Characterization of the myostatin gene and a

linked microsatellite marker in shi drum

(Umbrina cirrosa, Sciaenidae)

L. Maccatrozzo a, L. Bargelloni b, P. Patarnello c, G. Radaelli a,F. Mascarello a, T. Patarnello a,b,*

aFacolta di Medicina Veterinaria-Agripolis, Universita di Padova, Via Romea 16 I-35020 Legnaro, ItalybDipartimento di Biologia, Universita di Padova, Via Ugo Bassi 58/B, I-35121 Padua, ItalycDipartimento di Scienze della Produzione Animale, Universita di Udine, Via S. Mauro 2,

33100 Pagnacco, Italy

Received 21 January 2001; accepted 1 May 2001

Abstract

We report the characterisation of the gene coding for myostatin (or growth differentiation factor

8, GDF8) in the shi drum, Umbrina cirrosa. Because of its relevant role in muscle growth

regulation, GDF8 is an important candidate locus for improvement of animal production.

RT-PCR and RACE protocols were used to obtain the full-length GDF8 cDNA sequence. The

complete cDNA was 2086-bp long, containing an open reading frame of 376 amino acids.

Similarity searches on protein databases give highest values with zebrafish GDF8 (291 identical

residues over 376 compared amino acid positions), and other vertebrate GDF8s. This evidence

suggests that the putative protein isolated is the GDF8 homologue in the shi drum. At the genomic

level, the position and complete sequence was determined for two introns. While intron–exon

boundaries were conserved compared to mammalian GDF8 genes, both introns were considerably

smaller, of 342 and 735 bp, respectively. In the 3Vnoncoding region of the cDNA, a microsatellite

repeat (AC29) was present. This repeat region was examined at the genomic level, and its size

polymorphism assessed in a preliminary way, revealing four distinct alleles. This microsatellite

locus might represent a useful polymorphic marker for studying phenotype/genotype association.

We also examined the pattern of expression of sdGDF8, which is wider in the shi drum

compared to other vertebrates, suggesting possible additional functions of myostatin in the teleost

fish. These results should be taken into account if null mutants for GDF8 in this species are to be

0044-8486/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved.

PII: S0044-8486 (01 )00659 -7

* Corresponding author. Dipartimento di Biologia, Universita di Padova, Via Ugo Bassi 58/B, I-35121 Padua,

Italy. Tel.: +39-49-8276218; fax: +39-49-8276209.

E-mail address: patarnel@civ.bio.unipd.it (T. Patarnello).

www.elsevier.com/locate/aqua-online

Aquaculture 205 (2002) 49–60

produced, as they might have a more severe phenotype than observed in mammals. D 2002

Elsevier Science B.V. All rights reserved.

Keywords: Myostatin; GDF8; Muscle growth; Sciaenids; cDNA; Microsatellite

1. Introduction

Growth-differentiation factor 8 (GDF8) or myostatin (MSTN) is a member of the

transforming growth factor b (TGF-b) superfamily, which includes proteins that mediate

key events in cell growth and development through signal transduction. GDF8 seems to be

a negative regulator of skeletal muscle growth as mice knock-out for GDF8 display

increased muscle mass (McPherron et al., 1997) and cattle with null mutations of GDF8

gene present muscle hypertrophy (McPherron and Lee, 1997; Grobet et al., 1997).

Because of its role in muscle growth, GDF8 is an extremely interesting locus for genetic

improvement of farmed animals. Such potential applications in animal husbandry have

prompted the sequencing of GDF8 cDNA from several vertebrate species (man, baboon,

cattle, pig, sheep, chicken, turkey and zebrafish) (McPherron and Lee, 1997). However,

information on GDF8 expression is confined to a few mammalian species (McPherron et

al., 1997; Gonzalez-Cadavid et al., 1998; Ji et al., 1998; Sharma et al., 1999). Comparative

analysis of expression patterns might be helpful in understanding how function of specific

proteins evolved, and therefore, to which extent results and applications from higher

vertebrate taxa might be transferred to teleost fish.

Here, we report the isolation and characterisation of expression profile of the GDF8

gene in the shi drum, Umbrina cirrosa, a teleost fish belonging to the perciform family

Sciaenidae, which account for about 270 species and 70 genera worldwide. Sciaenids are

generally demersal fishes living in shallow waters on the continental shelf, though a few

marine species enter into brackish waters, while others are restricted to freshwater habitats.

