Warm-Up: Monday, Oct 22

• Complete in your 3 Brad Folder

• What macromolecule makes up DNA & RNA?

DNA and

RNA: Notes

#1

Objectives

1) Identify the 3 main components of DNA

2) List the 4 nitrogenous bases of DNA

3) List the scientists important in the history of DNA

DNA

= Deoxyribonucleic acid

• Helix shaped, long molecule

• Made up of nucleic acids (macromolecule)

• Nucleotides = building block nucleic acids

• Each nucleotide made up of 3 basic components:1) 5-Carbon sugar called Deoxyribose

2) Phosphate group

3) Nitrogenous base (4 different ones)

4 Nitrogenous Bases:

• 2 Purines (2 ring structures)– Adenine (A)– Guanine (G)

• 2 Pyrimidines (1 ring structures)– Cytosine (C)– Thymine (T)

Chargaff’s Rules

• Figured out how the base pairs went together

• A pairs with T

• C pairs with G

X- Ray Evidence

• Rosalind Franklin (1950’s)• Used X-ray diffraction• First to find the double

helix structure• Was not credited for many

years because she was a woman

• Never awarded the Noble Prize– They do not give the prize to

dead people!

The Double Helix

• Francis Crick & James Watson (1953)• Contributions:

– Discovered Franklin’s picture – Able to apply the final puzzle piece – Came up with a model

• Double helix: 2 strand wound around each other

• For a long time, they were given and took sole credit for this discovery, even won the noble prize for it!

Double Helix

= Looks like a twisted ladder or a spiral staircase

• Found that hydrogen bonds were between the nitrogenous bases (ATCG)

• Called this base pairing: – A to T – C to G

DNA in CellsProkaryotes (bacteria)• Single, circular DNA

molecule in the cytoplasm

• No nucleus

Eukaryotes (plants, animals, protists, fungi)

• 1000x more DNA• DNA located in the

nucleus • Found in the form of

chromosomes

Chromosomes

= DNA that is coiled and supercoiled

• Humans:– 23 pairs of chromosomes (46 individual)– Each has around 50 to 250 million bases

DNA Length• E.Coli

– Bacterium that lives in your intestines– Contains 4,639,221 base pairs!

• Length of DNA molecule is roughly 1.6 mm

• However, it must fit inside 1/1000th of the space!

Thinking Strategy #19 (pg 12): T-Shirt Design

• Directions: Design artwork for a t-shirt representing DNA1) Front of shirt must have artwork showing the

concept using 3 colors.

2) Back of the shirt must have a 1-2 line cute or clever (but clean) saying using DNA.

3) A minimum of one paragraph (5-6 sentences) must be written to describe how the artwork and saying explain DNA.

Warm-Up: Tuesday, Oct 23

• Complete in your 3 Brad Folder

• Who was the 1st person to discover the double helix shape of DNA?

DNA and

RNA: Notes

#2

Objectives

1) Describe the process of DNA replication.

2) Identify the 3 main components of RNA.

3) List the 3 types of RNA.

DNA Replication

• Replication = DNA makes an identical copy of itself

• Occurs in the cell’s nucleus

• Complimentary = each strand can be used to make a copy

Let’s Try It!

• Make a complimentary strand for the following DNA strand:

ATCGCCGTACGATCGAATTCGA

1) Helix unzipped by enzyme Helicase

2) Replications from 5’ to 3’ end

3) Free, unattached nucleotides find their complimentary base

4) Combine w/ their pair by hydrogen bonding

How does Replication occur?

How does Replication occur?

• Use multiple enzymes to replicate DNA

• 2 types strands from unzipped DNA:1) Leading Strand

- DNA polymerase III used to attach new nucleotides

2) Lagging Strand- Forms by Okazaki fragments

- RNA Primase lays down primer

- DNA Polymerase III lays down strand

- DNA Ploymerase I replaces RNA primer

Genes

= working subunits of DNA within chromosomes

• Encodes instructions that allow a cell to produce a specific protein or enzyme

• Large portions of DNA strand to not encode for proteins (function unknown)

• Only copy what need to make protein

*** You would not copy an entire book, if you only needed page 53!***

RNA= ribonucleic acid• Single Stranded!• Made up of:

1) 5-Carbon sugar called Ribose2) Phosphate3) Nitrogenous bases (4 different ones)

• Contains Uracil (U) instead of Thymine (T)• Base Pairs:

– A pairs w/ U– C still pairs w/ G

Similarities & Differences of DNA & RNA?

Let’s Practice

• Let’s take the same strand of DNA and make an RNA copy:

ATCGCCGTACGATCGAATTCGA

3 types of RNA

1) Messenger RNA:

• AKA mRNA

• Carries copies of the DNA instructional code OUT of the nucleus to the rough endoplasmic reticulum (ER)

2) Ribosomal RNA

• AKA rRNA

• Proteins are assembled on ribosomes

• Ribosomes are made up of several types of protein and rRNA

3 types of RNA

3) Transfer RNA

• AKA tRNA

• Transfers each Amino Acid to the ribosomes as it is coded by the specific messages in mRNA

3 types of RNA

Ziploc DNA Activity

1) Cut the plastic bag portion off of the Ziploc

2) Open up the zipping feature of the ziplock

3) Write the following base pairs on one side of the Ziploc:

AAGCTATTGCCCATTA

4) Now you write the complimentary strand on the other side of the Ziploc

5) Tape into your notebook on new page

6) Add to your Table of Contens

Warm-Up: Wednesday, Oct 24

• Complete in your 3 Brad Folder

• List the 3 types of RNA.

