Impaired expression of the peroxisome proliferator–activated receptor alpha during hepatitis C virus infection

Impaired Expression of Peroxisome Proliferator–ActivatedReceptor � in Ulcerative Colitis

LAURENT DUBUQUOY,* EMMELIE A JANSSON,‡ SAMIR DEEB,§ SABINE RAKOTOBE,�

MEHDI KAROUI,* JEAN–FREDERIC COLOMBEL,* JOHAN AUWERX,¶ SVEN PETTERSSON,‡

and PIERRE DESREUMAUX**Equipe Propre INSERM 0114 sur la Physiopathologie des Maladies Inflammatoires Intestinales, Lille, France; ‡Division of MolecularPathology, MTC, Karolinska Institutet, Stockholm, Sweden; §Departments of Medicine and Genome Sciences, University of Washington,Seattle, Washington; �UEPSD, INRA, Jouy-en-Josas, France; and ¶Institut de Genetique et Biologie Moleculaire et Cellulaire, Illkirch, France

See editorial on page 1538.

Background & Aims: The peroxisome proliferator–acti-vated receptor � (PPAR�) has been proposed as a keyinhibitor of colitis through attenuation of nuclear factor�B (NF-�B) activity. In inflammatory bowel disease, ac-tivators of NF-�B, including the bacterial receptor toll-like receptor (TLR)4, are elevated. We aimed to deter-mine the role of bacteria and their signaling effects onPPAR� regulation during inflammatory bowel disease(IBD). Methods: TLR4-transfected Caco-2 cells, germ-free mice, and mice devoid of functional TLR4 (Lpsd/Lpsd mice) were assessed for their expression of PPAR�in colonic tissues in the presence or absence of bacteria.This nuclear receptor expression and the polymorphismsof gene also were assessed in patients with Crohn’sdisease (CD) and ulcerative colitis (UC), 2 inflammatorybowel diseases resulting from an abnormal immuneresponse to bacterial antigens. Results: TLR4-trans-fected Caco-2 cells showed that the TLR4 signaling path-way elevated PPAR� expression and a PPAR�-depen-dent reporter in an I�� dependent fashion. Murine andhuman intestinal flora induced PPAR� expression incolonic epithelial cells of control mice. PPAR� expres-sion was significantly higher in the colon of controlcompared with Lpsd/Lpsd mice. Although PPAR� levelsappeared normal in patients with CD and controls, UCpatients displayed a reduced expression of PPAR� con-fined to colonic epithelial cells, without any mutation inthe PPAR� gene. Conclusions: These data showed thatthe commensal intestinal flora affects the expression ofPPAR� and that PPAR� expression is considerably im-paired in patients with UC.

The peroxisome proliferator–activated receptor �(PPAR�) is a nuclear receptor initially identified

for its role in regulating the expression of genes involved

in metabolism and adipocyte differentiation.1 PPAR� isexpressed in tissues outside the adipose lineage, with thehighest expression observed in colonic epithelia. In vitrostudies have shown that PPAR� can suppress an inflam-matory response by limiting the production of chemo-kines and cytokines secreted from myeloid and epithelialcells.2–4 The molecular mechanisms of this suppressionremain unknown. PPAR� agonists can attenuate colitisin mouse models when administered in vivo.5,6 Theobservation that PPAR� � heterozygous mice exhibit anincreased susceptibility to develop colitis further sup-ports the hypothesis that PPAR� has an important rolein homeostasis within the gastrointestinal tract.6

PPAR� expression is predominantly confined to theepithelial surface layer with low, if any, expressionwithin the crypts of colonic cells.4 The underlying mo-lecular mechanisms accounting for the spatial distribu-tion of PPAR� expression as well as the regulation of thePPAR� promoter in epithelial cells are unknown. Afterstress-induced signals such as mechanical damage orinfection, several receptors intimately connected to hostdefense and repair mechanisms are expressed and acti-vated. Bacterial-recognition molecules such as the toll-like receptor (TLR)4 become activated after epithelialdamage in the gastrointestinal tract.7 This scavengerreceptor can respond to lipopolysaccharide (LPS) andactivate nuclear factor � B (NF-�B), a known masterregulator of inflammation. NF-�B levels are elevated inthe intestinal mucosa of patients with Crohn’s disease

Abbreviations used in this paper: CF, commensal flora; dnIKK, dom-inant-negative I�B kinase; GF, germ free; HF, human-flora; LPMC,lamina propria mononuclear cell; LPS, lipopolysaccharide; NF-�B, nu-clear factor-kappa B; OD, optical density; PBMC, peripheral bloodmononuclear cell; PCR, polymerase chain reaction; PPAR�, peroxi-some proliferator-activated receptor �; RPA, ribonuclease protectionassay; TLR, toll-like receptors; WT, wild type.

© 2003 by the American Gastroenterological Association0016-5085/03/$30.00

doi:10.1016/S0016-5085(03)00271-3

GASTROENTEROLOGY 2003;124:1265–1276

(CD) and ulcerative colitis (UC).8 These patients displaychronic intestinal inflammation characterized by an im-paired capacity of the innate immune system to maintainhomeostasis with luminal bacteria.9,10 It has been hy-pothesized that the commensal flora (CF) possesses thecapacity to attenuate or block activation of the innateimmune system through yet unknown mechanisms. Theelevated levels of NF-�B in inflammatory bowel disease(IBD) patients may in part be explained by lack ofinhibitory signals, perhaps mediated through bacterialflora and their known receptors.10,11 The abilities ofPPAR� to suppress inflammation and the property ofTLR4 to activate inflammation led us to suggest thatthese 2 antagonistic signaling pathways in colonic epi-thelial cells may be cross-coupled.

Here we report that bacterially induced signals, viaTLR4, affect the expression of PPAR� both in in vitrocell lines and in mice. We also show that colonic epi-thelial cells from UC patients, but not CD patients,display very low levels of PPAR� expression. The im-plications of these observations are discussed in the con-text of microbe-host interactions in the alimentary tract.

