fig.cox.miami.edu/~cmallery/150/gene/20southernblot.gif

Southern blotSouthern blot

A procedure for transferring denatured DNA from an A procedure for transferring denatured DNA from an agarose gel to a solid support membrane such as agarose gel to a solid support membrane such as nitrocellulose or nylon. ….the gel is overlaid with a sheet of nitrocellulose or nylon. ….the gel is overlaid with a sheet of nitrocellulose paper, which in turn is covered by a thick nitrocellulose paper, which in turn is covered by a thick layer of paper towels and… compressed by heavy weight. layer of paper towels and… compressed by heavy weight.

The liquid in the gel is forced (blotted) through the The liquid in the gel is forced (blotted) through the nitrocellulose so that the single-stranded DNA binds to it at nitrocellulose so that the single-stranded DNA binds to it at the same position it had in the gel….. the same position it had in the gel…..

DNA bands may be located using a radioactive…probeDNA bands may be located using a radioactive…probe

A probe is a short radiolabeled DNA with the A probe is a short radiolabeled DNA with the complementary DNA sequence of interestcomplementary DNA sequence of interest

Oxford dictionary of biochemistry & molecular biology

The first DNA fingerprintThe first DNA fingerprint

On a Monday morning in On a Monday morning in September 1984, the September 1984, the X-ray of the blot was dX-ray of the blot was developed in the Leicesteveloped in the Leicester University darkroom.er University darkroom. “I took one look, thoug “I took one look, thought ‘what a complicated ht ‘what a complicated mess’, then suddenly rmess’, then suddenly realized we had patternealized we had patterns,” says Professor Jeffrs,” says Professor Jeffreys. eys.

http://www.wellcome.ac.uk/en/genome/genesandbody/hg07f005.html

??? Patterns !!!!

Multi-loci probe vs. single locus probeMulti-loci probe vs. single locus probe

‘B’ probe ‘A’ probe

4032

10

‘A’ probe is a single locus probe because its DNA sequence only recognize one specific minisatellite

‘B’ probe is a multi-loci probe because its DNA sequence only recognize multiple minisatellites

20

Use of RFLP in parentageUse of RFLP in parentage

Matching of DNA Matching of DNA fingerprints with fingerprints with parentsparents

Actual RFLP result isActual RFLP result isNOT colored coded.NOT colored coded.They all look the same They all look the same in the Southern blotin the Southern blot

Parentage information Parentage information is from the bands’ is from the bands’ size/positionsize/position

http://www.bioteach.ubc.ca/MolecularBiology/DNAfingerprint/

Biological

daughter

Biological

sonD

aughter fromP

revious m

arriage

Adopted

son

Use of RFLP in criminal investigationUse of RFLP in criminal investigation

Matching of DNA Matching of DNA obtained fromobtained from Crime sceneCrime scene SuspectsSuspects

Victi

m

Suspect

A Suspect

B Sperm

D

NA

From crime scene

Note:1. Multiple minisatellites will be used in

actual criminal investigation to increase accuracy

2. Crime scene DNA is often degraded and it may affects the accuracy of RFLP-based DNA fingerprinting• Restriction fragment too large• Sensitive to DNA degradation• Solved by PCR-based DNA

fingerprinting

2 types of DNA fingerprinting2 types of DNA fingerprinting RFLP-basedRFLP-based

Original method developed by Alec JeffreysOriginal method developed by Alec Jeffreys MinisatelliteMinisatellite length polymorphism detected by RFLP length polymorphism detected by RFLP

Banding patternBanding pattern Involves Involves Southern blotSouthern blot Multiple steps; time consumingMultiple steps; time consuming Difficult to automateDifficult to automate Degradation of DNA may interfere fingerprint patternDegradation of DNA may interfere fingerprint pattern Requires relatively more DNARequires relatively more DNA

PCR-basedPCR-based MicrosatelliteMicrosatellite length polymorphism detected by length polymorphism detected by PCR product sizePCR product size Fewer steps; quickFewer steps; quick Automated PCR and capillary electrophoresisAutomated PCR and capillary electrophoresis Less interfered by DNA degradationLess interfered by DNA degradation Requires less DNARequires less DNA Standard methods in crime labs including Hong Kong Government Standard methods in crime labs including Hong Kong Government

LaboratoryLaboratory

Southern blot1. Restriction enzyme digestion2. Agarose gel electrophoresis3. Transfer DNA onto membrane4. Hybridized with probe

