MOLECULAR AND CELLULAR BIOLOGY, Mar. 1993, p. 1836-18460270-7306/93/031836-11$02.00/0Copyright ©3 1993, American Society for Microbiology

COUP-TF Acts as a Competitive Repressor for EstrogenReceptor-Mediated Activation of the Mouse Lactoferrin Gene

YOUHUA LIU, NENGYU YANG, AND CHRISTINA T. TENG*

Laboratory ofReproductive and Developmental Toxicology, National Institute ofEnvironmental Health Sciences, Research Triangle Park, North Carolina 27709

Received 23 July 1992/Returned for modification 24 September 1992/Accepted 8 December 1992

We previously demonstrated that the estrogen response module (mERM) of the mouse lactoferrin gene,which contains an overlapping chicken ovalbumin upstream promoter transcription factor (COUP-TF)- andestrogen receptor-binding element, is responsible for estrogen induction. In this report we show that COUP-TFrepresses the mERM response to estrogen stimulation. Mutation and deletion of the COUP-TF-binding elementor reduction of the endogenous COUP-TF increases mERM estrogen responsiveness. Likewise, overexpressionof the COUP-TF expression vector blocked the estrogen-stimulated response ofmERM in transfected cells. Themolecular mechanism of this repression is due to the competition between COUP-TF and the estrogen receptorfor binding at identical contact sites in the overlapping region of the mERM. Our results indicate that twomembers of the steroid-thyroid receptor superfamily work in concert to modulate lactoferrin gene expression.

Regulation of gene expression at the transcriptional levelis a complex process. The expression of a gene is controlledby multiple trans-acting factors that interact with each otherand with the cluster of cis-acting DNA elements in regulatedpromoters (11, 61). The estrogen receptor (ER), an estrogen-dependent transcription factor, mediates a variety of estro-genic effects on target tissues at the molecular level (2, 11,17, 24). Through gene transfers and deletion studies, thecis-acting DNA sequences that are responsible for estrogenregulation have been identified in various estrogen-regulatedgenes (3, 7, 23, 46, 52). ER, upon binding to the consensuspalindromic estrogen response element (ERE), is able toconfer estrogen-stimulated transcription. Recent studiesshow that the response elements for steroid hormones couldalso act together with other transcription factor-bindingelements to bring about hormone-dependent responses (1, 8,12, 50, 60). The trans activation of these genes is initiated bythe interaction between ER and other transcription factorsand their respective cognated elements.

In addition to the steroid hormone receptors that re-

sponded to well-known ligands, a large collection of orphanreceptors that share structural homology has been isolated,although the particular ligand has not yet been identified (28,51, 57, 58). One of those is the well-characterized chickenovalbumin upstream promoter transcriptional factor (COUP-TF) (57, 58). COUP-TF was originally found through itsinteraction with a response element in the chicken ovalbu-min gene promoter (48) and has been shown to play bothpositive and negative roles in gene regulation upon bindingto various regulatory elements (5, 6, 20, 25, 32, 37, 54).These diverse roles highlight the importance of COUP-TF inthe regulation of gene expression in various tissues. Wepreviously found that the estrogen response module(mERM) of the mouse lactoferrin gene was composed of anoverlapping ERE and COUP-TF-binding element (31, 32).Band shift assay showed that both ER and COUP-TFspecifically interacted with the mERM (32). Therefore, themERM of the mouse lactoferrin gene might provide a unique

* Corresponding author.

model to study the interplay between these two members ofthe steroid hormone receptor superfamily.

In the current study, we address two specific issues: first,the role that COUP-TF plays in estrogen responsiveness ofthe mERM, and second, the type of interaction that occursamong COUP-TF, ER, and the mERM. We show thatCOUP-TF can functionally repress the ER-activated re-sponse by direct competition for overlapping binding sites ofthe mERM.

MATERIALS AND METHODS

Oligonucleotides and construction of plasmids. Oligonucle-otides were synthesized by Research Genetics and purifiedby gel electrophoresis. Complementary strands were an-nealed in 10 mM Tris (pH 8.0)-200 mM NaCl-1 mM EDTAby heating to 95°C and cooling to room temperature over aperiod of 3 h. The double-stranded synthetic oligonucle-otides were inserted into the BglII site of the pCAT-reporterplasmid (Promega, Madison, Wis.; psv-CATO) to generatethe psv-mCAT series. Mutated oligonucleotides were clonedinto the SphI site of the 0.3 mL14-CAT to generate the Mutseries. The copy number and orientation of the insert se-quence were determined by dideoxy sequencing (49). Allplasmid DNAs used for transfection experiments were twiceCsCl gradient purified and examined on agarose gels. Adetailed description of the oligonucleotides used in thispaper has been previously published (32). They are asfollows: mERM, 5'-GATCGCATGCAAGTGTCACAGGTCAAGGTAACCCACAAATGCATGC-3'; mERE, 5'-GATCGGTCAAGGTAACCCA-3'; mCOUP, 5'-GATCAAGTGTCACAGGTCA-3'; Ov-COUP, 5'-TITTCTATGGTGTCAAAGGTCAAACT-3'; vitERE, 5'-GATCTAGGTCACAGTGACCTA-3'; GRE, 5'-GATCTGGTACAGGATGTTCT-3'; andtheir complements. The following expression vectors weregifts from the indicated laboratories: RS-COUP, Sophia Tsai(57); HEO, P. Chambon (18); and hGR, R. Evens (13).

Preparation of protein extract and band shift assay. RL95-2cells in an exponential growth stage were washed twice withcold phosphate-buffered saline and scraped off the plate witha rubber policeman. Cells were collected and the nuclei wereisolated according to the method of Brunel et al. (4). Briefly,

1836

Vol. 13, No. 3

REPRESSOR FOR ER-MEDIATED LACTOFERRIN GENE ACTIVATION 1837

the pelleted cells were resuspended in buffer A containingprotein inhibitors (20 mM HEPES [N-2-hydroxyethylpiper-azine-N'-2-ethanesulfonic acid, pH 7.9], 0.5 M sucrose, 15mM NaCl, 60 mM KCl, 0.15 mM spermidine, 0.5 mMspermine, 0.5 mM EDTA, and 1 mM dithiothreitol, plus 5 p,geach of leupeptin, soybean trypsin inhibitor, antipain, andchymostatin per ml). An equal volume of buffer A containing0.6% Nonidet P-40 was added with gentle mixing to lyse thecells. Immediately after lysis (verified with a phase micro-scope), the solution was diluted with 2 volumes of buffer Aand the nuclei were collected by sedimentation at 2,000 x g.Nuclear protein was extracted with 0.4 M KCl-TGM buffer{10 mM Tris-HCl [pH 7.6], 10% glycerol, 3 mM MgCl2, 3mM EGTA [ethylene glycol-bis(3-aminoethyl ether)-N,N,N',N'-tetraacetic acid]} containing high levels of proteaseinhibitor as previously described (32). The viscous lysatewas centrifuged for 45 min at 200,000 x g at 4°C. Thesupernatant was collected and dialyzed against TGM bufferwithout 0.4 M KCI. The insoluble material was removed bycentrifugation, and small aliquots of protein extract werequickly frozen and stored at -70°C after the protein concen-tration had been determined (protein assay; Bio-Rad, Rich-mond, Calif.). Whole-cell extracts containing transfectedHEO and the band shift assay were described previously(32). Antibodies to ER were purchased from Abbott (Chica-go, Ill.; ER-ICA monoclonal H222 kit), and COUP-TFantibody was a gift from S. Tsai's laboratory (Cell BiologyDepartment, Baylor College of Medicine, Houston, Tex.).Production of human lactoferrin antibody has been de-scribed previously (42).DNase I footprinting. A 298-bp HincII-XbaI mouse lacto-