Materials and Methods

Transient Transfections in Cell Lines

The colon carcinoma cell line Caco-2 (ATCC HTB-37)was used for all transient transfections and RNA expressionanalysis. Caco-2 cells were transfected using the FuGENEtransfection reagent according to the manufacturer (RocheDiagnostics Corporation, Indianapolis, IN) and RNA was pre-pared after 48 hours. The luciferase assay (SDS/Promega, Mad-ison, WI) was used according to instructions from the manu-facturer. SDS/Promega describes all reporter gene constructs,the Tk-promoter-luciferase from firefly, and the renilla-lucif-erase construct. The constitutively active mCD4/toll is a chi-meric construct in which the extracellular portion from themouse CD4 receptor has been fused to the transmembrane andintracellular cytoplasmic tail of the human TLR4.13 A mini-mal promoter construct containing 2 copies of a peroxisomeproliferator response element obtained from the cytochromep450 4A (2XCYP) was used to assess PPAR� activity inCaco-2 cells. Ligand induction with LPS (Sigma, Stockholm,Sweden) was performed with 50 ng/mL-1 for 24 hours or fortimes otherwise indicated. The PPAR� synthetic ligand rosi-glitazone (BRL-49653; a kind gift from SmithKlineBeecham,Tonbridge, UK) also was added in the culture solution for 24hours, or as stated in the individual experiments. To evaluateif one of the predominant I�B-kinases within the NF-�Bsignaling pathway, namely I�B kinase (IKK�), was involvedin the regulation of PPAR� activation, cotransfection experi-ments using a dominant-negative form of IKK� (dnIKK�)were included.14

Mice Strains

Adult C3H/He, LPS-responsive, female mice wereused and fed ad libitum a commercial rodent diet (R03-40;UAR, Villemoisson-sur-Orge, France) sterilized by �-ray irra-diation (40 KGy). Germ-free (GF) mice and mice colonizedwith human-flora (HF) were housed in a Trexler plastic isolator(La Cahlene, Velizy, France). HF mice were developed by 2gastric inoculations of 5-week-old GF mice at a 24-hourinterval, each with 0.5 mL of a 10�2 dilution of fresh humanfecal homogenate prepared as described previously.12 This floracontained predominantly Bacteroides, Eubacterium, Peptostrepto-coccus, Clostridium, Plectridium, Escherichia coli, and Streptococcus.After 1 week, fecal samples from HF mice were collected andthe predominant flora (i.e., �108 bacteria/g�1 of feces) wasanalyzed to verify implantation of the human fecal flora.12

C3H/He mice with CF were bred under standard conditions inour accredited animal facilities. All C3H/He female mice withor without flora were killed at the age of 10–12 weeks. TheLPS-nonresponder mice C3H/HeJ (Lpsd/Lpsd) (a naturally oc-curring mutation within the third exon of the TLR4 gene) andtheir wild-type (WT) LPS-responsive littermates C3H/HeouJ(Lpsn/Lpsn), were obtained from Institut Cochin (P. Podevin,M.D., Paris, France). All mice were killed at 8 weeks of age.The colons of all mice were removed and immediately frozen orparaffin embedded for immunohistochemistry.

Patients and Tissue/Cells Processing

A local ethics committee approved the study and all111 subjects gave informed consent. Colonic biopsy sampleswere taken from inflamed, as well as macroscopically andhistologically healthy mucosa from 30 patients with UC (13women; 17 men; mean age, 35 years; range, 17–71 years) and38 patients with CD (23 women; 15 men; mean age, 31 years;range, 18–64 years). The diagnosis of UC and CD was estab-lished using standard criteria. The mean duration of the diseasewas 4.8 � 0.8 and 5.6 � 1.2 years, respectively.15 No patientreceived immunosuppressive or steroid treatments for at least3 weeks before the beginning of the study. As controls, colonicbiopsy samples were taken under the same conditions in 43patients with irritable bowel syndrome (13 women; 19 men;mean age, 53 years; range, 28–73 years) or diverticulitis of thesigmoid colon (5 women; 6 men; mean age, 55 years; range,44–75 years). Because PPAR� is expressed at very low levelsin the small bowel, only colonic biopsy specimens were takenfrom the digestive tract in the 111 patients (68 with IBD and43 controls) included in the study. All biopsy specimens weretaken with the same endoscopic forceps and all samples had asimilar size and a mean weight of 4 � 1 mg. Because it hasbeen shown that mucosal levels of PPAR� were higher in thedistal colon but similar from the rectum to the transversecolon, all biopsy samples in patients with IBD and controlswere limited to the rectum, left colon, and transverse colon toensure that all specimens for PPAR� levels were comparablewithin each group studied.4 Biopsy samples were cut into 2parts. One part was immediately frozen in liquid nitrogen,

1266 DUBUQUOY ET AL. GASTROENTEROLOGY Vol. 124, No. 5

stored at �80°C, then analyzed for PPAR� messenger RNA(mRNA)/protein levels and TLR4 immunostaining. The otherpart was fixed in fresh 4% paraformaldehyde/phosphate-buff-ered saline and embedded in paraffin for PPAR� immuno-staining. Peripheral blood mononuclear cells (PBMCs) wereisolated from 18 patients with UC, 23 with CD, and 14controls.16 DNA also was extracted from blood samples of 53patients with UC and from 1158 controls chosen in a randompopulation from the Lille area to study the polymorphisms ofthe PPAR� gene and promoter.

Isolation of Epithelial Cells From Patients

Epithelial cells were extracted from resected colonicspecimens as described by Toy et al.17 Mucosal layers weredissected away from the muscular and serosal layers and incu-bated in RPMI medium 1640 containing 0.5 mmol/L dithio-threitol. Mucosal fragments were rinsed in calcium- and mag-nesium-free Hank’s balanced salt solution supplemented withheat-inactivated fetal calf serum (5%), L-glutamine, and 500mmol/L ethylenediaminetetraacetic acid. The epithelial cellswere collected at the interface of a Percoll gradient. Theviability of epithelial cells evaluated by Trypan blue stainingwas greater than 85%. After several washes, cells were frozenat �20°C.

Quantification of Peroxisome Proliferator-Activated Receptor �, PeroxisomeProliferator-Activated Receptor �, and�-Actin Messenger RNA by Reverse-Transcription Competitive PolymeraseChain Reaction and RibonucleaseProtection Assay

RNA was isolated from colonic samples and PBMCswith the TRIzol reagent (Life Technologies, Cergy Pontoise,France) as described previously.18 After treatment at 37°C for30 minutes with 20–50 U of DNase I Ribonuclease-free(Roche Diagnostics Corporation, Indianapolis, IN), the totalRNA (10 �g) was reverse-transcribed into complementaryDNA. The retrotranscription reaction mixture was amplifiedby polymerase chain reaction (PCR) using sense and anti-senseprimers specific for PPAR�, PPAR�, and �-actin.18,19 Thesamples were subjected to 40 PCR cycles (Perkin-Elmer Cor-poration, Foster City, CA). Quantification of complementaryDNA was performed by electrophoresis in 2% to 3% agarosegel using an image analyzer (Gel Analyst; Clara Vision, Paris,France)20 and the number of PPAR� mRNA molecules wasexpressed as compared with the number of 105 mRNA mol-ecules of an internal control, �-actin.

