www.elsevier.com/locate/ybbrc

Biochemical and Biophysical Research Communications 352 (2007) 384–389

BBRC

Characterization of Schistosoma mansoni ATPDase2 gene,a novel apyrase family member

Julio Levano-Garcia a, Renato A. Mortara b, Sergio Verjovski-Almeida a,Ricardo DeMarco a,*

a Departamento de Bioquımica, Instituto de Quımica,Universidade de Sao Paulo, 05508-900 Sao Paulo, SP, Brazilb Departamento de Microbiologia, Imunologia e Parasitologia, Escola Paulista de Medicina, UNIFESP, Sao Paulo, SP, Brazil

Received 6 November 2006Available online 14 November 2006

Abstract

Schistosoma mansoni is a major causative agent of schistosomiasis, which constitutes a severe health problem in developing countries.We have previously described the SmATPDase1 gene, encoding a protein from the external surface of the parasites. In this work, wedescribe the cloning and characterization of SmATPDase2, a novel CD39-like ATP diphosphohydrolase gene in S. mansoni. In silico

analysis of the protein encoded by SmATPDase2 predicts a single N-terminal transmembrane domain similar to that described for secret-ed human apyrase isoforms. Immuno-colocalization experiments detected both SmATPDase proteins at the S. mansoni adult worm teg-ument basal and apical membranes, but only SmATPDase2 in the tegument syncytium. SmATPDase2 but not SmATPDase1 protein wasdetected by Western blot in culture medium supernatants following incubation of adult worms in vitro, indicating that SmATPDase2 wassecreted by the parasite to the medium. Taken together these data suggest a non-redundant role for SmATPDase2 in the parasite–hostinterplay.� 2006 Elsevier Inc. All rights reserved.

Keywords: Schistosoma mansoni; ATP-diphosphohydrolase isoforms; Apyrase; Cloning; Tegument

Schistosoma mansoni, a digenetic blood fluke, is one ofthe major causative agents of schistosomiasis, an endemicdisease that affects 200 million individuals; an estimatedadditional 500–600 million are at risk [1]. S. mansoni isadapted to life in the human blood vessels, and some ofthe adaptation mechanisms are effected by the secretionof prostaglandin [2] or GPI anchored proteins [3].

The ecto-apyrases/ATP-diphosphohydrolases (ATPD-ases/NTPDases EC 3.6.1.5; EC 3.6.1.6) are enzymes thathydrolyze ATP and ADP (and other tri- and diphosphatenucleosides) to monophosphate esters plus inorganic phos-phate (Pi). In humans, it has been called the CD39-likegene family, which has five different isoforms (CD39 toCD39-L4). All ATPDases share five highly conservedregions of homology (Pfam PF01150, Interpro

0006-291X/$ - see front matter � 2006 Elsevier Inc. All rights reserved.

doi:10.1016/j.bbrc.2006.11.023

* Corresponding author.E-mail address: rdemarco@iq.usp.br (R. DeMarco).

IPR000407) [4,5] that are important for catalytic activity[6]. ATPDases play a role in platelet aggregation becauseit modulates the levels of circulating ADP, a key mediatorof hemostasis and clot formation in the vascular endothe-lium [7].

An ecto-ATPDase activity was detected at the surface ofS. mansoni [8], and cross-reactive anti-potato ATPDaseantibodies suggested an ATPDase protein at the parasite’ssurface [5]. We have proposed that the ecto-ATPDasecould help the parasites to escape host hemostasis by pre-venting ADP-induced platelet activation [5,8]. Subsequent-ly, we characterized the S. mansoni ATPDase1 gene,encoding a protein with two transmembrane regions, andconfirmed by immunostaining the external localization[9]. Recent proteomic studies confirmed ATPDase1 in themembrane fraction of the tegument of adult worms [10,11].