RFLP

RestrictionEnzyme site 1. PCR amplify using flanking

fluorescent primers

2. Capillary electrophoresis

RFLP-based DNA fingerprinting

PCR-based DNA fingerprinting

PCR product of different sizes

Fluorescent peaks of different mobility

Radioactive bandsof different mobility

Principle of PCR

Short Tandem Repeats (STR)Short Tandem Repeats (STR)

Each individual’s repeats is polymorphic in lengthEach individual’s repeats is polymorphic in length For example:For example:

25 %25 % of population have 56 repeats in an STR of population have 56 repeats in an STR 50 % have 58 repeats50 % have 58 repeats 25 % have 60 repeats25 % have 60 repeats

Repeats can be 2 – 7 bpRepeats can be 2 – 7 bp Repeat length at different STRs used as fingerprintRepeat length at different STRs used as fingerprint Each STR is flanked at 5’ and 3’ ends with Each STR is flanked at 5’ and 3’ ends with commoncommon

DNA sequence:DNA sequence: Can be used to design PCR primers to amplify the STRCan be used to design PCR primers to amplify the STR UniversalUniversal: can be used to amplify DNA from any individual: can be used to amplify DNA from any individual

Length of STR in different individualsLength of STR in different individuals

PCR product

221 bp

(AATG)45

A

A (45 X 4) + 2 X 20 + 1

(AATG)42

209 bp

(42 X 4) +2 X 20 + 1

A

A

A : Template-independent addition of 3’ “A” by Taq DNA polymerase

20 nt 20 nt

20 nt 20 nt

Primer A

Primer A

Primer B

Primer B

Multiplex PCRMultiplex PCR

Multiple STRs amplified simultaneously to create the Multiple STRs amplified simultaneously to create the DNA fingerprintDNA fingerprint 9 PCR reactions (18 primers) in a single tube9 PCR reactions (18 primers) in a single tube

Each PCR primer pair is labeled with different Each PCR primer pair is labeled with different fluorophoresfluorophores

Not enough fluorophoresNot enough fluorophores Use 3 to 4 fluorophores onlyUse 3 to 4 fluorophores only

5 FAM, JOE, NED, ROX5 FAM, JOE, NED, ROX Each PCR products using the same fluorophore will be of Each PCR products using the same fluorophore will be of

different size range different size range can be differentiated from each other even though they use the can be differentiated from each other even though they use the

same fluorophoresame fluorophore PCR products are then analyzed by capillary PCR products are then analyzed by capillary

electrophoresiselectrophoresis

Locus Designation

Chromosome location

Common sequence motifSize range (bp)

Dye label

D3S1358 3p TCTA(TCTG)1-3(TCTA)n 114-142 5-FAM

vWA 12p12-pter TCTA(TCTG)3-4(TCTA)n 157-197 5-FAM

FGA 4q28 (TTTC)3TTTTTTCT(CTTT)nCTCC(TTCC)2 219-267 5-FAM

AmelogeninX: p22.1-22.3

- 107,113 JOEY:p11.2

TH01 11p15.5 (AATG)n 169-189 JOE

TPOX 2p23-2per (AATG)n 218-242 JOE

CSF1PO 5q33.3-34 (AGAT)n 281-317 JOE

D5S818 5q21-31 (AGAT)n 135-171 NED

D13S317 13q22-31 (GATA)n 206-234 NED

D7S820 7q (GATA)n 258-294 NED

9 STRs used9 STRs used

Cathode

Sample

Capillary tubing

+

Capillary electrophoresisCapillary electrophoresis

Analysispoint

Addition of sampleMovement of DNA

•Glass capillary •Liquid polymer inside capillary•Separation based on molecular weight

Fluorescencedetector

Small DNA migrates faster

http://www.ceandcec.com/

Capillary electrophoresisCapillary electrophoresis

Uses narrow-bore (10–100 Uses narrow-bore (10–100 m) fused-silica capillariesm) fused-silica capillaries Low sample volume required Low sample volume required

High surface to volume ratio High surface to volume ratio ↑ ↑ heat dissipationheat dissipation ↓ ↓ joule heatingjoule heating allows the use of very high electric fields (100–500 V cmallows the use of very high electric fields (100–500 V cm−1−1) with negligible ) with negligible

heat generationheat generation Speed of data acquisitionSpeed of data acquisition