ferrin 5'-flanking region (-589 to -291 containing themERM) was used for DNase I footprinting analysis. TheDNA fragments were labeled at the XbaI site with Klenowenzyme and 32P-dCTP. Before digestion with DNase I, thelabeled fragments were incubated with various amounts ofbaculovirus-expressed ER (gift from M. Parker, MolecularEndocrinology Laboratory, Imperial Cancer ResearchFund, London, United Kingdom) and the nuclear proteinextract (from RL95-2 cells) alone or in combination. TheDNA fragments were analyzed on a 6% denaturing polyac-rylamide sequencing gel. The chemical reaction for G+A onthe same DNA fragment was included as a marker (35).

Methylation interference assay. The methylation interfer-ence assay was conducted as described by Kumar andChambon (26) with minor modifications. Single-strandedmERM oligonucleotides were end labeled with T4 kinaseand y-32P-ATP and then annealed to the unlabeled comple-mentary strand. The double-stranded oligonucleotides 32plabeled at one end were gel purified and methylated withdimethyl sulfate (55). The conditions for interactions be-tween methylated labeled DNA, ER, and nuclear proteinextract were identical to the conditions for the band shiftassay with the exception of a twofold increase in the reactionmixtures. Following electrophoresis through a 5% polyacryl-amide gel, the radioactive bands (both protein bound andfree) were localized and excised according to the autoradiog-raphy of the wet gel. The DNA was eluted with 400 ,ul of 0.3M sodium acetate (pH 5.2) at room temperature, purified bya Sephadex G-25 column, and precipitated with ethanol. TheDNA was cleaved at the guanine residues by 1 M piperidine,and the fragments were resolved on an 8% sequencing gel.

Cell culture, DNA transfection, and chloramphenicol acetyl-transferase (CAT) assay. Human endometrium carcinomaRL95-2 cells obtained from the American Type CultureCollection (Rockville, Md.; ATCC CRL 1617) (59) were

grown in 1:1 phenol red-free Dulbecco's modified Eagle'smedium-Ham nutrient mixture (F12 medium) with 10% fetalbovine serum (GIBCO-BRL, Grand Island, N.Y.). Cellswere cultured in a humidified atmosphere containing 5%CO2.RL95-2 cells containing a low level of ER (5,000 per cell)

(59) were cotransfected with reporter plasmid (5 ,ug perwell), 3-galactosidase reference plasmid pCH110 (0.25 p,gper well), and HEO expression plasmid (concentrations areindicated in individual experiments) by the calcium phos-phate method (CellPhect transfection kit from Pharmacia,Piscataway, N.J.). Following transfection, cells were incu-bated in phenol red-free Dulbecco's modified Eagle's medi-um-F12 medium containing 10% charcoal-stripped fetal bo-vine serum. The cells were then incubated in the absence orpresence of 10-8 M diethylstilbestrol (DES) (Sigma, St.Louis, Mo.) for 16 to 20 h before harvest. CAT enzymeactivity from the whole-cell extract was measured (31). Thereaction products were analyzed by thin-layer chromatogra-phy followed by X-ray autoradiography and liquid scintilla-tion counting. All experiments were repeated at least threetimes and performed in duplicate to ensure reproducibility.Relative CAT activity, after normalization for either ,B-gal-actosidase activity or protein concentration, was presentedas the average for all experiments.

Site-directed mutagenesis. Oligonucleotide-directed muta-genesis was performed according to the method of Kunkel etal. (27). Mouse lactoferrin mERM (-351 to -322) wasisolated from pmL-CAT1 (32) by SphI digestion and sub-cloned into the M13mpl8 vector. The phage were grown inuridine-supplemented Trypton-yeast extract-NaCl medium.Synthetic oligonucleotides, with point mutations at themERM region, were phosphorylated and annealed to thesingle-stranded uracil-containing phage DNA. The double-stranded circular DNA molecules were generated by the T4DNA polymerase and T4 DNA ligase reactions. The hetero-duplex phage molecules were transformed into cells, andlarge quantities of DNA were prepared. The mutatedmERMs isolated from the phage DNA were either subclonedinto 0.3 mL14-CAT reporter plasmid (31) for transfectionexperiments or used directly for the band shift assay.

RESULTS

ER and COUP-TF compete for binding to the mERM. Inthe band shift assays, we found that COUP-TF and the ERformed separate complexes with the mERM (32). To under-stand more about the interaction between these two tran-scription factors and the mERM, we carried out band shiftexperiments using various ratios of COUP-TF to ER. Thespecific binding of COUP-TF or ER to the mERM is pre-sented in Fig. 1A. COUP-TF interacted with the mERM toform complexes Cl and C4 (lane 2). Upon addition of theCOUP-TF antibody, both Cl and C4 showed reduced elec-trophoretic mobility (lane 4, SB2). Although there was novisible complex between endogenous ER and the mERM(lane 2), a retarded band (SB1) was seen in the presence ofantibody to ER (lane 3). In these experiments, addition ofantibody to ER did not interfere with the Cl and C4 complexformation (compare the intensities of Cl and C4 in lanes 2and 3). When the ratio of ER to COUP-TF in the nuclearprotein extract (NPE) was increased (lanes 5 to 9), however,Cl complex was reduced in the presence of ER antibody.There are several possible explanations: first, the exogenousbaculovirus-expressed ER contains protein factors thatcould interact with COUP-TF; second, the ER antibody

VOL. 13, 1993

1838 LIU ET AL.

A

Proteins (0.8 gI)Ab

C4 o

Ci O

B

- RL95- NPE ER + RL95- NPEI- I ER

- - ER COUP - ER COUP COUP LF

-ae

.di3ilk on tw||t

=_ _ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~__4 _ _

ER (gf)NPE (pA)

4 SB2.*: SB1

= 82

F -

- - 0.8- 20 20

C4C2,C3 -

Ci - -

FU.

