UvA-DARE (Digital Academic Repository) Microparticles in ... · pregnant women with HELLP syndrome, necessitating immediate delivery. Preeclampsia is a heterogeneous disorder, making

UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Microparticles in pregnancy and preeclampsia

Lok, C.A.R.

Link to publication

Citation for published version (APA):Lok, C. A. R. (2008). Microparticles in pregnancy and preeclampsia.

General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, statingyour reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Askthe Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,The Netherlands. You will be contacted as soon as possible.

Download date: 09 Aug 2019

https://dare.uva.nl/personal/pure/en/publications/microparticles-in-pregnancy-and-preeclampsia(2072e19a-f643-4c6c-a9b3-1b5b0c58cea7).html

Microparticles

in

pregnancy and preeclampsia

Publication of this thesis was generously sponsored by:

Stichting Wetenschappelijk Onderzoek Gynaecologie en Obstetrie Spaarne Ziekenhuis

Leerhuis Spaarnepoort

IQ products

Hagamedical B.V.

Ferring Pharmaceuticles

Bayer Health Care

Medical Dynamics

The Department of Obstetrics and Gynaecology of the Academic Medical Center

The Faculty of Medicine of the Academic Medical Center


Christine A.R. Lok

PhD Thesis, University of Amsterdam - with summary in Dutch

ISBN: 978-90-9022936-2

Printed by: Ponsen & Looijen B.V.

Cover: K. Boer

Lay-out: H. Lok

© C.A.R. Lok, Hoofddorp, The Netherlands, 2008

Microparticles

in


ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor

aan de Universiteit van Amsterdam

op gezag van de Rector Magnificus

prof. dr. D.C. van den Boom

ten overstaan van een door het college voor promoties

ingestelde commissie,

in het openbaar te verdedigen in de Aula der Universiteit

op woensdag 18 juni 2008, te 10:00 uur

door

Christine Anne Rachel Lok

Geboren te Hoofddorp

Promotiecommissie:

Promotores Prof. dr. J.A.M. van der Post

Prof. dr. A. Sturk

Co-promotores Dr. K. Boer

Dr. R. Nieuwland

Overige leden Dr. M.H. Emanuel

Prof. dr. H.P. van Geijn

Prof. dr. M.J. Heineman

Prof. dr. C.J.F. van Noorden

Prof. dr. H. Pannekoek

Prof. dr. I.L. Sargent

Faculteit der Geneeskunde

Aan mijn ouders

Contents

7

CO�TE�TS Part I General introduction

Chapter 1 Introduction and aim of the thesis 11

Chapter 2 Microparticles and exosomes: impact on normal and

complicated pregnancy

33

Part II Microparticle numbers and characteristics in


Chapter 3 Changes in microparticle numbers and cellular origin

during pregnancy and preeclampsia

61

Chapter 4 Microparticle-associated P-selectin reflects platelet

activation in preeclampsia

79

Chapter 5 Circulating platelet- and placenta-derived microparticles

expose Flt-1 in preeclampsia

95

Part III Microparticles and inflammation

Chapter 6 Expression of inflammation-related genes in endothelial

cells is not directly affected by microparticles from

preeclamptic patients

113

Chapter 7 Leukocyte activation and circulating leukocyte-derived

microparticles in preeclampsia

135

Chapter 8 Cell-derived microparticles and complement activation in

preeclampsia versus normal pregnancy

157

Part IV General discussion, future perspectives and summary

Chapter 9 General discussion and future perspectives 177

Chapter 10 Summary 193

Samenvatting 199

Co-authors 207

Bibliography 209

Dankwoord 211

Curriculum vitae 215

9

PART I

General introduction

Chapter 1

Introduction and aim of the thesis

Chapter 1

12

I�TRODUCTIO� A�D AIM OF THE THESIS

1.1 General introduction

1.2 Preeclampsia

1.2.1 Clinical aspects of preeclampsia

1.2.2 Theories on the pathophysiology of preeclampsia

- The role of the placenta

- Endothelial dysfunction

- Inflammation

- Haemostasis

1.3 Aim and outline of the thesis


13

1 1.1 GE�ERAL I�TRODUCTIO�

Preeclampsia is a pregnancy specific multisystem disorder, occurring in the second half of

pregnancy. The incidence in unselected populations is 2.6%1. Still, it is a major cause of

maternal and fetal morbidity and mortality. Preeclampsia is a syndrome, defined by

hypertension and proteinuria2-4. Clinical features, like edema, headache, visual

disturbances, nausea and pain in the upper abdominal region differ from patient to patient.

Preeclampsia can present as asymptomatic hypertension and proteinuria, but in rare cases it

can also evolve into multi-organ failure with complications like convulsions, cerebral

hemorrhage, liver failure, acute renal failure or respiratory insufficiency5. In addition,

preeclampsia may present with placental hypoperfusion which compromises the fetus and

subsequently leads to fetal growth retardation and distress, sometimes resulting in intra-

uterine fetal death.

The exact etiology of preeclampsia is still a matter of debate and many theories

have been proposed. A generally accepted hypothesis is the two-stage model of

preeclampsia (Figure 1)5.

Early in pregnancy, a defective trophoblast invasion into the spiral arteries of the

uterus occurs and these arteries fail to become low-resistance vessels. This results in a

disturbance of uteroplacental perfusion with subsequent placental hypoxia and oxidative

stress. In the second half of pregnancy, this leads to the release of factors from the placenta

into the maternal circulation and/or activation of leukocytes and platelets, all contributing to

a systemic inflammatory response characterized by an impairment of the endothelial

function2,6.

Since not all preeclamptic patients show these signs of hypoplacentation, however,

poor placentation is unlikely to be the exclusive cause for the development of preeclampsia.

Women with relatively large placentas (like in diabetes mellitus, multiple pregnancies or

hydatidiform mole pregnancies) are at risk of developing preeclampsia probably because of

a higher amount of factors released from the placenta. In this respect, the placental factors

STBM (syncytiotrophoblast basal membrane fragments or placenta-derived microparticles

(MP)) and sFlt-1 (soluble fms-like tyrosine kinase) are of particular interest and they will

be discussed in one of the following paragraphs.