Glass capillary allows detection of fluorescently labeled DNAGlass capillary allows detection of fluorescently labeled DNA Laser light through capillaryLaser light through capillary Automated real time data collectionAutomated real time data collection

Applied Biosystems ABI310 single capillary electrophoresisApplied Biosystems ABI310 single capillary electrophoresis Automatic DNA sequencingAutomatic DNA sequencing DNA fingerprintingDNA fingerprinting Popular equipment for medium throughput applicationsPopular equipment for medium throughput applications

Each peak refers to the a fluorescently labeled DNA passing through detector

Larger PCR product size

A

B

X, Y

X X

15,16

15, 18

11,11

11, 13

7, 9.3

7, 9

14, 16

17, 19

11,11

11,11

8,8

8, 9

24, 26

23,24

7, 12

9, 10

11,12

10, 12

1. Each number refersto number of repeats insuch STR allele

2. Human is diploid (2n)2 alleles per STR

Capillary electrophoresisresults

X chromosome: amylogenin gene PCR product = 107 bp

Y-chromosome: amylogenin-like gene PCR product = 113 bp

AlleleSample A

(Male)Sample B (Female)

Amelogenin X,Y X,X

D3S1358 15,16 15,18

D5S818 11,11 11,13

TH01 7, 9.3 7, 9

vWA 14, 16 17, 19

D13S317 11, 11 11, 11

TOPX 8, 8 8, 9

FGA 24, 26 23, 24

D7S820 7, 12 9,10

CSF1PO 11, 12 10, 12

To exclude identity is easy, to prove is difficultTo exclude identity is easy, to prove is difficult

To interpret the significance of a match between genetically typed To interpret the significance of a match between genetically typed samples, it is necessary to know the population distribution of samples, it is necessary to know the population distribution of alleles at each locus in question. alleles at each locus in question.

If the genotype of the relevant evidence sample is different from If the genotype of the relevant evidence sample is different from the genotype of the suspect’s reference sample, then the suspect the genotype of the suspect’s reference sample, then the suspect is “excluded” as the donor of the biological evidence tested. is “excluded” as the donor of the biological evidence tested.

An exclusion is independent of the frequency of the two An exclusion is independent of the frequency of the two genotypes in the population.genotypes in the population.If the suspect and evidence samples have the same genotype, If the suspect and evidence samples have the same genotype, then the suspect is “included” as a possible source of the then the suspect is “included” as a possible source of the evidence sample. The probability that another, unrelated, evidence sample. The probability that another, unrelated, individual would also match the evidence sample is estimated by individual would also match the evidence sample is estimated by the frequency of that genotype in the relevant population(s). Local the frequency of that genotype in the relevant population(s). Local population genotype frequency is needed.population genotype frequency is needed.

Case scenario

For 2 unknown DNA samples from 2 US Caucasians having

Same CSF1PO allele 10,10 &Same D2S1338 allele 19,19

Probability of their identitybeing different is

=24.21% X 24.21% X13.75% X13.75% = 0.111%

Usually 9, 13 or even 15 STRs used

Probability brought down to 1 in a billion

Population geneticsPopulation genetics

Need to know the population geneticsNeed to know the population genetics What is the allelic frequency of each STR for your human What is the allelic frequency of each STR for your human

population?population? Each population is differentEach population is different Government Lab is responsible for collecting the allelic frequency of Government Lab is responsible for collecting the allelic frequency of

each STReach STR What is the chance of the 2 DNA samples, having identical What is the chance of the 2 DNA samples, having identical

STR profiles, yet are coming from two different persons?STR profiles, yet are coming from two different persons? 5 STRs identical (usually 9 or 13 STRs used in forensic studies)5 STRs identical (usually 9 or 13 STRs used in forensic studies) = 1 in= 1 in

0.12 X 0.123 X 0.12 X 0.123 X 0.89 X 0.67 X 0.89 X 0.67 X 0.112 X 0.112 X 0.112 X 0.112 X 0.239 X 0.33 X 0.239 X 0.33 X 0.29 X 0.10.29 X 0.1=1 in 2.525E-6=1 in 2.525E-6

Each pair of numbers refer to thefrequency of the 2 alleles of STR inthe general population.