In this work, we describe SmATPDase2, a novel CD39-like ATP-diphosphohydrolase gene in S. mansoni. Data

J. Levano-Garcia et al. / Biochemical and Biophysical Research Communications 352 (2007) 384–389 385

obtained here suggest that SmATPDase1 and SmATP-Dase2 are not redundant, and that their expression pat-terns and/or sub-cellular localization patterns likelydictate the role(s) that these enzymes will play in the lifecycle of the parasite.

Materials and methods

Parasite maintenance. Schistosoma mansoni adult worms (BH strain)were obtained by perfusion of mice 7–8 weeks after infection. Eggs,miracidia, cercariae, and schistosomula were obtained as previouslydescribed [9].

Rapid amplification of cDNA ends (RACE). mRNA was obtained fromworms conserved in RNALater (Ambion) by extraction with MACmRNA isolation kit (Miltenyi Biotec). Full-length cDNA was obtainedwith the rapid amplification of cDNA ends (RACE) technique, using200 ng mRNA and either the 3 0-RACE or 5 0-RACE kits (Gibco), andspecific primers, as specified by the manufacturer. The PCR step in RACEexperiments was performed with Advantage II polymerase (Clontech)using the following cycle: 95 �C (5 min); 30 cycles of 95 �C (30 s), 60 �C(30 s), and 68 �C (3 min); final extension of 68 �C (3 min). PCR amplifi-cation products were cloned into pGEM-T vector (Promega) andsequenced.

Expression of recombinant SmATPDase protein fragments having low

identity between SmATPDase1 and 2. SmATPDase2-deduced proteinsequence was aligned to SmATPDase1. A region with very low identitybetween them was determined (18% identity over 149 amino acids), andthe cDNAs encoding those regions were used as templates for cloning andexpression as recombinant proteins. For this purpose, we amplified byPCR the cDNA segments corresponding to SmATPDase1 from S280 toK444 (with primers GGAATTCCATATGTCGGAATTTGAAAGACGand TCCGAGCTCGATTTAGCAGTAAACCCTTGG) and toSmATPDase2 from H352 to N500 (GGAATTCCATATGCATTTCAAGTTAATTACC and TCCGAGCTCGAATTTTGAAAATCATTCACTG). Products were purified and cloned into pGEM-T vector (Promega)and sequenced to confirm the identity. Clones were digested with NdeI andSacI to generate inserts with overhang ends that were ligated into the NdeIand SacI sites of expression vector pET21b (Novagen).

Antigens expression and polyclonal antibodies production. PlasmidspET21bATPDase1 or pET21bATPDase2 were transformed intoBL21(DE3) Escherichia coli, and the hexa-histidine fusion proteins wereexpressed in LB medium with 1mM IPTG at 37 �C. Inclusion bodies werewashed [12] and solubilized with 8 M Urea, 20 mM Tris, pH 8.5. Proteinfragments were purified on Ni–NTA column (Qiagen) according to [13].Eluted fractions were dialyzed against PBS at 5 �C (24 h). Fusion proteinswere showed as single bands on SDS–PAGE, and were used as antigensfor immunization of either mice (ATPDase1 fragment) or rabbit (ATP-Dase2 fragment) with injections of 30 lg purified protein plus aluminumhydroxide adjuvant. Three injections were employed, at 15-day intervals,and blood was collected 10 days after the third immunization. The antiserawere negatively purified [14] by four washing steps using BL21(DE3)E. coli extract in PBS at 5 �C. Subsequently, each antiserum (mouse orrabbit) was further purified to eliminate cross-reactive antibodies byincubating with heat-denatured bacterial inclusion body products from thecorresponding opposite ATPDase isoform, in PBS at 5 �C with overnightagitation, followed by centrifugation and recovery of the purified serum inthe supernatant.