Also, maternal susceptibility to “placental” factors is important. Patients with

thrombophilia, the metabolic syndrome, a genetic predisposition and preexisting vascular

disease have a higher chance of developing preeclampsia5. Thus, risk factors can be

identified although prediction of preeclampsia remains difficult. Preventive strategies have

been investigated extensively, but their efficacy appears variable and therefore, they are not

generally applied in clinical practice7.

Chapter 1

14

In short, preeclampsia is a trophoblast-induced disorder of pregnancy with

characteristics of a multisystem disease, resulting from an adverse maternal response to (in

part) allogenic placental tissue for which there seems to be only one causal therapy, i.e.

delivery of the placenta.

Figure 1. Two stage development of preeclampsia

Figure 1. A schematic representation of the currently adapted hypothesis that preeclampsia

develops in two stages. (I) Early in pregnancy a defective trophoblast invasion into the

spiral arteries of the uterus results in a high-resistance vasculature in the placenta with a

disturbance in uteroplacental perfusion. The risk of poor placentation is influenced by

genetic factors, immunologic factors and preexisting vascular disease. (II) In the second

half of pregnancy this results in oxidative stress and the release of factors from the

placenta into the maternal circulation or activation of leukocytes and platelets, all

contributing to a systemic inflammatory response characterized by an impairment of the

endothelial function.


15

1 1.2 PREECLAMPSIA

1.2.1 Clinical aspects of preeclampsia

Preeclampsia is defined as de novo proteinuria and hypertension occurring after the 20th

week of pregnancy. The relation between preeclampsia and eclampsia became apparent in

the 18th century when Alexander Hamilton, Professor of Midwifery at the university of

Edinborough, described the symptoms that often preceed eclampsia (“pre”eclampsia)8. The

name preeclampsia strongly suggests that eclampsia is always preceded by preeclampsia.

However, the impressive clinical picture of eclampsia with generalized convulsions in

pregnant women without a history of epilepsy also develops in women without

hypertension or preeclampsia. Other related disorders are the HELLP syndrome (an

acronym of Hemolysis Elevated Liver Enzymes and Low Platelets) and AFLP (Acute Fatty

Liver of Pregnancy). Although HELLP is considered a severe complication of

preeclampsia, one third of the HELLP patients does not develop a blood pressure over 90

mmHg diastolic and/or proteinuria. AFLP is considered an often lethal complication in

pregnant women with HELLP syndrome, necessitating immediate delivery.

Preeclampsia is a heterogeneous disorder, making generalization of results from

different studies difficult. To solve this problem, several institutions have developed

definitions of preeclampsia. The most widely used criteria to define preeclampsia are those

of the ISSHP (International Society to the Studies of Hypertension in Pregnancy)3 which

are summarized in Table 1. These criteria are also used in this thesis. For HELLP

syndrome, we used the criteria described by Sibai (Table 2)9.

Table 1. The definition of preeclampsia

Criteria of preeclampsia from the ISSHP

1. Systolic blood pressure ≥140 mmHg or diastolic blood pressure ≥90 mmHg measured

on two separate occasions

2. Development of symptoms after 20th week of gestation

3. Urinary excretion of ≥0.3 gram protein in a 24-hour specimen

4. Normalization of blood pressure within 3 months after delivery

Different forms of hypertension may occur in pregnancy. A classification of hypertensive

disorders in pregnancy is presented in the report of the National High Blood Pressure

Education Program Working Group on High Blood Pressure in Pregnancy4. Four different

forms are described: 1) chronic hypertension, 2) preeclampsia, 3) preeclampsia

superimposed on chronic hypertension and 4) gestational hypertension.

Chronic hypertension is defined as hypertension observed before pregnancy or diagnosed

Chapter 1

16

before the 20th week of gestation. Hypertension that is diagnosed for the first time during

pregnancy and that does not resolve post partum is also classified as chronic hypertension.

Gestational blood pressure elevation is defined as a blood pressure ≥140 mmHg systolic or

≥90 mmHg diastolic, in a woman who was normotensive before 20 weeks’ gestation. It is

recommended that the diagnosis gestational blood pressure elevation is based on at least

two determinations of the blood pressure. Proteinuria is defined as the urinary excretion of

≥0.3 g protein in a 24-hour specimen. Preeclampsia is the combination of gestational

hypertension with proteinuria. If a patient with chronic hypertension develops symptoms of

preeclampsia, superimposed preeclampsia is present. Finally, gestational hypertension is

defined as transient hypertension of pregnancy with preeclampsia not being present at the

time of delivery and blood pressure normalizing within 3 months after delivery. Still, in

spite of the progress made in standardizing definitions, no real uniformity with respect to

the diagnosis of preeclampsia exists. This hampers research since preexisting hypertension

and kidney disease share common clinical features with preeclampsia but probably no

common cause.

Table 2. The definition of HELLP syndrome

1.2.2 Theories on the pathophysiology of preeclampsia

Preeclampsia has been called “the disease of theories” because of the large number of

hypotheses that have been postulated in an attempt to solve the etiology of preeclampsia in

order to find a cure for this syndrome. Although interesting findings have been reported,

preeclampsia still is “the great imposter”10. It is unlikely that a single factor underlies the

development of preeclampsia. The most important pathophysiologic mechanisms in

preeclampsia are summarized in this paragraph. One has to realize, however, that these

mechanisms may overlap considerably.

The role of the placenta

Although the precise etiology of preeclampsia is unclear, the placenta undoubtedly plays a

central role in preeclampsia. Delivery of the placenta leads to rapid recovery from all

symptoms. In diseases with an increased placental volume, the risk of preeclampsia is

elevated. The importance of the placenta also became clear from observations in patients

Criteria of HELLP syndrome

1. Signs of hemolysis (peripheral blood smear, lactate dehydrogenase >600 U/L or serum

bilirubin ≥1,2 mg/dL)

2. Elevated liver enzymes (aspartate aminotransferase ≥70 U/L)

3. Low platelet counts (<100*109/L)


17

1 suffering from (complete) hydatidiform mole. These patients, presenting with an excessive

amount of abnormally developing trophoblast without embryonic tissue, can develop

symptoms of preeclampsia already early in pregnancy. Currently, these cases are hardly

seen in developed countries because of the early (ultrasonic) detection of hydatidiform

moles. However, cases of (in particular partial) molar pregnancies complicated by

gestational hypertension, preeclampsia or even eclampsia before 24 weeks gestational age

are still incidentally reported11,12. The exact cause of the preeclampsia in these cases is

unknown but it seems likely that the excess of placental volume composed of mainly

paternally-derived allogenic tissue, leading to an elevated release of placental factors into

the maternal circulation, plays a major role. Unfortunately, concentrations of e.g. placenta-

derived MP or sFlt-1 have not been investigated in gestational trophoblastic disease.