Hong Kong Government Lab Hong Kong Government Lab 政 府 化 驗 所政 府 化 驗 所

Criminalistics and Quality Management Group Criminalistics and Quality Management Group (( 刑 事 科 學 及 品 質 管 理 科 刑 事 科 學 及 品 質 管 理 科 ) )

Biochemical Sciences Biochemical Sciences 生化 組生化 組 Chemical Sciences Chemical Sciences 化學 組化學 組 DNA Database SectionDNA Database Section DNA DNA 資 料 庫 組資 料 庫 組 Parentage Testing Section Parentage Testing Section 親子 鑑 證 組親子 鑑 證 組 Physical Sciences SectionPhysical Sciences Section 物 理 組物 理 組 Scene of Crime and Quality Management SectionScene of Crime and Quality Management Section

現 場 勘 查 及 品 質 管 理 組現 場 勘 查 及 品 質 管 理 組

http://www.govtlab.gov.hk/

Applications of DNA fingerprintingApplications of DNA fingerprinting

ParentageParentage Criminal investigationCriminal investigation

Matching of suspect DNA with that of crime sceneMatching of suspect DNA with that of crime scene Database of criminals’ DNA fingerprintDatabase of criminals’ DNA fingerprint

Matching of suspect DNA with criminal databaseMatching of suspect DNA with criminal database CODIS (Combined DNA Index system) by FBICODIS (Combined DNA Index system) by FBI http://www.fbi.gov/hq/lab/codis/brochure.pdfhttp://www.fbi.gov/hq/lab/codis/brochure.pdf

Animal pedigree confirmationAnimal pedigree confirmation Check authenticity of pedigrees of dogs, racing horsesCheck authenticity of pedigrees of dogs, racing horses

Diagnosis of inherited disorders Diagnosis of inherited disorders ?Any association between DNA fingerprints with genetic diseases??Any association between DNA fingerprints with genetic diseases?

Identification of dead bodies in natural disasterIdentification of dead bodies in natural disaster

South Asia Tsunami South Asia Tsunami

2004 Dec; >150,000 dead, many unidentified2004 Dec; >150,000 dead, many unidentified China offered the DNA fingerprinting service to identify victims China offered the DNA fingerprinting service to identify victims

for freefor free Direct match with DNA from victims’ DNA (from toothbrush, hairbrush): Direct match with DNA from victims’ DNA (from toothbrush, hairbrush):

relatively easyrelatively easy ? 10 STRs enough? 10 STRs enough

Matching parents with kids : OK (similar to parentage)Matching parents with kids : OK (similar to parentage) Each kid has inherited one copy of the STR from each parentEach kid has inherited one copy of the STR from each parent

Matching siblings: difficultMatching siblings: difficult 1/41/4thth chance siblings have totally different DNA fingerprint at each STR chance siblings have totally different DNA fingerprint at each STR

Matching relatives: very difficultMatching relatives: very difficult More STRs will be neededMore STRs will be needed Need more relatives to reconstruct pedigreeNeed more relatives to reconstruct pedigree

More STRs used, the more accurateMore STRs used, the more accurate Alec Jeffreys suggested to use 15 to 20 STRsAlec Jeffreys suggested to use 15 to 20 STRs

http://www.newscientist.com/article.ns?id=dn6851

Example Example

14, 15 16,18

14, 16 14, 18 15, 16 15, 18

STR D3S1358

Totally different STR patternsImpossible to identify victims by using the sibling ‘s DNA onlyParent’s DNA will help

Victim Victim’s sibling

ReferencesReferences Wikipedia (easy reading for general principles)Wikipedia (easy reading for general principles)

http://en.wikipedia.org/wiki/DNA_fingerprintinghttp://en.wikipedia.org/wiki/DNA_fingerprinting General background (detailed, but easy reading)General background (detailed, but easy reading)

http://science.howstuffworks.com/dna-evidence1.htmhttp://science.howstuffworks.com/dna-evidence1.htm Interview with Alec Jeffreys and brief historyInterview with Alec Jeffreys and brief history

http://www.wellcome.ac.uk/en/genome/genesandbody/hg07f005.htmlhttp://www.wellcome.ac.uk/en/genome/genesandbody/hg07f005.html Interview with Jeff Alec: DNA fingerprinting and societyInterview with Jeff Alec: DNA fingerprinting and society

http://www.wellcome.ac.uk/en/genome/genesandbody/hg07f006.htmlhttp://www.wellcome.ac.uk/en/genome/genesandbody/hg07f006.html CODIS all good ? privacyCODIS all good ? privacy

http://www.unm.edu/~abqteach/multi_disc/01-05-08.htmhttp://www.unm.edu/~abqteach/multi_disc/01-05-08.htm A Brief Tour of DNA fingerprintingA Brief Tour of DNA fingerprinting

http://www.bioteach.ubc.ca/MolecularBiology/DNAfingerprint/http://www.bioteach.ubc.ca/MolecularBiology/DNAfingerprint/ Hong Kong Government LabHong Kong Government Lab

http://www.govtlab.gov.hk/english/home.htmhttp://www.govtlab.gov.hk/english/home.htm National DNA database National DNA database

http://www.wellcome.ac.uk/en/genome/genesandbody/hg07f006.htmlhttp://www.wellcome.ac.uk/en/genome/genesandbody/hg07f006.html