1 2 3 4 5 6 7 8 9 1 2 3FIG. 1. ER and COUP-TF compete for mERM binding. (A) Radiolabeled mERM oligonucleotides were incubated with NPE of the RL95-2

cells (1 pLg/p.l) or the baculovirus-expressed ER-enriched NPE (1:1 mixture of NPE and ER) as described in Materials and Methods. (B) Sameas panel A, with a higher concentration of NPE and one-half of the amount of labeled mERM oligonucleotides. The complexes and free probewere separated and analyzed. The ER-DNA complexes (C2 and C3) and their supershift band by ER antibody H222 (SB1) andCOUP-TF-DNA complexes (Cl and C4) and their supershift band by COUP-TF antibody (SB2) are indicated. F, free mERM probe; LF,antibody to lactoferrin; Ab, antibody.

stabilizes the ER-DNA complexes that could result in moreER-DNA than the COUP-TF-DNA complexes; and third, ata higher ratio of ER to COUP-TF in the NPE, interactiondoes occur between ER and COUP-TF. Antibody alone didnot form any complex with the mERM (data not shown). Itis interesting to note that the addition of exogenous ER tothe NPE resulted in three complexes only (lane 5, Cl, C2,and C3); two of the complexes contained ER (lane 6), andonly one (Cl) contained COUP-TF (lane 7). The addition ofboth ER and COUP-TF antibodies to the reaction mixturereduced all three complexes' electrophoretic mobilities (lane8, Cl, C2, and C3 become SB1 and SB2). Nonspecificantiserum (antilactoferrin) did not affect the electrophoreticmobilities of these complexes; however, the antiserum didstabilize the protein-DNA complexes (lane 9). More proteinin the lactoferrin antiserum could account for this stabilizingeffect. Thus, the results shown in Fig. 1A suggest thatER-COUP-TF heterodimers do not seem to form becausenovel bands do not appear in the mixing experiments (lanes5 to 9) or in the presence of antibody to COUP-TF, ER, orboth. Furthermore, the individual antibody can retard onlyits respective complex; i.e., ER antibody affects C2 and C3(lanes 3 and 6), while COUP-TF antibody affects Cl and C4(lanes 4 and 7). We did not detect any complex retarded byboth ER and COUP-TF antibodies. Interference between theER, COUP-TF, and other protein factors, however, cannotbe excluded. Separate DNA-protein complexes formed withER or COUP-TF were more clearly demonstrated in Fig. 1B.

Under limited mERM oligonucleotides, competition forbinding between ER and COUP-TF was evident (compareCl in lanes 2 and 3). Therefore, the amount of individualprotein-mERM complexes varies according to the relativeratio of proteins in the nuclear extract.

Direct evidence of competition for COUP-TF and ER tobind to the mERM came from the DNase I footprintingexperiments. We showed that baculovirus-expressed ERprotected the DNA fragment at -346 to -324 at the locationof the imperfect ERE (-341 to -329) (Fig. 2A, lanes 3 to 6).NPE of RL95-2 cells that contain COUP-TF protected theregion containing the COUP-TF-binding element (-355 to-332) (Fig. 2A, lanes 7 to 10). Interestingly, when ER andNPE were incubated together with the DNA fragment, theregion at -346 to -332 was protected completely, even atvery low concentrations of protein. Partial protections wereobserved at the regions from -355 to -346 and -332 to-324 (Fig. 2A, lanes 12 to 14). Therefore, with limited DNA,some DNA would interact with COUP-TF and some wouldinteract with ER. This type of interaction would result incomplete protection from DNase I digestion at the overlap-ping region and partial protection at both ends of the DNAfragment.ER and COUP-TF share an identical contact site in the

overlapping region of the mERM. In order to define moreprecisely the nucleotide contacts of ER and COUP-TF, weperformed the methylation interference assay. The mERMoligonucleotides were end labeled with 32P at either the top

MOL. CELL. BIOL.

REPRESSOR FOR ER-MEDIATED LACTOFERRIN GENE ACTIVATION 1839

AER NPE

x

i..

1 2 345 6 7 8

B

-359a0

a0

1010

02101I-

aJERE0

o<5

0

-320Zn

ER

-346

-324

FIG. 2. DNase I footprinting protecenhancer region by ER and COUP-TF.-291) containing the mERM was 3' en'filling in with 32P-dCTP and Klenow frajThe labeled DNA probe was incubatedwith increasing amounts of ER (bacul1.0, and 1.0 Al for lanes 3, 4, 5, and 6, reand 10 ,ug for lanes 7, 8, 9, and 10, resj

13, and 14) before being treated wichemical sequencing reactions on thmarkers. (B) Schematic representaticprotection regions. The DNA sequer

presented, and the mERM (COUP andprotected regions are indicated by op

protected regions are indicated by haalongside refer to the nucleotide posititional initiation site.

or bottom strand and partiallysulfate at the G residues. DNAcomplexes, and the free probe regiwas cleaved at methylated residuesThe results are shown in Fig. 3A. .to 6) the cleavage pattern revealsdouble G residues within the o%

mERM strongly interfered with both ER (Fig. 3A, lane 3)and COUP-TF (lane 6) binding. A weak interference with ER

ER+NPE r and COUP-TF binding at the Gs outside the overlapping0 0 co region was observed (Fig. 3A, lanes 3 and 6). Thus, within

the overlapping 5'-GGTCA-3' region, these two GGs actedas contact sites for both COUP-TF and ER binding. Simi-larly, a strong and weak interference with ER and COUP-TF, respectively, at the G in the overlapping region was

I t * observed for the bottom strand (Fig. 3A, lanes 7 to 12).- 3| Methylation of the three individual Gs within the COUP,,* , element interfered with COUP-TF binding (Fig. 3A, lane 12).. I| Methylation of the two Gs at the 3' arm of the ERE, together

0i" with the third G outside the consensus ERE of the bot-jx * tom strand, strongly interfered with ER binding (Fig. 3A,

£ g lane 9). The G outside the consensus ERE that also served asthe contact site for ER binding made the complexes morestable.

*- * * COUP-TF represses the mERM response to estrogen stim-W * ~ - **ulation.Our previous studies showed that the mERM acted

9 10 11 12 13 14 15 16 as an enhancer in conferring estrogen stimulation (32). Thequestion we would like to address in this study is what rolesthe overlapping COUP-TF-binding element plays in ER-

NPE ER+NPE mediated transcription activation. We have constructed var-ious chimeric reporter plasmids and cotransfected them withER expression plasmid HEO to test the estrogen responsive-ness in RL95-2 cells. Figure 4 shows that the chimericplasmids containing the imperfect ERE (psv-mCAT5 andpsv-mCAT6) responded to estrogen stimulation much moreefficiently than the plasmids containing the wild-type mERM(psv-mCAT1 and psv-mCAT2). A twofold increase in CATactivity was observed (compare psv-mCAT5 and psv-mCAT6 and psv-mCAT1 and psv-mCAT2). The COUPelement, by itself, has very little enhancing activity (psv-mCAT10 and psv-mCAT11), while the perfect vitellogeninA2 ERE (psv-vCAT1 and psv-vCAT2) exhibited a twofold-

-332 higher activity than the imperfect mouse lactoferrin ERE(compare psv-vCAT1 and psv-vCAT2 and psv-mCAT5 andpsv-mCAT6). These data suggest that the COUP element of