The chain of events leading from a hypoperfused placenta to the systemic

symptoms of preeclampsia is still obscure and multiple factors probably contribute to its

development. Factors of placental origin that have been suggested to play a role are the

release of trophoblast-debris into the maternal circulation, the increased production of (anti)

angiogenic factors, oxidative stress and the elevated release of inflammatory mediators.

Trophoblast-debris (STBM or placenta-derived MP) is also detectable in the

circulation of normotensive pregnant women. MP are membrane vesicles released from

trophoblastic cells, blood cells or endothelial cells upon activation or during apoptosis. MP

are released from cells by “shedding” and range in size between 0.1-1 µm. Cell-derived MP

in plasma predominantly originate from platelets. Increased numbers of MP from various

cell types have been reported to occur in diseases associated with a procoagulant state

(Chapter 2). MP, including placenta-derived MP, may modulate or reflect several of the

key-processes in preeclampsia, including endothelial dysfunction, inflammation and

coagulation. Although placenta-derived MP only compose a small fraction of the total

number of MP, elevated numbers have been reported in preeclamptic women compared to

normotensive pregnancy13. In contrast, placenta-derived MP were not increased in late

onset preeclampsia or intrauterine growth retardation (IUGR)14. Such MP’s were reported

to impair the relaxation of subcutaneous arteries15 and to activate neutrophils and T-cells in

vitro16,17 (see also Chapter 2). Circulating placenta-derived MP can bind to monocytes and

stimulate the production of the pro-inflammatory cytokines tumor necrosis factor-alpha

(TNFα), interleukin (IL)-12 and IL-1818. Therefore, subsets of MP may be involved in the

systemic inflammatory response in preeclampsia, but their exact contribution needs further

investigation.

Several anti-angiogenic factors are produced in the placenta. The concentrations

of both soluble (s) Flt-1 and soluble endoglin (sEng) in plasma are elevated in preeclampsia

and they are likely to play a role in the development of preeclampsia19. In fact, sFlt-1 and

sEng were reported to be elevated in plasma already before the onset of preeclampsia. Flt-1

Chapter 1

18

is one of the receptors of vascular endothelial growth factor (VEGF), but also binds the pro-

angiogenic placental growth factor (PlGF). VEGF is produced by several tissues including

the placenta and plays an important role in angiogenesis, regulation of the vascular tone and

thus blood pressure. In preeclampsia, the plasma concentration of VEGF is decreased due

to elevated concentrations of sFlt-1 (see Chapter 8), thereby inhibiting the biological

activity of VEGF. Indeed, in rat renal arterioles, the VEGF-induced relaxation is inhibited

by sFlt-1, and administration of sFlt1 to pregnant rats induces hypertension, proteinuria and

glomerular endotheliosis, symptoms classic for preeclampsia20. Adenovirus-mediated

overexpression of sEng in rodents leads to mild hypertension and elevated vascular

permeability21. The combined overexpression of sFlt-1 and sEng causes vascular damage

with severe hypertension and proteinuria, laboratory abnormalities and growth restriction22.

An imbalance between anti- and pro-angiogenic factors seems of high importance in the

development of preeclampsia. However, the specific roles of sFlt-1 and sEng in vivo still

have to be determined. It is not yet understood how underdevelopment and hypoxia of the

placenta lead to release of anti-angiogenic factors. Whether or not there is a role for

placenta-derived MP in delivering Flt-1 to the maternal tissues is also not known.

Because of the abnormal development of the placental vasculature in preeclampsia

it is generally assumed that both the subsequent ischemia and elevated rate of apoptosis are

caused by hypoxia. Pathological evidence of placental ischemia includes intravascular

fibrin depositions, intimal thickening, necrosis, atherosclerosis, endothelial damage and

placental infarcts22. These placental abnormalities are not uniformly present in cases of

preeclampsia. No direct measurements are available to confirm that hypoxia itself causes

these placental changes. Rather than merely hypoxia, an alteration between hypoxia and

reoxygenation leading to the production of oxygen radicals, the so-called oxidative stress,

seems responsible for the local damage in the placenta in preeclampsia23. Redman and

Sargent proposed that oxidative stress induces increased syncytiotrophoblast apoptosis and

necrosis, thereby increasing the shedding of placenta-derived MP24. Indeed, oxidative stress

causes apoptosis in numerous cell lines and triggers the production of cytokines like TNFα

in the placenta, which can lead to peroxidation of plasma lipids during placental passage

and to activation of maternal neutrophils25,26. Treating women at risk for preeclampsia with

anti-oxidants, i.e. vitamin A and E, however, did not prevent the development of

preeclampsia27. Although there is evidence of placental oxidative stress, the clinical

consequences are still unclear and other factors are likely to contribute to the development

of preeclampsia.

Pregnancy is a mild inflammatory state which is even more prominent in

preeclampsia2. Evidence that this systemic inflammation is initiated by inflammatory

mediators originating in the placenta is lacking. However, there are some findings that

suggest a placental origin of inflammation. It has been reported that leukocytes, especially


19

1 neutrophils and monocytes, become activated during placental passage in preeclampsia28.

Whether this is the underlying cause of the elevated cytokine production in preeclampsia,

however, is unknown. On the other hand, hypoxia triggers the production of TNFα, IL-1α

and IL-1β in villous explants from human placenta29, but data from studies investigating the

expression of inflammation-related genes (especially TNFα, IL-1α, IL-1β, and IL-6) in

placental tissue from preeclamptic patients and normotensive pregnant women are

inconclusive30,31.

Endothelial dysfunction

There is convincing evidence that the endothelium is involved in the development of

preeclampsia. This evidence is based on electron microscopy findings, soluble markers of

endothelial cell activation, in vitro experiments with isolated arteries and in vivo

experiments in preeclamptic patients (see below). Still, there is no proof of a causative role

in the maternal syndrome.

Endothelial cell activation results in an altered function, more precise dysfunction,

of the maternal endothelium in preeclampsia. This dysfunction induces vasoconstriction

through an imbalance in the production of vasodilators and vasoconstrictors. An altered

vascular tone in small arteries changes the peripheral resistance and thus blood pressure.