DNA and

RNA: Notes

#3

Objectives

1) Define transcription and translation.

2) Compare and contrast transcription and translation.

Transcription= Process of creating a

complementary RNA copy of a sequence of DNA

• Requires the enzyme RNA polymerase

• Looks for DNA promoters and binds to them

• Copies the section of DNA until it comes to the stopping point

Translation

= Process of decoding of instructions for making proteins

• Sequence of nucleotides serves as instructions for the order of amino acids

• Proteins are made from joining many amino acids into a long chain

• The code is read 3 letters at a time

Translation Process

1) mRNA is transcribed from DNA in the nucleus

2) The proper amino acid is brought in by tRNA

3) Peptide bond is formed between amino acids

4) Continues to grow until reaches a stop codon

Let’s Practice

• Let’s take the same strand of DNA and make an RNA copy:

ATCGCCGTACGATCGAATTCG

• Now, using the codon chart, let’s make amino acid sequence coding for a protein in the process called Translation

Why do we care about DNA?

• Organ/Bone Marrow Transplants

• Paternity Tests

• Crime Scene Investigations

• Chromosomal Abnormalities (tomorrow)

EXTRA CREDIT (Due Fri, Nov 2)1) Research one of mentioned real world

applications of DNA and how it was used in a specific situation.

2) Create a visual presentation that includes the following:

- Written summary: minimum of 7-8 sentences describing how DNA was used in a real life situation

- 2 illustrations that supplement the summary

- Cite where you got the information from (may print a copy of article)

Warm-Up: Thursday, Oct 25

• Complete in your 3 Brad Folder

1) In which organelle is mRNA transcribed from DNA?

2) What type of bond is formed between amino acids?

DNA and

RNA: Notes

#4

Objectives

1) Define the term mutation

2) Compare and contrast point mutations and frameshift mutations.

3) List common mutations found in the human body.

Mutations• Now and then cells make mistakes in

copying their own DNA

• Mutations = mistakes in DNA copying

• Involves changes in one or a few nucleotides

Types of Gene Mutations

1) Point Mutation = type of mutation that causes the replacement of a single base nucleotide w/ another nucleotide of the genetic material– Example:

Original: The fat cat ate the wee rat.

Point Mutation: The fat hat ate the wee rat.

Example: Sickle Cell Anemia• Description: disease passed down through

families – Red blood cells form an abnormal sickle

or crescent shape – Red blood cells carry oxygen to the body

& are normally shaped like a disc.

• Caused by a point mutation.

Types of Gene Mutations2) Frameshift Mutation = genetic mutation

cased by a deletion or insertion (addition)

• Remember: amino acids are still read in groups of 3, so these mistakes can be deadly

• If a nucleotide is added/deleted then it causes the DNA to shift (frameshift)– Example

Original: The fat cat ate the wee rat.

Frame Shift: The fat caa tet hew eer at

Frameshift Mutations

Example: Tay-Sachs Disorder• Description:

– Baby appears to develop normally for the first few months of life

– As nerve cells become distended with fatty material, a relentless deterioration of mental and physical abilities occurs.

– Have "cherry-red" spots in their eyes

• Symptoms:– Blind, deaf, and unable to swallow – Muscles begin to atrophy and

paralysis sets in

• Caused by a frameshift mutation

Chromosomal Mutations

= changes in the number or structure of chromosomes

Structure changes:

= involve even larger mutations, where segments of the DNA within chromosomes break & then rearrange

• Translocation: Cancer and Infertility

Types of Chromosomal Mutations

1) Inversion = insertion of a chromosome fragment in reverse orientation

• Causes an increased risk of miscarriages

Types of Chromosomal Mutations

2) Translocation = attachments of chromosome fragments to non-homologous chromosomes

• Causes Cancer and Infertility

Types of Chromosomal Mutations

3) Deletion = lose of a portion of the chromosome

• Example: Wolf-Hirschhorn Syndrome

- Distinct craniofacial phenotype, growth & mental retardation, seizures, congenital heart defects

• Duplication = portion of the chromosome is duplicated, resulting in extra genetic material

• Example: Carcot-Marie-Tooth disease–  Progressive loss of muscle tissue and touch

sensation across various parts of the body

Types of Chromosomal Mutations

Review: DNA & RNADNA RNA

Sugar: Deoxyribose Sugar: Ribose

Bases: A to T, C to G Bases: A to U, C to G

Double Stranded Single Stranded

Located in Nucleus Copies DNA in nucleus (mRNA) & leaves to make amino acids in cytoplasm

Review: DNA & RNA ProcessesProcess Location What Happens

DNA Replication Inside nucleus Makes complimentary strand of DNA (DNA copies itself)

Transcription Nucleus & Cytoplasm

mRNA copies DNA in nucleus, then brings info into cytoplasm

Translation Cytoplasm mRNA is read in codons (3 base pairs at a time), amino acids are put in a sequence to form a protein

Thinking Strategies• May pick one of the following 2 strategies:

1) Diamante Poem (#21 pg 12B)– Top beginning noun = DNA– Bottom beginning noun = RNA

2) Map News (#22 pg 12B)

Avid Thinking Strategy

• Map News!

 

Title of News Article or Topic

How does thisAffect me? Name of

SourceDate

Science Fact

ConclusionCluesEvidence

New Vocabulary

Branch ofScience

Warm-Up: Friday, Oct 26

• Complete in your 3 Brad Folder

• Define the term point mutation and give an example.

DNA Extraction Lab