4a. a Leucemie Acute Mieloidi - LAM

  • View
    129

  • Download
    1

Embed Size (px)

Text of 4a. a Leucemie Acute Mieloidi - LAM

HEMATOPOIESIS HEMATOPOIESIS

WHO Integrated ClassificationsMorphology: Cytology Histopathology Immunology: Immuno-cytohistochemistry

Cytogenetics

Molecular Genetics

Leucemia Acuta Mieloblastica De Novo Secondaria

Et > 18 anni

LEUCOSI ACUTE

LEUCOSI ACUTE DE NOVO: NON RICONOSCONO UNA CAUSA EZIOPATOGENETICA CERTA. LEUCOSI ACUTE SECONDARIE: PATOLOGIE CONGENITE. (Sindrome di Down, Anemia di Fanconi, Atassia Telangectasia, etc..) LEUCOSI ACUTE SECONDARIE: IATROGENE O DA ESPOSIZIONE A TOSSICI AMBIENTALI LEUCOSI ACUTE SECONDARIE: MIELOPROLIFERATIVI E MIELODISPLASTICHE A DISORDINI SINDROMI

Leukemia is a genetic disease

- point mutations/deletions - chromosome gain / loss -chromosomal translocations -amplification

Citogenetica e Analisi Molecolare delle Leucemie

Diagnosi e Prognosi Follow-up

Malattia Residua Minima

Gruppi di rischio in relazione alla valutazione citogenetica

Favorevolet(8;21) Inv16 del(16q) t(15,17)

IntermedioNormale +8 +6 11q23 +21 +22 del(12p) -Y

Sfavorevoledel(5q)/-5 del(7q)/-7 t(9;22) 3q,9q,11q,20q,21q,17p t(6;9) Cariotipo complesso (3 anomalie non

correlate)

Leucemie Acute Mieloidi: Anomalie citogenetiche e molecolari

LEUCEMIA ACUTA PROMIELOCITICA ( M 3 ) AML con t (15;17) (q 22;q 12) ; (PML/RAR )Nella LAM M3, che rappresenta 5-8% delle LAM, la popolazione dominante a livello midollare costituita da promielociti atipici, il citoplasma repleto di granuli di dimensioni rilevanti, di colore rosso porpora al Romanowsky. Talora il loro numero cos elevato da oscurare il nucleo. In una variabile percentuale di cellule sono presenti numerosi corpi di Auer, sovente raccolti in fasci. I bastoncelli di Auer sono spesso pi larghi che nelle altre forme di LAM. Le reazioni al Sudan nero e alla Perossidasi sono particolarmente intense

Leucemia Acuta Promielocitica

I bastoncelli di Auer hanno in microscopia elettronica una morfologia caratteristica con una disposizione esagonale di strutture tubulari a periodicit specifica di 250m in contrasto con la periodicit 620 di altre LAM.

t(15;17)(q15;q21) t(15;17)(q15;q21)

AML-M3 favorable prognosis fusion gene: PML RAR

One of the rare leukaemia where treatment is an emergency for intra vascular coagulation treatment with retinoic acid

A partial G-banded karyotype of two cells from a patient with APL showing t(15;17)(q22;q21) /(top panel, while insert). The bottom panel shows PML-RAR fusion (yellow) in three interphase cells from the same patient

Leucemie Acute Mieloidi: Anomalie citogenetiche e molecolari

t(8;21)(q22;q21) t(8;21)(q22;q21)

AML-M2 favorable prognosis fusion gene: AML1-ETO

CBF LEUKEMIAS

t(8;21) / AML1-ETO inv(16) / MYH11-CBFB

CBFB

Attivatore Trascrizionale

AML1 Geni target MPO, IL-3, GM-CSF, CSF-1R

inv (16)(p13q22) inv (16)(p13q22)