Furthermore, endothelial cell activation leads to increased small vessel permeability

causing generalized edema. The endothelial damage in the kidney (also called glomerular

endotheliosis), which is characterized by enlargement of the endothelial cells with

vacuolization and a diminished capillary lumen, is likely to cause the proteinuria in

preeclampsia32.

Electron microscopy revealed that endothelial cells in myometrial arteries from

normotensive pregnant women show a continuous sheath of tightly connected and

elongated endothelial cells with intact cytoplasma membranes. In contrast, the arteries of

preeclamptic patients showed a disorganized lining of endothelial cells with shrunken cells

and detachment and blebbing of the cytoplasma membranes and attachment of protein

aggregates33.

Soluble markers of endothelial cell activation are summarized in Table 3. The

increase of some markers may predate the onset of symptoms and indicate that endothelial

function is indeed involved in the etiology of preeclampsia and not only a secondary

phenomenon.

In vitro experiments with wire-myography showed that endothelial-dependent

dilatation is impaired in isolated sub-cutaneous fat arteries41 and myometrial arteries42 from

preeclamptic patients. Furthermore, flow-mediated dilatation measured with perfusion-

myography is also impaired in sub-cutaneous fat arteries43 and myometrial arteries44 from

preeclamptic patients. These studies did not determine the underlying cause of the impaired

Chapter 1

20

endothelium-dependent dilatation. Incubation of myometrial vessels with MP from

preeclamptic patients caused reduced dilatation of the vessels45 and similar experiments

with comparable results were performed with placenta-derived MP15.

Table 3. Soluble markers of endothelial cell injury in preeclampsia

Marker Increase or decrease References

Cellular fibronectin ↑ 36

Endothelin-1 ↑ 34

sE-selectin ↑ 35

PAI-1/PAI-2 ratio ↑ 38

Prostacyclin ↓ 39

Trombomodulin ↑ 37

sVCAM-1 ↑ 35

Von Willebrand factor ↑ 40

Finally, in vivo evidence of endothelial dysfunction is difficult to obtain.

Ultrasonic measurement of the brachial artery after forearm cuff occlusion is often used to

evaluate flow-mediated dilatation in patients and controls. Such experiments show a

reduced dilatation in patients with preeclampsia46. These alterations already occur before

the onset of clinical symptoms of preeclampsia47.

Inflammation

Activation of many parts of the inflammatory network, like leukocyte activation, cytokine

release, leukocyte / endothelial interactions, activation of endothelial cells and stimulation

of the clotting cascade are present in preeclampsia. These changes reflect a sterile

inflammation brought about by pregnancy itself instead of infection. Although a mild

systemic inflammatory response in pregnancy is physiological, in preeclampsia this

response is much more intense24. Signs of inflammation in preeclampsia are summarized in

Table 4.

In preeclampsia, elevated numbers of leukocytes occur with signs of activation,

such as an intracellular rise of calcium, elevated expression of adhesion molecules and

complement-related markers on the leukocyte membrane51. Additionally, degranulation

products of neutrophils which are released upon cell activation, including myeloperoxidase,

lactoferrin and elastase, are elevated in preeclampsia51-53.


21

1 Table 4. Signs of inflammation in preeclampsia

Signs of inflammation Increase or

decrease References

Clotting system activation ↑ Next paragraph

Complement activation ↑ / = Chapter 8

Endothelial cell activation ↑ Previous paragraph

Leukocytosis

Granulocytes

Lymfocytes

Monocytes

↑

=

↑

Chapter 7

48

49

Leukocyte activation

Adhesion molecules

Complement-related markers

Degranulation products

Intracellular calcium rise

↑

↑

↑

↑

28, 50

51

51

51-53, Chapter 7

54

Leukocyte phagocytosis ? 55*

Leukocyte priming ↑ 56*, 57

Platelet activation ↑ Next paragraph, Chapter 6

Plasma markers

CRP ↑ 47, 58

TNFα ↑ 18, 59-60

IL-1β ↑ / = 59, 60

IL-6 ↑ 59-61

IL-8 ↑ 18, 59, 61

IL-12 ↑ / = 18, 61-62

IL-18 ↑ / = 18, 63-64

IFNγ ↑ / = 18, 61

MCP-1 ↑ / = 61, 65

*Elevated in normal pregnancy, but not determined in preeclampsia

In pregnancy, adjustment of the immunological system is necessary to prevent rejection of

the (semi)allogenic fetus. One alteration that takes place is a shift towards Thelper (Th)2

immunity at the expense of cytotoxic Th1 responses. In preeclampsia, this shift fails to

develop with subsequent predominance of (pro- inflammatory) Th1 responses (Figure 2)66.

Chapter 1

22

Figure 2. Immunity response in pregnancy and preeclampsia

Figure 2. A mild systemic inflammatory response in pregnancy is physiological. In

preeclampsia, a predominance of (pro-inflammatory) Th1 response is present with the

cytokine balance changing in favor of pro-inflammatory cytokines.

Pro-inflammatory cytokines of potential importance for the inflammatory response in

preeclampsia are IL-1, IL-2, IL-6, IL-8, IL-12, IL-18, TNFα, IFNγ and MCP-1. In

preeclampsia, the balance between pro-inflammatory and anti-inflammatory agents is

changed in favor of the pro-inflammatory cytokines, and elevated levels of many of these

cytokines are observed in preeclampsia18,59,60,65. Also, an elevated concentration of C-

reactive protein (CRP), which is a marker of an overall increased inflammatory status, is

present in preeclampsia58 already before the onset of clinical symptoms47.

The complement system is an important part of the maternal immune system

(Figure 3). The complement system consists of several enzyme cascades which can be

triggered by various mechanisms. Activation products of the complement system induce

chemotaxis and activation of leukocytes. Hypothetically, complement activation may be

part of the systemic inflammatory response in preeclampsia. Therefore, the concentrations


23

1 of complement factors and the role of classical pathway activation have been investigated

in preeclamptic patients and controls. The results from these studies, however, are

contradicting (see also Chapter 8) 51,67,68. The alternative pathway and the lectin pathway of

complement activation do not seem to be involved in the pathogenesis of preeclampsia,

although literature is scarce. Thus, a role for the complement system in the development of

preeclampsia is not yet definitely established.

