The relative frequency of intraspecific lateral gene transfer of penicillin binding proteins 1a, 2b, and 2x, in amoxicillin resistant Streptococcus pneumoniae

www.elsevier.com/locate/meegid

Infection, Genetics and Evolution 7 (2007) 520–534

The relative frequency of intraspecific lateral gene transfer of penicillin

binding proteins 1a, 2b, and 2x, in amoxicillin resistant

Streptococcus pneumoniae

Michael J. Stanhope a,*, Stacey L. Walsh b, Julie A. Becker b, Linda A. Miller b,Tristan Lefebure a, Ping Lang a, Paulina D. Pavinski Bitar a, Heather Amrine-Madsen c

a Department of Population Medicine and Diagnostic Sciences, College of Veterinary Medicine,

Cornell University, Ithaca, NY 14853, United Statesb GlaxoSmithKline, 1250 South Collegeville Road, Collegeville, PA 19426, United States

c GlaxoSmithKline, 5 Moore Drive, Research Triangle Park, NC 27709, United States

Received 28 December 2006; received in revised form 21 March 2007; accepted 23 March 2007

Available online 30 March 2007

Abstract

Evidence exists for both interspecific and intraspecific recombination (lateral gene transfer; LGT) involving Streptococcus pneumoniae pbp

(penicillin binding protein) loci. LGT of capsular genes, or serotype switching, is also know to occur between S. pneumoniae of different serotype.

It is not clear whether intraspecific pbp LGT is relatively common, whether there is a difference in the relative frequency of intraspecific LGT of

different pbps, and whether serotype switching is more or less frequent than pbp LGT. The purpose of this study was to use comparative

evolutionary biology analysis of 216 international clinical S. pneumoniae isolates, from the Alexander Project collection, to gain insight on these

issues, as well as the possible role they might be playing in spreading amoxicillin resistance. All 216 isolates were genotyped using MLST and

complete or nearly complete sequences for pbp1a, pbp2b, and pbp2x were determined. Amoxicillin MICs were available for each isolate. pbps

were genotyped using phylogenetics and two or more pbp types within a MLST sequence type (ST) or clonal complex were taken as putative cases

of pbp LGT; these hypotheses were statistically evaluated using the approximately unbiased (AU) test. Serotypes were determined for 171 of these

isolates and the minimum number of switching events necessary to explain the serotype phenotypes for each of the STs and clonal complexes were

evaluated. The majority (78%) of the amoxicillin resistant isolates were comprised in 5 clonal complexes. The relative frequency of pbp LGT was

greatest for pbp2b and 2x (minimum of 10.2 and 7.8%, respectively, of the isolates consistent with the LGT hypothesis), followed by 1a (3.9%).

Serotype switching was more frequent than intraspecific pbp LGT (33% of isolates consistent with serotype switching hypothesis). Although

intraspecific LGT of pbps is occurring and has played a role in the spread of amoxicillin resistance in S. pneumoniae, clonal dissemination appears

to be more significant.

# 2007 Elsevier B.V. All rights reserved.

Keywords: Streptococcus pneumoniae; Penicillin binding proteins; Amoxicillin resistance; Lateral gene transfer

1. Introduction

Beta-lactam resistance in Streptococcus pneumoniae has

emerged through the development of altered penicillin binding

proteins which have a decreased affinity for penicillin and other

beta-lactam antibiotics. Mutations within the transpeptidase

domain of these proteins are implicated in conferring this

* Corresponding author. Tel.: +1 607 256 5638; fax: +1 607 253 3440.

E-mail address: [email protected] (M.J. Stanhope).

1567-1348/$ – see front matter # 2007 Elsevier B.V. All rights reserved.

doi:10.1016/j.meegid.2007.03.004

decreased affinity. S. pneumoniae contains six pbps: the high

molecular weight pbp1a, pbp1b, pbp2a, pbp2b, and pbp2x and

the low molecular weight pbp3. Alterations in pbp2b and pbp2x

are the primary resistance determinants, conferring low-level

resistance to sensitive strains, whereas alterations in pbp1a

result in an increase in resistance levels (Grebe and Hakenbeck,

1996; Hakenbeck et al., 1999).

Although the efficacy of beta-lactam antibiotics has been

compromised through such alterations in pbps this has been less

so for amoxicillin than for penicillin. For example, in a

summary of the Alexander Project for the period 1998–2000

mailto:[email protected]

http://dx.doi.org/10.1016/j.meegid.2007.03.004

M.J. Stanhope et al. / Infection, Genetics and Evolution 7 (2007) 520–534 521

(the Alexander Project is a surveillance program established in

1992, examining the antimicrobial susceptibility of several key

respiratory pathogens to a range of compounds), Jacobs et al.

(2003) reported that 18.2% of the isolates are penicillin

resistant and 2.1% of the isolates are amoxicillin resistant.

There have been several recent studies reporting on compara-

tive pbp sequence analysis and/or issues of clonality involving

amoxicillin resistant S. pneumoniae (e.g. Doit et al., 1999;

Perez-Trallero et al., 2003; Kosowska et al., 2004; Cafini et al.,

2006). These studies have generally either included a relatively

small number of isolates, been focused on a particular country,

or did not include comparative pbp sequence analysis along

with the isolate genotyping. Additional information on issues of

clonality of amoxicillin resistant S. pneumoniae, concomitant

with comparative molecular evolution analyses of their pbp

sequences, could be helpful in elucidating the details under-

lying the development and spread of amoxicillin resistance in S.

pneumoniae.

Important alterations in pbps appear to have emerged

through recombination events involving S. pneumoniae pbp

genes and their homologues in human commensal streptococcal

species (Dowson et al., 1989, 1990; Potgieter and Chalkley,

1995; Reichmann et al., 1997). Some of these mosaic pbps

appear to have evolved through several recombination events

involving different donors (Dowson et al., 1997). In addition to

these interspecific recombination events there is also evidence

that intraspecific recombination of pbps is also occurring,

between different clones, suggesting an important possible

means of resistance spread (e.g. Coffey et al., 1991, 1995; Sa-

Leao et al., 2002). Intraspecific recombination is not surprising

given that recombination frequency in S. pneumoniae increases

with decreasing sequence divergence between donor and

recipient (Majewski et al., 2000). However, the relative

frequency with which such intraspecific lateral gene transfer

(LGT) or recombination events is occurring amongst clinical

isolates of different S. pneumoniae clones is not well

understood or thoroughly explored. In addition, we are not

aware of any study which specifically attempts to assess this

with regard to amoxicillin resistant isolates. This focus on LGT

of pbps from amoxicillin resistant isolates could shed light on

the spread of amoxicillin resistance in S. pneumoniae.

Estimates of the relative frequency of LGT involving resistance

conferring loci should prove beneficial in developing models

designed to predict the spread of resistance. Our intentions here

are to use a comparative evolutionary biology approach to

provide insight on the relative frequency of lateral gene transfer

of pbp1a, 2b, and 2x genes in S. pneumoniae using nearly

complete pbp gene sequences derived from a large set of

clinical isolates including amoxicillin resistant isolates as well

as other resistance profiles and sampled from a variety of

geographic areas.

It has been clear for some time that S. pneumoniae clinical

isolates of the same clone or sequence type often express

different serotypes (e.g. Coffey et al., 1991) indicating that

lateral gene transfer of capsular genes takes place between S.

pneumoniae lineages (sometimes referred to as serotype

switching), emulating the early transformation experiments

on S. pneumoniae involving capsular loci (reviewed in Yother,

2004). Analyses of recombinational junctions and sequence

polymorphisms within introduced capsular genes led Coffey

et al. (1998) to conclude that 19F variants of the Spain 23F-1

clone arose on multiple independent occasions, from which

they suggested that changes in capsular type by recombination

may be relatively frequent in pneumococci. MLST databases

provide ample evidence supporting a diversity of genotypes for

individual serotypes and the most parsimonious hypothesis to

explain this is horizontal gene transfer of the capsular gene

locus (e.g. Spratt et al., 2004). There is also evidence that

capsular genes and pbp loci (particularly pbp1a and pbp2x) can

be co-transferred (Coffey et al., 1999; Trzcinski et al., 2004). It

is presently unclear whether serotype switching is more

frequent than lateral gene transfer of pbps and the degree, or

frequency, with which pbps and capsular loci are co-

transferred. An additional purpose of this study was to provide

insight on these issues through a comparative evolutionary

biology approach involving isolates for which serotype,

housekeeping genotypes, and pbp gene sequences have been

obtained. Although there are numerous studies supporting the

importance of clonal dissemination in the spread of beta-lactam

resistance in S. pneumoniae (reviewed in Klugman, 2002),

these studies generally do not have as an additional goal the

simultaneous assessment of the role of intraspecific pbp LGT.

