Transcript
Page 1: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

HORIZON DISCOVERY

THE CELL BUILDERS Designing, engineering and applying gene-edited cells to advance human health

Page 2: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

2

The information contained in this confidential document (“Presentation”) has been prepared by Horizon Discovery Group plc (the “Company”). It has not been fully verified and is subject to material updating, revision and further amendment. Any person who receives this Presentation should not rely or act upon it. This Presentation should not be re-distributed, re-published, reproduced or disclosed by recipients, in whole or in part.

While the information contained herein has been prepared in good faith, neither the Company, Numis Securities Limited (“Numis") nor any of their respective shareholders, directors, officers, agents, employees or advisers give, have given or have authority to give, any representations or warranties (express or implied) as to, or in relation to, the accuracy, reliability or completeness of the information in this Presentation, or any revision thereof, or of any other written or oral information made or to be made available to any interested party or its advisers (all such information being referred to as “Information”) and liability therefore is expressly disclaimed. Accordingly, neither the Company, Numis nor any of their shareholders, directors, officers, agents, employees or advisers take any responsibility for, or will accept any liability whether direct or indirect, express or implied, contractual, tortious, statutory or otherwise, in respect of, the accuracy or completeness of the Information or for any of the opinions contained herein or for any errors, omissions or misstatements or for any loss, howsoever arising, from the use of this Presentation.

This Presentation may contain forward-looking statements that involve substantial risks and uncertainties, and actual results and developments may differ materially from those expressed or implied by these statements and past performance is no guarantee of future performance. These forward-looking statements are statements regarding the Company's intentions, beliefs or current expectations concerning, among other things, the Company's results of operations, financial condition, prospects, revenue generation, growth, strategies and the industry in which the Company operates. By their nature, forward-looking statements involve risks and uncertainties because they relate to events and depend on circumstances that may or may not occur in the future. These forward-looking statements speak only as of the date of this Presentation and the Company does not undertake any obligation to publicly release any revisions to these forward-looking statements to reflect events or circumstances after the date of this Presentation.

In no circumstances will the Company or Numis be responsible for any costs, losses or expenses incurred in connection with any appraisal or investigation of the Company. In furnishing this Presentation, the Company does not undertake or agree to any obligation to provide the recipient with access to any additional information or to update this Presentation or to correct any inaccuracies in, or omissions from, this Presentation which may become apparent. This Presentation does not constitute an offer or invitation to subscribe for or purchase any securities and neither this Presentation nor anything contained herein shall form the basis of any contract or commitment whatsoever. In particular, this Presentation does not constitute an offer or invitation to subscribe for or purchase any securities in the United States. The securities of the Company have not been and will not be registered under the US Securities Act of 1933, as amended (the “US Securities Act”) or the securities laws of any state or other jurisdiction of the United States and may not be offered or sold in the United States except pursuant to an exemption from, or in a transaction not subject to, the registration requirements of the US Securities Act and in accordance with any applicable state securities laws. There will be no public offering of the securities of the Company in the United States.

Disclaimer

Page 3: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

3

The Cell Builders

CCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGGCAAAATTTTGGCCCAAATTTTGGCCCATAGGG

“I am a cancer patient”

“I am a cancer survivor”

Horizon deploys a powerful and flexible gene editing platform to develop cell models that drive the understanding of disease, to perform genome surgery, and to create novel molecular, cellular and gene therapies

How we do it What we do

Page 4: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

4

Horizon, a growth story

Page 5: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

December 2015 FY Financial Highlights Investment strategy delivers strong revenue growth

Revenue

£20.2m +69% (FY14: £11.9m)

EBITDA (£6.6m) Cash £25.1m

Products

£7.8m +124% (FY14: £3.5m)

Volume driven expansion of GM to 57%

Services

£12.1m +69% (FY14: £7.2m)

Significant increase in scale

Research Biotech

Up to £208m +32% (FY14: £158m)

RedX and Servier deals Avvinity deal post year end

4

Page 6: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

6

• Making specific changes to a gene

• Allows diseases to be reproduced in a laboratory setting

• Empowers researchers to ask important biological questions earlier in the drug discovery process

What is gene editing?