Figure 3. Schematic representation of the complement cascade

Figure 3. There are three different pathways to initiate the complement cascade. The

classical pathway can be initiated by binding of C1q to the pathogen surface. This pathway

can also be activated by the binding of C1q to antibody-antigen complexes. The mannan-

binding lectin pathway is initiated by binding of mannan-binding lectin, a serum protein, to

mannose-containing carbohydrates on bacteria or viruses. Finally, the alternative pathway

can be initiated when a spontaneously activated complement component binds to the

surface of a pathogen. Each pathway follows a sequence of reactions to generate a

protease called C3 convertase. The C3 convertases then bind to the pathogen surface, and

cleave C3 into C3b, the main effector molecule of the complement system, and C3a, a

peptide mediator of inflammation.

Chapter 1

24

Haemostasis

Normal pregnancy is associated with extensive changes in haemostasis. Plasma

concentrations of prothrombin, factor VII, VIII, X and XII are increased in pregnancy. Also

prekallikrein and fibrinogen levels change. On the other (anti-coagulant and fibrinolytic)

side, activated protein C (APC) resistance is increased, and both plasminogen activator and

plasminogen activator inhibitor (PAI-1 and PAI-2) are elevated69. These changes in

haemostasis are essential to maintain uteroplacental blood flow during pregnancy and on

the other hand to control bleeding after parturition.

In preeclampsia, an increase of intravascular coagulation occurs, leading to

thrombus formation in the uteroplacental unit and other maternal organs. Intravascular

coagulation is reflected by an increased consumption of factor VIII and thrombin activity,

reduced levels of PAI-2 and an increased level of plasminogen activator. Since also

antitrombin levels are decreased in preeclampsia, the balance between coagulation and

anticoagulation systems is shifted towards coagulation, and thus a thrombotic tendency.

The impaired trophoblast invasion in the spiral arteries of the uterus in early pregnancy

leads to hypoperfusion and increased fibrin deposition in the placental vasculature.

Histologically, “acute sclerosis” can be found, which is characterized by fibrinoid necrosis,

accumulation of lipophages in the arterial wall and plaques on the intima of the vessels.

Another sign strongly suggesting a disturbance in the haemostatic balance in preeclampsia

is the elevated risk of patients with inherited trombophilias to develop this disease.

Platelets play an essential role in haemostasis. Activation of platelets is evident in

preeclamptic patients as indicated by an elevated number of platelets exposing P-selectin70-

72 and by elevated levels of β-thromboglobulin and soluble P-selectin in plasma70, 73. Upon

activation, platelets release MP. In human blood, circulating MP predominantly originate

from platelets. MP, especially platelet-derived MP (PMP), are known for their procoagulant

properties. They expose relatively high numbers of binding sites for activated coagulation

factors. MP of various cellular origin, including those of platelet origin, may expose tissue

factor (TF), or may trigger cellular expression and production of TF. MP support

coagulation in vitro as well as in vivo, and increased numbers of MP from various cell types

have been reported to occur in diseases associated with a procoagulant state (Chapter 2).


25

1 1.3 AIM A�D OUTLI�E OF THE THESIS

As mentioned in the previous paragraphs, MP may modulate or reflect several of the key-

processes in preeclampsia, including endothelial dysfunction, inflammation and coagulation

activation. Therefore, MP may be one of the factors contributing to the development or

aggravation of preeclampsia. The aim of this thesis was to test the hypothesis that MP play

a role in the development or severity of preeclampsia.

A review of the current knowledge of MP in pregnancy and preeclampsia is

described in Chapter 2. As will become clear from this chapter, longitudinal data of MP

numbers during the course of a normotensive pregnancy are lacking. Thus, reference values

of physiologic pregnancies at different gestational ages are not available. Because normal

pregnancy causes hemodynamic, metabolic and immunological alterations and changes in

many plasma constituents, the effect of pregnancy itself, gestational age and the different

phases of placentation on MP formation could be anticipated and was therefore analyzed

longitudinally in healthy normotensive pregnant patients. This longitudinal study is

described in Chapter 3. In this study, we confirmed that platelet-derived MP (PMP)

compose 95-99% of the total MP population. This largest fraction was most likely to be

involved in the etiology of PE. Moreover, platelet activation is an important feature in

preeclampsia. Therefore, PMP were the focus of interest in Chapter 4 in which the

exposure of the adhesion molecule P-selectin on MP was analyzed. Whereas the increased

percentage of PMP reflected platelet activation, their absolute number decreased compared

to normotensive pregnancies. Thus, characteristics of MP are at least as important as total

MP numbers. Therefore, other subpopulations of MP were also investigated. Expression of

the anti-angiogenic VEGF receptor, Flt-1 (fms-like tyrosine kinase-1) on MP was analyzed

in Chapter 5. Since pro- and anti-angiogenic factors are likely to play a role in the

development of preeclampsia and the placenta is an important source for the production of

the soluble form of Flt-1, we investigated in this chapter whether Flt-1 is exposed by

placenta-derived MP.

Indeed, more MP characteristics proved to be different between preeclamptic

patients and pregnant and non-pregnant control patients. Therefore it was important to

investigate how MP from preeclamptic patients may affect endothelial cells. This was

analyzed in Chapter 6 by measuring the RNA expression of inflammation-related genes in

cultured endothelial cells in the presence of MP from preeclamptic patients or controls.

Although we could not establish an effect of MP on endothelial cell RNA expression in this

study, vascular effects of both total numbers of MP as well as subpopulations of MP have

been described by others.

In previous experiments there was evidence of increased numbers of leukocyte-

Chapter 1

26

derived MP in preeclamptic patients compared to normotensive pregnant controls. It is not

known, however, how this relates to leukocyte activation in the maternal circulation. In

Chapter 7, we studied whether the numbers of the different leukocyte-derived MP are

related to markers of leukocyte activation and to RNA expression of inflammation-related

genes in maternal leukocytes.

Another important part of the maternal immune system is the complement

cascade. Its involvement in the development of preeclampsia has been suggested by several

investigators. We tested in Chapter 8 whether MP expose complement factors and can be

associated with classical pathway activation.

In view of all these findings, a conclusion concerning the role of MP in

preeclampsia will be provided in Chapter 9 and possible goals for future research will be

defined.