We argue that without concomitantly evaluating the clonal

hypothesis with knowledge of the intraspecific evolutionary

history of the pbps one cannot adequately disentangle the

relative importance of clonal dissementation versus pbp LGT in

the spread of resistance. We have recently adopted a similar

approach to assess the role of intraspecific LGT of fluoroqui-

nolone target loci in the spread of fluoroquinolone resistance in

S. pneumoniae (Stanhope et al., 2005), concluding that a small

proportion of the isolates were consistent with the intraspecific

LGT hypothesis. Layering on top of this an attempt to better

understand the relative frequency of serotype switching is

important because of the potential role serotype switching

could play in avoiding newly developed vaccines (e.g. PCV7)

and possibly the simultaneous development of beta-lactam

resistance and vaccine avoidance through co-transformation of

the capsular locus and pbps.

2. Materials and methods

2.1. Isolates

Isolates included in this study come from the Alexander

Project collection. Susceptibility data and descriptions of the

tests for the Alexander Project have been published elsewhere

(Felmingham and Washington, 1999; Jacobs et al., 2003). The

Alexander Project collection contains a total of 172 isolates of

non-US origin that are amoxicillin resistant (MIC � 8 mg/ml).

We made an effort to include all of these but quite a number

could not be cultured, or one or another of the pbp loci

amplified, resulting in a total of 120 resistant isolates from non-

US locations. Within the Alexander Project collection there are

a total of 340 isolates from non-US locations that are of

M.J. Stanhope et al. / Infection, Genetics and Evolution 7 (2007) 520–534522

intermediate amoxicillin resistance (MIC = 4 mg/ml) and we

randomly chose 20 from this set for inclusion in our analysis;

two of these could not be cultured. These non-susceptible

isolates of non-US origin come from the following countries:

South Africa (ZA), United Kingdom, Spain, France, Israel (IS),

Portugal (PR), Slovakia (SL), Switzerland, Belgium, Czech

Republic (CR), Japan, Italy, Poland, and China (Hong Kong).

The majority of these non-susceptible isolates (97/138) arose

from France and Spain. There are many thousands of non-US

isolates that are amoxicillin susceptible in the Alexander

Project collection. From these susceptible non-US isolates we

randomly chose 50; 6 of these would not culture. Countries in

this non-US susceptible category included: Germany, Greece,

Spain, France, Portugal, Slovakia, Switzerland, Belgium, Italy,

and Poland. Large numbers of amoxicillin resistant and

intermediate isolates from the US are included in the Alexander

Project and we intend to focus on the US in a subsequent

analysis. However, in order to provide some preliminary

perspective on relationships between European and US isolates

in the present study we included a small number of US isolates.

Our focus in this instance involved the state of Ohio because our

preliminary analysis of the Alexander Project database

indicated that it was one of the states with relatively high

numbers of amoxicillin resistant isolates. We included 32

isolates from Ohio, 9 of which were amoxicillin non-

susceptible. Two further US isolates (from California and

New York) of non-susceptibility were also included as

incidental to the entire set simply because sequence data

was already available for these particular isolates. In total 216

isolates were included.

Serotyping was performed at G.R. Micro Ltd. (London, UK)

using the Neufeld Quellung reaction and Statens Serum

Institute (SSI) antisera (SSI, Copenhagen, Denmark). SSI was

used as the reference laboratory for quality assurance and

identification of rare serotypes.

2.2. Sequence data collection

Sequence data for all 216 isolates were obtained for all 7

MLST housekeeping loci using previously described PCR

primers (Enright and Spratt, 1998) and for nearly complete

pbp1a, 2b and 2x genes. PCR primers for the pbp loci included

the following (the number in the primer name refers to the

nucleotide position of the 30 end of the primer in the R6

reference sequence): pbp1a-F26: 50 TGAACAAACCAAC-

GATTCTGCGCCT 30; pbp1a-R2140: 50 ATGTTATGGT-

TGTGCTGGTTGAGG 30; pbp2b-F53: 50 AACAGCCATTC-

GATTCCGATTCGGCT 30; pbp2b-R1997: 50 TCACGCG-

CAATGGAAGGTCCTA 30; pbp2x-F31: 50 GAAGTGGAC-

AAAAAGAGTAATCCGTTATG; pbp2x-R2362: 50 CTGATG-

CTGTTTGACATCCTCATGC 30 or pbp2x-R2265: 50 ATGT-

CACAATTCCAGCACTGATGG 30. The PCR products were

purified with a QIAGEN QIAquick PCR purification kit

according to the manufacturer’s instructions. The products

were sequenced on both strands using Applied Biosystems

machines 3730, 3700, and 3100 and Applied Biosystems Big

Dye. The resulting comparative data sets included a sequence

alignment for pbp1a that was missing 55 bp from the 5 prime

end and 57 bp from the 3 prime end of this particular locus

(2.0 kb fragment). For pbp2b the resulting sequence alignment

excluded 150 bp from the 5 prime end of the gene and 108 bp

from the 3 prime end (1.8 kb fragment). For pbp2x only 54 bp

from the 5 prime end were excluded; the 3 prime end was

complete (2.2 kb fragment).

2.3. Data analysis

MLST housekeeping sequence data were compared to the

MLST S. pneumoniae database (http://spneumoniae.mlst.net/)

to assign STs (sequence types). Sequence types not present on

the database were assigned unique identifiers for our analysis.

Groups of related STs differing in not more than one of the

seven loci that were thought to be descendants from a common

ancestor were grouped into clonal complexes using eBURST

(Feil et al., 2004). Singleton isolates were defined as individual

isolates of unique ST that did not group into a clonal complex.

Singleton clones were defined as unique STs that did not group

with a clonal complex and which were comprised of more than

one isolate.

Homologous DNA sequence alignments of pbp gene

sequences were generated by using ClustalX, version 1.83

(Thompson et al., 1994), with any necessary manual editing in

GeneDoc, version 2.6.0.2. The best-fitting model of sequence

evolution and the corresponding values for the rate matrix,

shape of the gamma distribution, and proportion of invariant

sites were estimated by the program MODELTEST (Posada and

Crandall, 1998). Phylogenies of the pbp sequences were

reconstructed by the maximum likelihood (ML) method

implemented in PAUP*4.0b. Starting trees for the ML analyses

were obtained by neighbor joining with nearest neighbor

interchange used as the branch-swapping algorithm. Bootstrap

support values were obtained with 500 ML replicates using the

program PHYML (Guindon and Gascuel, 2003).

The pbp phylogenies were used to determine pbp types,

where a type was considered to be a monophyletic group (two

or more sequences) comprised of sequences with little or no

sequence divergence. This means that singleton lineages were

considered ‘‘non-typeable’’ under this criterion. pbp types were

then compared to the MLST results demarcating STs and clonal

complexes. Isolates of the same ST, or clonal complex,

harboring the same pbp type were considered to share that pbp

type because of common ancestry and dissent (clonal

dissemination). In contrast, isolates of the same ST (or clonal

complex) with different pbp types were judged to have acquired

those different pbps through lateral gene transfer (LGT). To be

considered as putative LGT, different pbp types must be

separated by a minimum of three nodes on the pbp tree. This

subjective criterion was determined after reconstructing and

visually inspecting each phylogeny and its conservative

intention was to avoid the inclusion of moderately divergent,

neighboring sequences (particularly sister groups), with well-

defined pbp types. In order to provide a more rigorous statistical

perspective on whether such putative LGT events had a history

that was significantly different from that of clonal dissemina-

http://spneumoniae.mlst.net/


tion (common ancestry and descent), pbp ML trees were

constrained to support the clonal hypothesis for individual LGT

sequences and these constrained trees were assessed for

significant difference against the highest likelihood trees using

the AU test implemented in CONSEL (Shimodaira and

Hasegawa, 2001; Shimodaira, 2002). Rejection of the null

hypothesis of no difference between the constrained tree and

the highest likelihood tree, and acceptance of the alternative

hypothesis, was taken as phylogenetic statistical evidence for

LGT of that pbp involving that isolate. We refer to these two

different means of evaluating pbp LGT as the ‘‘subjective’’ and

‘‘statistical’’ criteria respectively; we only consider instances

that satisfy both criteria as putative cases of LGT.

The principle of parsimony was employed in evaluating the

occurrence and number of putative LGT and serotype switching

events. This means, for example, that if we have 5 isolates of a

particular ST and three of them are serotype 11 and two of them

are serotype 14, we consider this to be a single serotype switching

event from 11 to 14 (or vice versa); the additional serotype 14 (or

11) isolate is assumed to be the consequence of clonal

dissemination from a serotype 14 (or 11) ancestor. Because

we do not have an evolutionary history for isolates comprising a

clone it is not possible to definitively derive the directionality of

such switches. Nonetheless, it is often the case that our data, and/

or the MLST database, indicate that a particular serotype is

clearly more representative of a clone and thus suggest a possible

directionality of the serotype switch. In any event, the minimum

number of switching events necessary to explain the array of

serotype phenotypes is taken as the number of serotype switches

for that clone. Similarly, if we have a STor clonal complex which

has 20 isolates of a particular pbp type and 5 of another pbp type,

this is assumed to involve a single LGT event from the more

numerous type to the less numerous type, followed by clonal

multiplication of that particular LGT event. This conservative

approach will have the consequence of underestimating the

actual number of LGT or serotype switching events.

The nucleotide sequences obtained in this study have been

deposited in GenBank under the following accession numbers:

EF499539–EF501698.

