Gene amplification through PCR

Presented ByP.UMA DEVIRVM 08-26MVSC 1ND YEAR

Contents

PCR Definition Components of the reaction mixture PCR primer design guidelines Steps in PCR Variations on the basic PCR technique Comparison of PCR and Gene cloning Applications of PCR Problems related to PCR

What is PCR?

Polymerase Chain Reaction is an in vitro technique for the amplification of a specific sequence of DNA Which is used for further testing.

Kary Mullis (1987)Cetus Corporation (A Biotech Company of United States)Nobel Prize 1993

Components of the reaction mixture

Template DNA.Primers (forward and reverse)dNTPsTaq DNA Polymerase Buffer solutionDivalent cationsSterile deionized water

Template DNA

It contains the DNA region to be amplifiedRange - 1-2 µl ( for a total reaction mixture of 10 µl)

Primers

Short Single stranded oligonucleotidesThey are complementary to the 5' or 3' ends of the DNA regionRange - 1 µl ( for a total reaction mixture of 10 µl)

TTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>and <. . . . . . . . . . AAATTTGGCCAATTAACGGCCTTAA . . . TTTAAACCGGTT

PCR Primer Design Guidelines

Primer Length:

Optimal length of PCR primers is 18-22 bp

TTAACGGCCTTAA….. TTTAAACCGGTT

AATTGCCGGAATT........>

Primer Melting Temperature: (Tm) Temperature at which one half of the DNA

duplex will dissociate to become single stranded and indicates the duplex stability.

Range - 52-58°C

Formula Tm = 4 (G+C) + 2 (A+T) (GCAT no. of respective nucleotides in the

primer)

GC Content 40-60%.

GC Clamp Presence of G or C bases within the last five

bases from the 3' end of primers Promotes specific binding at the 3' end due to the stronger bonding of G and C bases

Primer Secondary Structures : produced by intermolecular or intramolecular interactions

Lead to poor or no yield of the product. Ex - Hairpins Dimers

Hairpins Intramolecular interaction within the primer

Self Dimer They formed by intermolecular interactions between

the two primers, where the primer is homologous to itself.

They reduce the product yield.

Repeats A di-nucleotide occurring many times consecutively.

They should be avoided because they can misprime.

Ex. ATATATATATAT……….. Acceptable di-nucleotide repeats are maximum 4

Runs Primers with long runs of a single base.

Ex. AGCGGGGGATGGGG……….. The maximum number of runs accepted are 4

Avoid Cross homology Primers designed for a sequence must not amplify other genes in the mixture.Position Sequence close to the 3‘ end preferred most frequently.

dNTPs

De oxy nucleotide triphosphate (dATP, dGTP, dTTP, dCTP)They are the building blocks from which the DNA polymerases synthesizes a new DNA strand.

Range - 0.5 µl (for 10µl reaction mixture)

dNTPs in the reaction mix

Taq DNA Polymerase

Thermus aqaticus Range 0.2ul of (in 10µl of reaction mix) It assebles a new DNA strand from dNTPs

Buffer solution Contains Divalent cations like Mg+2 Provides suitable chemical environment for

optimum activity and stability of the DNA polymerase

Range - 1µl ( for a total reaction mixture of 10 µl)Sterile deionized water

It’s quantity is variable

Steps in PCR

InitializationDenaturationAnnealingExtension / ElongationFinal elongationFinal holdInitialization step

Heating the reaction to a temperature of 94-96°C for 1-9 minutes.

Denaturation step 94-98°C for 20-30 seconds. Denaturation of DNA template by disrupting the

hydrogen bonds between complementary bases of the DNA strands, yielding single strands of

DNA.

Annealing step

50-65°C for 20-40 seconds Stable DNA-DNA hydrogen bonds are formed The polymerase binds to the primer-template

hybrid and begins DNA synthesis.

Extension/elongation step

75-80°C At this step the DNA polymerase synthesizes a new DNA

strand complementary to the DNA template by adding dNTPs in 5' to 3' direction.

Final elongation 70-74°C for 5-15 minutes To ensure that any remaining single-

stranded DNA is fully extended.Final hold 4-15°C for an indefinite time short-term storage of the reaction

Allele- Specific PCR

Selective PCR amplification of the alleles to detect single nucleotide polymorphism (SNP)

Selective amplification is usually achieved by designing a primer such that the primer will match or mismatch one of the alleles at the 3’ end of the primer.

Asymmetric PCR

It is used for DNA sequencing The two primers are used in the 100:1 ratio so that after

20-25 cycles of amplification one primer is exhausted thus single stranded DNA is produced in the next 5-10 cycles

Real Time PCR

Quantitative real time PCR (Q-RT PCR) It is used to amplify and simultaneously

quantify a target target DNA molecule Real time PCR using DNA dyes Fluorescent reporter probe method

Real Time PCR

Helicase-dependent amplification

Constant temperature is used rather than cycling through denaturation and annealing/extension cycles.

DNA Helicase, an enzyme that unwinds DNA, is used in place of thermal denaturation.

Intersequence-specific PCR (ISSR):

A PCR method for DNA fingerprinting that amplifies regions between some simple sequence repeats to produce a unique fingerprint of amplified fragment lengths.

Inverse PCR

A method used to allow PCR when only one internal sequence is known.

This is especially useful in identifying flanking sequences of various genomic inserts.

Anchored PCR

When sequence of only one end of the desired segment of gene is known,the primer complimentary to the 3' strand of this end is used to produce several copies of only one strand of the gene.

RT-PCR (Reverse Transcription PCR)

It is used to amplify, isolate or identify a known sequence from a cellular or tissue RNA.

RT-PCR is widely used in expression profiling, to determine the expression of a gene or to identify the sequence of an RNA transcript.

RACE-PCR

Used to obtain 3' and 5' end sequence of cDNA transcripts

  Parameter PCR Gene cloning

1. Final result Selective amplification of specific sequence

Selective amplification of specific sequence

2. Manipulation In vitro In vitro and in vivo

3. Selectivity of the specific segment from complex DNA

First step Last step

4. Quantity of starting material Nanogram (ng) Microgram (m)

5. Biological reagents required DNA polymerase (Taq polymerase)

Restriction enzymes, Ligase, vector. bacteria

6. Automation Yes No

7. Labour intensive No Yes

8. Error probability Less More

9. Applications More Less

10. Cost Less More

11. User’s skill Not required Required

12. Time for a typical experiment Four hours Two to four days

Comparison PCR - Polymerase Chain Reaction and Gene Cloning

Application of PCR

Cloning a Gene encoding a known protein

Amplification of old DNA

Amplifying cloned DNA from Vectors

Rapid Amplification of cDNA ends

Detecting Bacterial or Viral Infection

● AIDS infection

●Tuberculosis (Mycobacterium tuberculosis)

Genetics Diagnosis Diagnosing inherited disorders

Cystic fibrosis Muscular dystrophy Haemophilia A and B Sickle cell anaemia

Diagnosing cancerBlood group typing.

Problems with PCR

Polymerase errors

Polymerase lacks exonuclease activity Size limitations

PCR works readily with DNA of lengths two to three thousand basepairs

Non specific priming