REFERE�CES

1. Morris RK, Cnossen JS, Khan KS, Robson SC, Kleijnen J, Ter Riet G, Mol BW, Van

der Post JAM. Serum screening with Down’s syndrome markers to predict pre-

eclampsia and fetal growth restriction: Systematic review and meta-analysis. HTA

report 01/64/04 2008;12(6), (www.hta.ac.uk).

2. Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science

2005;308:1592-4.

3. Brown MA, Lindheimer MD, de SM, Van AA, Moutquin JM. The classification and

diagnosis of the hypertensive disorders of pregnancy: statement from the International

Society for the Study of Hypertension in Pregnancy (ISSHP). Hypertens Pregnancy

2001;20:IX-XIV.

4. Report of the National High Blood Pressure Education Program Working Group on

High Blood Pressure in Pregnancy. Am J Obstet Gynecol 2000;183:S1-S22.

5. Sibai B, Dekker G, Kupferminc M. Pre-eclampsia. Lancet 2005;365:785-99.

6. Borzychowski AM, Sargent IL, Redman CW. Inflammation and pre-eclampsia. Semin

Fetal Neonatal Med. 2006;11:309-16.

7. Meads CA, Khan KS, Hyde CJ, Cnossen JS, Meher S, Juarez-Garcia A, ter Riet G,

Duley L, Roberts TE, Mol BW, van der Post JA, Leeflang MM, Barton PM, Gupta JK.

Methods of prediction and prevention of pre-eclampsia – systematic reviews of

accuracy and effectiveness literature with economic modelling

(http://www.hta.ac.uk/1337).

8. Hamilton AM. History of a case of convulsions in pregnancy. Edinburgh medical and

surgical journal, and medical literature of Edinburgh 1824;20:318.


27

1 9. Sibai BM. The HELLP syndrome (hemolysis, elevated liver enzyme levels, and low

platelets): much ado about nothing? Am J Obstet Gynecol 1990;162:311-6.

10. Goodlin RC. Preeclampsia as the great impostor. Am J Obstet Gynecol

1991;164:1577-80.

11. Wong LF, Stuart B, Gleeson N. Triploidy partial mole and proteinuric hypertension. J

Obstet Gynaecol 2007;27:424-5.

12. Prasannan-Nair C, Reynolds SF, Budden G. Partial molar pregnancy with severe pre-

eclampsia at 19 weeks' gestation. J Obstet Gynaecol 2006;26:817.

13. Knight M, Redman CW, Linton EA, Sargent IL. Shedding of syncytiotrophoblast

microvilli into the maternal circulation in pre-eclamptic pregnancies. Br J Obstet

Gynaecol 1998;105:632-40.

14. Goswami D, Tannetta D, Magee LA, Fuchisawa A, Redman CWG, Sargent IL,

Dadelszen P. Excess syncytiotrophoblast microparticle shedding is a feature of early-

onset pre-eclampsia, but not either late-onset pre-eclampsia or normotensive

intrauterine growth restriction. Placenta 2006;27:56-61.

15. Cockell AP, Lear mont JG, Smarason AK, Redman CW, Sargent IL, Poston L. Human

placental syncytiotrophoblast microvillous membranes impair maternal vascular

endothelial function. Br J Obstet Gynaecol 1997;104:235-40.

16. Gupta AK, Hasler P, Holzgreve W, Gebhardt S, Hahn S. Induction of neutrophil

extracellular DNA lattices by placental microparticles and IL-8 and their presence in

preeclampsia. Hum Immunol 2005;66:1146-54.

17. Gupta AK, Rusterholz C, Holzgreve W, Hahn S. Syncytiotrophoblast micro-particles

do not induce apoptosis in peripheral T lymphocytes, but differ in their activity

depending on the mode of preparation. J Reprod Immunol 2005;68:15-26.

18. Germain SJ, Sacks GP, Sooranna SR, Sargent IL, Redman CW. Systemic

inflammatory priming in normal pregnancy and preeclampsia: the role of circulating

syncytiotrophoblast microparticles. J Immunol 2007;178:5949-56.

19. Levine RJ, Lam C, Qian C, Yu KF, Maynard SE, Sachs BP, Sibai BM, Epstein FH,

Romero R, Thadhani R, Karumanchi SA; CPEP Study Group. Soluble endoglin and

other circulating antiangiogenic factors in preeclampsia. N Engl J Med 2006;355:992-

1005.

20. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann TA, Morgan

JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP, Karumanchi SA. Excess

placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial

dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest

2003;111:649-58.

21. Venkatesha S, Toporsian M, Lam C, Hanai J, Mammoto T, Kim YM, Bdolah Y, Lim

KH, Yuan HT, Libermann TA, Stillman IE, Roberts D, D'Amore PA, Epstein FH,

Chapter 1

28

Sellke FW, Romero R, Sukhatme VP, Letarte M, Karumanchi SA. Soluble endoglin

contributes to the pathogenesis of preeclampsia. Nat Med 2006;12:642-9.

22. Maynard S, Epstein FH, Karumanchi SA. Preeclampsia and angiogenic imbalance.

Annu Rev Med 2008;59:61-78.

23. Hung T, Skepper JN, Charnock-Jones, S, Burton GJ. Hypoxia-reoxygenation. A

potent inducer of apoptotic changes in the human placenta and possible etiological

factor in preeclampsia. Circ Res 2002;90:1274-81.


2005:308;1592-4.

25. Jauniaux E, Poston L, Burton GJ. Placental-related diseases of pregnancy:

involvement of oxidative stress and implications in human evolution. Hum Reprod

Update 2006;12:747-55.

26. Poston L, Endothelial dysfunction in pre-eclampsia. Pharmacological Reports

2006;57:69-74.

27. Poston L, Briley AL, Seed PT, Kelly FJ, Shennan AH. Vitamins in Pre-eclampsia

(VIP) Trial Consortium. Vitamin C and vitamin E in pregnant women at risk for pre-

eclampsia (VIP trial): randomised placebo-controlled trial. Lancet 2006;367:1145-54.

28. Mellembakken JR, Aukrust P, Olafsen MK, Ueland T, Hestdal K, Videm V.

Activation of leukocytes during the uteroplacental passage in preeclampsia.

Hypertension 2002;39:155-60.

29. Benyo DF, Miles TM, Conrad KP. Hypoxia stimulates cytokine production by villous

explants from the human placenta. J Clin Endocrinol Metab 1997;82:1582-8.