3. Results and discussion

3.1. Clonality of amoxicillin resistance

The 216 isolates were comprised of 114 sequence types (ST),

including 49 STs listed on the S. pneumoniae MLST database.

The remaining 65 STs were single, occasionally double, and one

triple locus variant of existing STs (Appendix A). A total of 38

STs were unique because of combinations of existing alleles and

27 STs were unique because of unrecorded alleles. The 114 STs

comprised 13 clonal complexes (eBURST determination of STs

and their associated SLVs), plus 5 singleton clones (two or more

isolates of same ST) and 39 singleton isolates (individual isolates

of unique ST which could not be assigned to a clone or clonal

complex). Amoxicillin non-susceptible isolates were distributed

among 7 clonal complexes and the majority of amoxicillin

resistant isolates (98/125; 78.4%) were contained in 5 clonal

complexes. These five clonal complexes included representatives

of the PMEN (Pneumococcal Molecular Epidemiology Net-

work) clones Spain 23F-1, Spain 6B-2, Spain 9V-3, and Poland

23F-16, as well as one additional group without a specific PMEN

clonal member. This latter group did include, however, a ST (13)

which was a SLV of the England 14-9 clone. The three Spanish

clones have been mentioned elsewhere as major contributors to

amoxicillin resistance (Perez-Trallero et al., 2003); we are not

aware of Poland 23F-16 being similarly implicated. This clonal

complex included 2 isolates with amoxicillin MICs of 16 mg/L.

The isolates were sampled from the years 1996–2000 and were

all from Poland. Other PMEN clones represented in our set of

isolates included the following: Taiwan 23F-15, Sweden 1–28,

The Netherlands 3–31, The Netherlands 8–33, The Netherlands

14–35, The Netherlands 18C-36, The Netherlands 15B-37, The

Netherlands 7F-39, and Portugal 6A-41. With the exception of

the Taiwan 23F-15 isolates, these were all amoxicillin

susceptible isolates.

There were 11 amoxicillin non-susceptible isolates from the

USA, grouped into 6 STs; within this group there was a set of

clearly resistant isolates from Ohio, all ST 13. The clonal

complex containing ST 13 has 1 isolate collected from France

in 1999, with all other isolates from Ohio, USA in 2000. This

same sequence type has been reported previously in the US (e.g.

Sa-Leao et al., 2001), although we are not aware of a report

linking it to amoxicillin resistance. The majority of the

members of this clonal complex (and indeed all of the ST 13

isolates) have the same unique pbp types (Figs. 1 and 2). This

could be an important clone to watch in the USA for the spread

of amoxicillin and other types of resistance, and it is perhaps

fortunate that all these isolates were serotype 14, which is one

of the serotypes included in the PCV7 vaccine.

3.2. Lateral transfer of pbp loci

Pbp1a was divided into 12 different phylogenetic groups, or

pbp types (Fig. 3), with 10 isolates considered as non-typeable

based on our criteria. One of the distinguishing features of this

treewas that the different pbp1a types were relatively distinct, yet

showed little or no variation within a type. pbp1a type 1 was the

most common, including a total of 73 isolates, encompassing two

clonal complexes (4 and 7; Figs. 2 and 3) and one singleton

isolate. Clonal complex 4 includes ST 81, which is the Spain 23F-

1 clone, and clonal complex 7 includes ST 156, which is the

Spain 9V-3 clone. These two clones have previously been

reported to possess the same pbp1a genotype, based on pbp RFLP

analysis (e.g. McGee et al., 2001). Clonal complex 4 includes 13

different sequence types, and all of these isolates have our pbp1a

type 1. Clonal complex 7 includes 21 different sequence types

and 9 of these sequence types possess pbp1a type 1. The most

parsimonious explanation of this evolutionary pattern is that

pbp1a type 1 has been common to clonal complex 4 for some

time, since all 13 different sequence types possess it, and at some

point this sequence was passed to a member of clonal complex 7,

via a lateral gene transfer event, and through common ancestry

and descent it subsequently diversified into other STs within this

other group. This suggests that two intraspecific LGT events are

Fig. 1. Summary of pbp LGT and serotype switching events, as well as

amoxicillin (amox.) MIC values, at the level of sequence type. pbp type and

serotypes are indicated along the top of each figure and sequence type is

indicted along the vertical axis. A horizontal red line indicates a LGT event for


sufficient to explain the observed phylogenetic distribution for

this sequence in this set of 216 isolates; once from clonal

complex 4 to 7 and once from either 4 or 7 into the singleton

lineage identified by isolate 517.1FR95.

In general there was a very high degree of association between

pbp1a type and ST or clonal complex, suggesting that the

distribution of the vast majority of these pbp sequences amongst

these 216 isolates could be explained by clonal dissemination. Of

the 27 sequence types represented by more than one isolate (a

total of 128 isolates), only three of these STs showed evidence for

lateral transfer of pbp1a (Fig. 1); ST 156 supported 3 cases of

LGT, and there was one example in each of STs 1624, and SLV

156 (ddl-4). In the case of ST 156, two of the LGT cases were

correlated with an increase in amoxicillin MIC (from 8 to 16 mg/

L) and were associated with isolates from 1999 to 2000, with the

other members of the clone dated at 1995, suggesting a possible

time frame for the LGT events within this clone. All of these

putative cases of LGT were supported by both the ‘‘subjective’’

(different pbps must be separated by at least three nodes on the

pbp tree) and ‘‘statistical’’ (phylogenetic AU test) criterion.

Thus, the frequency of LGT for pbp1a, using the disrupted

monophyly of ST as the criterion, was 5/128 (3.9%). This

association was also quite apparent in a comparison of clonal

complex and pbp1a type (Fig. 2). Within the 160 isolates

distributed into 13 clonal complexes, there were 10 examples of

pbp1a LGT (10/160; 6.3%). This slight increase in number of

examples of LGT, when the criterion is disruption of clonal

complex monophyly, is precisely what would be expected with

the expansion of the comparative framework to a consideration of

groups of closely related clones, and not just single STs, since this

represents an expansion of the evolutionary timeframe for the

detection of such events.

The origins of many of these pbp sequences may have

involved recombination events with commensal Streptococcus

species such as Streptococcus mitis (e.g. Dowson et al., 1989),

after which antibiotic selection of particular recombinants,

clonal dissemination, and intraspecific LGT may have been the

more significant factors. The degree or frequency to which

ongoing interspecific LGT involving S. pneumoniae pbps and

commensal flora takes place is not well understood. A

phylogenetic comparison of these S. pneumoniae pbp1a

sequences to orthologs from S. mitis and Streptococcus oralis

available on GenBank (three sequences from S. mitis and one S.

oralis), indicates that one of these S. pneumoniae isolates

(675.1PL96) possesses a pbp1a sequence that is much more

closely related to S. mitis, and thus supports an instance of

interspecific LGT. The pbp1a sequence for 675.1PL96 was

listed as non-typeable in our analysis, and was not implicated in

an intraspecific LGT event. Additional comparative data on

pbps for commensal species such as S. mitis could eventually

lead to an assessment of the relative importance of interspecific

that sequence type. Non-typeable pbps are indicated with their isolate ID; non-

typeable pbps that were not implicated in a LGT event are indicated as an

addition to the pbp type with which they were judged not significantly different

(e.g. 5 + 675.1PL96).

Fig. 2. Summary of pbp LGT and serotype switching events, as well as

amoxicillin (amox.) MIC values, at the level of clonal complex. pbp type

and serotypes are indicated along the top of each figure and clonal complex is

indicted along the vertical axis. A horizontal red line indicates a LGT event for

Fig. 3. Unrooted maximum likelihood (ML) tree of pbp1a sequences derived

from the set of 216 S. pneumoniae isolates. pbp1a sequence type designations

are listed adjacent to the various clades comprising each type; *ML bootstrap

support in excess of 80%; isolate IDs for non-typeable pbp1a sequences are

indicated for those sequences implicated in a LGT event.


versus intraspecific LGT in development and spread of beta-

lactam resistance in S. pneumoniae.

One of the remarkable aspects of the evolutionary history of

pbp1a (and indeed to an extent, also pbp2b and 2x) is the

pronounced lack of sequence variation in many of the major

types. del Campo et al. (2006) have recently pointed out similar

such sequence conservation for pbps and MurM in penicillin

resistant isolates. Earlier RFLP studies suggested similar

homogeneity amongst certain pbps amplified from different

isolates, which formed the basis of PCR/RFLP typing schemes,

such as the one adopted by the Pneumococcal Molecular

Epidemiology Network (Gherardi et al., 2000). RFLP digests

though, are not as specific as complete DNA sequences. The

increased specificity for each of the pbp loci resulting from our

approach, results in distinguishing some pbps that the RFLP

scheme lumps into a single category. For example, the PMEN

lists the pbp1a type for ST 81 and ST 90 as both type 1,

that clonal complex. Non-typeable pbps are indicated with their isolate ID; non-

typeable pbps that were not implicated in a LGT event are indicated as an

addition to the pbp type with which they were judged not significantly different

(e.g. 5 + 675.1PL96).


however, our sequence analysis clearly indicates that these

clones possess distinct pbp types (Figs. 1 and 3). Further more

subtle distinctions are apparent for some of the ST 156 isolates,

which also are listed on PMEN as pbp1a type 1; although the

majority of the ST 156 isolates have the same type as ST 81,

some isolates carry a pbp1a sequence that is clearly different,

and which we categorize as 1b (Figs. 1 and 3). Although such

distinctions may seem trivial at first glance, they result in very

different interpretations regarding the evolutionary history of

the pbp gene. For example, ST 81 and ST 90 with the same pbp

sequence, suggests recent lateral transfer of this pbp between

clones, however, different pbp types suggests something

different; it could still involve a history of lateral transfer,

followed by some period of change in the pbp, but in this case it

does not suggest a recent event.