-324 the mERM actually represses the ERE response to estrogen.The following experiments were designed to demonstrate

the negative role that COUP-TF played in the estrogen-tion of the mouse lactoferrin activated response. Individual Gs at the COUP-TF contact(A) DNA fragment (-589 to sites were mutated. We found that the mutation at the Gs ofd labeled at position -291 by the overlapping region in the mERM (Mutl and Mut2)gment of DNA polymerase I. completely abolished both COUP-TF and ER binding (Fig.alone (lanes 2, 11, and 15) or 5C, lanes 3 to 6) as well as the enhancing activity (Fig. 5B).lovirus expressed; 0.5, 0.75, Mutation at the COUP-TF-binding element (Mut3) outside,spectively), NPE (5,7.5, 10, the overlapping region resulted in diminished COUP-TF-pectively), or both (lanes 12, binding ability (Fig. 5C, lanes 7 and 8), whereas its capabilityLe same DNA fragment as to respond to estrogen stimulation was twice as high as that)n of DNase I footprinting of the wild type (compare CAT activities of mERM andnce from -359 to -320 is Mut3).ERE) is marked. Completely Cells of uterine origin contain high levels of COUP-TF asen boxes, and the partially revealed by Western blot (immunoblot) analysis (52a). Ititched boxes. The numbers would have been ideal to transfect the mERM to COUP-TF-ons relative to the transcrip- negative uterine cells and to examine the estrogen respon-

siveness. But since there were no such cells available, thenext best thing was to partially deplete the endogenouscellular COUP-TF by cotransfecting double-stranded

methylated by dimethyl ovalbumin COUP oligonucleotides (-93 to -70 of the pro-was recovered from the moter region of the chicken ovalbumin gene) to the RL95-2on of the band shift assay cells (Fig. 6A). As the molar ratio of Ov-COUP to mERMs by piperidine treatment. increased in the transfected cells, the estrogen response ofAt the top strand (lanes 1 the mERM also increased accordingly. At the molar ratio of5 that methylation at the 100 (Ov-COUP to mERM), the mERM activity was stimu-verlapping region of the lated by estrogen to the level of mERE (compare CAT

VOL. 13, 1993

1840 LIU ET AL.

A Top Strand Bottom Strand

cL.: 0 < 0 D

D LuW CD LL o+CD

A-

0 9x:4-c e t

2 : 40 -

W~ ~40<C

u-I

4 r < I O)L L C L OLLW (DLLO(.

0-

3 :a* S do

.... ....o

, so

1 2 3 4 5 6 7 8 9 10 11 12

BV V ..

Top Strand 5'- AAGTGTCACAGGTCAAGGTAACCCAC-3'BottomStrand 3'- TTCACAGTGTCCAGTTCCATTGGGTG-5'

I- _0 *O*

A A A

* ER - COUP-TF ERE COUP Element

FIG. 3. Common nucleotide contacts of ER and COUP-TF at the overlapping region of the mERM. The double-strand mERMoligonucleotides were partially methylated and used for methylation interference assay as described in Materials and Methods. (A)Methylation interference at the top strand and the bottom strand of the DNA. Lanes 3 and 9, DNA recovered from the ER complexes; lanes6 and 12, DNA recovered from the COUP-TF complex (C1); lanes Free, unbound DNA recovered from the ER (lanes 2 and 8) and COUP-TF(lanes 5 and 11) reactions; lanes G+A, chemical sequencing of the same DNA fragment as the marker. (B) Nucleotide sequence of the COUPand ERE region. The nucleotide contact sites are indicated. Circles, ER; triangles, COUP-TF. Solid symbol depicts the strong contact, whileopen symbol indicates the weak one.

activities of psv-mCAT5 and psv-mCAT1 plus 100-fold Ov-COUP). Thus, when endogenous cellular COUP-TF wasreduced by binding to Ov-COUP, it also relieved the nega-tive effect on the mERM. Conversely, overexpressing theCOUP-TF expression vector in the transfected cells re-presses the estrogen-stimulated response of the mERM (Fig.6B). COUP-TF, however, did not interfere with dexametha-sone-stimulated GRE/CAT (Fig. 6C). In fact, we have seensome stimulation of GRE/CAT activity repeatedly after theaddition of COUP expression vector. Furthermore, cotrans-fection with a higher level of ER (10 times higher) counter-acted the repression ability of the COUP-TF (data notshown).

Interaction of the mERM with ER was more stable thanthat with COUP-TF. Figure 7 shows that the dissociation ofER from the mERM was slower than the dissociation ofCOUP-TF. The addition of 100-fold cold mERM displacedCOUP-TF binding in 10 min, while more than 60 min wasrequired for ER.

DISCUSSION

Lactoferrin, an iron-binding glycoprotein with multiplefunctions (22, 33, 40, 47), is present in various tissues andunder different mechanisms of control. In the uterus, lacto-ferrin is a major secretory protein whose expression isinfluenced by estrogen (44, 53). Although the biological roleof lactoferrin in uterine physiology is not clear, it plays animportant role in the general defense mechanism of the body(22, 33, 47). This paper reports that COUP-TF, an orphanreceptor belonging to the steroid-thyroid receptor superfam-ily, represses ER-mediated activation of the mouse lactofer-rin gene by competing for binding to the mERM.COUP-TF competes with ER for binding at an overlapping

site. COUP-TF was originally reported as a transcriptionactivator for the ovalbumin gene promoter in vitro (48, 55).Though the ligand that binds to COUP-TF has not beenfound, it could be activated by the physiological concentra-tion of dopamine via the phosphorylation event of thecellular membrane receptor. This implies the existence of

MOL. CELL. BIOL.

mCX-~

REPRESSOR FOR ER-MEDIATED LACTOFERRIN GENE ACTIVATION

Reporter Constructs Relative CAT Activity0 5 10 15 20 25 30, 40 50 60

psv-CATO

psv-mCAT1 CAT

psv-mCAT2 * CAT

psv-mCAT5

psv-mCAT6

psv-mCAT1 0

psv-mCAT1 1

psv-vCAT1

psv-vCAT2

Eu OmERM mERE mCOUP VitA2 ERE

-1

-1

O Control U DES

FIG. 4. The imperfect ERE of the mouse lactoferrin gene conferred higher estrogen responses than the mERM. Synthetic oligonucleotidescontaining the mouse lactoferrin imperfect ERE (psv-mCAT5 and psv-mCAT6), the COUP-TF-binding element (psv-mCAT10 andpsv-mCAT11), the wild-type mERM (psv-mCAT1 and psv-mCAT2), and the vitallogennin A2 perfect ERE (psv-vCAT1 and psv-vCAT2)sequences were individually cloned into the reporter gene with simian virus 40 promoter (SV) as described in Materials and Methods. Thevarious CAT constructs are schematically presented at the left. The orientation of the insert relative to the start site is indicated by the arrows.Human endometrium carcinoma RL95-2 cells were transiently cotransfected with chimeric CAT reporter plasmid (5 ,ug per well), human ERexpression vector (HEO, 0.05 ,ug per well), and ,B-galactosidase expression vector (pCH110, 0.25 pg per well). The transfected cells weretreated with 10-8 M DES as described in Materials and Methods. Relative CAT activity was represented after normalization for,B-galactosidase activity, and the results presented are the averages from at least four independent experiments performed in duplicate.Control, no treatment.

