Why do we Why do we study study DNA?DNA?

The Central Dogma of The Central Dogma of Molecular BiologyMolecular Biology

Genes code Genes code protein protein perform perform functions in the cell that results functions in the cell that results in a phenotypein a phenotype

DNA DNA RNA RNA Protein Protein

TranscriptTranscriptionion

TranslatiTranslationon

Example of Phenotypes Example of Phenotypes Created by ProteinsCreated by Proteins

Hair colorHair color Eye colorEye color Hair textureHair texture Blood type (A, B, O)Blood type (A, B, O) Shoe sizeShoe size Eyelash lengthEyelash length

How much DNA is in our How much DNA is in our body?body?

Our DNA makes up 1% of our Our DNA makes up 1% of our body weight, so a 150 lb. person body weight, so a 150 lb. person would have 1.5 lbs. of DNA.would have 1.5 lbs. of DNA.

In one cell – 3 meters of DNA.In one cell – 3 meters of DNA. If you typed out your entire DNA If you typed out your entire DNA

sequence in Times 12pt font you sequence in Times 12pt font you would fill enough paper to reach would fill enough paper to reach the top of the Washington the top of the Washington Monument in D.C.Monument in D.C.

How the Cell Stores DNAHow the Cell Stores DNA Double helixDouble helix NucleosomesNucleosomes

DNA and DNA and histoneshistones Folds long strands of Folds long strands of

DNADNA Regulates what is Regulates what is

expressedexpressed ChromatinChromatin –– Packed Packed

DNA and histones (type of DNA and histones (type of protein)protein)

SupercoilsSupercoils Chromosomes Chromosomes –– most most

tightly packaged DNAtightly packaged DNAPackaging Movie

I supercoiled myself into this box!

Chromosome NumbersChromosome Numbers Humans: 46Humans: 46

Mouse: 40Mouse: 40

Dog: 78Dog: 78

Corn: 20Corn: 20

Ant: 2Ant: 2

The Structure of DNAThe Structure of DNANucleotidesNucleotides

DNA: DNA: DeoxyriboNucleic AcidDeoxyriboNucleic Acid Found in the nucleusFound in the nucleus Three subunits for each Three subunits for each

building block:building block: DeoxyriboseDeoxyribose (5 carbon sugar) (5 carbon sugar) PhosphatePhosphate Nitrogen Base (can be 1 of 4)Nitrogen Base (can be 1 of 4)

GuanineGuanine CytosineCytosine AdenineAdenine ThymineThymine

Base Pair MatchingBase Pair Matching

The two The two strands are strands are held together held together by by hydrogen hydrogen bondsbonds..

G and C – G and C – form form 3 hydrogen bonds3 hydrogen bonds

A and T – A and T – form form 2 hydrogen bonds2 hydrogen bonds

DNAtris

The Double HelixThe Double Helix James WatsonJames Watson, ,

FrancisFrancis CrickCrick, and , and Maurice WilkinsMaurice Wilkins were awarded the were awarded the Nobel prize.Nobel prize.

Rosalie FranklinRosalie Franklin died before she died before she could be awarded could be awarded with the Nobel prize.with the Nobel prize.

ChargraffChargraff identified identified that G and C pair, that G and C pair, and T and A pair.and T and A pair.

DNA Game

DNA ReplicationDNA Replication Double helix must unzipDouble helix must unzip

H-bonds breakH-bonds break Each original strand becomes Each original strand becomes

a a template strandtemplate strand (white) (white) Bases fill in to form Bases fill in to form

Complementary strandsComplementary strands (black)(black)

DNA polymeraseDNA polymerase –– building building enzyme enzyme –– adds new bases adds new bases

Occurs in the nucleusOccurs in the nucleus

DNA DNA ReplicatioReplicatio

nn

DNA Workshop

Enzyme(Helicase)

Unzips

New Strands

T

A

A

G

C

A

T

T

C

G

A-T

T-A

T-A

C-G

G-C

A-

T-

T-

C-

G-

-T

-A

-A

-G

-C

Enzyme(DNA Polymerase)

fills in new nucleotide bases

A-

T-

T-

C-

G-

-T

-A

-A

-G

-C

RNA StructureRNA Structure RNA: RNA: RiboNucleicRiboNucleic Acid Acid Found in the nucleus Found in the nucleus

(nucleolus)(nucleolus) Can leave the nucleusCan leave the nucleus Single stranded!Single stranded! Building blocks made of:Building blocks made of:

Ribose (5 carbon sugar)Ribose (5 carbon sugar) PhosphatePhosphate Nitrogen Base (1 of 4)Nitrogen Base (1 of 4)

GuanineGuanine CytosineCytosine AdenineAdenine Uracil (Instead of Thymine)Uracil (Instead of Thymine)