The distinct lack of sequence variation for the majority of

pbp1a types is true even though several of these types, such as

pbp1a type 1 (common to the Spain 23F-1 clone), are distributed

amongst different clones and clonal complexes. Sequence types

that are members of the clonal complex defined by Spain 23F-1

(clonal complex 4 in our analysis) are generally single locus

variants of ST 81, or more occasionally, one of the other STs in

this complex. Current evidence suggests different STs are formed

by recombination of their housekeeping loci (Spratt, 2004).

Although there is undoubtedly selection pressure against certain

recombinants of such housekeeping loci, many such recombi-

nants will not possess sequences that will result in significant

negative selection pressure. Similar recombination events of

pbp1a type 1 are likely to be at a significant disadvantage, if type

1 is playing a role in conferring amoxicillin and perhaps beta-

lactam resistance in general. The majority (43/73; 59%) of the

isolates possessing pbp1a type 1, have amoxicillin MICs � 8 and

only 15% (11/73) have MICs � 2. Thus, a likely explanation is

that pbp1a type 1 was present in the ancestor of our clonal

complex 4, conferred a selective advantage to isolates that

retained it, and was passed onto other STs, through common

ancestry and descent, while those STs differentiated through

occasional recombination events of their housekeeping loci.

Spratt et al. (2004) suggested that SLVof ST81 have arisen over a

period of about 30 years, and amoxicillin was first introduced in

1972 (White et al., 2004). Thus, the history of this apparent

example of strong directional selection favoring a particular

pbp1a allele can be roughly dated as occurring over the course of

the last 30 years. The distinct nature of the majority of the pbp1a

types, concomitant with the pronounced lack of variation for

most of these groups, as well as their tendency to be clonally

disseminated, suggests a similar history for most of these pbp1a

types.

The phylogeny for pbp2b (Fig. 4) divided the sequences into

21 types, several of which were very closely related and thus

were designated as subtypes of a larger group (e.g. 1, 1b, 1c).

This tree differed from pbp1a in that the types tended not to be

as clearly distinct and there were many more sequences not

falling into clearly distinguishable clades, yielding more in the

non-typeable category. Ppb2b type 10 was the most common,

and included 54 isolates, all but four of which came from clonal

complex 4 or 7. Unlike pbp1a, where all of the clonal complex 4

isolates carried exactly the same pbp1a sequence, for pbp2b, 7

out of a total of 39 isolates were not type 10. In the case of

clonal complex 7, 37 out of a total of 55 isolates were not pbp2b

type 10. Overall, like pbp1a, pbp2b also showed a high degree

of association between pbp2b genotype and ST or clonal

complex. Out of the 128 isolates comprising the 27 STs

consisting of more than one isolate, there were 13 examples of

pbp2b LGT (13/128; 10.2%; Fig. 1). When one expands the

comparison to the level of clonal complex, there were a total of

30 examples of pbp2b LGT (30/160; 18.8%; Fig. 2).

Phylogenies that include pbp2b sequences taken from

GenBank for S. mitis, S. oralis, and Streptococcus sanguis (16

sequences from S. mitis, 2 S. oralis, and 1 S. sanguis), support

interspecific LGT events involving S. pneumoniae isolates

595.5IT97 and 640.6IT98 (ST 321), as well as for 595.2FR99;

the implicated species is S. mitis. The former two sequences

were pbp2b type 8, and were not implicated in an intraspecific

LGT event in our analysis; the latter sequence was non-typeable

and was implicated in a LGT event involving the clonal

complex 7 comparison.

The phylogeny for pbp2x (Fig. 5) divided the sequences into

25 types, including several subtypes. pbp2x type 3 was the most

common and with the exception of 5 isolates (four of which

were singleton isolates), was found only in clonal complex 4 or

7. However, ten isolates within clonal complex 4 were not

pbp2x type 3 and 37 isolates within clonal complex 7 were not

type 3. This set of 37 isolates from clonal complex 7, not

carrying pbp2x type 3, were the same isolates not carrying

pbp2b type 10. This in turn suggests a possible evolutionary

history in which a clonal complex 4 member (or members),

acted as a donor of all three pbps (either simultaneously or

independently) to a clonal complex 7 isolate(s). These pbps

were then passed on by common ancestry and descent within

the clonal complex 7 group, eventually being distributed

amongst 8 different STs within this complex. Concomitant with

this diversification there were further events of LGT involving

clonal complex 7 and other lineages, resulting in some isolates

within the various clones harboring different pbp types than

their ancestors. For example, the majority of the ST 156 (Spain

9V-3) isolates have the same pbp types, and these in turn are the

same as those of the majority of the clonal complex 4 members,

including ST 81 (Spain 23F-1). This similarity in pbps between

Spain 23F-1 and Spain 9V-3 and the hypothesis of LGT

involving these clones and their pbps was first noted by Coffey

et al. (1991). After the original transfer event we suggest there

were several subsequent LGT events, changing the pbp types of

some ST 156 members. Isolates 405.7PR00S, 405.3BE99, and

405.16SW99, all ST 156, each have different pbp1a, 2b and 2x

genes suggesting a minimum of 3 independent LGT events. In

the TIGR S. pneumoniae genome sequence (Tettelin et al.,

2001), pbp1a and pbp2x are separated by about 42 kb and

pbp2b is in excess of 1 Mb removed. Thus, although it is

possible that 1a and 2x are co-transferred, it is unlikely that 2b

would be transferred with either of the other loci. Our data

suggest there is less transfer involving 1a than 2x (and 2b as

well), and thus, even though 1a and 2x are relatively proximal,

we favor the hypothesis that each apparent LGT event is

Fig. 4. Unrooted maximum likelihood (ML) tree of pbp2b sequences derived from the set of 216 S. pneumoniae isolates. pbp2b sequence type designations are listed

adjacent to the various clades comprising each type; *ML bootstrap support in excess of 80%; isolate IDs for non-typeable pbp2b sequences are indicated for those

sequences implicated in a LGT event.


independent of the other pbps. In our recent LGT analysis of

fluoroquinolone target loci we concluded that Spain 23F-1 is a

frequent donor of fluoroquinolone resistance conferring loci to

other lineages (Stanhope et al., 2005). In the present case it

would appear that Spain 23F-1, or at least a member(s) of that

clonal complex, has been a likely donor of pbp genes as well.

However, the evidence in this case tends to support this LGT

event with one or two recipient lineages, rather than multiple

independent lineages as in our fluoroquinolone example. Of

course it is possible that a broader sampling of isolates might

have picked up other examples and we are currently working

towards making this assessment involving a more globally

complete sample of beta-lactam resistant isolates from the

Alexander Project collection. Using the criterion of disrupted

ST monophyly, there were 10 examples of pbp2x LGT (10/128;

7.8%; Fig. 1), and with the broader consideration of disrupted

clonal complex monophyly, there were 29 (29/160; 18.1%;

Fig. 2) examples of pbp2x LGT in this data set.

Phylogenies that include pbp2x sequences taken from

GenBank for S. mitis and S. oralis (12 sequences from S. mitis,

2 from S. oralis), do not provide clear support for interspecific

LGT events involving any of our S. pneumoniae isolates. Many

of the S. mitis and S. oralis sequences do fall within the S.

pneumoniae group, but none of the resulting branching

arrangements provide clear evidence for donor/recipient

relationships. Nonetheless, since the S. mitis sequences tend

to be arranged as small paraphyletic groups scattered

throughout the S. pneumoniae tree, it does suggest the

possibility of a complex history of recombination involving

pbp2x from S. mitis and S. pneumoniae.

3.3. Serotype switching

The phenomenon of serotype switching in Streptococcus

pneumoniae via capsular locus recombination between clinical

isolates, has been known for some time (Coffey et al., 1991,

Fig. 5. Unrooted maximum likelihood (ML) tree of pbp2x sequences derived from the set of 216 S. pneumoniae isolates. pbp2x sequence type designations are listed

adjacent to the various clades comprising each type; *ML bootstrap support in excess of 80%; isolate IDs for non-typeable pbp2x sequences are indicated for those

sequences implicated in a LGT event.