complicated cross-talk among the nuclear receptor, tran-scription factors, and the signal transduction pathway (re-viewed in references 38, 41, and 45, and see referencestherein). COUP-TF binds predominantly to the direct repeatof the GGTCA with two nucleotide spaces (6, 25). Naturalgenes that contain this direct repeat or its variants bindCOUP-TF (6, 14, 20, 32, 54). The mouse lactoferrin gene hasa composite ERE which is composed of overlapping COUP-TF- and ER-binding elements (31, 32). The band shift assayand DNase I footprinting experiments revealed thatCOUP-TF and ER competed for binding to the overlappingsite of the mERM in a mutually exclusive manner (Fig. 1 and2). There was no clear evidence of heterodimer formationbetween COUP-TF and ER in these studies; however,protein interference with each other cannot be discounted.Recent reports did indicate that COUP-TF forms het-erodimers with other members of the steroid-thyroid recep-tor superfamily, such as RXR (25) and ARP-1 (37). Incomparing the general structural and functional organizationof these receptors, it is clear that ARP-1 and RXR have ahigher sequence homology to COUP-TF than ER does (18,28, 29, 39, 57). This sequence difference could be one of theelements that distinguishes the transcription factor withwhich COUP-TF heterodimerizes. From the methylationinterference studied, we found that COUP-TF and ERshared identical contact sites for binding at the overlapping

region. The double G (GGTCA) contacts were critical forboth proteins to exert their actions. Mutation at these Gsabolished the binding ability of both proteins (Fig. SC) andtheir ability to confer estrogen action as well (Fig. SB). It hasbeen established that the double Gs at the 5' arm of thepalindromic ERE are critical for ER binding and action (24);it is interesting to find that the same sites were also criticalfor COUP-TF binding. Negative regulation of vitamin D3,thyroid, and retinoic acid response pathways as well asHNF-4 by COUP-TF were found in several natural genes (6,37, 54). The repression effect of the COUP-TF, however,could be overridden by increasing amounts of hormonereceptors or the HNF-4 transcription factor (6, 37, 54). Ofinterest is that members of the steroid-thyroid receptorsuperfamily could act as both positive and negative tran-scription factors, depending on the organization of theresponse element and its ability to interact with othertranscription factors. In fact, the thyroid receptor was foundto bind to the ERE and interfere with ER-mediated geneactivation (14). In CV-1 cells the heterodimer of thyroidreceptor and ot-retinoic acid receptor resulted in a positivetranscriptional effect on a synthetic palindromic thyroidresponse element construct but had a negative effect on athyroid response element of the a-myosin heavy-chain gene(15). The direct competition for the overlapping site withinthe same members of the steroid-thyroid receptor superfam-

VOL. 13, 1993 1841

-00. CAT

.0- _---wCAT

1842 LIU ET AL.

mRNA

-CAT

mLF

mRNA

CAT

mF

5' - AAQGTrAQA(:ACQiT;-AAGGTAACCCACAAAT- 3

5' - AAGTGTCACAG cTCAAGGTAACCCACAAAT - 3'

5' - AAGTGTCACAcGTCAAGGTAACCCACAAAT -3

5 - AAGTGTg ACAGGTCAAGGTAACCCACAAAT - 3'

Mut I Mut 2 Mut 3 mERM

Competitor - - 30X 1OOX 30X IOOX 30X 1OOX 30X 1OOX

WCE - + + + + + + + + +

C

C3 ->C2->

C1,- *'~~iiI_ _ _ _.

C Control* DES

F ->

0.3 mL 14-CAT mERM Muti Mut2 Mut3

ily is not limited to the mammalian system; two Drosophilahormone receptor-like proteins, Kni and Tll, exhibit similarcompetition for the overlapping sites in the regulatory regionof the Kruppel gene (19). Therefore, binding to the overlap-ping sets of the regulatory element by members of thesteroid-thyroid receptor superfamily could be one of thecommon molecular mechanisms that fine-tune the regula-tion.COUP-TF represses ER-activated transcription by interfer-

ing with ER binding. The antagonistic effect of the steroidreceptor and other transcription factor family nmembers iswell documented (9, 10, 21, 25, 37, 63). The mechanisms ofthe two distinct classes of transcription factors that exerttheir opposing effects appear to differ among cell types andspecies. Several molecular mechanisms that modulate theexpression of natural genes by the steroid receptor and othertranscription factors have been found. Competition for thecommon mediators (36, 43) and for the overlapping respon-sive enhancer (6, 37, 54) by the steroid receptor and tran-scription factor is well documented. Another common phe-nomenon is through protein-protein interactions (12, 21, 30,62). Examples of members within the steroid-thyroid recep-tor superfamily that regulate steroid hormone-responsivegenes in an opposing fashion are just beginning to be found(6, 25, 37, 54). In these studies COUP-TF already plays a

negative role by either interfering with receptor binding or

forming an inactive heterodimer with the receptor. Theseobservations parallel our current finding that COUP-TFrepresses the ER-activated transcription of the lactoferringene by direct competition for the binding site. Deletion and

1 2 3 4 5 6 7 8 9 10FIG. 5. Effect of mCOUP mutation on ER-dependent mERM

activity. Wild-type and mutated mERM were cloned into the 0.3mL14-CAT reporter plasmid (mouse lactoferrin promoter, -291 to-21 [31]) as described in Materials and Methods. (A) Nucleotidesequence of the insert. Mutated nucleotides are indicated by lower-case letters with asterisks above. (B) Estrogen responsiveness ofvarious constructs. Reporter CAT plasmids and ,B-galactosidaseexpression plasmids were cotransfected with HEO (0.1 ,ug per well).CAT activities were measured and normalized by ,B-galactosidaseactivity 20 h after the addition of 10-8 M DES. The data wererepresented as the averages from at least four independent experi-ments performed in duplicate. (C) Competition for binding tomERM by various mutated oligonucleotides with HEO-transfectedRL95-2 whole-cell extract (WCE). Protein-DNA complexes (Cl toC3) and free probe (F) are indicated.

mutation of the COUP-TF-binding element outside the over-

lapping region of the mERM render higher responses toestrogen (Fig. 4 and 5). Conversely, overexpressingCOUP-TF inhibits an estrogen-stimulated response of thelactoferrin mERM in RL95-2 cells (Fig. 6). These observa-tions further strengthen the negative role that COUP-TFplays in regulating the lactoferrin gene by estrogen in themouse uterus. Of note is that RXR and COUP-TF recognizethe same binding sequence. Therefore, RXR in the presenceof retinoic acid can transactivate a synthetic reporter con-struct through the COUP-TF-binding element in CV-1 cells(25, 54). The COUP-TF can also bind to the CRBPII-RXRelement of the CRBPII gene; however, it is unable toactivate this response element by itself (25). A similarsituation is found in the mouse lactoferrin gene; COUP-TFbinds to the mERM but does not activate the promoter of thereporter CAT in the RL95-2 cells (Fig. 4). Exogenous ligandor other factors may also be required for the activation byCOUP-TF alone.Endogenous concentrations of COUP-TF dictate estrogen

response of the mouse lactoferrin gene. The ER-dependentmERM-CAT activation was repressed by COUP-TF in a

A0.3 mL 14-CAT

pmL m-CAT 1

Wild Type mERM

Muti

Mut2

Mut3

B

> 20

0< 15

0 10I-

CC

MOL. CELL. BIOL.