Western blot. Tegument was obtained from freshly perfused adultworms in PBS at 37 �C by 10 s strong vortex mixing. Whole worms wereseparated by decantation and the supernatant was submitted to ultra-centrifugation at 100,000g for 1 h. The pellet was suspended in 0.3 ml of5 mM Tris–HCl, pH 7.4, 8% sucrose, 0.5 lg/ml leupeptin, 0.1 lg/mlpepstatin, 0.05 lg/ml trypsin inhibitor, and 8.7 lg/ml PMSF. Sampleswere stored in liquid nitrogen until further use. Tegument samples werethawed just before use and solubilized with 40 mM Tris, pH 7.4, 7 M urea,200 mM b-ME, 2% Chaps and 1% SDS, then soluble and insoluble frac-

tions were separated by ultracentrifugation at 100,000g. Samples weresubmitted to 12% SDS–PAGE, transferred to a nitrocellulose membraneand developed with anti-ATPDase1 or anti-ATPDase2 (1:500 v:v) plusHRP-linked anti-mouse IgG or anti-rabbit IgG and chemiluminescence(Amersham Biosciences), as previously described [9].

Immunofluorescence on histological sections and whole parasites. Adultworms, fixed in 70% alcohol, were dehydrated, cleared, embedded inparaffin wax, and cut 4 lm thick. Sections were adhered to poly-L-lysineglass slides and fixed in acetone for 30 min at �20 �C. Sections wereblocked with PBS, 1% BSA, 0.1% Tween 20 (permeabilizing solution)overnight at room temperature. Sections were then incubated with antiseraanti-ATPDase1 (mouse) and 2 (rabbit) (1:100 v:v) overnight at 5 �C. Afterwashing three times with PBS buffer, a Cy3 (red) conjugated anti-mouseIgG and a FITC (green) conjugated anti-rabbit IgG (1:50 v:v) were addedto the permeabilizing solution with samples for 1 h at room temperature.Sections were washed, then mounted in a glycerol 90% solution, 50 mMTris–HCl, pH 9.0. Pre-immune sera from rabbit and mouse were used asnegative control. Images were acquired in a Bio-Rad 1024UV confocalsystem as previously described [9].

Whole miracidia, cercariae and schistosomula were fixed in coldmethanol for 10 min, incubated overnight in permeabilizing solution andthe remaining steps were as describe above for histological section of adultworms.

Schistosoma mansoni adult worm in vitro culture. Adult worms werewashed three times with advanced RPMI 1640 medium (Invitrogen), 1%BSA, 10 mM Hepes, pH 7.4. Worms were placed into 30 ml culturemedium with antimycotic antibiotic (Invitrogen), 100 U/ml Penicillin G,100 lg/ml Streptomycin sulphate, 0.25 lg/ml amphotericin B and incu-bated 48 h at 37 �C under 5% CO2, followed by separation of worms withfilter paper (Amersham Bioscience). Culture medium with antibiotics andwithout worms was used in parallel as negative control. Experiments wererun in duplicate (60 ml) containing 1790 worms in total.

The culture media from adult worm cultures or control were concen-trated about five times using Amicon ultra filters 10000 MWCO (Milli-pore) and dialyzed overnight against 100 volumes of equilibrium buffer(50 mM Tris–HCl, pH 7.5, 10% glycerol, 5 mM MgCl2, 20 mM NaCl) at5 �C. Samples were then centrifuged at 20,000g for 60 min at 5 �C. Thesupernatants were applied separately to 4 ml Reactive Red RR120 col-umns (Sigma) previously equilibrated with dialysis buffer. Columns werewashed with 10 volumes of equilibrium buffer, and bound proteins wereeluted with three volumes of equilibrium buffer plus 5 mM ADP and5 mM ATP. Eluted fractions were dialyzed (24 h) against 100 volumes of50 mM Tris–HCl, 5% glycerol, 50 mM NaCl at 5 �C, and then concen-trated about 30 times using Amicon ultra filters 10000 MWCO (Milli-pore). The recovered total proteins were quantified with the Bradfordmethod. For SDS–PAGE and Western blot, �140 lg protein were usedfrom each sample.

Sequence deposition. Full-length sequence of SmATPDase2 cDNA wasdeposited at GenBank with Accession No. DQ868522.