1998; Barnes et al., 1995; Nesin et al., 1998; Ramirez and

Tomasz, 1999) and there is evidence, at least for Spain 23F-1, that

this may occur relatively frequently (Coffey et al., 1998; Spratt

et al., 2004). Not all of the isolates in the present dataset were

serotyped, however, we do have serotype data for 171 of them,

allowing an assessment of the relative frequency of capsular

switching versus pbp LGT in the same isolates. Of the total

isolates serotyped, 103 fall into STs with more than a single

serotyped representative (total of 22 STs). Using disrupted ST

monophyly as the criterion of capsular switching, there were a

minimum of 40 isolates within this set of 103 (40/103; 38.8%)

expressing serotypes consistent with an evolutionary history of

capsular switching (Fig. 1). For example, ST 62 includes three

isolates, two of which express serotype 11, and one serotype 14.

Whether one regards serotype 11 or 14 as the ancestral state, we

still consider this to be a single serotype switching event. In this

particular example our data supports more cases of serotype 11

(albeit only by one) for this clone and if one examines the isolates

for ST 62 on the MLST database, all six are either serotype 11 or

11A, suggesting 11 may be the ancestral state for this clone, and

that there was a single capsular switching event, from 11 to 14.

Only three STs, out of the total of 22 STs with multiple serotyped

representatives, do not support evidence for capsular switching.

If one examines pbp LGT for the same serotyped isolates

considered for possible capsular switching, there were 5

examples of pbp1a, 11 for pbp2b, and 10 for pbp2x. Thus,

our data suggest that capsular switching is roughly 3–7 times

more frequent than LGT of pbps. Furthermore, of the cases of

apparent pbp LGT (based on the criterion of disrupted ST

monophyly) involving the set of serotyped isolates, only a small

number of these involve LGT events that can be unambiguously

identified as independent of a serotype switch (1 case for pbp1a, 4

for pbp2b, and 3 for pbp2x). S. pneumoniae genome sequence

data indicate that pbp2x and pbp1a are located within 10 and

14 kb of the capsular biosynthesis operon, and it has been

demonstrated that capsular genes and pbp loci can be transferred


in a single transformation step (Trzcinski et al., 2004). Coffey

et al. (1999), presented evidence indicating that serotype 14

variants of the Spain 9V clone have arisen on multiple occasions

by large recombinational replacements that include the majority

of the pbp1a gene. This co-transformation of capsular loci and

pbps suggests a possible explanation for why there is a

correlation between serotype and resistance to beta-lactam

antibiotics, with some serotypes, such as 9Vand 19A, correlated

with high resistance, and other serotypes, such as 1–4, generally

associated with low resistance (McCormick et al., 2003).

Although our results involving possible co-transfer of capsular

genes and pbps are circumstantial, and thus should be regarded

with certain skepticism (e.g. often not possible to unambiguously

determine the ancestral state of serotype), it is also true that the

majority of pbp LGT cases (at least for the serotyped isolates)

cannot be disentangled from possible co-transfer with the

capsular locus. Thus, our results are certainly consistent with the

possibility of relatively frequent co-transformation of capsular

genes and pbp loci.

The vast majority of the amoxicillin non-susceptible isolates

in this dataset expressed serotypes included in the PCV-7

vaccine. The majority of putative switching events involved a

change from a vaccine serotype to either another vaccine

serotype, or a vaccine related serotype. There were, however, at

least six exceptions, which parsimoniously supported a change

from vaccine or vaccine related serotype to a non-vaccine

serotype. For example, with ST 838, we have serotype data for

16 isolates, 15 of which express vaccine or vaccine-related

serotypes, and one of them is serotype 3, leading to the most

parsimonious hypothesis of a switch from vaccine or vaccine

related, to serotype 3. It is important to realize that our

estimates of capsular switching are undoubtedly an under-

estimate of the actual number of switching events that have

occurred amongst these isolates. Coffey et al. (1998) concluded

from an examination of the differences in recombinational

junctions and sequence polymorphisms of the capsular genes of

19F variants of the Spain 23F-1 clone, that of the eight variants

they examined, a minimum of four separate evolutionary events

were responsible. In our parsimony based assessment of

serotype changes we are evaluating such changes as a single

evolutionary event. The pbp assessment on the other hand,

although conservative, is not as likely to be as much of an

underestimate of LGT as the capsular genes since in this case

we are examining nearly complete pbp sequences and not a

phenotype. Thus, it would seem that for each of these clones

and clonal complexes, there have been many more examples of

capsular gene recombination than pbp lateral transfer. It is

interesting to note that for clonal complex 4, which includes

Spain 23F-1 (ST 81), there is considerable variation in capsular

Appendix A. Clonal composition, pbp type, and amoxicillin Mincluded in this study

Lab ID mlst ST Clonal complex Serotyp

525.12Oh00a 13 1

525.14Oh00 13 1

525.4Oh00 13 1

genes, and housekeeping sequences of the various clones

comprising this complex obviously differ, yet their pbp1a

sequences are exactly the same.

It is possible that the reason we detect more examples of

capsular gene transfer than pbp lateral transfer is related to the

strong selection pressure against isolates that recombine any of

these resistance conferring pbps. If this were the case then one

might expect that the relative frequency of capsular switching

versus pbp lateral transfer would not be so extreme for

susceptible isolates. Although phylogenetic trees reconstructed

on just the susceptible pbps tend not to have a great deal of

support on many of the nodes, there are nonetheless several

clades that are strongly supported with either very limited or no

internode branch lengths and these tend to correspond with ST

and clonal complex, suggesting very little pbp lateral transfer

even amongst these susceptible isolates. For these same groups

there are multiple examples of serotype switching. For

example, in this data set there are 7 STs that are comprised

of more than one isolate, are serotyped, and are amoxicillin

susceptible. Within this set of 7 STs, including a total of 19

isolates, there are eight examples of capsular switching and two

examples of LGT for pbp1a, two for pbp2b, and two for pbp2x.

In summary, our results suggest that clonal dissemination is

playing a more significant role than is intraspecific lateral gene

transfer in the development and spread of amoxicillin resistance

in S. pneumoniae. Nonetheless, intraspecific lateral gene transfer

of pbps is occurring and has played a role in the spread of

resistance. The relative frequency of these transfer events

appears to be greatest for pbp2x and 2b, followed by 1a. Serotype

switching appears to be much more frequent than pbp LGT, in

this pre-vaccine era dataset (all isolates in the current study

collected prior to PCV-7 vaccine introduction), implying that S.

pneumoniae might relatively easily escape conjugatevaccines. In

this regard we would certainly concur with the suggestions of

others (e.g. Spratt and Greenwood, 2000) that current evidence

supporting serotype switching between vaccine serotypes is

likely a reflection of the fact these serotypes are most commonly

found in the nasopharynx of children. However, with develop-

ment of serotype replacement the potential donors of capsular

genes will be increasingly of non-vaccine serotype, potentially

leading to vaccine avoidance. Finally, our results are consistent

with occasional, to relatively frequent, cases of co-transforma-

tion of capsular genes and pbp loci.

Acknowledgements

This work was supported by the Alexander Network, and

Cornell University start-up funds, granted to MJS.

ICs for the 216 Streptococcus pneumoniae isolates

e pbp1a type pbp2b type pbp2x type Amoxicillin MIC (mg/ml)

3c 2b 1 8

3c 2b 1 8

3c 2b 1 8

Appendix A (Continued )Lab ID mlst ST Clonal complex Serotype pbp1a type pbp2b type pbp2x type Amoxicillin MIC (mg/ml)