The RNA also was analyzed by ribonuclease protection assay(RPA) as described previously21 and the expression was ana-lyzed using phosphoimager quantification (BAS 1500; Fuji,Tokyo, Japan). The riboprobe for PPAR� was generated byHind III-Hind III cleavage of PPAR� complementary DNA,and subsequent cloning into pCDNA3 (New England Biolabs,Hitchin, UK). A 467-bp nonprotected radioactive riboprobe

was achieved by in vitro transcription of KpnI cut vector withT7 polymerase (Promega) in the presence of � [32P]UTP(Amersham Pharmacia Biotech, Uppsala, Sweden). Treatmentwith Ribonuclese T1 and Ribonuclese A generated a 346-bpprotected fragment when hybridized to a correctly initiatedtranscript. Quantification was made by comparison of thelevels of PPAR� specific transcript with the internal standard.The heat-shock protein 70, used as an internal standard, aswell as the �-actin, have been described previously.22,23

Quantification of Peroxisome Proliferator-Activated Receptor � and PeroxisomeProliferator-Activated Receptor � byWestern Blot Analysis

Protein preparation and immunoblotting were per-formed in colonic biopsy samples, extracted epithelial cells,and PBMCs as described previously.24 Total protein extractswere obtained by homogenization of tissues and PBMCs in anextraction buffer consisting of phosphate-buffered saline with1% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecylsulfate, and a classic protease inhibitor cocktail (ICN Pharma-ceuticals, Orsay, France). Total proteins were then separated bypolyacrylamide gel electrophoresis and electroblotted.4 Poly-vinylidendifluoride membranes were incubated overnight withrabbit anti-serum directed against PPAR� (1/500; TEBU, LePerray en Yveline, France) or PPAR� (1/1000; Geneka,Souffelweyersheim, France). Immunodetection with a swinesecondary peroxidase-conjugated antibody (1/1000; Dako,Trappes, France) and chemiluminescence was performed ac-cording to the manufacturer’s protocol (ECL, Amersham, UK).The results were expressed as the units of optical density per 5ng of total protein.

Peroxisome Proliferator-Activated Receptor� and TLR4 Immunostainings in Mice andHuman Colon

Paraffin-embedded colonic biopsy specimens were pre-incubated with a blocking solution containing avidin D andbiotin (Blocking Kit, SP2001; Vector Laboratories, Burlin-game, CA) and were then exposed overnight to the primaryrabbit polyclonal antibody directed against PPAR� (dilution1/50; WAK-CHEMIE, Bad Soden, Germany). Samples wererinsed in phosphate-buffered saline containing Triton 0.05%and incubated with an Alexa 488-coupled secondary swineanti-rabbit antibody (1/100 dilution during 1 hr; MolecularProbes, Eugene, OR). Immunofluorescence was revealed undera fluorescence microscope and nuclei of cells were stained withbis-benzimide.

For TLR4 detection, we used frozen human colonic biopsysamples because paraffin-embedded sections caused autofluo-rescence. Sections of 5 �m were exposed for 2 hours at roomtemperature to a mouse antibody directed against TLR4 (1/50dilution, Imgenex; Clinisciences, Montrouge, France) and thenincubated for 1 hour with an Alexa 594-coupled donkeyanti-mouse antibody (1/100 dilution; Molecular Probes).

May 2003 PPAR� IN ULCERATIVE COLITIS 1267

For double-staining analysis, we first stained a single frozensection with the antibody directed against TLR4 as describedpreviously, and then submitted the same section to the anti-PPAR� antibody, followed by an incubation with the Alexa594- and Alexa 488-coupled secondary antibody.

Immunofluorescence was revealed under a fluorescence mi-croscope (Leica, Bensheim, Germany) and nuclei of cells werestained with bis-benzimide. As negative controls, primaryantibody was omitted or replaced with irrelevant rabbit ormouse sera.

Polymorphism of Peroxisome Proliferator-Activated Receptor � Gene and Promoter

Standard techniques were used to prepare genomicDNA from biopsy material and then used as templates forPCR reactions. The PCR was performed for 30 cycles withannealing at 64°C to 66°C and the product was labeled byincorporation of [32P] deoxycytidine triphosphate during am-plification with different primers spanning the PPAR� exonsand promoter (Table 1). Single-strand conformation polymor-phism analysis was performed as described previously.25 Forsingle-strand conformation polymorphism analysis, 1.5 �L ofa 1/50 dilution of the PCR products were electrophoresed ona 6% nondenaturing polyacrylamide gel. PCR products thatdisplayed variant conformers were sequenced directly.

Statistical Methods

Comparisons of the mean � SEM PPAR� mRNA andproteins between patients with UC and CD and controls wereanalyzed by the nonparametric Kruskal–Wallis one-wayANOVA test. Differences were statistically significant ifP 0.05.

ResultsTLR4 Can Regulate PeroxisomeProliferator-Activated Receptor �Expression in Colonic Epithelial Cells

To assess whether a TLR4-mediated signal couldaffect PPAR� expression, Caco-2 cells were used becausethis particular cell line has low baseline levels of TLR4expression.26 The cells were stimulated with LPS for 24hours and PPAR� expression was monitored by an RPA.As shown in Figure 1A, LPS significantly up-regulatedthe expression of PPAR� by approximately 3-fold com-pared with cells transfected with an empty vector. Theup-regulation of PPAR� was observed after 24 hours andit is therefore possible that the induction may be post-transcriptional, thus, being similar to the reported reg-ulation of PPAR� in adipocytes.27 To circumvent the useof LPS, Caco-2 cells were transfected with a constitu-tively active form of TLR4, the mCD4/toll construct (seethe Materials and Methods section). This transfectionshowed an increase in PPAR� mRNA levels, similar tothe wt-TLR4 results (Figure 1A). Analysis of PPAR�activity on a PPAR�-dependent reporter gene (2XCYP)transfected into Caco-2 cells and cotransfected with themCD4/toll, showed that TLR4 signals could modestlyelevate reporter gene activity (Figure 1B, 2-fold activa-tion). This increased PPAR�-dependent reporter geneactivity was suppressed by the dnIKK� in a dose-depen-dent fashion (Figure 1C). These results indicate thatTLR4-mediated signaling can affect PPAR� expression andactivation, which appears to be, in part, IKK� dependent.