Results

Cloning and characterization of S. mansoni ATPDase2

Full-length sequence of the S. mansoni cDNA encodingATP-diphosphohydrolase 2 was obtained from adult wormmRNA using the RACE (rapid amplification of cDNAends) method with specific oligos that were designed froman EST assembly partial sequence (SmAE608642.1,http://bioinfo.iq.usp.br/schisto/). The resulting 3 0 RACEsequence permitted deduction of the protein carboxyl ter-minal region followed by an additional 621 bp of 3 0

UTR. However, the 5 0 RACE sequence appeared not tocontain the entire protein-coding region, because thededuced protein had the first conserved domain, namely

Fig. 1. Detection of ATPDase1 and 2 in the tegument fractions of S.

mansoni adult worms. (A,B) Western blots with tegument soluble (S) andinsoluble (I) fractions from adult parasites; (C,D) respective SDS–PAGEstained with Coomassie blue. (A) Anti-ATPDase1, (B) anti-ATPDase2antisera. Arrow indicates the most reactive band detected in eachexperiment. Positive control (P) contains E. coli total bacterial lysatefrom the transformant expressing the respective ATPDase isoform. Themolecular mass markers, from top to bottom, are: 118, 85, 47, 36, 26, and20 kDa.

386 J. Levano-Garcia et al. / Biochemical and Biophysical Research Communications 352 (2007) 384–389

the ACR1 region, only three amino acids away from the N-terminal. BLASTN search against the GenBank EST data-base using this RACE-extended sequence as query detectedan unannotated EST from lung schistosomulum(AM044701.1) that overlapped our RACE sequence andfurther extended it towards the 5 0-end. RT-PCR with prim-ers from the newly deduced ends of this gene amplified afull-length message that was cloned and sequenced, con-taining the entire 5 0 portion. The resulting full-length genehas 2293 bp and displays an ORF of 1695 bp, encoding aprotein of 564 amino acids that we named SmATPDase2.

BlastP comparisons of the deduced S. mansoni proteinsequence to GenBank data showed that the best match(E-value = 0.0) was to a Schistosoma japonicum deducedprotein (AAW26231) that has been automatically annotat-ed as NTPDase6-like protein ortholog, with 73% identityand 81% similarity over 550 amino acids. SmATPDase2next best matches were against rat, mouse, and humanCD39-L2 isoforms. The latter (NP_001238.1) showed 35%identity and 51% similarity with SmATPDase2 over 447amino acids (E-value = 4 · 10�65). Another human iso-form, CD39-L4 (NP_001240.1) showed 33% identity and49% similarity over 443 amino acids (E-value = 1 · 10�62).Interestingly, alignment of the two S. mansoni ATPDasesshowed a low level of identity (26%) and similarity (42%)over 465 amino acids (E-value = 3 · 10�20), suggesting thatan ancient divergence event must have generated these twoisoforms.

SmATPDase2 amino acid sequence was aligned withother members of the apyrase family (SupplementaryFig. S1) using Clustal X, and displays the five conservedregions (Supplementary Fig. S1, boxes) described previous-ly for this family [4,5]. Phylogenetic analysis with membersof the ATP-diphosphohydrolase family resulted in the treeshown in Supplementary Fig. S2. SmATPDase2 is moreclosely related to human CD39-L2, and CD39-L4 proteinsthan to SmATPDase1, which is placed in the branch con-taining human CD39, CD39-L1 and CD39-L3 proteins.Moreover, in silico analysis of SmATPDase2 topologyidentified only one amino-terminal transmembrane region(Supplementary Fig. S1), as described for human CD39-

L2 and CD39-L4. In contrast, SmATPDase1 has twotransmembrane regions, one amino- and the other carbox-yl-terminal, as in human CD39, CD39-L1, and CD39-L3

proteins.