525.5Oh00a 13 1 3c 2b 1 8

540.2Oh00 SLV 13 (recp-2) 1 3c 2b 5* 8

5.3Oh92 33 2 23F 7 14 19 0.06

215.1Oh00 439 2 7 14 19 <0.015

0.6FR00 62 3 14 7 14 19 0.03

80.1Oh93 62 3 11 7 14 NT# 0.06

365.1SP94S 62 3 11 7 14 19 4

442.1SP95 1760 3 6B 7 14 19 8

275.1Oh93 81 4 23F 1 10 3 0.5

305.1Oh93 81 4 23F 1 10 3 1

520.1Oh00 81 4 1 10 3 2

521a.1FR96 81 4 1 10 3 2

535.1Oh94 81 4 23F 1 10 3 2

643.1CH99 81 4 1 10 3 2

450.1Oh93 81 4 19F 1 10 14# 2

552.1FR95 81 4 1 10 3 4

651.1FR98 81 4 1 10 3 4

705.4CH00 81 4 1 10 3 4

720.1CH00 81 4 1 10 3 4

720.5CH00 81 4 1 10 3 4

533.1SP95 81 4 1 12# 3 4

615.1Oh00 81 4 1 10 14 4

615.5Oh00 81 4 1 10 14 4

615.6Oh97 81 4 19F 1 10 14 4

464.1SP95 81 4 14 1 10 3 8

645.8FR95 81 4 6B 1 10 3 8

674.1FR95 81 4 19A 1 10 3 8

670.4FR99 81 4 23F 1 NT 3 8

670.7SL00 81 4 19A 1 NT# 3 8

415.1SP93 81 4 23F 1 5# 4 8

500.1FR95 81 4 3 1 NT# 4 8

688.1CH99 1275 4 1 10 3 4

705.2CH00 1275 4 1 10 3 4

498.1SP95 1623 4 6B 1 10 NT* 8

439.1BE96 SLV 1275 (gki-10) 4 1 10 3 2

522a.1FR94 SLV 1623 (xpt-4) 4 1 10 3 2

599.1FR95 SLV 81 (aroe-95) 4 23F 1 10 3 8

595.1FR00 SLV 81 (ddl-i) 4 14 1 3* NT* 8

645.9FR98 SLV 81 (ddl-ii) 4 23F 1 5* NT* 16

705.3CH00 SLV 81 (gdh-5) 4 1 10 15* 4

553.1FR95 SLV 81 (gdh-i) 4 19A 1 10 3 8

486.1FR95 SLV 81 (gki-10) 4 1 10 3 2

393.2FR95 SLV 81 (gki-10) 4 23F 1 10 3 8

498.3SP95 SLV 81 (gki-10) 4 21 1 10 3 8

601.1FR95 SLV 81 (gki-10) 4 23F 1 10 3 8

599.3FR95 SLV 81 (recp-15) 4 23F 1 10 3 8

674.3FR95 SLV 81(gki-4) 4 9V 1 10 3 8

460.1SW00a 90 5 14 2 4 11 4

670.10SP94 90 5 9V 2 5 12 8

670.9SP94 90 5 6B 2 5 12 8

685.3JA00 90 5 2 NT# 13 8

445.1SP95 90 5 9V 2 NT# 8b# 8

464.2SP95 90 5 6B 2 NT# 8b 8

590.7SP97 1624 5 23F 3 1 7 8

575.1SP95 1624 5 23F 3 1b 7 8

590.6SP97 1624 5 11 3 1b 7 8

590.1FR98 1624 5 6B 3* 1 7 16

595.6SP00 1624 5 6B 7# 14# 19# 16

605.1FR93 DLV 90 (gki-i, ddl-iii) 5 13 2 2 7 8

690.1FR98 SLV 90 (ddl-iv) 5 6B 2 NT NT* 8

605.2FR96 SLV 90 (ddl-v) 5 9V 2 2* 7 8

670.3FR99 SLV 90 (ddl-v) 5 6B 2 2 7 8

670.5FR99 SLV 90 (ddl-v) 5 6B 2 2 7 8

665.1FR97 SLV 90 (ddl-v) 5 19F 2 2 3b# 8

655.3FR97 SLV 90 (ddl-v) 5 19F 2 2 NT# 8



640.4FR98a SLV 90 (ddl-v) 5 6B 2 2 7 16

530.2SP93 SLV 90 (ddl-vi) 5 6B 2 5 NT* 8

670.1FR94 SLV 90 (ddl-vii) 5 14 2 3b* 10* 8

670.2FR94 SLV 90 (ddl-vii) 5 14 2 3b 10 8

553.1SP95 SLV 90 (gki-10) 5 9A NT* NT* 3 8

674.1SP95 SLV 90 (gki-2) 5 23F 2 10* 13 8

0.53SP96 113 6 6B 7 14 19 0.03

0.71Oh93 113 6 18C 7 14 19 0.06

0a 121 6 7 14 19 0.03

0.4BE99 SLV 113 (spi-i) 6 18C 7 14 19 0.03

606.2FR98 144 7 1 10 3 4

336.1ZA98 156 7 1 10 3 4

393.3FR95 156 7 23F 1 10 3 8

393.3SP95 156 7 14 1 10 3 8

393.4FR95 156 7 23F 1 10 3 8

393.4SP95 156 7 9V 1 10 3 8

393.5SP95 156 7 9V 1 10 3 8

393.6SP95 156 7 6B 1 10 3 8

405.16SW99 156 7 14 1b NT# NT 8

380.3IS99 156 7 14 1b# 10 3 8

405.7PR00a 156 7 14 2b# NT# 9# 16

405.3BE99 156 7 23F 3# 4c# 7b# 16

0h 162 7 7 14 19* 0.015

0i 162 7 7 14 19 0.015

0g 162 7 7* 14 19 0.015

347.1SP95 333 7 14 NT 10 NT* 8

365.2SP96 838 7 6A 1 1* 3b 4

380.9SP94 838 7 9V 1 1b 6* 8

355.1SP96 838 7 14 1 1b 19 8

380.11SP95 838 7 6B 1 1 3b 8

380.16SP99 838 7 9A 1 1 3b 8

380.12SP96 838 7 19F 1 1b 3b 8

380.13SP97 838 7 1 1b 3b 8

380.15SP97 838 7 9A 1 1b 3b 8

405.10SP94 838 7 6B 1 1b 3b 8

405.11SP94 838 7 9A 1 1b 3b 8

405.13SP94 838 7 3 1 1b 3b 8

405.14SP95 838 7 14 1 1b 3b 8

335.2SP99 838 7 9A 1 1c 3b 8

335.3SP99a 838 7 9A 1 1c 3b 8

380.10SP95 838 7 9V 1 1 3c 8

335.1SP99 838 7 9V 1 1b 3b 16

380.1FR00a 838 7 19A 1 1b 3b 16

615.4Oh00 DLV 156 (gdh-4, gki-2) 7 1 10 3 4

685.2FR99 DLV 156 (gki-ii, ddl-119) 7 14 2b* 9* 2 8

530.1FR96 SLV 156 (ddl-119) 7 4 2b 9 7* 8

405.1BE96 SLV 156 (ddl-22) 7 23F NT 9 7b 8

347.2SP95 SLV 156 (ddl-4) 7 3 1b# 12* NT 8

435.1SP95 SLV 156 (ddl-4) 7 23F 2b NT# 15* 8

405.15SP95 SLV 156 (ddl-47) 7 23F 2b 6* 15 8

405.5FR94 SLV 156 (ddl-ix) 7 6B NT NT* 8* 8

380.8SP00 SLV 156 (ddl-viii) 7 14 1b 4b* 6 8

405.9PR99 SLV 156 (ddl-x) 7 18C 2b NT* 9 8

640.2FR94 SLV 156 (ddl-xi) 7 14 2b 4 5* 8

640.3FR96 SLV 156 (ddl-xi) 7 19F 2b 4 5 8

640.5IS99 SLV 156 (ddl-xi) 7 19F 2b 4 5 8

489.1Ca99 SLV 156 (gdh-16) 7 1 10 3 4

405.2BE97 SLV 156 (gdh-8) 7 6B 1b NT 7b 8

327.1FR95 SLV 156 (gki-1) 7 1 10 3 2

393.1FR95 SLV 156 (gki-1) 7 23F 1 10 3 8

336.1UK94 SLV 156 (gki-2) 7 1 10 3 4

393.2SP95 SLV 156 (gki-2) 7 3 1 10 3 8

348.1SP95 SLV 156 (gki-29) 7 11 1 10 3 8

393.1SP95 SLV 156 (gki-7) 7 14 1 10 3 8

405.4FR94 SLV 156 (spi-ii) 7 14 2b NT* NT 8



595.2FR99a SLV 156 (ddl-157) 7 14 1b NT* NT* 8

685.6PL97 173 8 23F 5 7 NT# 8

675.1PL96 173 8 23F NT NT# 16b 8

660.1PL96 272 8 19A 5 7 16 4

685.7PL98 272 8 23F 5 7 16b 16

685.4PL00 272 8 6A 5 7 NT# 16

635.1PL97 1506 8 19F 5 NT NT 8

650.1PL96 2140 8 23F 5 NT* NT* 8

675.2PL97 SLV 173 (ddl-xii) 8 19F 5 7 NT* 8

0.10FR96 180 9 14 7 14 19 0.015

0.21IT95 180 9 23F 7 14 19 0.03

0.36PL98 180 9 3 7 14 19 0.03

0.73Oh93 180 9 3 7 14 19 0.06

630.1SP00 SLV 180 (gdh-11) 9 6B 1b* 4b* 6* 8

0.2BE96 191 10 9V 7 14 19 0.03

0.34PL96 SLV 191 (aroe-i) 10 3 7 14 19 0.03

0.70Oh92 199 11 15 7 14 19 0.06

30.1Oh92 199 11 19A 7 13 18 0.12

60.1Oh92 199 11 19A 7 13 18 0.12

0.82Oh97 199 11 19F NT 13 NT 0.015

0f 419 11 7 14 19 0.03

0.37PR00 232 12 3 7 14 19 0.03

0.57SW99a 232 12 3 7 14 19 0.03

0.22IT96 SLV 232 (ddl-22) 12 3 7 14 19 0.015

105.1Oh93 SLV 37 (ddl-14) 13 23F NT NT NT 0.5

175.1Oh00 SLV 37 (ddl-28) 13 7 14 19 0.03

5.4OH93 SLV 37 (ddl-xiii) 13 23F 7 14 19 0.06

510.1SP94 17 Sc 6B 2b 6 NT 2

655.1SP97 17 Sc 6B 2b 6 8 8

655.2SP97 17 Sc 6A 2b 6 8 8

670.8SP00 17 Sc 8 2b 6 4b 8

685.8SP99a 17 Sc 14 2b 6 4b 8

0.51SP95 260 Sc 23F 7 14 19 0.015

0.49SP94 260 Sc 6B 7 14 19 0.03

595.5IT97 321 Sc 6A 6 8 17 8

640.6IT98 321 Sc 23F 6 8 17 16

0.20IT00 1766 Sc 23F 7 14 19 0.03

0.92FR98 1766 Sc 31 7 14 19 0.03

600.3CR96 TLV 268 (gdh-ii, spi-iii, ddl-xiv) Sc 6B 4 6b 7 8

550.1CR96 TLV 268 (gdh-ii, spi-iii, ddl-xiv) Sc 19A 4 6b 16 8



645.1SL00 TLV 268 (gdh-ii, spi-iii, ddl-xiv) Sc 19A 4 6b 16 8

645.2SL00 TLV 268 (gdh-ii, spi-iii, ddl-xiv) Sc 14 4 6b 16 8

0.47SP00 53 Si 6B 3 1b 7 0.03

0.9FR95 61 Si 18C 7 14 19 0.015

0.8FR94 72 Si 24FA 7 14 19 0.03

0.44SL98 124 Si 6A 7 14 19 0.03

0c 138 Si 7 14 19 0.03

380.5PR00 176 Si 4 7 14 19 8

0.14GE00 177 Si 19F 7 14 NT 0.03