30. Rinehart BK, Terrone DA, Lagoo-Deenadayalan S, Barber WH, Hale EA, Martin JN

Jr, Bennett WA. Expression of the placental cytokines tumor necrosis factor alpha,

interleukin 1beta, and interleukin 10 is increased in preeclampsia. Am J Obstet

Gynecol 1999;181:915-20.

31. Benyo DF, Smarason A, Redman CW, Sims C, Conrad KP. Expression of

inflammatory cytokines in placentas from women with preeclampsia. J Clin

Endocrinol Metab 2001;86:2505-12.

32. Gaber LW, Spargo BH, Lindheimer MD. Renal pathology in pre-eclampsia. Baillieres

Clin Obstet Gynaecol 1987;1:971-95.

33. Svedas E, Nisell H, Vanwijk MJ, Nikas Y, Kublickiene KR. Endothelial dysfunction

in uterine circulation in preeclampsia: can estrogens improve it? Am J Obst Gyn

2002;187:1608-16.

34. Schiff E, Ben-Baruch G, Peleg E, Rosenthal T, Alcalay M, Devir M, Mashiach S.

Immunoreactive circulating endothelin-1 in normal and hypertensive pregnancies. Am

J Obstet Gynecol 1992;166:624-8.


29

1 35. Chaiworapongsa T, Romero R, Kim YM, Kim GJ, Kim MR, Espinoza J, Bujold E,

Gonçalves L, Gomez R, Edwin S, Mazor M. Plasma soluble vascular endothelial

growth factor receptor-1 concentration is elevated prior to the clinical diagnosis of

pre-eclampsia. J Matern Fetal Neonatal Med 2005;17:3-18.

36. Powers RW, Evans RW, Ness RB, Crombleholme WR, Roberts JM. Homocysteine

and cellular fibronectin are increased in preeclampsia, not transient hypertension of

pregnancy. Hypertens Pregnancy 2001;20:69-77.

37. Boffa MC, Valsecchi L, Fausto A, Gozin D, Vigano' D'Angelo S, Safa O, Castiglioni

MT, Amiral J, D'Angelo A. Predictive value of plasma thrombomodulin in

preeclampsia and gestational hypertension. Thromb Haemost 1998;79:1092-5.

38. Reith A, Booth NA, Moore NR, Cruickshank DJ, Bennett B. Plasminogen activator

inhibitors (PAI-1 and PAI-2) in normal pregnancies, pre-eclampsia and hydatidiform

mole. Br J Obstet Gynaecol 1993;100:370-4.

39. Suzuki Y, Hattori T, Kajikuri J, Yamamoto T, Suzumori K, Itoh T. Reduced function

of endothelial prostacyclin in human omental resistance arteries in pre-eclampsia. J

Physiol 2002;545:269-77.

40. Calvin S, Corrigan J, Weinstein L, Jeter M. Factor VIII: von Willebrand factor

patterns in the plasma of patients with pre-eclampsia. Am J Perinatol1988;5:29-32.

41. McCarthy AL, Woolfson RG, Raju SK, Poston L. Abnormal endothelial cell function

of resistance arteries from women with preeclampsia. Am J Obstet Gynecol

1993;168:1323-30.

42. Ashworth JR, Baker PN, Warren AY, Johnson IR. Mechanisms of endothelium-

dependent relaxation in myometrial resistance vessels and their alteration in

preeclampsia. Hypertens Pregnancy 1999;18:57-71.

43. Cockell AP, Poston L. Flow-mediated vasodilatation is enhanced in normal pregnancy

but reduced in preeclampsia. Hypertension 1997;30:247-51.

44. Kublickiene KR, Lindblom B, Krüger K, Nisell H. Preeclampsia: evidence for

impaired shear stress-mediated nitric oxide release in uterine circulation. Am J Obstet

Gynecol 2000;183:160-6.

45. Van Wijk MJ, Svedas E, Boer K, Nieuwland R, Vanbavel E, Kublickiene KR: Isolated

microparticles, but not whole plasma, from women with preeclampsia impair

endothelium-dependent relaxation in isolated myometrial arteries from healthy

pregnant women. Am J Obstet Gynecol 2002;187:1686-93.

46. Yamamoto T, Suzuki Y, Kojima K, Suzumori K. Reduced flow-mediated vasodilation

is not due to a decrease in production of nitric oxide in preeclampsia. Am J Obstet

Gynecol 2005;192:558-63.

47. García RG, Celedón J, Sierra-Laguado J, Alarcón MA, Luengas C, Silva F, Arenas-

Mantilla M, López-Jaramillo P. Raised C-reactive protein and impaired flow-mediated

Chapter 1

30

vasodilation precede the development of preeclampsia. Am J Hypertens 2007;20:98-

103.

48. Paeschke S, Chen F, Horn N, Fotopoulou C, Zambon-Bertoja A, Sollwedel A,

Zenclussen ML, Casalis PA, Dudenhausen JW, Volk HD, Zenclussen AC. Pre-

eclampsia is not associated with changes in the levels of regulatory T cells in

peripheral blood. Am J Reprod Immunol 2005;54:384-9.

49. Smárason AK, Gunnarsson A, Alfredsson JH, Valdimarsson H, Monocytosis and

monocytic infiltration of decidua in early pregnancy. J Clin Lab Immunol 1986;21:1–

5.

50. Sacks GP, Studena K, Sargent K, Redman CW. Normal pregnancy and preeclampsia

both produce inflammatory changes in peripheral blood leukocytes akin to those of

sepsis. Am J Obstet Gynecol 1998;179:80-6.

51. Mellembakken JR, Hogasen K, Mollnes TE, Hack CE, Abyholm T, Videm V.

Increased systemic activation of neutrophils but not complement in preeclampsia.

Obstet Gynecol 2001;97:371-4.

52. Gupta AK, Gebhardt S, Hillermann R, Holzgreve W, Hahn S. Analysis of plasma

elastase levels in early and late onset preeclampsia. Arch Gynecol Obstet

2006;273:239-42.

53. Belo L, Santos-Silva A, Caslake M, Cooney J, Pereira-Leite L, Quintanilha A, Rebelo

I. Neutrophil activation and C-reactive protein concentration in preeclampsia.

Hypertens Pregnancy 2003;22:129-41.