ReferencesReferences CODIS (FBI)CODIS (FBI)

http://www.fbi.gov/hq/lab/codis/index1.htmhttp://www.fbi.gov/hq/lab/codis/index1.htm DNA fingerprinting protocols (very detailed) by Applied Biosystems and population DNA fingerprinting protocols (very detailed) by Applied Biosystems and population

geneticsgenetics http://docs.appliedbiosystems.com/pebiodocs/04323291.pdfhttp://docs.appliedbiosystems.com/pebiodocs/04323291.pdf

Southern blot FlashSouthern blot Flash http://www.pbs.org/wgbh/nova/sheppard/labwave.htmlhttp://www.pbs.org/wgbh/nova/sheppard/labwave.html

PCR principlePCR principle http://www.wellcome.ac.uk/en/genome/technologies/hg17b009.htmlhttp://www.wellcome.ac.uk/en/genome/technologies/hg17b009.html

Courtroom: Useful but perfect? What about contamination of PCR reactions?Courtroom: Useful but perfect? What about contamination of PCR reactions? http://www.pbs.org/wgbh/nova/sheppard/labwave.htmlhttp://www.pbs.org/wgbh/nova/sheppard/labwave.html

Capillary electrophoresis (a lot of technical terms)Capillary electrophoresis (a lot of technical terms) http://www.ceandcec.com/http://www.ceandcec.com/

Matching of Tsunami victims’ DNA (New Scientist)Matching of Tsunami victims’ DNA (New Scientist) http://www.newscientist.com/article.ns?id=dn6851http://www.newscientist.com/article.ns?id=dn6851

Glossary (A-F)Glossary (A-F) BiotechnologyBiotechnology

A set of biological techniques developed through basic research and now applied to research and A set of biological techniques developed through basic research and now applied to research and product development. In particular, biotechnology refers to the use by industry of recombinant DNA, product development. In particular, biotechnology refers to the use by industry of recombinant DNA, cell fusion, and new bioprocessing techniques.cell fusion, and new bioprocessing techniques.

Dinucleotide repeat Dinucleotide repeat A short tandem repeat polymorphism (STRP) consisting of a repeated two base-pair sequence.A short tandem repeat polymorphism (STRP) consisting of a repeated two base-pair sequence.

ElectrophoresisElectrophoresis A method of separating large molecules (such as DNA fragments or proteins) from a mixture of similar A method of separating large molecules (such as DNA fragments or proteins) from a mixture of similar

molecules. An electric current is passed through a medium containing the mixture, and each kind of molecules. An electric current is passed through a medium containing the mixture, and each kind of molecule travels through the medium at a different rate, depending on its electrical charge and size. molecule travels through the medium at a different rate, depending on its electrical charge and size. Agarose and acrylamide gels are the media commonly used for electrophoresis of proteins and nucleic Agarose and acrylamide gels are the media commonly used for electrophoresis of proteins and nucleic acids.acids.

ExonExon The protein-coding DNA sequence of a gene. The protein-coding DNA sequence of a gene.

FingerprintingFingerprinting In genetics, the identification of multiple specific alleles on a person's DNA to produce a unique In genetics, the identification of multiple specific alleles on a person's DNA to produce a unique

identifier for that person. identifier for that person. ForensicsForensics

The use of DNA for identification. Some examples of DNA use are to establish paternity in child support The use of DNA for identification. Some examples of DNA use are to establish paternity in child support cases; establish the presence of a suspect at a crime scene, and identify accident victims.cases; establish the presence of a suspect at a crime scene, and identify accident victims.

http://www.ornl.gov/sci/techresources/Human_Genome/glossary/

GlossaryGlossary (G –M) (G –M) Genetic marker Genetic marker

A gene or other identifiable portion of DNA whose inheritance can be followed. A gene or other identifiable portion of DNA whose inheritance can be followed. HeterozygosityHeterozygosity

The presence of different alleles at one or more loci on homologous chromosomes.The presence of different alleles at one or more loci on homologous chromosomes. HomozygoteHomozygote

An organism that has two identical alleles of a gene.An organism that has two identical alleles of a gene. Homologous recombinationHomologous recombination

Swapping of DNA fragments between paired chromosomes. Swapping of DNA fragments between paired chromosomes. HybridizationHybridization

The process of joining two complementary strands of DNA or one each of DNA and RNA to form a double-stranded The process of joining two complementary strands of DNA or one each of DNA and RNA to form a double-stranded molecule.molecule.