Western blot and immunolocalization of S. mansoniATPDases 1 and 2

Fragments of SmATPDases 1 and 2 were selected in aregion of low conservation comprising 149 amino acidsthat exhibit only 18% sequence identity, and antibodiesspecific for each protein fragment were produced asdescribed in Materials and methods. Specificity of each iso-form antibody was tested by Western blots against the tworecombinant proteins. Supplementary Fig. S3A and Bshows that for each antiserum a detectable signal was only

present in the lane containing the corresponding ATPDaseisoform, indicating the specificity of each serum to itsrespective SmATPDase.

When S. mansoni tegument extracts were tested, anti-ATPDase1 antiserum revealed a major reactive band of�63 kDa (Fig. 1A), corresponding to a protein of relativelylow abundance in the mild-detergent soluble fraction, asseen by Coomassie blue staining (Fig. 1C). The antibodyreacted with the ATPDase1 fragment in the bacterial celllysate, and did not recognize any other bacterial protein(Fig. 1A, positive control). Anti-ATPDase2 revealed amajor reactive band of �55 kDa in the detergent-insolubleS. mansoni tegument fraction (Fig. 1B). Again, the reactiveband corresponds to a relatively low abundance protein inthat fraction (Fig. 1D), which suggests a good specificityand preferential reactivity of the anti-ATPDase2 antibody.

Co-immunolocalization experiments were performed byincubating tissues with the two different antisera, specificfor either SmATPDase1 or SmATPDase2. Confocal fluo-rescence microscopy images of histological sections ofadult worm and of permeabilized miracidium, cercaria,and 7-day schistosomulum were acquired (Fig. 2). Inadults, SmATPDase1 was co-immunolocalized withSmATPDase2 on both basal and apical membranes ofthe tegument (Fig. 2B, yellow). In contrast, SmATPDase2

Fig. 2. Co-immunolocalization of SmATPDase1 and 2 in S. mansoni whole permeabilized parasites and histological sections. (A) Fluorescence confocalmicroscopy (Fluor) and corresponding differential interference contrast (DIC) images of S. mansoni at different life cycle stages. Purified anti-SmATPDase1 and anti-SmATPDase2 antisera, and secondary antibodies coupled to Cy3 (red) or FITC (green) were used for fluorescence detection ofSmATPDase1 or SmATPDase2, respectively, on (a) miracidium, (e) cercaria, (i) schistosomulum and (m) adult worm histological sections. Pre-immunesera from mice and rabbit were used as negative controls for each stage (c, g, k, and o, respectively). (B) Left, detail of the adult florescence image frompanel (m) above, showing the localization of only SmATPDase2 (green) in the syncytium and co-localization (yellow) of both SmATPDase1 andSmATPDase2 on the tegument basal and apical membranes. Right, a scheme showing the structural components of the tegument. (For interpretation ofthe references to color in this figure legend, the reader is referred to the web version of this paper.)

J. Levano-Garcia et al. / Biochemical and Biophysical Research Communications 352 (2007) 384–389 387

388 J. Levano-Garcia et al. / Biochemical and Biophysical Research Communications 352 (2007) 384–389

was found throughout both the tegument syncytium andparts of the basal and apical membranes (Fig. 2B, green).The presence of lower fluorescence intensity in internal sec-tions of the worm indicates a low abundance in some inter-nal structure in comparison to the tegument (Fig. 2A, panelm).

Schistosomulum displays the two isoforms uniformlydistributed throughout the tegument (Fig. 2A, panel i),suggesting that even at the early stages of infection, anecto-ATPDase activity must be important for the parasite.SmATPDase2 was more concentrated at the caudal regionin the miracidium, especially at the body/tail junction(Fig. 2A, panel a). In the cercarial stage, SmATPDase2was localized mainly at the apical (oral sucker and mouth)and caudal regions (Fig. 2A, panel e).