Some sciaenids are important foodfishes, and in the Mediterranean area, at least five

species are exploited in bottom fisheries. In particular, the shi drum, because of its meat

quality and large size, is highly appreciated and commercially valuable. Experiments of

captive breeding have been already carried out, and this species is now a promising new

candidate for extensive marine aquaculture, in response to the increasing need of

diversification of marketed fish products.

The aim of the present work is to contribute to the study of shi drum biology, and in

particular, toward the understanding of mechanisms of muscle growth. This might in

turn lead to important practical applications for improvement of its aquaculture produc-

tion.

2. Materials and methods

Samples were collected from a farmed population, at the experimental fish farm

‘‘Impianto di Acquacoltura di Pellestrina, Veneto Agricoltura’’, Italy. Analysed tissues

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–6050

Table 1

PCR primers: name, sequence, annealing temperature (Ta) and PCR product size

Primer names (amplified region) Forward primer (5V–3V) Reverse primer (5V–3V) Ta (�C) Fragmet size (bp)

M1F–M1R (exon 1) GCCAT(CA)AA(GA)TCCCAAAT(CT)

CT(i)AG(CT)AA

TC(i)GT(i)G(CG)CATGGT(AC)ATGAT

(i)GT(CT)TC(CT)GT

53! 45 (*) 210

M3F–M3R (exon 3) CT(i)AC(i)GT(CG)GA(CT)TT(CT)GA

(AG)GACTTTGG(AC)TGG

ATCTG(CT)TCTTT(GT)CC(AG)TTAA

A(AG)TA(i)AGCAT

53! 45 (*) 222

E1F–M2R

(exon 1!exon 2, intron 1)

CAGCTTCTCGACCAGTACGAC A(GA)CAC(i)TGCTT(CT)AC(AG)TC

(AT)AT(i)CTCTGCCA

53! 47 (*) 372, 704

M2F–E3R

(exon 2!exon 3, intron 2)

GTAA(GA)(GA)GC(i)CAGCT(i)TGG

(GA)TT(CT)AT(CT)TGAG

TTTGGGGCAATAATCCAGTC 53! 47 (*) 413, 1183

MB5R1–UPM (5VUTR) TCCTCCATAACCACATCCCT CTAATACGACTCACTATAGGGCAA

GCAGTGGTAACAACGCAGAGT

56 469

MB5R2–UPM (5VUTR) GATATTAGGAGCCTCTTTCAT CTAATACGACTCACTATAGGGCAA

GCAGTGGTAACAACGCAGAGT

56 356

MB3R1–NUP (3VUTR) ATCTCAGAGGGACCCAGGCGTGC AAGCAGTGGTAACAACGCAGAGT 58 1278

MB3R2–NUP (3VUTR) TGCTGTACCCCCACCAAGATG AAGCAGTGGTAACAACGCAGAGT 58 1032

3VACrepF–3VACrepR(AC repeat)

(Fluorescent-Cy5)AACCAGAGTAG

AGGCCACAA

GACAGAGCACAGAACACCGA 56 261

M2OF–E3R

(exon 2!exon 3)

TCCCTGAAGATCGACGTGAA TTTGGGGCAATAATCCAGTC 60! 52 (*) 335

(*) indicates a touchdown PCR approach.

L.Macca

trozzo

etal./Aquacultu

re205(2002)49–60

51

(adipose tissue, brain, eye, gonad, heart, intestine, kidney, liver, skeletal lateral muscle and

spleen) were dissected from 2-year-old anaesthetized shi drums, rapidly frozen in liquid

nitrogen and then stored at �80 �C.An RT-PCR approach together with the Rapid Amplification of CDNA Ends (RACE)

technique (Frohman et al., 1988) was used to isolate the complete GDF8 cDNA. Total

RNA was extracted from skeletal muscle tissue (50–100 mg) using Trizol Reagent

(Gibco, Gaithersburg, MD), and following the manufacturer’s instructions. The protocol

is a modification of the single-step RNA isolation method by Chomczynski and Sacchi

(1987). An aliquot of extracted RNA was tested spectrophotometrically and run on

agarose gel under denaturing conditions to confirm yield and quality. One microgram of