Gene editing enables Personalised Medicine for: improved patient outcomes, deployment of scarce resources, and delivering

increased returns on drug development

Page 7: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

7

Gene editing now underpins the pharma value chain

SAM £1.2bn (HZD estimate)

HZD revenue growing from 2%

Share

Rapidly growing market

Markets and Markets Genomics Market by Products Global Forecast

to 2018, January 2014 Visiongain Cell-Based Assays: World Market

Prospects 2013-2023, February 2013 Markets and Markets Genomics

Market by Products Global Forecast to 2018, January 2014 BCC Research

Molecular Diagnostics: Technologies and Global Markets, March

Page 8: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

There are many ways to edit a gene

• Access to multiple gene editing tools allows tremendous flexibility for

precision, speed and price

• Broad and deep IP position with emerging position in Tx space

Deep practical experience • A decade of industrial application and know-how and advised

by the global academic opinion leaders in gene editing

• Thousands of genes modified making every possible type of modification

• High-throughput, low cost and proprietary cell line engine has allowed expansion from 2,750 to over 23,000 products in 2015

8

Horizon is a global leader in gene editing

Page 9: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

9

Flywheel commercial model for scalable growth

>60% global top 50 pharma • Mid-margin model creation • High-margin applications

Up to £208m milestones Risk managed portfolio • Synthetic lethality, immuno-oncology • Target ID and validation • Gene and cell therapy

Gene editing core platform • Platform, experience, application • Unlocks “Sequence to treatment” value

>23,000 Products >1,400 Customers • Vending machine of models • Product manufacturing engines • High-margin and scalable

PRODUCTS

SERVICES RESEARCH BIOTECH

8

Page 10: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

10

Horizon’s Products

By using Horizon’s BRAF V600E cfDNA Reference Standard

Set, we were able to directly compare the sensitivities of two

systems against a known series of controls down to an allelic

frequency of 0.1% - a very important threshold when trying to

detect low abundance markers. Horizon’s reference standard

was more reliable than any patient-derived cfDNA, and

moreover one can exclude genomic DNA contamination, and

so we were able to make our choice of instrument with

confidence.

Dr. Sukirthini Balendran

Medical University of Vienna

Research use cell lines

Diagnostic reference standards

Pre-clinical human disease models

Biomanufacturing cell lines

>23,000 Product Catalogue

Off the Shelf

Value drivers

Page 11: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

11

Horizon’s Services

At MISSION Therapeutics, we engage in drug discovery around

the use of deubiquitylating enzymes to address cancer and other

diseases. When we have a promising compound, an important

early part of our validation process is to test those compounds on

cell lines that lack their target. We engaged Horizon to perform

custom cell line engineering in two backgrounds for us for

an important project. The process worked perfectly, with the

cell lines delivered in four months and subsequently validated

as true genetic knockouts. The process was great, with clear

communication around progress, so that we could be relaxed and

trust that we would get what we need and when we needed it.

We have since gone back to Horizon for additional work.

Dr. Yaara Ofir-Rosenfeld

Senior Scientist

MISSION Therapeutics.

Targeted services across drug development

Value drivers

Page 12: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

12

Research Biotech

Our collaboration with Vernalis resulted in the discovery of a

number of promising drug candidates that, while exhibiting great

promise for treatment of a range of cancer types based on pre-

clinical data, unfortunately lacked a biomarker immediately

available to help identify the patients most likely to benefit from

them. And so we turned to Horizon. Horizon’s technology

portfolio and expertise made them ideally positioned to progress

these drug candidates into the clinic, and to investigate their

potential for therapeutic efficacy both alone and in combination

therapies. With work now underway we are excited to see the

results of this project.