SmATPDase2 is released by the parasites to the medium

Adult worms were kept in culture for 48 h and thesupernatant was cleared by paper filtration and by high-speed centrifugation followed by concentration asdescribed under Materials and methods. The concentratedsupernatant was subjected to affinity chromatographyusing Reactive Red RR120 resin. ATP-binding proteinswere eluted from the resin with 5 mM ADP and 5 mMATP. Western blot of the eluted fraction was developedusing either primary antibody anti-ATPDase2 (1:500)(Fig. 3B) or anti-ATPDase1 (1:500) (Fig. 3A). It was clear-ly seen that SmATPDase2 but not SmATPDase1 wasdetected in the supernatants.

Fig. 3. Detection of SmATPDase2 in the supernatant of adult wormin vitro cultures. Supernatants were obtained either from adult wormsculture media (+) or control culture media with no worms (�) as describedin Materials and methods. (A,B) Western blots with specific antisera;(C,D) respective SDS–PAGE stained with Coomassie blue. (A) Anti-ATPDase1 (1:500), (B) anti-ATPDase2 (1:500) antibodies. Black arrowspoint to ATPDase2. Positive controls (P), bacterial lysates of E. coli

expressing ATPDase1 or ATPDase2 fragments, each have �20 kDa. Themolecular mass markers, from top to bottom, are: 118, 85, 47, 36, 26, and20 kDa.

Discussion

In this report, we describe a novel ATP-diphosphohy-drolase gene from S. mansoni, displaying very differentcharacteristics in relation to the previously describedSmATPDase1. Phylogenetic analysis of SmATPDase2deduced protein has grouped it together with humanCD39-L2, CD39-L4, and apyrases from Anopheles gambiae

and Drosophila melanogaster, with a considerable distancefrom SmATPDase1 (Supplementary Fig. 2).

SmATPDase2 displays only one transmembrane regionand Western blots of adult whole homogenates detected a55 kDa band, suggesting that it could be subject to a pro-teolytic pos-translational processing. Proteolytic cleavageand secretion would be analogous to that described forboth human CD39-L2 and CD39-L4, as well as ratCD39L2, in experiments using mammalian transfected cellsin culture [15–17]. It has been hypothesized that some alter-native proteolysis mechanism is responsible for the releaseof CD39-L2 to the medium [16]. Search for a signal peptidein CD39-L2 (NP_001238.1) or SmATPDase2 using the sig-nalP 3.0 program [18] does not detect any cleavage signal,but signal anchors are predicted with 87.9% probability forCD39-L2 and 99.5% for SmATPDase2 (considering analternative start codon at methionine 33). Additionally,both SmATPDase2 and CD39-L2 are given high scores(0.649 and 0.6113, respectively) when using the Secretome2.0 prediction algorithm [19], suggesting that they mightbe secreted through a non-classical secretory pathway.

While ATPDase1 locates preferentially at the border ofthe tegument (Fig. 2B), ATPDase2 is contained in someinternal cellular structure of the tegument syncytium. Thereis a possibility that SmATPDase2 is associated to detergentinsoluble fractions of Golgi or Endoplasmatic Reticulum,as described for some exported proteins [20,21], whichwould explain why SmATPDase2 was located in the deter-gent insoluble tegumental fraction on Western blot experi-ments (Fig. 1B). Additionally, SmATPDase2 may beassociated with discoid and/or multilamellar bodies previ-ously described in the S. mansoni tegument [22], whichwould account for its widespread presence in the tegumentsyncytium, ready to be released to the extra-cellular space.In fact, Western blot analysis of the medium supernatantdetected ATPDase2, suggesting that it is being secretedby the parasite.

We hypothesize that SmATPDase2 is being produced bythe subtegumental cell, transported across the tegument,being finally secreted from the tegument to the exteriorenvironment. It is possible that ATPDase2 performs a sim-ilar function as that of the soluble human CD39-L2 thathas been implicated in maintaining circulatory hemostasis[16,17]. Secretion of SmATPDase2 would be advantageousto the parasite to prevent platelet activation and recruit-ment, which has been shown to mediate cytotoxic respons-es from the host [23]. Due to the fact that SmATPDase2is secreted while SmATPDase1 is bound to parasitemembranes, it is possible that both enzymes perform