Bacteria and Toll-Like Receptor 4 RegulatePeroxisome Proliferator-Activated Receptor� Expression in Primary Colonic MouseEpithelial Cells

To assess the possible cross-talk between theTLR4 receptor signaling and PPAR� expression,PPAR� expression was determined in vivo. For thispurpose, we analyzed PPAR� expression by immunohis-tochemistry in the colon of mice kept under GF condi-tions or colonized with intestinal CF or HF. PPAR� wasbarely detectable in colonic tissue from GF mice (Figure2A). Some mononuclear cells of the lamina propria dis-played low but distinct levels of PPAR�. This stainingin mononuclear cells was detectable at similar levels inboth commensal and GF mice. However, colonizationwith CF or HF dramatically increased PPAR� levelsselectively at the mucosal surface (Figure 2A). Interest-ingly, the PPAR� signal was located in the cytoplasmiccompartment and not within the nucleus, as previouslydescribed in cell lines.4 Additional experiments per-

Table 1. Human Oligonucleotide Sequencesfor Genetic Study

Primer Sequence

Pr 1F 5TTGGGCTTCACAAATCAGTAGAG3Pr 1R 5ACACTGTCTCGCCGGTGACC3Pr 2F 5CTGAACATGTGGTCACCGGCG3Pr 2R 5CAGCATGGAATATGGGTTTGCTG3Exon BF 5GACAAAATATCAGTGTGAATTCACGC3Exon 5R 5CCCAATAGCCGTATCAGGAAGG3Exon 1F 5GGTTGACACAGAGATCGCATTC3Exon 1R 5GACCAATTCTAGTCCTAGTAGTCTG3Exon 2F 5GGTGGCTTGCCTGTTGCC3Exon 2R 5CACCTTGCATCCTTCACAAGC3Exon 3F 5GGCTGTAGGTTCGTGCTTCC3Exon 3R 5GTGTCCACTGGTCTGGCAGC3Exon 4F 5GTGTTCAGAGCTGTAGTAATCC3Exon 4R 5CCCAATGAAGACAGCAGAAGAG3Exon 5-1F 5CTGTGAGTTAGAAATCTCCAAGTC3Exon 5-1R 5GGCATACTCTGTGATCTCCTGC3Exon 5-2F 5CGCTCCGTGGAGGCTGTGCAGG3Exon 5-2R 5GCTGCTGTCATCTAATTCCAGTGC3Exon 6F 5CCGCCCAGGTTTGCTGAATGTG3Exon 6R 5CAGTGGCTCAGGACTCTCTG3

F, forward; R, reverse.


formed with colonic specimens prepared from TLR4-mutant mice displayed virtually undetectable expressionof PPAR� (Figure 2B). In contrast, the TLR4-positivecontrol mice showed PPAR� staining in the colonicmucosa similar to that observed in mice colonized withcommensal or human flora (Figure 2). We conclude thatthe TLR4 receptor and bacteria can regulate the expres-sion of PPAR�.

Lowered Levels of Peroxisome Proliferator-Activated Receptor� Messenger RNA inColonic Mucosa of Ulcerative Colitis Patients

In patients with CD, but not with UC, the site ofthe chronic inflammation is coupled with accumulationof intra-abdominal fat.28 PPAR� has been reported to bea key regulator of adipogenesis.1 The lack of mesentericfat hypertrophy in UC patients suggests that the levels ofPPAR� may be different in CD and UC patients. By useof retrotranscription competitive PCR technique, wequantified PPAR� mRNA in colonic biopsy samples

taken from these 2 patient groups and compared themwith levels obtained from healthy controls. AlthoughPPAR� mRNA levels were reduced both in CD and UCpatients, the levels were significantly lower in UC pa-tients compared with controls (Figure 3A). PPAR� lev-els were reduced both in inflamed and in noninflamedtissue. Comparable concentrations of �-actin RNA wereobserved in all 3 groups tested. Subsequent statisticalanalysis showed that PPAR� levels are significantlylower in UC patients than in CD patients (P � 0.025)and healthy controls (P � 0.034). Additional RPA anal-ysis confirmed UC patients displayed lower levels ofPPAR� compared with CD patients (Figure 3B ).

The Peroxisome Proliferator-ActivatedReceptor� Protein is Barely Detectable inPatients With Ulcerative Colitis

Western blot analysis in whole biopsy specimensrevealed a band with a molecular weight of 57 kilodal-tons corresponding to PPAR� (Figure 4A). The levels of

Figure 1. Modulation of PPAR� expression and activation by TLR4 in Caco-2 cells. (A) Increased expression of PPAR� mRNA compared with aninternal standard after stimulation of Caco-2 cells with LPS (50 ng/mL�1) or transfection with the constitutive active TLR4 (mCD4/toll). (B ) Caco-2cells transfected with the response element for PPAR� (2XCYP) and PPAR�1 or the constitutive active TLR4 (mCD4/toll) showed a 2- or 3-foldactivation, suggesting that the enhancement of PPAR� reporter gene activity might be owing to an increased expression of PPAR�. (C) CaCo-2cells transfected with 2XCYP and mCD4/toll displayed a 3-fold increase of the reporter gene activity. This induction was limited by the additionof 1 �g of a dnIKK�, which blocks the NF-�B pathway. Two �g of dnIKK suppressed the effect of the TLR4 signals on PPAR� reporter gene activity.Stimulation of PPAR� with the synthetic ligand BRL 49653 (10 �mol/L) resulted in an 6- to 8-fold increased reporter gene activity. Results areexpressed as fold activation (mean � SEM) compared with cells transfected with an empty vector.


PPAR� protein in healthy colonic mucosa of UC patientswere approximately 60% lower compared with thehealthy colonic mucosa of patients with CD (P � 0.013)and controls (P � 0.003) (Figure 4A and B). In contrast,similar levels of the PPAR� protein were found in biopsysamples from CD patients and healthy controls.

To evaluate if the impaired expression of PPAR� inUC patients was unique to PPAR�, the PPAR� mRNAand protein levels were determined. Similar levels ofPPAR� mRNA (expressed as molecules of PPAR�mRNA per 104 molecules of �-actin mRNA) and pro-tein (expressed as optical density [OD] of PPAR� per 50ng of total protein) were found in patients with UC(29 � 20 molecules and 15.9 � 10.6 OD) comparedwith CD patients (20 � 8 molecules and 15.9 � 2.0OD) and controls (31 � 24 molecules and 11.2 � 7.7OD). Hence, UC patients exhibit a considerable im-paired expression level of PPAR� in colonic cells com-pared with CD patients and healthy controls.

Lowered Expression of the PeroxisomeProliferator-Activated Receptor � Protein isConfined to the Epithelial Cells

To determine whether the observed lowered ex-pression of PPAR� was cell-type restricted or more

generalized, additional immunohistochemistry was per-formed. Biopsy samples were obtained from healthy co-lonic mucosa of controls and noninflamed mucosa fromCD and UC patients, respectively, and stained with anantibody recognizing the human PPAR�. PPAR�stained positively in healthy controls and in biopsy sam-ples taken from CD patients. As previously reported,29

expression was confined to surface-level epithelial cellsbut not at the bases of the crypts (Figure 5A and B).However, a faint staining also was observed in a fewlamina propria mononuclear cells (1% to 3% of cellslocated in the lamina propria), having the morphologicappearance of macrophages at higher magnification. Incontrast, colonic biopsy samples taken from UC patientsshowed no detectable levels of PPAR� in the epitheliallayer, despite a labeling preservation in the mononuclearcells of the lamina propria (1% to 5%) (Figure 5C).Subsequent comparison of PPAR� levels in purified ep-ithelial cells prepared from surgical specimens from UC,CD, and control patients confirmed the dichotomy. Nodetectable level of PPAR� was observed in epithelialcells purified from UC patients (Figure 5D). Thus, weconclude that UC patients show a dramatically reducedexpression level of PPAR� in their colonic epithelial cells.