IntronIntron DNA sequence that interrupts the protein-coding sequence of a gene; an intron is transcribed into RNA but is cut out DNA sequence that interrupts the protein-coding sequence of a gene; an intron is transcribed into RNA but is cut out

of the message before it is translated into protein.of the message before it is translated into protein. Locus (pl. loci) Locus (pl. loci)

The position on a chromosome of a gene or other chromosome marker; also, the DNA at that position. The use of The position on a chromosome of a gene or other chromosome marker; also, the DNA at that position. The use of locus is sometimes restricted to mean expressed DNA regions. locus is sometimes restricted to mean expressed DNA regions.

MicrosatelliteMicrosatellite Repetitive stretches of short sequences of DNA used as genetic markers to track inheritance in families.Repetitive stretches of short sequences of DNA used as genetic markers to track inheritance in families.

Multiplexing Multiplexing A genotyping approach that uses several pooled samples run simultaneously on the same gel, increasing genotyping A genotyping approach that uses several pooled samples run simultaneously on the same gel, increasing genotyping

efficiency.efficiency.

Glossary (P-R)Glossary (P-R) Population geneticsPopulation genetics

The study of variation in genes among a group of individuals.The study of variation in genes among a group of individuals. Primer Primer

Short preexisting polynucleotide chain to which new deoxyribonucleotides can be added by DNA Short preexisting polynucleotide chain to which new deoxyribonucleotides can be added by DNA polymerase.polymerase.

RecombinationRecombination The process by which progeny derive a combination of genes different from that of either parent. The process by which progeny derive a combination of genes different from that of either parent.

In higher organisms, this can occur by crossing over. In higher organisms, this can occur by crossing over. The study of variation in genes among a group of individuals.The study of variation in genes among a group of individuals.

Restriction fragment length polymorphism (RFLP) Restriction fragment length polymorphism (RFLP) Variation between individuals in DNA fragment sizes cut by specific restriction enzymes; Variation between individuals in DNA fragment sizes cut by specific restriction enzymes;

polymorphic sequences that result in RFLPs are used as markers on both physical maps and polymorphic sequences that result in RFLPs are used as markers on both physical maps and genetic linkage maps.genetic linkage maps.

Restriction-enzyme cutting siteRestriction-enzyme cutting site A specific nucleotide sequence of DNA at which a particular restriction enzyme cuts the DNA. A specific nucleotide sequence of DNA at which a particular restriction enzyme cuts the DNA.

Some sites occur frequently in DNA (e.g., every several hundred base pairs); others much less Some sites occur frequently in DNA (e.g., every several hundred base pairs); others much less frequently (rare-cutter; e.g., every 10,000 base pairs).frequently (rare-cutter; e.g., every 10,000 base pairs).

Glossary (S-T)Glossary (S-T) Short tandem repeat polymorphism (STRP)Short tandem repeat polymorphism (STRP)

A polymorphic sequence with a variable number of tandem repeats; commonly used as markers A polymorphic sequence with a variable number of tandem repeats; commonly used as markers in genetic maps.in genetic maps.

Southern blottingSouthern blotting Transfer by absorption of DNA fragments separated in electrophoretic gels to membrane filters Transfer by absorption of DNA fragments separated in electrophoretic gels to membrane filters

for detection of specific base sequences by radio-labeled complementary probes.for detection of specific base sequences by radio-labeled complementary probes. Tandem repeat sequencesTandem repeat sequences

Multiple copies of the same base sequence on a chromosome; used as markers in physical Multiple copies of the same base sequence on a chromosome; used as markers in physical mapping. mapping.

TelomereTelomere The end of a chromosome. This specialized structure is involved in the replication and stability The end of a chromosome. This specialized structure is involved in the replication and stability

of linear DNA molecules. of linear DNA molecules.

Thank you !Thank you !