J. Levano-Garcia et al. / Biochemical and Biophysical Research Communications 352 (2007) 384–389 389

complementary functions. Moreover, the differences in pri-mary sequence between ATPDase1 and 2 must confer dis-tinct enzymatic properties related to each enzyme’s role.The peripheral location of ATPDase2 in both adult andschistosomula, and the relatively low overall similarity tohuman CD39L2 and CD39L4 (33–35%), makes it a poten-tial candidate for the development of a vaccine or newdrugs. Further in vivo characterization of the function ofboth ATPDases and their role in host–parasite interactionwill help understand the biology of S. mansoni and eventu-ally aid the development of new strategies for intervention.

Acknowledgments

Supported by a grant from FAPESP, Fundacao deAmparo a Pesquisa do Estado de Sao Paulo to S.V.A.,and by fellowships from FAPESP and CNPq, ConselhoNacional de Desenvolvimento Cientıfico e Tecnologico,Brasil. We thank Dr. Simon Braschi and Dr. R. Alan Wil-son, University of York, York (UK), for valuable sugges-tions in the interpretation of the immunolocalizationimages. We thank Dr Cybele Gargioni, Instituto AdolfoLutz for supplying adult worm histological sections, as wellas Katia P. Oliveira, Universidade de Sao Paulo for supply-ing S. mansoni at different stages. Technical assistance fromRenato Alvarenga is acknowledged.

Appendix A. Supplementary data

Supplementary data associated with this article can befound, in the online version, at doi:10.1016/j.bbrc.2006.11.023.

References

[1] WHO, TDR Strategic Direction for Research: Schistosomiasis,World Health Organization, Geneve, 2002.

[2] M. Herve, V. Angeli, E. Pinzar, R. Wintjens, C. Faveeuw, S.Narumiya, A. Capron, Y. Urade, M. Capron, G. Riveau, F. Trottein,Pivotal roles of the parasite PGD2 synthase and of the host Dprostanoid receptor 1 in schistosome immune evasion, Eur. J.Immunol. 33 (2003) 2764–2772.

[3] H. Sprong, M. Suchanek, S.M. van Dijk, A. van Remoortere, J.Klumperman, D. Avram, J. van der Linden, J.H. Leusen, J.J. vanHellemond, C. Thiele, Aberrant receptor-mediated endocytosis ofSchistosoma mansoni glycoproteins on host lipoproteins, PLoS Med. 3(2006).

[4] M. Handa, G. Guidotti, Purification and cloning of a soluble ATP-diphosphohydrolase (apyrase) from potato tubers (Solanum tubero-

sum), Biochem. Biophys. Res. Commun. 218 (1996) 916–923.[5] E.G. Vasconcelos, S.T. Ferreira, T.M. Carvalho, W. Souza, A.M.

Kettlun, M. Mancilla, M.A. Valenzuela, S. Verjovski-Almeida,Partial purification and immunohistochemical localization of ATPdiphosphohydrolase from Schistosoma mansoni. Immunologicalcross-reactivities with potato apyrase and Toxoplasma gondii

nucleoside triphosphate hydrolase, J. Biol. Chem. 271 (1996)22139–22145.

[6] F. Yang, C.A. Hicks-Berger, T.M. Smith, T.L. Kirley, Site-directedmutagenesis of human nucleoside triphosphate diphosphohydrolase3: the importance of residues in the apyrase conserved regions,Biochemistry 40 (2001) 3943–3950.

[7] A.J. Marcus, M.J. Broekman, J.H. Drosopoulos, N. Islam, T.N.Alyonycheva, L.B. Safier, K.A. Hajjar, D.N. Posnett, M.A. Schoen-born, K.A. Schooley, R.B. Gayle, C.R. Maliszewski, The endothelialcell ecto-ADPase responsible for inhibition of platelet function isCD39, J. Clin. Invest. 99 (1997) 1351–1360.