/ CBFB-MYH11

CBF LEUKEMIAS

t(8;21) / AML1-ETO inv(16) / MYH11-CBFB

CBFB

Attivatore Trascrizionale

AML1 Geni target MPO, IL-3, GM-CSF, CSF-1R

de novo AML

t-AML

OS of 1091 patients with de novo AML according to cytogenetic risk groups. Leukemia 2004;18,120-125

OS of 93 patients with t-AML according to cytogenetic risk groups. Leukemia 2004; 18,120-125

P e r c e n t

Leucemie Acute Mieloidi: Anomalie citogenetiche e molecolari

MUTAZIONEE UNA VARIAZIONE NELLA NORMALE SEQUENZA DEL DNA

ALCUNE MUTAZIONI SONO RESPONSABILI DELLO SVILUPPO DI EMOPATIE MALIGNE LESPOSIZIONE AD AGENTI FISICI (RADIAZIONI IONIZZANTI), CHIMICI (BENZENE) O AMBIENTALI (VIRUS) PUO AUMENTARE LA FREQUENZA DI TALI MUTAZIONI

Plasma membrane

Nucleus

FOSFOPROTEINA NUCLEOLARE CON FUNZIONI DI TRASPORTO DI RNA E PROTEINE FRA NUCLEO E CITOPLASMA

Nucleolus

Cytoplasm

NPM CRM1

CRM1 NPM

Mutazione ARIPRODUCIBILITA

WT

WT A

GATCT CT G GC AG T G G A G G AAGTCTCTTTAAGAAAATAG GATCT CT G TCTG GC AG T G G A G G AAGTCTCTTTAAGAAAATAG

959

965

Figure 5. Kaplan-Meier analysis of AML with normal karyotype and different NPM1 and FLT3LM status

Schnittger, S. et al. Blood 2005;106:3733-3739

Copyright 2005 American Society of Hematology. Copyright restrictions may apply.

NPM1 mutated AMLAge: Sex: Karyotype: Immunophenotype: Associated genetic events: Prognosis Adults Female Normal ( > 90%) CD34FLT3-ITD ( 40%) Low Risk

LeucemiaTrattamento (Chemio-TMO-Altri Agenti)

Refrattaria

Remissione

Malattia Minima Residua (Recidiva)

NPM mut.A copies/10^4 ABL copies

1000000 100000 10000 1000 100 10 1

NR NR PR

CR

Diagnosis

Post-induction

Gorello P. et. al Leukemia. 2006 Jun;20(6):1103-8

AMLDiagnostic WORK-UP for SPECIFIC SUBSET

Individualized Therapy

Genomic Identity Card

Malattia minima residua: Con questa espressione si intende il tentativo di identificare, con sofisticate tecniche di biologia molecolare, cellule leucemiche residue, anche quando a livello del sangue periferico e del midollo osseo la malattia appare in remissione. Questo approccio per pu essere utilizzato quando la cellula leucemica possiede una anormalit molecolare (marcatore). Ci permette un follow-up pi sensibile dei pazienti in remissione e, di sapere precocemente se c necessit di terapie aggiuntive.

Malattia Residua Minima

Meto

Immunofe

Leucemia Acuta MieloblasticaMutazioni Geniche NPM1 FLT3 KIT RASnucleoporina (trasporto nucleo/citoplasma) tirosinchinasi recettori per fattori di crescita transduzione del segnale

RECEPTOR FAMILY Extra Cellular FLT3 KIT

Cell Membrane

Tyr Kinase domains

Intra Cellular

Phosphorilation - Dimerisation Signal Transduction ( RAS; STAT; MAPK)

Science 20 October 2006. Vol.314 no.5798, pp.433-434

LEUCEMIA ACUTA MIELOIDEDE NOVO NPM1 FLT3 CEBP- PU.1 AML1 RAS C-KIT PTPN11Complex Karyotype, del (5q); -5; del(7q);-7

CONGENITE PTPN11 NF1 AML1 GATA RAS

SECONDARIE MLL MDR P53 JAK2 Loss Rb

Citogenetica e Analisi Molecolare delle leucemie Diagnosi e prognosi Follow-up Malattia residua minima