RNA was reverse-transcribed using a reverse transcriptase (Superscript II, Gibco) and

random hexamers to obtain first strand cDNA. The obtained cDNA was then used as

template for the subsequent PCR reactions (experimental conditions are given in Table

1). All PCR were performed with 32 cycles using GeneAmp PCR System 9700 (Perkin

Elmer, Branchburg, NJ, USA) in 20 ml of PCR mix [1� Promega PCR buffer, 1.8 mM

MgCl2, 0.1 mM of each dNTPs, 0.5 mM of each primer, 0.5 U Taq DNA Polymerase

(Promega, Madison, USA), 1 ml cDNA]. Initially, two fragments were amplified using

degenerate primers, designed on the basis of GDF8 amino acid sequences in other

species (M1F–M1R, M3F–M3R, Table 1). PCR products were cloned into a plasmid

vector (pCR-II, Invitrogen, Carlsbad, CA) using a TOPO-TA cloning kit (Invitrogen) and

sequenced using the Thermosequenase pre-mixed cycle sequencing kit (Amersham-

Pharmacia Biotech, Uppsala, Sweden). At least three independent clones were

sequenced. Based on the sequenced fragments, specific primers were designed to amplify

other two cDNA regions (E1F–M2R, M2F–E3R, Table 1), that were cloned and

sequenced as described above.

The SMART RACE cDNA Amplification kit (Clontech, Palo Alto, CA) was used

according to the manufacturer’s instructions to obtain the 5V and 3V unknown regions.

RACE reactions were carried out using shi drum specific primers (MB5R1, MB5R2,

MB3R1, MB3R2, Table 1), designed on the basis of the already obtained cDNA

sequence. PCR products of 5V and 3V RACE were cloned and sequenced as described

above.

In addition to the cDNA sequence, two introns were completely sequenced. Total

genomic DNA was extracted using a salting-out protocol (Patwary et al., 1994) from 200

Fig. 1. (A) Experimental strategy used to obtain complete sdGDF8 cDNA. Dotted lines indicate amplified

fragment with the corresponding primers: A–B (M1F–M1R), C–D (M3F–M3R), E–F (E1F–M2R), G–H

(M2F–E3R), I–L (MB5R1–UPM), M–N (MB3R1–NUP). The fragment size is indicated in base pair. The grey

rectangles represent the full-length sdGDF8 cDNA; 5VUTR, 3VUTR and the coding sequence (CDS) are

differently shaded. The position and size of both introns and microsatellite (AC29) region are indicated on the

cDNA. (B) Complete nucleotide sequence of sdMSTN cDNA (2086 bp) (GenBank AF316881), and sequence of

intron 1 (342 bp) and intron 2 (735 bp) (underlined) as determined by PCR amplification and sequencing of

genomic DNA (GenBank AF316882). The inferred protein sequence is reported below the corresponding coding

region (upper case), which is delimited by the putative starting and stop codons (in grey). The noncoding

sequences are typed in lower case.

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–6052

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–60 53

mg of muscle tissue. Hundred nanograms of extracted DNA were subjected to PCR

amplification, using four primers (E1F–M2R, M2F–E3R, Table 1), presumably encom-

passing the position of the two introns, based on information from human (Gonzalez-

Cadavid et al., 1998) and porcine GDF8 gene (Stratil and Kopecny, 1999). Both PCR

products obtained were cloned and completely sequenced as described above.

Similarity searches were performed using the BLASTP program (http://www.

ncbi.nlm.nih.gov/BLAST/) with default settings on the complete, non-redundant Gen-

Bank database of translated coding sequences (release 2.0.11, Jan-20-2000).

To test the polymorphism of the identified microsatellite (see Results), two specific

primers (3VACrepF–3VACrepR, Table 1) were designed on the sequences flanking the

microsatellite region. Genomic DNA (50 ng) was obtained as described above, from 12

shi drum specimens, collected at the earlier mentioned location. Individual DNA

samples were amplified and PCR products were resolved on 6% denaturing polyacry-

lamide gels run onto an ALFexpressII automatic sequencer (Amersham Pharmacia

Biotech).