Figure 2. Regulation of PPAR� expression by bacteria and TLR4 in the colon of mice. PPAR� immunostainings in colonic sections of mice(magnification �250). (A) PPAR� staining (green) was observed at the colonic epithelial surface of mice having an intestinal CF or HF. Almostno PPAR� staining was found in the epithelial layer of colonic sections of GF mice. (B ) PPAR� expression in epithelial cells from control mice(C3H/HeouJ, left) or TLR4 mutant mice (C3H/HeJ, right). PPAR� was expressed in epithelial cells at the top of the epithelium of C3H/HeouJ(Lpsn/Lpsn) mice but absent in the colon of C3H/HeJ (lpsd/lpsd) mice.


Peripheral Blood Cells Obtained FromUlcerative Colitis Patients Display NormalPeroxisome Proliferator-Activated Receptor� Expression

To determine whether the reduced expression ofPPAR� in UC patients was restricted to epithelial cells,the expression levels of PPAR� in PBMCs extracted fromblood samples of patients with IBD and controls wereanalyzed. Retrotranscription competitive PCR and

Western blot revealed almost comparable levels ofPPAR� both at mRNA and protein levels in patientswith UC compared with CD patients and healthy con-trols (Figure 6A and B). Thus, the defective expression ofPPAR� appears to be restricted to colonic epithelialcells.

Lowered Peroxisome Proliferator-ActivatedReceptor � Expression is not Caused byAbsence of Toll-Like Receptor 4 Expression

To determine the expression levels of PPAR� andTLR4 expression in the colon specimens of patients withUC and CD, double stainings using 2-color fluorescencewere performed and compared in healthy and inflamed

Figure 4. Impaired PPAR� protein levels in UC patients. PPAR� pro-tein levels were determined by Western blot analysis. Protein extractswere prepared from whole, noninflamed colonic mucosa of patientswith UC, CD, and biopsy samples obtained from control patients. (A)Immunodetection of PPAR� protein (approximately 57 kilodaltons) inthe colon of 3 representative patients with UC, CD, and controls,respectively. (B ) PPAR� levels (mean OD � SEM) in the colon ofpatients with UC (black), CD (grey), and controls (white). The number(n) of patients as well as the statistical significance (p) are indicated.

Figure 3. Impaired mRNA expression of PPAR� in UC patients. (A)PPAR� mRNA levels were determined by retrotranscription-competi-tive PCR in healthy mucosa of control patients (controls), mucosa ofpatients with CD (CDh, healthy) and CDi (inflamed), and of patientswith UC (UCh and UCi). The number of patients as well as thestatistical significance are indicated. Results are expressed as themean value � SEM of each subgroup. (B ) A representative RPA.PPAR� mRNA levels determined by a RPA protection assay, measuringthe specific transcript of PPAR�, correlated to an internal standard,the �-actin transcript. The autoradiograph shows 3 representativepatients with CD or UC.


colonic mucosa from IBD patients and control patientswith diverticulitis of the sigmoid colon. Low and dullTLR4 staining was observed in the healthy colon ofpatients with CD, UC, and controls (Figure 7D–F). Incontrast, pronounced TLR4 expression was detected inepithelial cells of inflamed colon taken from UC and CDpatients (Figure 7G and H), whereas the levels of TLR4were modest in the inflamed colon of control patientswith diverticulitis of the sigmoid colon (Figure 7I).Double TLR4 and PPAR� stainings showed a positivesignal of only TLR4 in UC in favor of an imbalancebetween PPAR� and TLR4 expression (Figure 7J). Us-ing the same method of analysis, predominant PPAR�staining recognized by green fluorescence was observedin control patients with diverticulitis of the sigmoidcolon (Figure 7L). Superimposition of both signals re-vealed a distinct yellow signal resulting from combinedred (TLR4) and green (PPAR�) signals only in theinflamed colon of CD patients (Figure 7K). Negative

controls in which any primary antibodies were omittedand replaced by irrelevant sera displayed neither red norgreen staining (Figure 7A–C).

Taken together, these results underlie an impairedexpression of PPAR� by colon epithelial cells of patientswith UC and suggest an imbalance between PPAR� andTLR4 in the colon of UC patients.

No Mutations Were Detected in thePeroxisome Proliferator-Activated Receptor� Gene/Promoter

To rule out a possible genetic mechanism under-lying the reduced expression of PPAR� in UC patients,DNA was collected and subjected to sequencing. ThePPAR�2 promoter (up to �665 bp from the transcrip-tion start site), coding sequences, and intron-exon junc-tions were amplified by PCR and subjected to single-strand conformation polymorphism analysis. The onlyvariants found were the previously described Pro12Ala

Figure 5. UC patients display impaired expression of PPAR� in colonic epithelial cells. (A–C) PPAR� immunostainings (green) in sectionsobtained from (A) healthy controls and noninflamed biopsy specimens from (B ) CD and (C) UC patients, respectively (magnification 250�). (A)PPAR� staining in epithelial cells from control patients. A few lamina propria mononuclear cells (LPMCs) were labeled (1% to 3%). (B ) Stainingof epithelium from CD patients. Slightly more LPMCs were labeled (5% to 10%). (C) Colon sections of patients with UC. There was no stainingin the epithelium layer despite a labeling preservation in the lamina propria involving about 1% to 5% of LPMCs. (D) Western blot analysis ofPPAR� protein in purified epithelial cells (as described in the Materials and Methods section) from the colonic mucosa of representative control,CD, and UC patients.


substitution (Pro allele) in exon B and the synonymous Cto T substitution (T allele) at nucleotide position 161 inexon 6.30,31 The frequencies of the Pro allele (0.12 vs.0.11) and T allele (0.14 vs. 0.14) were similar in patientswith UC compared with a random population samplefrom the Lille area (data not shown).32

These results show that mutations in the PPAR� geneand promoter are unlikely to explain the impaired ex-pression of PPAR� in UC. Thus, epigenetic events maybe involved in deregulating PPAR� in colon epithelialcells.

DiscussionIntestinal colonic epithelial cells are an important

barrier between luminal bacteria and the adaptive im-mune cells of the lamina propria. The epithelial liningrepresents a well-documented player in mucosal ho-meostasis. These cells secrete many mediators such ascytokines or chemokines in response to bacterial trigger-ing, in part via the TLR4 receptor.33 As much as thesecells secrete all the mediators—to promote inflamma-tion—they may do so in their sole purpose to ensureinduction of repair mechanisms in their attempts torestore wound healing. Among the players involved inboth inflammation and wound repair is NF-�B. In ad-dition, although many reports have linked TLR4-medi-ated signaling to the activation of NF-�B,34 little isknown about the mechanisms that inhibit the TLR4signaling.