Mr Jean Pierre Abastado

Director of Oncology Innovation

Servier

Activate immune system to recognise and destroy cancer

Attack genetic Achilles’ heel of cancer leaving healthy cells alone

Directly target DNA or cell repair or replacement in a patient

Immuno-oncology

Synthetic lethality

Gene and cell therapy

Page 13: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

13

Our flywheel in action

MANUFACTURING ENGINE Cell line used to manufacture reference standard products

LEVERAGE OF MODEL Cell and research service expertise drive therapeutic development

APPLICATION OF MODEL Cell line used in range of assay and screening services

CORE BUSINESS ASSET Cell line goes into Horizon’s catalogue of research models

ADVANCED MODELS Expertise and work supports and leads into in vivo disease model generation

• Scientific leadership on K-Ras resistance in cancer (COLTHERES) • Custom engineering (Qiagen) yielded £500k service revenue • Downstream product revenue of >£1m • On-going clinical trial and in-kit sales with Dx partner • Downstream service and grant revenue of >£1M • Deployed in HD-001, SyntheTx research biotech programs

Case Study: K-Ras cell lines

1

2

3 4

5

6

2

3

4

5

6

PAID FOR DEVELOPMENT Customer pays Horizon to develop an engineered cell line

1

Page 14: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

14

What to expect from Horizon in 2016

1. Delivery of our strategy

2. Continued commercialisation • Product relationships for scale • Service alliances for scale • Research biotech investment and milestones

3. Investment for scale and delivery of our path-to-profit

Sustainable core revenue growth

Increasing the value of what we do

Scientific leadership Accelerated growth

Follow Horizon: Web: www.horizondiscovery.com Email: sign up to our email list Investor Twitter: @horizonIR General HZD Twitter: @HorizonGenomics

Page 15: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

Your Horizon Contact:

t + 44 (0)1223 655580 f + 44 (0)1223 655581 e [email protected] w www.horizondiscovery.com Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom

Chris Claxton

VP Investor Relations & Corporate Communication

[email protected]

+44 (0)1223 976 000

Page 16: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

HORIZON DISCOVERY

APPENDIX

Page 17: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

17

Zinc Finger Nucleases (ZFNs) • Good genome coverage • Advantage in certain applications

CRISPR • High Efficiency • Fast • Flexible

rAAV (Recombinant Adeno-Associated Virus) • Most precise approach • No potential for off-target effects • Broadest range of targeting

We use multiple gene editing technologies

Technology agnostic: “Using the best tool for the

job at hand”

Page 18: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

18

First knock-out rat First knock-in rat

First conditional knock-out rat

Scientific leadership and innovation in gene editing 2016 Nature Communications: Gene Editing / Genomics SAB:

Dr. Feng Zhang MIT/Broad Institute Inventor and world

expert on CRISPR/Cas9 Founder EDITAS

Dr. Emmanuelle Charpentier Max Planck Institute

Inventor of CRISPR/Cas9 Founder CRISPR Tx

Dr. J. Keith Joung Harvard/Mass General

Expert in gene editing platforms, including ZFNs and CRISPR

Founder EDITAS

Professor David Russell Univ. of Washington

Founder - Universal Stem Cells Inventor of rAAV

Professor Eric Hendrickson Univ. of Minnesota

World expert on DNA repair mechanisms and gene editing

Dr. S. Nijman University of Oxford

Expert in gene editing and functional genomics

Founder Haplogen GmbH

Dr. Eric Rhodes Horizon CTO

Nuclease Gene Editing VP at Sangamo Bioscience

for IPO on NASDAQ

Dr. Jon Moore Horizon CSO

Gene editing and Oncology Expert, former

Head of Biology at Vernalis plc

Page 19: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

19

Board and key management

Dr Paul R Morrill President Products

Dr Ed Weinstein President Services

Mr Jeb Ledell COO

Dr Darrin M Disley CEO *

* Board member

SIGNIFICANT EXPERIENCE IN • Building sustainable international businesses

in biotech, diagnostics and pharma • Private and public companies in UK and US • Successful M&A transactions