[8] E.G. Vasconcelos, P.S. Nascimento, M.N. Meirelles, S. Verjovski-Almeida, S.T. Ferreira, Characterization and localization of an ATP-diphosphohydrolase on the external surface of the tegument ofSchistosoma mansoni, Mol. Biochem. Parasitol. 58 (1993) 205–214.

[9] R. DeMarco, A.T. Kowaltowski, R.A. Mortara, S. Verjovski-Almeida, Molecular characterization and immunolocalization ofSchistosoma mansoni ATP-diphosphohydrolase, Biochem. Biophys.Res. Commun. 307 (2003) 831–838.

[10] S. Braschi, R.A. Wilson, Proteins exposed at the adult schistosomesurface revealed by biotinylation, Mol. Cell. Proteomics 5 (2006) 347–356.

[11] S. Braschi, R.S. Curwen, P.D. Ashton, S. Verjovski-Almeida, A.Wilson, The tegument surface membranes of the human bloodparasite Schistosoma mansoni: a proteomic analysis after differentialextraction, Proteomics 6 (2006) 1471–1482.

[12] W. Richter, T. Hermsdorf, T. Kronbach, D. Dettmer, Refolding andpurification of recombinant human PDE7A expressed in Escherichia

coli as inclusion bodies, Protein Expr. Purif. 25 (2002) 138–148.[13] G. Lemercier, N. Bakalara, X. Santarelli, On-column refolding of an

insoluble histidine tag recombinant exopolyphosphatase from Try-

panosoma brucei overexpressed in Escherichia coli, J. Chromatogr. BAnalyt. Technol. Biomed. Life Sci. 786 (2003) 305–309.

[14] A. Gruber, B. Zingales, Alternative method to remove antibacterialantibodies from antisera used for screening of expression libraries,Biotechniques 19 (1995) 28–30.

[15] J.J. Mulero, G. Yeung, S.T. Nelken, J.E. Ford, CD39-L4 is a secretedhuman apyrase, specific for the hydrolysis of nucleoside diphosphates,J. Biol. Chem. 274 (1999) 20064–20067.

[16] G. Yeung, J.J. Mulero, D.W. McGowan, S.S. Bajwa, J.E. Ford,CD39L2, a gene encoding a human nucleoside diphosphatase,predominantly expressed in the heart, Biochemistry 39 (2000)12916–12923.

[17] C.A. Hicks-Berger, B.P. Chadwick, A.M. Frischauf, T.L. Kirley,Expression and characterization of soluble and membrane-boundhuman nucleoside triphosphate diphosphohydrolase 6 (CD39L2), J.Biol. Chem. 275 (2000) 34041–34045.

[18] J.D. Bendtsen, H. Nielsen, G. von Heijne, S. Brunak, Improvedprediction of signal peptides: SignalP 3.0, J. Mol. Biol. 340 (2004)783–795.

[19] J.D. Bendtsen, L.J. Jensen, N. Blom, G. Von Heijne, S. Brunak,Feature-based prediction of non-classical and leaderless proteinsecretion, Protein Eng. Des. Sel. 17 (2004) 349–356.

[20] S.J. Lee, U. Liyanage, P.E. Bickel, W. Xia, P.T. Lansbury Jr., K.S.Kosik, A detergent-insoluble membrane compartment contains Abeta in vivo, Nat. Med. 4 (1998) 730–734.

[21] M. Bagnat, S. Keranen, A. Shevchenko, K. Simons, Lipid raftsfunction in biosynthetic delivery of proteins to the cell surface inyeast, Proc. Natl. Acad. Sci. USA 97 (2000) 3254–3259.

[22] R.A. Wilson, P.E. Barnes, The tegument of Schistosoma mansoni:observations on the formation, structure and composition ofcytoplasmic inclusions in relation to tegument function, Parasitology68 (1974) 239–258.

[23] D. Bout, M. Joseph, M. Pontet, H. Vorng, D. Deslee, A. Capron, Ratresistance to schistosomiasis: platelet-mediated cytotoxicity inducedby C-reactive protein, Science 231 (1986) 153–156.