RT-PCR expression analysis was carried out on total RNA that was extracted using

the same method described above, from different tissues and organs of adult shi drum

(adipose tissue, brain, eye, gonad, heart, intestine, kidney, liver, skeletal lateral muscle

and spleen). For each sample, the same amount of RNA (1.5 mg) was reverse-tran-

scribed, using as primers either a (T)30 oligo or a mixture of random hexamers. RT

products were amplified with two specific primers encompassing intron 2 (M2OF–E3R,

Table 1). PCR products from each tissue were electrophoresed on a 1.8% agarose gel. To

confirm the specificity of PCR products, the agarose gel was blotted onto a nylon

membrane and hybridised with a specific probe (M2OF–E3R, Table 1) that was

digoxigenin-labelled (DIG Nucleic Acid Detection Kit, Roche, Mannheim, Germany).

DIG-labelled probe was detected, after hybridisation, by enzyme-linked immunoassay

using an antibody anti-DIG alkaline phosphatase conjugate. A subsequent enzyme-cata-

lysed colour reaction with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue

tetrazolium salt (NBT) produced an insoluble blue precipitate, which visualised hybrid

molecules.

3. Results

Initially, two fragments of 210 and 222 base pairs (bp), respectively, were amplified and

sequenced by means of RT-PCR (A–B, C–D, Fig. 1A). Subsequently, other two

Fig. 2. Multiple alignment of GDF8 amino acid sequences. Shi drum myostatin (sdMSTN), Atlantic salmon

(asMSTN, GenBank AJ297267), brook trout (btMSTN, GenBank AF247650), zebrafish (zMSTN, GenBank

AF019626), mouse (mMSTN, GenBank U84005) and human (hMSTN, GenBank AF019627). Dashes indicate

insertion–deletions, shading refers to different degree of overall conservation for each site (black—100%, dark

grey—80%, light grey—60%). Other four fish GDF8 cDNA can be found in GenBank (yellow perch, mahi-

mahi, little tunny and king mackerel). As these are only partial sequences, they are not included in the

alignment.

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–6054

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–60 55

fragments, 372- and 413-bp long (E–F, G–H), were amplified using shi drum specific-

primers. To characterise the 5V and 3V unknown regions, two PCR products of 469 and

1278 bp were obtained using a RACE protocol (I–J, K–L, Fig. 1A), and completely

Fig. 3. Results of electrophoretic separation of microsatellite alleles on ALFexpressII sequencer. Each lane

corresponds to a different screened individual (1–12). The uppermost and lowermost lanes (C) represent the

amplified product from the original clone containing the microsatellite repeat (262 bp, 29 AC repeats). In the

chromatogram, peaks represent microsatellite alleles. For each individual, the allele dimension is indicated in

base pairs.

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–6056

sequenced. Overlapping sequences of all fragments allowed to achieve a full-length

cDNA (GenBank accession number AF316881), which consisted of 2086 bp. A search

for open reading frames (ORF) revealed an ORF of 1131 bp, with the first possible start

codon located at position 109. This ORF encoded a peptide sequence of 376 amino

acids. The putative 5V untranslated region (UTR) was 108 bp, while the 3VUTR was

847 bp in length (Fig. 1B). The latter region is characterised by an ‘‘imperfect’’ AC29

microsatellite repeat (Fig. 1A,B). The entire inferred amino acid sequence (376 residues)

was used as a query in a BLASTP search with default parameters (Fig. 2). The highest

similarity values were obtained for the Atlantic salmon and brook trout myostatin with

301–300 identical residues over 376 compared amino acid positions, and the zebrafish

GDF8 (292/376), followed by other vertebrate GDF8s (226–230/372). Analysis of the

shi drum protein sequence showed a potential proteolytic processing site (RARR,

matching the RXXR consensus site) and seven cysteine residues in the carboxy-terminal

portion of the coding sequence, which corresponds to the mature processed protein

(McPherron and Lee, 1996), as observed in all TGF-b-like factors. The C-terminal

region, which is the most conserved, also contained two additional cysteines shared

among all vertebrate GDF8s. Based on the above results, the isolated sequence was

assumed to be the shi drum homologue of GDF8 (sdGDF8).

A partial characterisation of sdGDF8 gene was carried out through genomic amplifi-

cation of two regions (E–F, G–H), putatively encompassing two intronic sequences.