Recent studies have shown that the nuclear receptorPPAR� can inhibit NF-�B activation and cytokine ex-pression in monocytes35 and in murine and human co-lonic epithelial cells.5,6,36 In the present study, we ob-served that commensal murine or human luminal floracan elevate PPAR� expression in colonic epithelial cellsof mice. In addition, evaluation of PPAR� expression inTLR4 mutant mice and in cell lines, Caco-2 cells trans-fected with TLR4 and stimulated with LPS, suggestedthat cellular signals from TLR4 can regulate PPAR�expression in colonic epithelial cells. It is tempting tospeculate that some luminal bacteria can activate PPAR�expression through signaling via the TLR4 receptor.Hence, cross-talk between the PPAR� and the TLR4signal transduction pathways may exist in colonic epi-thelial cells. Our hypothesis is that bacteria up-regulatePPAR� in epithelial cells, where PPAR� is acting in anegative feedback loop, uncoupling NF-�B–dependenttarget genes that are important for inflammatory re-sponses.37

Having obtained these results of regulation of PPAR�expression by bacteria, and the notion that intestinalflora could affect the chronic inflammation in IBD pa-tients, we assessed the expression levels of PPAR� inpatients with CD and UC.9,10 Using different methods ofquantitative retrotranscription-competitive PCR, RPA,Western blot, and immunostainings in colonic biopsysamples of a large number of patients with IBD andcontrols, an impaired expression of PPAR� in the colon

Figure 6. PPAR� levels were similar in PBMCs of controls and IBD patients. (A) PPAR� mRNA and (B ) PPAR� protein concentrations weredetermined respectively by retrotranscription-competitive PCR and Western blot in PBMCs of control, CD, and UC patients. The numbers ofpatients (n) as well as the statistical significance (p) are indicated and results are expressed as the mean � SEM.


of patients with UC was observed. Because loweredPPAR� expression levels also are observed in healthymucosa from UC patients, it is unlikely that the per-turbed levels of PPAR� are linked to the inflammatoryprocess. Because epithelial cells and macrophages are themain cellular sources of PPAR� in the colonic mucosa,38

we further characterized which cells accounted for theimpaired expression of PPAR� in UC. PPAR� immu-nostainings in the colon and the quantification ofPPAR� protein by Western blot in purified epithelialcells revealed that colonic epithelial cells from UC pa-tients display a dramatically impaired expression ofPPAR�. In addition, the similar levels of PPAR� in thecolons of all patients enrolled in the study suggest thatthe defect of PPAR� in UC is not owing to a generalalteration of nuclear factor expression.

The etiology underlying the impaired PPAR� expres-sion in colonic epithelial cells of UC patients remainsunknown. Comparable levels of PPAR� in PBMCs ofIBD patients and controls, and the absence of specificmutations of the PPAR� gene or promoter in UC pa-tients, suggest that epigenetic events may contribute toor account for the impaired PPAR� expression in UCpatients. Another possibility could be reduced expressionof TLR4 in UC colonic epithelial cells, leading to re-duced PPAR� expression. At present, this possibilityseems unlikely because Cario and Podolsky39 have re-ported that TLR4 was expressed abundantly by epithelialcells in both macroscopically and histologically inflamedand noninflamed colonic mucosa of UC patients. Immu-nostainings of colonic mucosa clearly show elevated lev-els of TLR4 in material obtained from patients with

Figure 7. Imbalance between PPAR� and TLR4 expressions in UC patients. Detection of TLR4 (visualized in red) and PPAR� (visualized in green)in the (A–F) healthy and (G–L) inflamed colonic mucosa of patients with UC, CD, and a representative control patient with diverticulitis of thesigmoid colon (control). Negative controls revealed no staining in healthy colons of patients with (A) UC, (B ) CD, or (C) control patient. (D–F ) Avery faint TLR4 staining was observed in the healthy colon of the 3 groups of patients. The antibody directed against TLR4 revealed a strong redstaining in inflamed colons of patients with (G) UC and (H ) CD compared with (I ) control. ( J ) The double TLR4 and PPAR� staining only showeda red fluorescence in patients with UC. (K) The anti-TLR4 and anti-PPAR� antibodies revealed, respectively, a red and green staining but also ayellow fluorescence corresponding to a co-expression of these 2 receptors in inflamed colons of CD patients. (L) A predominant PPAR� stainingin green was observed after double-staining analysis in control patients.


active IBD compared with controls, further supportingprevious findings.7 An attractive possibility may be thatthe TLR4 signaling to PPAR� is impaired. Furtherexperiments are highly warranted.

The observation that bacteria and TLR4 regulate theexpression of PPAR� in colonic epithelial cells has im-portant implications in our understanding of pathophys-iology of chronic inflammation in IBD patients. In UCpatients, reduced levels of PPAR� protein may disrupt apathway required to inhibit an ongoing inflammatoryprocess elicited by bacteria and TLRs. Such an imbalancebetween elevated levels of TLR439 and the impairedexpression of PPAR� in epithelial cells of UC patientsmay alter mucosal tolerance to luminal LPS and result insuperficial colonic inflammation.40 Another hypothesisworth considering is that impaired expression of PPAR�may somehow affect the metabolism of butyrate in UC.Many studies have shown that colonocytes of healthy andinflamed mucosal biopsy samples from patients with UChave an impaired ability to oxidize butyrate, the majorfuel source for the colonic epithelium.41 Recently, 2studies have reported that in transfected HT-29 cells42

and Caco-2 cells,43 butyrate has the ability to activateand enhance the expression of PPAR�. Because PPAR�is mainly involved in the metabolism of fatty acids,44 itis tempting to speculate that the impaired expression ofPPAR� in colonic epithelial cells of patients with UCmay, at least in part, be involved in the abnormal me-tabolism of butyrate, leading to superficial inflammation.

In conclusion, an impaired expression of PPAR�mRNA and protein in epithelial cells of patients withUC but not in patients with CD is reported. Despitecurrent classification systems and good clinical, morpho-logic, and histopathologic tools, physicians sometimesstill have problems differentiating between CD and UC.In approximately 10% of colitis cases, no differentiationcan be made and these patients are classified as indeter-minate colitis.45 Analysis of PPAR� expression in thecolon may help to distinguish between these 2 condi-tions. More studies to explore the regulation of PPAR�expression are urgently needed. Such research will nodoubt add to our understanding of the pathogenesis ofUC. This, in turn could enhance the development of newpreventive and therapeutic strategies in patients withIBD.46

References1. Schoonjans K, Martin G, Staels B, Auwerx J. Peroxisome prolif-

erator-activated receptors, orphans with ligands and functions.Curr Opin Lipidol 1997;8:159–166.

2. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK. The peroxisomeproliferator-activated receptor-gamma is a negative regulator ofmacrophage activation. Nature 1998;391:79–82.

3. Jiang C, Ting AT, Seed B. PPAR� agonists inhibit production ofmonocyte inflammatory cytokines. Nature 1998;391:82–86.

4. Lefebvre M, Paulweber B, Fajas L, Woods J, McCrary C, ColombelJF, Najib J, Fruchart JC, Datz C, Vidal H, Desreumaux P, Auwerx J.Peroxisome proliferator-activated receptor gamma is induced dur-ing differentiation of colon epithelium cells. J Endocrinol 1999;162:331–340.

5. Su CG, Wen X, Bailey ST, Jiang W, Rangwala SM, Keilbaugh SA,Flanigan A, Murthy S, Lazar MA, Wu GD. A novel therapy for colitisutilizing PPAR-gamma ligands to inhibit the epithelial inflamma-tory response. J Clin Invest 1999;104:383–389.

6. Desreumaux P, Dubuquoy L, Nutten S, Peuchmaur M, Englaro W,Schoonjans K, Derijard B, Desvergne B, Wahli W, Chambon P,Leibowitz MD, Colombel JF, Auwerx J. Attenuation of colon inflam-mation through activators of the retinoid X receptor (RXR)/perox-isome proliferator-activated receptor gamma (PPARgamma) het-erodimer. A basis for new therapeutic strategies. J Exp Med2001;193:827–838.

7. Cario E, Rosenberg IM, Brandwein SL, Beck PL, Reinecker HC,Podolsky DK. Lipopolysaccharide activates distinct signalingpathways in intestinal epithelial cell lines expressing toll-likereceptors. J Immunol 2000;164:966–972.

8. Tak PP, Firestein GS. NF-kappaB: a key role in inflammatorydiseases. J Clin Invest 2001;107:7–11.

9. Karlinger K, Gyorke T, Mako E, Mester A, Tarjan Z. The epidemi-ology and the pathogenesis of inflammatory bowel disease. Eur JRadiol 2000;35:154–167.

10. Campieri M, Gionchetti P. Bacteria as the cause of ulcerativecolitis. Gut 2001;48:132–135.

11. Shanahan F. Crohn’s disease. Lancet 2002;359:62–69.12. Sandre C, Gleizes A, Forestier F, Gorges-Kergot R, Chilmonczyk S,

Leonil J, Moreau MC, Labarre C. A peptide derived from bovinebeta-casein modulates functional properties of bone marrow-derived macrophages from germ-free and human flora-associatedmice. J Nutr 2001;131:2936–2942.

13. Medzhitov R, Preston-Hurlburt P, Janeway CA Jr. A human homo-logue of the Drosophila toll protein signals activation of adaptiveimmunity. Nature 1997;388:394–397.

14. Shivananda S, Hordijk ML, Ten Kate FJ, Probert CS, Mayberry JF.Differential diagnosis of inflammatory bowel disease. A compar-ison of various diagnostic classifications. Scand J Gastroenterol1991;26:167–173.

15. Mercurio F, Zhu H, Murray BW, Shevchenko A, Bennet BL, Li JW,Young DB, Barbosa M, Mann M, Manning A, Rao A. IKK-1 andIKK-2: cytokine-activated IkB kinase essential for NF-�B activa-tion. Science 1997;278:860–866.

16. de Rock E, Taylor N. An easy method of layering blood overFicoll-Paque gradients. J Immunol Methods 1977;17:373–374.

17. Toy LS, Yio XY, Lin A, Honig S, Mayer L. Defective expression ofgp180, a novel CD8 ligand on intestinal epithelial cells, in inflam-matory bowel disease. J Clin Invest 1997;100:2062–2071.

18. Desreumaux P, Brandt E, Gambiez L, Emilie D, Geboes K, KleinO, Ectors N, Cortot A, Capron M, Colombel JF. Distinct cytokinepatterns in early and chronic ileal lesions of Crohn’s disease.Gastroenterology 1997;113:118–126.

19. Auboeuf D, Rieusset J, Fajas L, Vallier P, Frering V, Riou JP,Staels B, Auwerx J, Laville M, Vidal H. Tissue distribution andquantification of the expression of mRNAs of peroxisome prolif-erator-activated receptors and liver X receptor-alpha in humans:no alteration in adipose tissue of obese and NIDDM patients.Diabetes 1997;46:1319–1327.

20. Desreumaux P, Ernst O, Geboes K, Gambiez L, Berrebi D, Muller-Alouf H, Hafraoui S, Emilie D, Ectors N, Peuchmaur M, Cortot A,Capron M, Auwerx J, Colombel JF. Inflammatory alterations inmesenteric adipose tissue in Crohn’s disease. Gastroenterology1999;117:73–81.

21. Pettersson S, Cook GP, Bruggemann M, Williams GT, Neuberger


MS. A second B cell-specific enhancer 3 of the immunoglobulinheavy-chain locus. Nature 1990;344:165–168.

22. Mason JO, Williams GT, Neuberger MS. The half-life of immuno-globulin mRNA increases during B-cell differentiation: a possiblerole for targeting to membrane-bound polysomes. Genes Dev1988;2:1003–1011.

23. Gunning P, Ponte P, Okayama H, Engel J, Blau H, Kedes L.Isolation and characterization of full-length cDNA clones for hu-man alpha-, beta-, and gamma-actin mRNAs: skeletal but notcytoplasmic actins have an amino-terminal cysteine that is sub-sequently removed. Mol Cell Biol 1983;3:787–795.

24. Fajas L, Auboeuf D, Raspe E, Schoonjans K, Lefebvre AM, Sala-din R, Najib J, Laville M, Fruchart JC, Deeb S, Vidal-Puig A, Flier J,Briggs MR, Staels B, Vidal H, Auwerx J. The organization, pro-moter analysis, and expression of the human PPARgamma gene.J Biol Chem 1997;272:18779–18789.

25. Nevin DN, Brunzell JD, Deeb SS. The LPL gene in individuals withfamilial combined hyperlipidemia and decreased LPL activity.Arterioscler Thromb 1994;14:869–873.

26. Abreu MT, Vora P, Faure E, Thomas LS, Arnold ET, Arditi M.Decreased expression of toll-like receptor-4 and MD-2 correlateswith intestinal epithelial cell protection against dysregulatedproinflammatory gene expression in response to bacterial lipo-polysaccharide. J Immunol 2001;167:1609–1616.

27. Puigserver P, Rhee J, Lin J, Wu Z, Yoon JC, Zhang CY, Krauss S,Mootha VK, Lowell BB, Spiegelman BM. Cytokine stimulation ofenergy expenditure through p38 MAP kinase activation of PPAR-gamma coactivator-1. Mol Cell 2001;8:971–982.