320.1SP97 229 Si 19F NT NT NT 8

560.1JA98 242 Si NT NT NT 4

0.7FR93 280 Si 6B 7 14 19 0.03

0.13FR99 306 Si 23F 7 14 19 0.03

0.16GR98 327 Si 6A 7 14 19 0.03

90.1Oh00a 460 Si 7 14 18 0.06

0.17GR99 574 Si 4 7 14 19 0.03

30.2Oh93 626 Si 23F 7 NT NT 0.06

0.56SW00 681 Si 7 14 19 0.03

0.68Oh92 1390 Si 6A 7 14 19 0.06

0.42SL00 1769 Si 9V 7 14 19 0.03

0.35PL97 2046 Si 7 14 19 0.03

405.8PR98 DLV 1043 (gdh-136, ddl-xv) Si 14 2b NT 7b 8

380.7SL99 DLV 2025 (gki-iii, ddl-xvi) Si 19A 3b NT NT 8



518.1SP95 DLV 66 (gki-10, ddl-xvii) Si 9V 3 NT NT 8

554.1SP95 DLV 90 (aroe-45, xpt-6) Si 19A 2 11 13 8

455.2SP95 DLV 90 (gdh-60, ddl-xviii) Si 14 2b NT NT 8

0.5CR96 SLV 1342 (recp-43) Si 19F 7 14 19 0.03

585.1FR94 SLV 143 (ddl-xix) Si 6B NT NT NT 8

462.1FR96 SLV 143 (gdh-4) Si 1c 10 3 2

598.1FR95 SLV 143 (gki-2) Si 9V 1c 10 3 8

533.1Ny94 SLV 1661 (ddl-17) Si 2 11 3 4

440.1ZA99 SLV 172 (ddl-xx) Si 23F NT 3 NT 8

35.4Oh93 SLV 193 (spi-6) Si 19F 7 14 19 0.06

645.7SP95 SLV 22 (ddl-xxi) Si 9V 2b NT 11 8

20.2Oh93 SLV 252 (xpt-11) Si 19F 7 14 NT 0.06

517.1FR95 SLV 29 (gdh-4) Si 1 10 3 4

0.55SP99 SLV 42 (gki-145) Si 23F 7 14 19 0.03

0.74Oh94 SLV 43 (recp-i) Si 19F 7 14 19 0.015

0.11FR97 SLV 478 (aroe-7) Si 11 7 14 19 0.015

595.4IT95 SLV 478 (spi-6) Si 23F 7 14 2 8

455.3SP96 SLV 5 (ddl-49) Si 19F 2b NT 7 8

The Lab ID is the laboratory identification number used in the present study and can be described as follows: an isolate with a zero to the left of the decimal place (e.g.

0.11FR97S) is susceptible to all antibiotics used for testing in the Alexander Project (minimum of 15, depending on the year). As the numbers to the left of the decimal

place increase, so do the number of antibiotics to which that isolate is resistant. The two-letter code following the number immediately to the right of the decimal place

is associated with the country code, or the state code, if it is an isolate from the United States (SP, Spain; FR, France, IT, Italy; UK, United Kingdom; ZA, South Africa;

CR, Czech Republic; SL, Slovakia; PR, Portugal; GR, Greece; SW, Switzerland; JA, Japan; CH, China (Hong Kong); BE, Belgium; PL, Poland; GE, Germany; IS,

Israel; Ca, California; Oh, Ohio; Ny, New York). NT, non-typeable; Si, singleton isolate; Sc, singleton clone. pbp types with a #next to them indicate a LGT event

based on the criterion of disrupted ST monophyly; * indicates LGT event based on criterion of disrupted clonal complex monophyly; in cases where there are an equal

number of two significantly different pbp types within a clone or clonal complex it is not clear which locus is recombinant, so the LGT indication is arbitrarily applied

to one of them. Housekeeping alleles are indicated for SLV (single locus variant), DLV (double locus variant) and TLV (triple locus variant) designated sequence

types; alleles not present on the MLST database are indicated with small roman numerals; alleles present on the MLST database are indicated with their allele number.

Unless indicated otherwise all isolates are nasopharyngeal.a Isolate from blood.


References

Barnes, D.M., Whittier, S., Gilligan, P.H., Soares, S., Tomasz, A., Henderson,

F.W., 1995. Transmission of multidrug-resistant serotype 23F Streptococcus

pneumoniae in group day care: evidence suggesting capsular transformation

of the resistant strain in vivo. J. Infect. Dis. 171, 890–896.

Cafini, F., del Campo, R., Alou, L., Sevillano, D., Morosini, M.I., Baquero, F.,

Prieto, J., 2006. Alterations of the penicillin-binding proteins and murM

alleles of clinical Streptococcus pneumoniae isolates with high-level resis-

tance to amoxicillin in Spain. J. Antimicrob. Chemother. 57, 224–229.

Coffey, T.J., Daniels, M., Enright, M.C., Spratt, B.G., 1999. Serotype 14

variants of the Spanish penicillin-resistant serotype 9V clone of Strepto-

coccus pneumoniae arose by large recombinational replacements of the

cpsA-pbp1a region. Microbiology 145 (Pt 8), 2023–2031.

Coffey, T.J., Daniels, M., McDougal, L.K., Dowson, C.G., Tenover, F.C., Spratt,

B.G., 1995. Genetic analysis of clinical isolates of Streptococcus pneumo-

niae with high-level resistance to expanded-spectrum cephalosporins. Anti-

microb. Agents Chemother. 39, 1306–1313.

Coffey, T.J., Dowson, C.G., Daniels, M., Zhou, J., Martin, C., Spratt, B.G.,

Musser, J.M., 1991. Horizontal transfer of multiple penicillin-binding

protein genes, and capsular biosynthetic genes, in natural populations of

Streptococcus pneumoniae. Mol. Microbiol. 5, 2255–2260.

Coffey, T.J., Enright, M.C., Daniels, M., Morona, J.K., Morona, R., Hryniewicz,

W., Paton, J.C., Spratt, B.G., 1998. Recombinational exchanges at the

capsular polysaccharide biosynthetic locus lead to frequent serotype

changes among natural isolates of Streptococcus pneumoniae. Mol. Micro-

biol. 27, 73–83.

del Campo, R., Cafini, F., Morosini, M.I., Fenoll, A., Linares, J., Alou, L.,

Sevillano, D., Canton, R., Prieto, J., Baquero, F., 2006. Combinations of

PBPs and MurM protein variants in early and contemporary high-level

penicillin-resistant Streptococcus pneumoniae isolates in Spain. J. Anti-

microb. Chemother. 57, 983–986.

Doit, C., Loukil, C., Fitoussi, F., Geslin, P., Bingen, E., 1999. Emergence in

France of multiple clones of clinical Streptococcus pneumoniae isolates

with high-level resistance to amoxicillin. Antimicrob. Agents Chemother.

43, 1480–1483.

Dowson, C.G., Barcus, V., King, S., Pickerill, P., Whatmore, A., Yeo, M., 1997.

Horizontal gene transfer and the evolution of resistance and virulence

determinants in Streptococcus. Soc. Appl. Bacteriol. Symp. Ser. 26,

42S–51S.

Dowson, C.G., Hutchison, A., Brannigan, J.A., George, R.C., Hansman, D.,

Linares, J., Tomasz, A., Smith, J.M., Spratt, B.G., 1989. Horizontal transfer

of penicillin-binding protein genes in penicillin-resistant clinical isolates of

Streptococcus pneumoniae. Proc. Natl. Acad. Sci. USA 86, 8842–8846.

Dowson, C.G., Hutchison, A., Woodford, N., Johnson, A.P., George, R.C.,

Spratt, B.G., 1990. Penicillin-resistant viridans streptococci have obtained

altered penicillin-binding protein genes from penicillin-resistant strains of

Streptococcus pneumoniae. Proc. Natl. Acad. Sci. USA 87, 5858–5862.