The complete sequence of the two amplified products revealed two introns, one (342-bp

long) in the first region (E–F), and a second one (735 bp) within fragment G–H

(GenBank accession number AF316882). Comparison between shi drum and mam-

malian GDF8 genes showed that intron–exon boundaries are conserved. However, both

introns are considerably smaller in the sdGDF8 gene than in its mammalian counter-

parts, because size of the first intron is 1808 bp in porcine GDF8 gene (Gonzalez-Cadavid

et al., 1998) and 1789 bp in human GDF8 (Stratil and Kopecny, 1999), while the second

intron spans 1977 and about 2400 bp, respectively.

An additional feature of the sdGDF8 cDNA was the presence of a repeat region

(AC29) in the 3VUTR. As this was a potential microsatellite marker, the same region was

investigated also at genomic level to evaluate its degree of polymorphism. Although

based on a limited sample size (12 individuals), results of this preliminary screening

revealed that the microsatellite is polymorphic, showing four alleles with size ranging

from 260 to 272 bp (Fig. 3). This microsatellite represents, therefore, a polymorphic

marker in tight linkage with the GDF8 locus.

To further characterise the sdGDF8 gene, its expression pattern was analysed by

means of RT-PCR. RT-PCR results for different organs and tissues were visualised on

agarose gel. A clearly visible PCR product was observed in the brain and muscle tissue,

while a much weaker band was obtained for the eye, gonad and heart. No band was

present in adipose tissue, intestine, kidney, liver and spleen (Fig. 4A). Hybridisation

with a DIG-labelled specific-probe confirmed the specificity of the RT-PCR assay,

yielding a strong signal for those tissue sample which were already positive on agarose

gel (Fig. 4B). In addition, this method revealed the presence of a faint band for other

tissues/samples (adipose tissue, kidney and spleen). No signal was present in the

intestine and liver even after Southern hybridisation. As a positive control, a b-actin

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–60 57

fragment of 406 bp was successfully amplified in all samples by means of RT-PCR

(Fig. 4C). A low number of PCR cycles (22) were performed to avoid signal saturation.

With this control, it was be possible to exclude that negative results are due to technical

problems, such as bad quality of extracted RNA and/or failure of RT reaction.

4. Discussion

Comparison of the isolated sequence with other vertebrates GDF8 genes provides

evidence that we obtained the full-length cDNA enconding the shi drum homologue of

GDF8. Further confirmation comes from the presence of characteristic amino acid

residues in the protein GFD8 sequence and the conserved position of two introns.

However, sdGDF8 intronic sequences were smaller in size than the corresponding

mammalian introns. This might be due either to size decrease in the teleost fish or to

increase in length for mammalian introns during evolution. In any case, the observation

is in agreement with the hypothesis of a more compact genome in several teleost fish.

Sequence analysis of the sdGDF8 locus also revealed an additional interesting

feature, the presence of a variable microsatellite region (four distinct alleles) in the

3VUTR. Further studies on a larger number of individuals are certainly needed to

determine more precisely its degree of polymorphism. However, tight linkage with such

an important locus makes this microsatellite a promising candidate marker for marker-

assisted selection of advantageous mutants, through correlation of alleles of different

size with different muscle-growth phenotypes and/or polymorphism of sdGDF8 ex-

pression across different individuals.

Fig. 4. (A) RT-PCR analysis of sdGDF8 expression profile. Five microliters of PCR product were loaded in each

lane. Lanes correspond to: adipose tissue (a), brain (b), eye (e), gonad (g), heart (h), intestine (i), kidney (k), liver

(l), muscle (m), spleen (s). Primers used were M2OF–E3R. (B) Hybridization of the sdGDF8 RT-PCR products

of different tissues with DIG-labelled probe. (C) As a positive control, a b-actin gene fragment of 406 bp was

successfully amplified in all samples by means of RT-PCR.

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–6058

The most striking finding of the present work, however, was obtained when RT-PCR

analysis of sdGDF8 expression was carried out on different organs and tissues. Positive

signal observed in the skeletal and heart muscle is in keeping with results for mammalian

GDF8s (McPherron et al., 1997; Gonzalez-Cadavid et al., 1998; Sharma et al., 1999),

thereby suggesting that its role in regulating muscle growth might be conserved across

vertebrate taxa. On the other hand, GDF8 is expressed also in other tissues/organs in the

shi drum, especially in the brain. Except for the adipose tissue, these results are at odd

with the expression profile in mammals. Since most expression data on mammalian

GDF8s were obtained using Northern blot analysis, it might be possible that expression in

a larger number of tissues could be revealed in other species by means of RT-PCR.