I

REPRESSOR FOR ER-MEDIATED LACTOFERRIN GENE ACTIVATION 1843

50 r A

+ + + + _

- 1:20 1:50 1:100 -

7

E2/

C.)

*_1-

HEO (pg/well) 0.1 0.1 0.1 0.1 0.1 0.1

DES - + + + + +

RS-coup (pg) - - 1.0 2.0 3.0 4.0

FIG. 6. The endogenous COUP-TF level affects the estrogenresponsiveness of the mERM. (A) Cotransfection of Ov-COUPoligonucleotide enhanced the estrogen responses. Chimeric plas-mids containing the wild-type mERM were cotransfected with 1 pLgof HEO per well and various concentrations of Ov-COUP oligonu-cleotide (20-, 50-, and 100-fold molar excesses to the mERM) to theRL95-2 cells. The estrogen response of the mERM-CAT (psv-mCAT1) was examined. A chimeric plasmid containing the mERE

C (psv-mCAT5) was included as a positive control. CAT activity wasnormalized by 13-galactosidase activity. (B) Overexpression ofCOUP-TF represses the ER-dependent, estrogen-stimulated re-sponse of the mERM. Chimeric plasmids containing the wild-typemERM were cotransfected with HEO (0.1 ,ug per well) and variousconcentrations of RS-COUP (COUP-TF expression vector, 1 to 4 F±gper well) to the RL95-2 cells. The estrogen response of the mERM(psv-mCAT1) was examined. The CAT activities were normalizedby protein concentration (based on 20 ,ug of the protein), and therelative CAT activities were presented as the averages from threeindependent experiments performed in duplicate. (C) Dexametha-sone (DEX)-stimulated GRE-CAT activity was not repressed byoverexpressing RS-COUP expression vector. Same as panel B,except the chimeric plasmids contain the GRE element instead.+hGR, cotransfected with 0.05 ,ug of human GR expression vectorper well; -hGR, no exogenous GR was added. CAT activity wasnormalized with the protein concentration for panels B and C,because cotransfected RS-COUP inhibits 0-galactosidase activity.

GRE/CAT-P + + + + + +

DEX 10-8M - + + + + +

RS-COUP(pg) - - 1.0 2.0 3.0 4.0

dose-dependent manner. We found that either reducing theendogenous COUP-TF by introducing the chick ovalbumingene COUP-TF-binding element to the transfected cells oroverexpressing the COUP-TF expression vector in the trans-fected cells (Fig. 6) increased or repressed the estrogenresponse, depending on the dose. COUP-TF, however, didnot inactivate the basal activity of the reporter construct. Infact, COUP-TF showed a synergistic effect with ER whenthe COUP-TF- and ER-binding elements were separated(30a).

Multiple forms of COUP-TF have been isolated, and theircDNAs have been cloned (56, 57). The distribution of theseCOUP-TFs was widespread, yet variations among the dif-ferent forms in different tissues were substantial (56).COUP-TF's characteristics made it a prime candidate formodulating various hormone-responsive genes either posi-tively or negatively. In mouse uterine tissue, COUP-TF

could bind to the lactoferrin gene at a quiescent state untilestrogen is administered. Judging by the half-life ofCOUP-TF and ER binding to the response element (Fig. 7),it is evident that the ligand-activated ER could easily replaceCOUP-TF on the response element and confer its action.The half-life of COUP-TF interaction with ovalbumin DNA(-269 to -44) was 2.4 min in the absence of stabilizing factorS300-II (55), which is comparable to the results of our

binding study. In the mouse uterus, however, it is not knownwhether additional protein factors are involved in COUP-TFbinding. We observed that the estrogen-stimulated lactofer-rin message in mouse uterus was detected by Northern(RNA) blotting and by the polymerase chain reaction (52b) 4h after administration of the hormone. The delayed responsein vivo might imply that there is shuffling between COUP-TFand ER on the response module before the lactoferrinpromoter could be turned on. This shuffling might be thenovel molecular mechanism that regulates lactoferrin geneexpression in the uterus, since the regulation of the gene inthe other tissues is quite different. Lactoferrin, for example,is not expressed in the liver (44), even though many estro-

40 H

30 H

C.)

0

co0

20 H

10

psv-mCAT1psv-mCAT5Ov-COUP

2 -hGR

* +hGR200 -

150 -

100 -

0

._

0

C:0

50 -

I}

7

10"Iol

I

I

I

I

I

I

VOL. 13, 1993

1844 LIU ET AL.

ER NPE

Tlime (min) 0 5 10 20 40 60 0 5 10 20 40 60

C2

ci~ ~ ~ ~ ~ _

F

1 2 3 4 5 6 7 8 9 10 11 12FIG. 7. ER binds to mERM with higher stability than COUP-TF.

ER and NPE of RL95-2 cells were incubated with labeled mERMoligonucleotide as described in Materials and Methods. The protein-DNA complexes were resolved at various times after addition of100-fold excess cold mERM. The ER-DNA complex is indicated byC2, and the COUP-TF-DNA complex is indicated by Cl.

gen-responsive genes are expressed there and bothCOUP-TF and ER are present. Lactoferrin is developmen-tally regulated in neutrophils; it is prolactin regulated in themammary gland and constitutively expressed in most wetsurface mucosas (16, 34, 42). Two models may be involvedin the regulation of the lactoferrin gene in these tissues. Onemodel is composed of different sets of regulatory elementsand transcription factors that are involved in tissue-specificregulation. The other model, however, could be more com-mon; ubiquitous factors such as COUP-TF, RXR, and AP-1affect cell-specific expression through a composite regula-tory element by a gradient effect and produce differentregulatory patterns. Therefore, the relative concentrationsof ubiquitous transcription factors in a particular tissue maybe the determining factor for the expression of lactoferrin.The results presented here and by others (37, 54) demon-strate the gradient effect of a transcription factor. Theparticipation of an orphan receptor in gene regulation opensup tremendous combinatorial possibilities. Interaction ofthese receptors with their yet to be identified ligands couldaffect the expression of different sets of genes and cause verydifferent biological responses.

ACKNOWLEDGMENTSWe thank A. Jetten and M. Negishi for their critical reading of the

manuscript and T. Kunkel for the advice on mutagenesis study. Weare grateful to M. Parker for the baculovirus-expressed ER, S. Tsaiand M. Tsai for COUP-TF antibody and RS-COUP expressionvector, P. Chambon for HEO plasmid, and R. Evens for hGRexpression vector. The editorial assistance of L. Belans is greatlyappreciated.

REFERENCES1. Altschmied, J., M. Muller, A. Baniahmad, C. Steiner, and R.

Renkawit. 1989. Cooperative interaction of chicken lysozyme

enhancer sub-domains partially overlapping with a steroid re-ceptor binding site. Nucleic Acids Res. 17:4975-4991.

2. Beato, M. 1989. Gene regulation by steroid hormones. Cell56:335-344.

3. Berry, M., A. M. Nunez, and P. Chambon. 1989. Estrogenresponsive element of the human pS2 gene is an imperfectlypalindromic sequence. Proc. Natl. Acad. Sci. USA 86:1218-1222.