LIMITI della citogenetica convenzionale Assenza di mitosi Cariotipo normale Riarrangiamenti criptici Amplificazione genicaANALISI MOLECOLARE:

Citogenetica molecolare: FISH

RT-PCR e sequenziamenti

J Mol Med (2007) 85:227-235

Krivtsov AV. Nat Rev Cancer. 2007 Nov;7(11):823-33

Leucemie Acute Mieloidi: Anomalie citogenetiche e molecolari

CBF LEUKEMIAS

t(8;21) / AML1-ETO inv(16) / MYH11-CBFB

CBFB

Attivatore Trascrizionale

AML1 Geni target MPO, IL-3, GM-CSF, CSF-1R

DHPLC

Assorbanza

Profilo wild type

Profilo mutato

Tempo di eluizione

Profilo wild type

Leucemia Acuta MieloblasticaMutazioni Geniche NPM1 FLT3 KIT RASnucleoporina (trasporto nucleo/citoplasma) tirosinchinasi recettori per fattori di crescita transduzione del segnale

Nt. 959

A.A 288

A.A 290

WT Mut.A

ctattcaagatctctg gcagtggaggaagtctctttaagaaaatag tctgTCTGgcagtggaggaagtctctttaagaaaatag

-DLWQWRKSL. -DLCLAVEEVSLRK.

(NM_002520)

NESNt. 964(Deletion 5 nt.)WT(NM_002520)

A.A 288

A.A 290

ctattcaagatctctggcagt ggaggaagtctctttaagaaaatag

-DLWQWRKSL.

Mut.E

cagtCTCTTGCCCaagtct (insertion 9 nt.)

-DLWQSLAQVSLRK.

NES

Differenziazione: interazione tra fattori di crescita e fasi del ciclo cellulareFLT3-L, SCF

Class II alterations target transcriptional regulators of hematopoiesis.Impaired transcriptional activity

Block in cellular differentiation & maturation

Fusion genes involving: - Core binding factor (CBF) - Retinoic acid receptor (RAR ) - Homeobox factors (HOX) - Co-activators: CBP/p300

Point mutations involving: - Core binding factor (CBF) - CCAAT/enhancer binding protein (CEBP/ ) - PU.1 - NPM1

LOSS OF FUNCTION MUTATIONS

Classificazione FAB delle LAMFABM0 minima differenziazione

Anticorpi monoclonaliCD34, CD13 e/o CD33 HLA-DR, anti-MPO CD11, CD13, CD33, MLA-DR (CD19) CD11, CD13, CD33, MLA-DR (CD19) CD19, CD33 (CD2) (CD34) CD11, CD13, CD33, CD14 HLA-DR, CD68 CD11, CD13, CD33, CD14 HLA-DR, CD68 Glicoforina, HLA-DR Antigeni ABH CD41, CD42a, CD42b, CD61

M1 M2 M3 M4

senza maturazione segni di maturazione promielociti leucemici maturazione granulocitaria e blasti monocitari monoblasti e monociti

M5

M6

eritroblasti e mieloblasti

M7

blasti megacariocitari

Panel of antibodies for the diagnosis of acute leukaemias

Myeloid First line:

Second line:

Bain BJ. Clin Lab Haematol 2002 Feb;24(1):1-13

PML/RARA blocca la differenziazione mediata da fattori di crescita (es. PU.1)

A very simplified model of action of transcription factor fusions associated with acute leukemia.Co-Act. Co-Rep.

TF

Co-Act.

TF

Co-Rep.

Co-Rep.

Co-Act.

TF-fusion

Co-Repr.

TF-fusion

Co-Act.

[e.g. CBF, X-RAR ]

[e.g. MOZ, CBP]

Deregulation of target gene expression

Geni coinvoltiETO 8q22 localizzazione nucleare fattore di trascrizione

AML1 21q22 localizzazione nucleare fattore di trascrizione per vari geni che regolano lematopoiesi