Three Kinds of RNAThree Kinds of RNA Messenger RNA (mRNA)Messenger RNA (mRNA)

conveys genetic conveys genetic information to the rest of information to the rest of the cellthe cell

Ribosomal RNA (rRNA)Ribosomal RNA (rRNA)

structural, part of structural, part of ribosomeribosome

Transfer RNA (tRNA)Transfer RNA (tRNA)

carries amino acids to carries amino acids to site of protein synthesissite of protein synthesis

TranscriptionTranscription Occurs in the Occurs in the

nucleusnucleus RNA polymerase RNA polymerase

adds adds complementary complementary nucleotidesnucleotides

Forms from one of Forms from one of the DNA strands the DNA strands ((template strandtemplate strand))

RNA is a blue print RNA is a blue print for proteinsfor proteins

Animation

TranscripTranscriptiontion

DNA Workshop

EnzymeUnzips

RNA Strand

U

A

A

G

C

A-T

T-A

T-A

C-G

G-C

A-

T-

T-

C-

G-

-T

-A

-A

-G

-C

Enzyme(RNA Polymerase)

fills in new nucleotide bases

Template Strand

ATGTCGGACTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGGTAAGGAAATGGACTCCTAAGATTCTTGTACGACGGTATTAGAATTCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGTGCTACGTATTAG

Not all of this DNA sequence will make a protein, some of it is nonsense and

some of it gives information about when the protein should be made.

The Genetic CodeThe Genetic Code

DNA is a code to DNA is a code to make proteinsmake proteins

Proteins:Proteins: Made by Made by Amino Amino

AcidsAcids There are 20 types There are 20 types

of amino acidsof amino acids Each amino acid Each amino acid

has it’s own has it’s own special character.special character.

Translation:Translation:mRNA to ProteinmRNA to Protein

Think of each base as Think of each base as a letter (G, C, A, U)a letter (G, C, A, U)

Three bases = Three bases = ““a a wordword””

Each Each ““wordword”” codes for codes for an amino acid - an amino acid - codoncodon

Start codonStart codon - AUG - AUG Stop codonsStop codons Many codons together Many codons together

make a make a genegene

Firefly

Movie

Where does each step take place?

LocationLocation: ribosomes: ribosomes mRNA has mRNA has codonscodons (3 bases) (3 bases) tRNA carries an amino acid to the forming tRNA carries an amino acid to the forming

polypeptide (3 bases on tRNA - polypeptide (3 bases on tRNA - anti-codonanti-codon)) The anti-codons complement the codons in the The anti-codons complement the codons in the

mRNAmRNA Begins at Begins at start codonsstart codons Ends at Ends at stop codonsstop codons

TranslatioTranslationn

Ribosome

mRNA

LysinetRNA

Forming Polypeptide Chain

Codon

TranslationTranslation

TAC GGC TATCCA

What Causes Mutations? What Causes Mutations? Carcinogens Radiation Viruses Heredity

What Do Mutations Cause? What Do Mutations Cause? Cancer Slight frequent changes = polymorphisms Genetic Diseases

Cystic fibrosis (effects mucus production) Hemophilia (blood won’t clot) Sickle cell anemia

MutationsMutations Point mutations (Substitutions)

Original: The fat cat ate the wee rat.

Point Mutation: The fat hat ate the wee rat.

Frameshift mutations (Insertion, Deletion)

Original: The fat cat ate the wee rat.

Frame Shift: The fat caa tet hew eer at.

SubstitutionSubstitution InsertionInsertionDeletionDeletion

Gene RegulationGene Regulation Not all genes are expressed in every cellNot all genes are expressed in every cell Not all genes are expressed at the same Not all genes are expressed at the same

time.time. An An operonoperon is a group of genes that is a group of genes that

operate togetheroperate together A skin cell expresses different genes than A skin cell expresses different genes than

a nerve cella nerve cell

Regulatory sites Promoter

Start transcription

DNA strand

Stop transcription

Chapter ObjectivesChapter Objectives Know the scientists involved with the discovery of the Know the scientists involved with the discovery of the

structure and function of DNAstructure and function of DNA Know the structure and function of DNA.Know the structure and function of DNA. Know how DNA is packaged in the cell.Know how DNA is packaged in the cell. Know how DNA is replicated.Know how DNA is replicated. Know the structure and function of RNA.Know the structure and function of RNA. Know how RNA is made.Know how RNA is made. Know the three types of RNA.Know the three types of RNA. Know how RNA makes proteins.Know how RNA makes proteins. Be able to go from a sequence of DNA to RNA to protein.Be able to go from a sequence of DNA to RNA to protein. Give examples of types of proteins and what they do.Give examples of types of proteins and what they do. Differentiate between replication, transcription and Differentiate between replication, transcription and

translation.translation. List, demonstrate, and identify types of mutations.List, demonstrate, and identify types of mutations. Be able to discuss the potential outcomes of mutations.Be able to discuss the potential outcomes of mutations.