28. Berliner L, Redmond P, Purow E, Megna D, Sottile V. Computedtomography in Crohn’s disease. Am J Gastroenterol 1982;77:548–553.

29. Mansen A, Guardiola-Diaz H, Rafter J, Branting C, Gustafsson JA.Expression of the peroxisome proliferator-activated receptor(PPAR) in the mouse colonic mucosa. Biochem Biophys ResCommun 1996;222:844–851.

30. Deeb SS, Fajas L, Nemoto M, Pihlajamaki J, Mykkanen L, Kuu-sisto J, Laakso M, Fujimoto W, Auwerx J. A Pro12Ala substitutionin PPARgamma2 associated with decreased receptor activity,lower body mass index and improved insulin sensitivity. NatGenet 1998;20:284–287.

31. Meirhaeghe A, Fajas L, Helbecque N, Cottel D, Lebel P, Dal-longeville J, Deeb S, Auwerx J, Amouyel P. A genetic polymor-phism of the peroxisome proliferator-activated receptor gammagene influences plasma leptin levels in obese humans. Hum MolGenet 1998;7:435–440.

32. Meirhaeghe A, Fajas L, Helbecque N, Cottel D, Auwerx J, DeebSS, Amouyel P. Impact of the peroxisome proliferator activatedreceptor gamma2 Pro12Ala polymorphism on adiposity, lipidsand non-insulin-dependent diabetes mellitus. Int J Obes RelatMetab Disord 2000;24:195–199.

33. Hornef MW, Frisan T, Vandewalle A, Normark S, Richter-DahlforsA. Toll-like receptor 4 resides in the golgi apparatus and colocal-izes with internalized lipopolysaccharide in intestinal epithelialcells. J Exp Med 2002;195:559–570.

34. Faure E, Equils O, Sieling PA, Thomas L, Zhang FX, Kirschning CJ,Polentarutti N, Muzio M, Arditi M. Bacterial lipopolysaccharideactivates NF-kappaB through toll-like receptor 4 (TLR4) in cul-tured human dermal endothelial cells. Differential expression ofTLR4 and TLR-2 in endothelial cells. J Biol Chem 2000;275:11058–11063.

35. Ji JD, Cheon H, Jun JB, Choi SJ, Kim YR, Lee YH, Kim TH, ChaeIJ, Song GG, Yoo DH, Kim SY, Sohn J. Effects of peroxisomeproliferator-activated receptor-gamma (PPAR-gamma) on the ex-pression of inflammatory cytokines and apoptosis induction in

rheumatoid synovial fibroblasts and monocytes. J Autoimmun2001;17:215–221.

36. Nakajima A, Wada K, Miki H, Kubota N, Nakajima N, Terauchi Y,Ohnishi S, Saubermann LJ, Kadowaki T, Blumberg RS, Nagai R,Matsuhashi N. Endogenous PPAR gamma mediates anti-inflam-matory activity in murine ischemia-reperfusion injury. Gastroen-terology 2001;120:460–469.

37. Straus DS, Pascual G, Li M, Welch JS, Ricote M, Hsiang CH,Sengchanthalangsy LL, Ghosh G, Glass CK. 15-deoxy-delta12,14-prostaglandin J2 inhibits multiple steps in the NF-kappa Bsignaling pathway. Proc Natl Acad Sci U S A 2000;97:4844–4849.

38. Jain S, Pulikuri S, Zhu Y, Qi C, Kanwar YS, Yeldandi AV, Rao MS,Reddy JK. Differential expression of the peroxisome proliferator-activated receptor gamma (PPARgamma) and its coactivatorssteroid receptor coactivator-1 and PPAR-binding protein PBP inthe brown fat, urinary bladder, colon, and breast of the mouse.Am J Pathol 1998;153:349–354.

39. Cario E, Podolsky DK. Differential alteration in intestinal epi-thelial cell expression of toll-like receptor 3 (TLR3) and TLR4in inflammatory bowel disease. Infect Immun 2000;68:7010–7017.

40. Ehrhardt RO. New insights into the immunopathology of chronicinflammatory bowel disease. Semin Gastrointest Dis 1996;7:144–150.

41. Topping DL, Clifton PM. Short-chain fatty acids and human co-lonic function: roles of resistant starch and nonstarch polysac-charides. Physiol Rev 2001;81:1031–1064.

42. Kinoshita M, Suzuki Y, Saito Y. Butyrate reduces colonic para-cellular permeability by enhancing PPARgamma activation. Bio-chem Biophys Res Commun 2002;293:827–831.

43. Wachtershauser A, Loitsch SM, Stein J. PPAR-gamma is selec-tively upregulated in Caco-2 cells by butyrate. Biochem BiophysRes Commun 2000;272:380–385.

44. Fajas L, Debril MB, Auwerx J. PPAR gamma: an essential role inmetabolic control. Nutr Metab Cardiovasc Dis 2001;11:64–69.

45. Price AB. Overlap in the spectrum of non-specific inflammatorybowel disease—‘colitis indeterminate’. J Clin Pathol 1978;31:567–577.

46. Lewis JD, Lichtenstein GR, Stein RB, Deren JJ, Judge TA, Fogt F,Furth EE, Demissie EJ, Hurd LB, Su CG, Keilbaugh SA, Lazar MA,Wu GD. An open-label trial of the PPAR-gamma ligand rosiglita-zone for active ulcerative colitis. Am J Gastroenterol 2001;96:3323–3328.

Received April 25, 2002; Accepted January 30, 2003.Address requests for reprints to: Pierre Desreumaux, M.D., Ph.D.,

Service de Gastroenterologie, Hopital Huriez, CHU, Lille 59037, France.e-mail: [email protected]; fax: (33) 3-20-44-47-13.

Supported by grants from IRMAD, the association F. Aupetit, syndi-frais, the Centre Hospitalier et Universitaire de Lille (EA2687,CA14555, and PHRC1926), the Fondation pour la Recherche Medicale(to L. D. and P. D.); Foundation for Knowledge and CompetenceDevelopment, Swedish Strategic Foundation and Cancerfonden Swe-den (to E. Å. J.); the National Institutes of Health grant numberHL-64322 (to S. P. and S. S. D.); INSERM, CNRS, Hopitaux Universita-ires de Strasbourg, and the European Union (GLRT-1999-00679 andGLRT-2001-00930) (to J. A.).

The authors thank C. Bisiaux for her valuable technical assistanceand Marie-Christiane Moreau and Philippe Podevin who provided micewith different flora, and C3H/HeJ (Lpsd/Lpsd) and C3H/HeouJ (Lpsn/Lpsn) mice, respectively. The authors also thank Drs. Cyrus Tamboliand William J. Sandborn for critical reading of the manuscript.

L. D. and E. Å. J. contributed equally to this work.


Documents

Impaired expression of the peroxisome proliferator–activated receptor alpha during hepatitis C virus infection