Enright, M.C., Spratt, B.G., 1998. A multilocus sequence typing scheme for

Streptococcus pneumoniae: identification of clones associated with serious

invasive disease. Microbiology 144, 3049–3060.

Feil, E.J., Li, B.C., Aanensen, D.M., Hanage, W.P., Spratt, B.G., 2004.

eBURST: inferring patterns of evolutionary descent among clusters of

related bacterial genotypes from multilocus sequence typing data. J. Bac-

teriol. 186, 1518–1530.

Felmingham, D., Washington, J., 1999. Trends in the antimicrobial suscept-

ibility of bacterial respiratory tract pathogens—findings of the Alexander

Project 1992–1996. J. Chemother. 11 (Suppl. 1), 5–21.

Gherardi, G., Whitney, C.G., Facklam, R.R., Beall, B., 2000. Major related sets

of antibiotic-resistant Pneumococci in the United States as determined by

pulsed-field gel electrophoresis and pbp1a-pbp2b-pbp2x-dhf restriction

profiles. J. Infect. Dis. 181, 216–229.

Grebe, T., Hakenbeck, R., 1996. Penicillin-binding proteins 2b and 2x of

Streptococcus pneumoniae are primary resistance determinants for different


classes of beta-lactam antibiotics. Antimicrob. Agents Chemother. 40, 829–

834.

Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to

estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704.

Hakenbeck, R., Grebe, T., Zahner, D., Stock, J.B., 1999. Beta-lactam resistance

in Streptococcus pneumoniae: penicillin-binding proteins and non-penicil-

lin-binding proteins. Mol. Microbiol. 33, 673–678.

Jacobs, M.R., Felmingham, D., Appelbaum, P.C., Gruneberg, R.N., 2003. The

Alexander Project 1998–2000: susceptibility of pathogens isolated from

community-acquired respiratory tract infection to commonly used antimi-

crobial agents. J. Antimicrob. Chemother. 52, 229–246.

Klugman, K.P., 2002. The successful clone: the vector of dissemination of

resistance in Streptococcus pneumoniae. J. Antimicrob. Chemother. 50

(Suppl. S2), 1–5.

Kosowska, K., Jacobs, M.R., Bajaksouzian, S., Koeth, L., Appelbaum, P.C.,

2004. Alterations of penicillin-binding proteins 1A, 2X, and 2B in Strep-

tococcus pneumoniae isolates for which amoxicillin MICs are higher than

penicillin MICs. Antimicrob. Agents Chemother. 48, 4020–4022.

Majewski, J., Zawadzki, P., Pickerill, P., Cohan, F.M., Dowson, C.G., 2000.

Barriers to genetic exchange between bacterial species: Streptococcus

pneumoniae transformation. J. Bacteriol. 182, 1016–1023.

McCormick, A.W., Whitney, C.G., Farley, M.M., Lynfield, R., Harrison, L.H.,

Bennett, N.M., Schaffner, W., Reingold, A., Hadler, J., Cieslak, P., Samore,

M.H., Lipsitch, M., 2003. Geographic diversity and temporal trends of

antimicrobial resistance in Streptococcus pneumoniae in the United States.

Nat. Med. 9, 424–430.

McGee, L., McDougal, L., Zhou, J., Spratt, B.G., Tenover, F.C., George, R.,

Hakenbeck, R., Hryniewicz, W., Lefevre, J.C., Tomasz, A., Klugman, K.P.,

2001. Nomenclature of major antimicrobial-resistant clones of Streptococ-

cus pneumoniae defined by the pneumococcal molecular epidemiology

network. J. Clin. Microbiol. 39, 2565–2571.

Nesin, M., Ramirez, M., Tomasz, A., 1998. Capsular transformation of a

multidrug-resistant Streptococcus pneumoniae in vivo. J. Infect. Dis.

177, 707–713.

Perez-Trallero, E., Marimon, J.M., Gonzalez, A., Garcia-Rey, C., Aguilar, L.,

2003. Genetic relatedness of recently collected Spanish respiratory tract

Streptococcus pneumoniae isolates with reduced susceptibility to amox-

icillin. Antimicrob. Agents Chemother. 47, 3637–3639.

Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of DNA

substitution. Bioinformatics 14, 817–818.

Potgieter, E., Chalkley, L.J., 1995. Relatedness among penicillin-binding

protein 2b genes of Streptococcus mitis, Streptococcus oralis, and Strepto-

coccus pneumoniae. Microb. Drug Resist. 1, 35–42.

Ramirez, M., Tomasz, A., 1999. Acquisition of new capsular genes among

clinical isolates of antibiotic-resistant Streptococcus pneumoniae. Microb.

Drug Resist. 5, 241–246.

Reichmann, P., Konig, A., Linares, J., Alcaide, F., Tenover, F.C., McDougal, L.,

Swidsinski, S., Hakenbeck, R., 1997. A global gene pool for high-level

cephalosporin resistance in commensal Streptococcus species and Strepto-

coccus pneumoniae. J. Infect. Dis. 176, 1001–1012.

Sa-Leao, R., Tomasz, A., de Lencastre, H., 2001. Multilocus sequence typing of

Streptococcus pneumoniae clones with unusual drug resistance patterns:

genetic backgrounds and relatedness to other epidemic clones. J. Infect. Dis.

184, 1206–1210.

Sa-Leao, R., Vilhelmsson, S.E., de Lencastre, H., Kristinsson, K.G., Tomasz,

A., 2002. Diversity of penicillin-nonsusceptible Streptococcus pneumoniae

circulating in Iceland after the introduction of penicillin-resistant clone

Spain(6B)-2. J. Infect. Dis. 186, 966–975.

Shimodaira, H., 2002. An approximately unbiased test of phylogenetic tree

selection. Syst. Biol. 51, 492–508.

Shimodaira, H., Hasegawa, M., 2001. CONSEL: for assessing the confidence of

phylogenetic tree selection. Bioinformatics 17, 1246–1247.

Spratt, B.G., 2004. Exploring the concept of clonality in bacteria. Meth. Mol.

Biol. 266, 323–352.

Spratt, B.G., Greenwood, B.M., 2000. Prevention of pneumococcal disease by

vaccination: does serotype replacement matter? Lancet 356, 1210–1211.

Spratt, B.G., Hanage, W.P., Brueggemann, A.B., 2004. Evolutionary and

population biology of Streptococcus pneumoniae. In: Tuomanen , E.I.,

Mitchell, T.J., Morrison, D.A., Spratt, B.G. (Eds.), The Pneumococcus.

ASM Press, Washington, DC, pp. 119–136.

Stanhope, M.J., Walsh, S.L., Becker, J.A., Italia, M.J., Ingraham, K.A., Gwynn,

M.N., Mathie, T., Poupard, J.A., Miller, L.A., Brown, J.R., Amrine-Madsen,

H., 2005. Molecular evolution perspectives on intraspecific lateral DNA

transfer of topoisomerase and gyrase loci in Streptococcus pneumoniae,

with implications for fluoroquinolone resistance development and spread.

Antimicrob. Agents Chemother. 49, 4315–4326.

Tettelin, H., Nelson, K.E., Paulsen, I.T., Eisen, J.A., Read, T.D., Peterson, S.,

Heidelberg, J., DeBoy, R.T., Haft, D.H., Dodson, R.J., Durkin, A.S., Gwinn,

M., Kolonay, J.F., Nelson, W.C., Peterson, J.D., Umayam, L.A., White, O.,

Salzberg, S.L., Lewis, M.R., Radune, D., Holtzapple, E., Khouri, H., Wolf,

A.M., Utterback, T.R., Hansen, C.L., McDonald, L.A., Feldblyum, T.V.,

Angiuoli, S., Dickinson, T., Hickey, E.K., Holt, I.E., Loftus, B.J., Yang, F.,

Smith, H.O., Venter, J.C., Dougherty, B.A., Morrison, D.A., Hollingshead,

S.K., Fraser, C.M., 2001. Complete genome sequence of a virulent isolate of

Streptococcus pneumoniae. Science 293, 498–506.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving

the sensitivity of progressive multiple sequence alignment through sequence

weighting, position-specific gap penalties and weight matrix choice. Nucl.

Acids Res. 22, 4673–4680.

Trzcinski, K., Thompson, C.M., Lipsitch, M., 2004. Single-step capsular

transformation and acquisition of penicillin resistance in Streptococcus

pneumoniae. J. Bacteriol. 186, 3447–3452.

White, A.R., Kaye, C., Poupard, J., Pypstra, R., Woodnutt, G., Wynne, B., 2004.

Augmentin (amoxicillin/clavulanate) in the treatment of community-

acquired respiratory tract infection: a review of the continuing development

of an innovative antimicrobial agent. J. Antimicrob. Chemother. 53 (Suppl.

1), i3–i20.

Yother, J., 2004. Capsules. In: Tuomanen, E.I., Mitchell, T.J., Morrison, D.A.,

Spratt, B.G. (Eds.), The Pneumococcus. ASM Press, Washington, DC, pp.

30–49.

Documents

The relative frequency of intraspecific lateral gene transfer of penicillin binding proteins 1a, 2b, and 2x, in amoxicillin resistant Streptococcus pneumoniae