Alternatively, the wider expression profile of sdGDF8 might suggest that GDF8 have

additional functions in U. cirrosa. Further studies are thus important to better understand

the role of GDF8 in lower vertebrates.

In conclusion, sequence conservation and expression in muscle tissue indicate a

conserved role for GDF8 in the shi drum, thereby confirming the potential of this gene

for practical applications also in aquacultured fish species. Moreover, the associated

microsatellite locus might be extremely useful for marker-assisted selection of advanta-

geous mutants. At present, no technology is available for homologous recombination in

fish, to achieve specific gene knock-out. However, null mutants might be obtained for

instance by means of production of dominant negative transgenic animals. If such GDF8

mutants are to be produced for aquaculture purposes, the wide expression profile of

GDF8 observed in the shi drum indicates that inactivation of GDF8 might be lethal or

highly detrimental, unless experimental suppression or reduction of GDF8 function is

limited to the muscle tissue.

Acknowledgements

We acknowledge the ‘‘Impianto di Acquacoltura di Pellestrina, Veneto Agricoltura’’ for

providing access to samples. This work was supported by ‘‘cofinanziamento Ministero

Italiano per le Politiche Agricole-Universita di Padova’’ to F.M. and by ‘‘ex-40%

MURST’’ to T.P.

References

Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate–

phenol–chloroform extraction. Anal. Biochem. 162 (1), 156–159.

Frohman, M.A., Dush, M.K., Martin, G.R., 1988. Rapid production of full-length cDNAs from rare transcripts:

amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. U. S. A. 85, 8998–

9000.

Gonzalez-Cadavid, N.F., Taylor, W.E., Yarasheski, K., Sinha, H.I., Ma, K., Ezzat, S., Shen, R., Lalani, R., Asa, S.,

Mamita, M., Nair, G., Arver, S., Bhasin, S., 1998. Organization of the human myostatin gene and expression

in healthy men and HIV-infected men with muscle wasting. Proc. Natl. Acad. Sci. U. S. A. 95, 14938–14943.

Grobet, L., Martin, L.J., Poncelet, D., Pirottin, D., Brouwers, B., Riquet, J., Schoeberlein, A., Dunner, S.,

Menissier, F., Massabanda, J., Fries, R., Hanset, R., Georges, M., 1997. A deletion in the bovine myostatin

gene causes the double-muscled phenotype in cattle. Nat. Genet. 17, 71–74.

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–60 59

Ji, S.Q., Losinski, R.L., Cornelius, S.G., Frank, G.R., Willis, G.M., Gerrard, D.E., Depreux, F.F.S., Spurlock,

M.E., 1998. Myostatin expression in porcine tissues: tissue specificity and developmental and postnatal

regulation. Am. J. Physiol.: Regul., Integr. Comp. Physiol. 44, R1265–R1273.

McPherron, A.C., Lee, S.J., 1996. The transforming growth factor-beta superfamily. Growth Factors Cytokines

Health Dis. 1B, 357–393.

McPherron, A.C., Lee, S.J., 1997. Double muscling in cattle due to mutations in the myostatin gene. Proc. Natl.

Acad. Sci. U. S. A. 94, 12457–12461.

McPherron, A.C., Lawler, A.M., Lee, S.J., 1997. Regulation of skeletal muscle mass in mice by a new TGF-beta

superfamily member. Nature 387, 83–90.

Patwary, M.U., Kenchington, E.L., Bird, C.J., Zouros, E., 1994. The use of random amplified polymorphic DNA

markers in genetic studies of the sea scallop Plactopecten magellanicus (GMELLIN, 1791). J. Shellfish Res.

13, 547–553.

Sharma, M., Kambadur, R., Matthews, K.G., Somers, W.G., Devlin, G.P., Conaglen, J.V., Fowke, P.J., Bass, J.J.,

1999. Myostatin, a transforming growth factor-beta superfamily member, is expressed in heart muscle and is

upregulated in cardiomyocytes after infarct. J. Cell. Physiol. 180, 1–9.

Stratil, A., Kopecny, M., 1999. Genomic organization, sequence and polymorphism of the porcine myostatin

(GDF8; MSTN) gene. Anim. Genet. 30, 468–470.

L. Maccatrozzo et al. / Aquaculture 205 (2002) 49–6060