Dr Vishal Gulati Non-Exec Director*

Independent

Mrs Susan Searle Non-Exec Director*

Ex CEO Innovations Plc

Dr Susan Galbraith Non-Exec Director* SVP AstraZeneca Plc

Mr. Grahame Cook Non-Executive Director*

Mr Richard Vellacott CFO*

Dr Ian Gilham Non-Exec Chairman* Ex CEO Axis Shield Plc

Dr Jonathan Milner Non-Exec Director* ex- CEO Abcam Plc

Page 20: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

INDUSTRY ACADEMIA

FY15 customers: Over 1,400 unique organisations in more than 50 countries

19

Page 21: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

21

Income statement

Strong product growth, scale of services, research bio upside

RESULT IN LINE • Margin maintained at 49% as expected • Investing for growth • Investment in FY16 to drive future scale

Milestones

Services

Products

• EBITDA margin remains at 33% • Full year effect of acquisitions • Operational scale up in line with strategy • 2 year £10m investment in Research Bio

INVESTMENT FOR SCALE

STRONG REVENUE GROWTH

+124%

+69%

+32%

FY15 FY14 FY13

£'000 £'000 £'000

Audited Audited Audited

Revenue 20,156 11,905 6,646

Cost of Sales (10,192) (5,351) (3,208)

Gross Profit 9,964 6,554 3,438

Sales and marketing (5,078) (2,671) (2,195)

Research and development (5,296) (2,158) (1,266)

Other operating income 806 615 404

Corporate (7,367) (5,502) (2,391)

Exceptional Items 391 (801) 0

EBITDA (6,580) (3,963) (2,010)

Depreciation and amortisation (3,708) (2,147) (920)

Operating Loss (10,288) (6,110) (2,929)

Investment income (256) 37 (114)

Loss Before Tax (10,544) (6,073) (3,043)

Tax 661 149 73

Loss for the year (9,883) (5,924) (2,970)

Loss per share (pence) (11.20) (9.20) (7.50)

Page 22: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

22

Cash flow Capital efficient model with funds raised invested in M&A, IP and operations to drive scale

INVESTMENT IN M&A AND SCALABLE INFRASTRUCTURE

• £3m of cash consideration for Haplogen

• £3.9m investment in IP and capex

STRONG CASH POSITION

Fundraise £25m

0

5,000

10,000

15,000

20,000

25,000

30,000

2012 2013 2014 2015

Cash £'000

FY15 FY14 FY13

£'000 £'000 £'000

Audited Audited Audited

Operating activities (10,953) (6,473) (2,222)

Acquisitions (2,946) (8,853) -

Intangibles (1,212) (6,255) (134)

Property, plant and equipment (2,688) (1,842) (897)

Interest 70 46 12

Investing activities (6,776) (16,904) (1,019)

Financing activities 24,328 37,643 3,738

Forex 15 0 0

Cash flow 6,614 14,266 497

Cash b/f 18,453 4,187 3,691

Cash c/f 25,067 18,453 4,187

Page 23: HORIZON DISCOVERY THE CELL BUILDERS€¦ · Prospects 2013-2023, February 2013 Markets and Markets Genomics Market by Products Global Forecast to 2018, January 2014 BCC Research Molecular

23

Balance sheet Robust balance sheet remains strong through capital raising and investment

FY15 FY14 FY13

£'000 £'000 £'000

Unaudited Audited Audited

Goodwill 30,778 22,821 48

Intangibles 13,619 10,094 514

Other non-current assets 7,962 7,014 3,569

Non-Current Assets 52,359 39,929 4,131

Inventories 1,793 1,307 453

Trade and other receivables 9,652 6,046 2,107

Cash and cash equivalents 25,067 18,453 4,187

Current Assets 36,512 25,806 6,748

Current Liabilities (6,779) (5,870) (2,748)

Net Current Assets 29,733 19,936 4,000

Non-Current Liabilities (2,235) (1,296) (271)

Net Assets 79,857 58,569 7,860

Equity 79,857 58,569 7,860

ACQUISITIONS AND IP

• Haplogen goodwill of £6.5m • Haplogen intangibles of £3.7m • Intangibles of £13.7m includes portfolio of IP

LEAN WORKING CAPITAL MODEL

• >23,000 products in catalogue (FY14 c. 2,750)

• Inventory remains lean

• Net working capital of £4.7m

EXPANSION CAPITAL

• £25m funds to drive further scale


Recommended