4. Brunel, F., A. Ochoa, E. Schaeffer, F. Boissier, Y. Guillou, S.Cereghini, G. N. Cohen, and M. M. Zakin. 1988. Interactions ofDNA-binding proteins with the 5'-region of the human trans-ferrin gene. J. Biol. Chem. 263:10180-10185.

5. Cooney, A. J., S. Y. Tsai, B. W. O'Malley, and M.-J. Tsai. 1991.Chicken ovalbumin upstream promoter transcription factorbinds to a negative regulatory region in the human immunode-ficiency virus type 1 long terminal repeat. J. Virol. 65:2853-2860.

6. Cooney, A. J., S. Y. Tsai, B. W. O'Malley, and M.-J. Tsai. 1992.Chicken ovalbumin upstream promoter transcription factor(COUP-TF) dimers bind to different GGTCA response ele-ments, allowing COUP-TF to repress hormonal induction of thevitamin D3, thyroid hormone, and retinoic acid receptors. Mol.Cell. Biol. 12:4153-4163.

7. Darwish, H., J. Krisinger, J. D. Furlow, C. Smith, F. E.Murdoch, and H. F. Deluca. 1991. An estrogen-responsiveelement mediates the transcriptional regulation of calbindinD-9K gene in rat uterus. J. Biol. Chem. 266:551-558.

8. Day, R. N., S. Koike, M. Sakai, M. Muramatsu, and R. A.Maurer. 1990. Both pit-1 and the estrogen receptor are requiredfor estrogen responsiveness of the rat prolactin gene. Mol.Endocrinol. 4:1964-1971.

9. Diamond, M. I., J. N. Miner, S. K. Yoshinaga, and K. R.Yamamoto. 1990. Transcription factor interactions: selectors ofpositive or negative regulation from a single DNA element.Science 249:1266-1272.

10. Doucas, V., G. Spyrou, and M. Yaniv. 1991. Unregulatedexpression of c-Jun or c-Fos proteins but not Jun D inhibitsoestrogen receptor activity in human breast cancer derivedcells. EMBO J. 10:2237-2245.

11. Evans, R. M. 1988. Steroid and thyroid hormone receptor astranscriptional regulators of development and physiology. Sci-ence 240:889-895.

12. Gaub, M. P., M. Bellard, I. Scheuer, P. Chambon, and P.Sassone-Corsi. 1990. Activation of the ovalbumin gene by theestrogen receptor involves the Fos-Jun complex. Cell 63:1267-1276.

13. Giguere, V., S. M. Hollenberg, M. G. Rosenfeld, and R. M.Evens. 1986. Functional domains of the human glucocorticoidreceptor. Cell 46:645-652.

14. Glass, C. K., J. M. Holloway, 0. V. Devary, and M. G.Rosenfeld. 1988. The thyroid hormone receptor binds withopposite transcriptional effects to a common sequence motif inthyroid hormone and estrogen response elements. Cell 54:313-323.

15. Glass, C. K., S. M. Lipkin, 0. V. Devary, and M. G. Rosenfeld.1989. Positive and negative regulation of gene transcription by aretinoic acid-thyroid hormone receptor heterodimer. Cell 59:697-708.

16. Green, M. R., and J. V. Pastewka. 1978. Lactoferrin is a markerfor prolactin response in mouse mammary explants. Endocri-nology 103:1510-1513.

17. Green, S., and P. Chambon. 1988. Nuclear receptors enhanceour understanding of transcription regulation. Trends Genet.4:309-314.

18. Green, S., P. Walter, V. Kumar, A. Krust, J. M. Bomert, P.Argos, and P. Chambon. 1986. Human oestrogen receptorcDNA: sequence, expression and homology to v-erb-A. Nature(London) 320:134-139.

19. Hoch, M., N. Gerwin, H. Taubert, and H. Jackie. 1992. Com-petition for overlapping sites in the regulatory region of theDrosophila gene Kruppel. Science 256:94-97.

20. Hwung, Y.-P., D. T. Crowe, L.-H. Wang, S. Y. Tsai, and M.-J.Tsai. 1988. The COUP transcription factor binds to an upstream

MOL. CELL. BIOL.

REPRESSOR FOR ER-MEDIATED LACTOFERRIN GENE ACTIVATION 1845

promoter element of the rat insulin II gene. Mol. Cell. Biol.8:2070-2077.

21. Jonat, C., H. J. Rahmsdorf, K. K. Park, A. C. B. Cato, S. Gebel,H. Ponta, and P. Herrlich. 1990. Antitumor promotion andantiinflammation: down-modulation of AP-1 (Fos/Jun) activityby glucocorticoid hormone. Cell 62:1189-1204.

22. Kalmar, J. R., and R. R. Arnold. 1988. Killing ofActinobacillusactinomycetemcomitans by human lactoferrin. Infect. Immun.56:2552-2557.

23. Klein-Hitpass, L., M. Schorpp, U. Wagner, and G. U. Ryffel.1986. An estrogen responsive element derived from the 5'-flanking region of the Xenopus vitellogenin A2 gene functions intransfected human cells. Cell 46:1053-1061.

24. Klein-Hitpass, L., S. Y. Tsai, G. L. Greene, J. H. Clark, M.-J.Tsai, and B. W. O'Malley. 1989. Specific binding of estrogenreceptor to the estrogen response element. Mol. Cell. Biol.9:43-49.

25. Kliewer, S. A., K. Umesono, R. A. Heyman, D. J. Mangelsdorf,J. A. Dyck, and R. M. Evans. 1992. Retinoid X receptor-COUP-TF interactions modulate retinoic acid signaling. Proc.Natl. Acad. Sci. USA 89:1448-1452.

26. Kumar, V., and P. Chambon. 1988. The estrogen receptor bindstightly to its responsive element as a ligand-induced homodimer.Cell 55:145-156.

27. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid andefficient site-specific mutagenesis without phenotypic selection.Methods Enzymol. 154:367-382.

28. Ladias, J. A. A., and S. K. Karathanasis. 1991. Regulation of theapolipoprotein Al gene by ARP-1, a novel member of the steroidreceptor superfamily. Science 251:561-565.

29. Leid, M., P. Kastner, R. Lyons, H. Nakshatri, M. Saunders, T.Zacharewski, J. Y. Chen, A. Staub, J. M. Garnier, S. Mader,and P. Chambon. 1992. Purification, cloning and RXR identityof the HeLa cell factor with which RAR or TR heterodimerizesto bind target sequences efficiently. Cell 68:377-395.

30. Liu, F., and M. R. Green. 1990. A specific member of the ATFtranscription factor family can mediate transcription activationby the adenovirus Ela protein. Cell 61:1217-1224.

30a.Liu, Y., and C. T. Teng. Unpublished data.31. Liu, Y. H., and C. T. Teng. 1991. Characterization of estrogen

responsive mouse lactoferrin promoter. J. Biol. Chem. 266:21880-21885.

32. Liu, Y. H., and C. T. Teng. 1992. Estrogen response module ofthe mouse lactoferrin gene contains overlapping chickenovalbumin upstream promoter transcription factor and estrogenreceptor binding elements. Mol. Endocrinol. 6:355-364.

33. Lu, L., G. Hangoc, A. Oliff, L. T. Chen, R. N. Shen, and H. E.Broxmeyer. 1987. Protective influence of lactoferrin on miceinfected with the polycythemia-inducing strain of Friend viruscomplex. Cancer Res. 47:4184-4188.

34. Masson, P. L., J. F. Heremans, and C. Dive. 1966. An iron-binding protein common to many external secretions. Clin.Chim. Acta 14:735-739.

35. Maxam, A., and W. Gilbert. 1980. Sequencing end-labeled DNAwith base-specific chemical cleavages. Methods Enzymol. 65:499-560.

36. Meyer, M. E., H. Gronemeyer, B. Turcotte, M. T. Bocquel, D.Tasset, and P. Chambon. 1989. Steroid hormone receptorscompete for factors that mediate their enhancer function. Cell57:433-442.

37. Mietus-Snyder, M., F. M. Sladek, G. S. Ginsburg, C. F. Kuo,J. A. A. Ladias, J. E. Darnell, Jr., and S. K. Karathanasis. 1992.Antagonism between apolipoprotein AI regulatory protein 1,Ear3/COUP-TF, and hepatocyte nuclear factor 4 modulatesapolipoprotein CIII gene expression in liver and intestinal cells.Mol. Cell. Biol. 12:1708-1718.

38. Miner, J. N., and K. R. Yamamoto. 1991. Regulatory crosstalkat composite response elements. Trends Biochem. Sci. 16:423-426.

39. Miyajima, N., Y. Kadowaki, S. I. Fukushige, S. I. Shimizu, K.Semba, Y. Yamanashi, K. I. Matsubara, K. Yoyoshima, and T.Yamamoto. 1988. Identification of two novel members of erbAsuperfamily by molecular cloning: the gene products of the two

are highly related to each other. Nucleic Acids Res. 16:11057-11074.

40. Nichols, B. L., K. S. Mckee, J. F. Henry, and M. Putman. 1987.Human lactoferrin stimulates thymidine incorporation intoDNA of rat crypt cells. Pediatr. Res. 21:563-567.

41. O'Malley, B. W. 1990. The steroid receptor superfamily: moreexcitement predicted for the future. Mol. Endocrinol. 4:363-369.

42. Panella, P. T., Y. Liu, A. T. Huang, and C. T. Teng. 1991.Polymorphism and altered methylation of the lactoferrin gene innormal leukocytes, leukemic cells, and breast cancer. CancerRes. 51:3037-3043.

43. Pashne, M., and A. A. F. Gann. 1990. Activators and targets.Nature (London) 346:329-331.

44. Pentecost, B. T., and C. T. Teng. 1987. Lactotransferrin is themajor estrogen inducible protein of mouse uterine secretions. J.Biol. Chem. 262:10134-10139.

45. Power, R. F., J. P. Lydon, 0. M. Conneely, and B. W. O'Malley.1991. Dopamine activation of an orphan of the steroid receptorsuperfamily. Science 252:1546-1548.

46. Richard, S., and H. H. Zingg. 1990. The human oxytocin genepromoter is regulated by estrogens. J. Biol. Chem. 265:6098-6103.

47. Richie, E. R., J. K. Hilliard, R. Gilmore, and D. J. Gillespie.1987. Human milk-derived lactoferrin inhibits mitogen andalloantigen induced human lymphocyte proliferation. J. Reprod.Immunol. 12:137-148.

48. Sagami, I., S. Y. Tsai, L. H. Wang, M. J. Tsai, and B. W.O'Malley. 1986. Identification of two factors required fortranscription of the ovalbumin gene. Mol. Cell. Biol. 6:4259-4267.

49. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

50. Seyfred, M. A., and J. Gorski. 1990. An interaction between the5' flanking distal and proximal regulatory domains of the ratprolactin gene is required for transcriptional activation byestrogens. Mol. Endocrinol. 4:1226-1234.

51. Sladek, F. M., W. Zhang, E. Lai, and J. E. Darnell. 1990.Liver-enriched transcription factor HNF-4 is a novel member ofthe steroid hormone receptor superfamily. Genes Dev. 4:2353-2365.

52. Slater, E. P., G. Redeuihl, K. Theis, G. Suske, and M. Beato.1990. The uteroglobin promoter contains a noncanonical estro-gen responsive element. Mol. Endocrinol. 4:604-610.

52a.Teng, C. T. Unpublished data.52b.Teng, C. T., and Y. Liu. Unpublished data.53. Teng, C. T., P. T. Pentecost, Y. H. Chen, R. R. Newbold, E. M.

Eddy, and J. A. McLachlan. 1989. Lactoferrin gene expressionin the mouse uterus and mammary gland. Endocrinology 124:992-999.

54. Tran, P., X.-K. Zhang, G. Salbert, T. Hermann, J. M. Lehmann,and M. Pfahl. 1992. COUP orphan receptors are negativeregulators of retinoic acid response pathways. Mol. Cell. Biol.12:4666-4676.

55. Tsai, S. Y., I. Sagami, L. H. Wang, M. J. Tsai, and B. W.O'Malley. 1987. Interactions between a DNA-binding transcrip-tion factor (COUP) and a non-DNA binding factor (S300-II).Cell 50:701-709.

56. Wang, L. H., N. H. Ing, S. Y. Tsai, B. W. O'Malley, and M. J.Tsai. 1991. The COUP-TFs compose a family of functionallyrelated transcription factors. Gene Express. 1:207-216.

57. Wang, L. H., S. Y. Tsai, R. G. Cook, W. G. Beattie, M. J. Tsai,and B. W. O'Malley. 1989. Coup transcription factor is amember of the steroid receptor superfamily. Nature (London)340:163-166.

58. Wang, L. H., S. Y. Tsai, I. Sagami, M. J. Tsai, and B. W.O'Malley. 1987. Purification and characterization of chickenovalbumin upstream promoter transcriptional factor from HeLacells. J. Biol. Chem. 262:16080-16086.

59. Way, D. L., E. S. Grosso, J. R. Davis, E. A. Surwit, and C. D.Christian. 1983. Characterization of a new human endometrialcarcinoma (RL95-2) established in tissue culture. In Vitro

VOL. 13, 1993

1846 LIU ET AL. MOL. CELL. BIOL.

(Rockville) 19:147-158.60. Weisz, A., and R. Rosales. 1990. Identification of an estrogen

response element upstream of the human c-fos gene that bindsthe estrogen receptor and the AP-1 transcription factor. NucleicAcids Res. 18:5097-5106.

61. Yamamoto, K. R. 1985. Steroid receptor regulated transcription ofspecific genes and gene networks. Annu. Rev. Genet. 19:209-252.

62. Yang-Yen, H. F., J. C. Chambard, Y. L. Sun, T. Smeal, T. J.

Schmidt, J. Drouin, and M. Karin. 1990. Transcriptional inter-ference between c-jun and the glucocorticoid receptor: mutualinhibition of DNA binding due to direct protein-protein interac-tion. Cell 62:1205-1215.

63. Zhang, X. F., J. M. Dong, and J. F. Chiu. 1991. Regulation ofa-fetoprotein gene expression by antagonism between AP-1 andthe glucocorticoid receptor at their overlapping binding site. J.Biol. Chem. 266:8248-8254.