54. von Dadelszen P, Wilkins T, Redman CW. Maternal peripheral blood leukocytes in

normal and pre-eclamptic pregnancies. Br J Obstet Gynaecol 1999;106:576-81.

55. Koumandakis E, Koumandaki I, Kaklamani E, Sparos L, Aravantinos D, Trichopoulos

D. Enhanced phagocytosis of mononuclear phagocytes in pregnancy. Br J Obstet

Gynaecol 1986;93:1150-4.

56. Sacks GP, Redman CW, Sargent IL. Monocytes are primed to produce the Th1 type

cytokine IL-12 in normal human pregnancy: an intracellular flow cytometric analysis

of peripheral blood mononuclear cells. Clin Exp Immunol 2003;131:490-7.

57. Luppi P, Deloia JA. Monocytes of preeclamptic women spontaneously synthesize pro-

inflammatory cytokines. Clin Immunol 2006;118:268-75.

58. Paternoster DM, Fantinato S, Stella A, Nanhorngue KN. Milani M, Plebani M,

Nicolini U, Girolami A. C-reactive protein in hypertensive disorders in pregnancy.

Clin Appl Thromb Hemost 2006;12:330-7.

59. Koçyigit Y, Atamer Y, Atamer A, Tuzcu A, Akkus Z. Changes in serum levels of

leptin, cytokines and lipoprotein in pre-eclamptic and normotensive pregnant women.

Gynecol Endocrinol 2004;19:267-73.

60. Conrad KP, Miles TM, Benyo DF. Circulating levels of immunoreactive cytokines in


31

1 women with preeclampsia. Am J Reprod Immunol 1998;40:102-11.

61. Jonsson Y, Rubèr M, Matthiesen L, Berg G, Nieminen K, Sharma S, Ernerudh J,

Ekerfelt C. Cytokine mapping of sera from women with preeclampsia and normal

pregnancies. J Reprod Immunol 2006;70:83-91.

62. Daniel Y, Kupferminc MJ, Baram A, Jaffa AJ, Fait G, Wolman I, Lessing JB. Plasma

interleukin-12 is elevated in patients with preeclampsia. Am J Reprod Immunol

1998;39:376-80.

63. Adams KM, Mandel LS, Guthrie KA, Atkinson MW. Interleukin-18 in the plasma of

women with preeclampsia. Am J Obstet Gynecol 2003;188:1234-7.

64. Sakai M, Shiozaki A, Sasaki Y, Yoneda S, Saito S. The ratio of interleukin (IL)-18 to

IL-12 secreted by peripheral blood mononuclear cells is increased in normal pregnant

subjects and decreased in pre-eclamptic patients. J Reprod Immunol 2004;61:133-43.

65. Kauma S, Takacs P, Scordalakes C, Walsh S, Green K, Peng T. Increased endothelial

monocyte chemoattractant protein-1 and interleukin-8 in preeclampsia. Obstet

Gynecol 2002;100:706-14.

66. Sargent IL, Borzychowski AM, Redman CW. NK cells and human pregnancy - an

inflammatory view. Trends Immunol 2006;27:399-404.

67. Houwert-de Jong MH, Claas FH, Gmelig-Meyling FH, Kalsbeek GL, Valentijn RM,

te Velde ER, Schuurman HJ. Humoral immunity in normal and complicated

pregnancy. Eur J Obstet Gynecol Reprod Biol 1985;19:205-14.

68. Massobrio M, Benedetto C, Bertini E, Tetta C, Camussi G. Immune complexes in

preeclampsia and normal pregnancy. Am J Obstet Gynecol 1985;152:578-83.

69. O'Riordan MN, Higgins JR. Haemostasis in normal and abnormal pregnancy. Best

Pract Res Clin Obstet Gynaecol 2003;17:385-96.

70. Holthe MR, Staff AC, Berge LN, Lyberg T. Different levels of platelet activation in

preeclamptic, normotensive pregnant, and nonpregnant women. Am J Obstet Gynecol

2004;190:1128-34.

71. Konijnenberg A, Stokkers EW, van der Post JA, Schaap MC, Boer K, Bleker OP,

Sturk A, Extensive platelet activation in preeclampsia compared with normal

pregnancy: enhanced expression of cell adhesion molecules. Am J Obstet Gynecol

1997;176:461-9.

72. Yoneyama Y, Suzuki S, Sawa R, Kiyokawa Y, Power GG, Araki T. Plasma adenosine

levels and P-selectin expression on platelets in preeclampsia. Obstet Gynecol

2001;97:366-70.

73. Hayashi M, Inoue T, Hoshimoto K, Negishi H, Ohkura T, Inaba N. Characterization

of five marker levels of the hemostatic system and endothelial status in normotensive

pregnancy and pre-eclampsia. Eur J Haematol 2002;69:297-302.

Chapter 2

Microparticles and exosomes: impact on

normal and complicated pregnancy

B. Toth, C.A.R. Lok, A.N. Böing, M. Diamant, J.A.M. van der Post,

K. Friese, R. Nieuwland

Am. J. Reprod. Immunol. 2007;5:389-402

Chapter 2

34

ABSTRACT

Eukaryotic cells release vesicles into their environment by membrane shedding (ectosomes

or microparticles) and secretion (exosomes). Microparticles and exosomes occur commonly

in vitro and in vivo. The occurrence, composition and function(s) of these vesicles change

during disease (progression). During the last decade, the scientific and clinical interest has

increased tremendously. Evidence is accumulating that microparticles and exosomes may

be of pathophysiological relevance in autoimmune, cardiovascular and thromboembolic

diseases, as well as in inflammatory and infectious disorders. In this review we will briefly

summarize the discovery, biology, structure and function of microparticles and exosomes,

and discuss their (patho-) physiological role during normal and complicated pregnancy.

Cell-derived vesicles and human pregnancy

35

2

I�TRODUCTIO�

Microparticles

Already in the 1940’s, human blood and plasma were shown to contain a subcellular

clotting-promoting factor1. More than 25 years later it was demonstrated that this fraction

consists of small platelet-derived particles2. Their clinical relevance became apparent in

1979, when a case report was presented of a young woman with an unexplained congenital

bleeding disorder. She suffered from a disease, later termed Scott syndrome, characterized

by reduced prothrombin consumption due to impaired release of microparticles (MP) and

phospholipid scrambling3,4.

MP are released from cells by “shedding” and, according to most investigators,

range in size between 0.1-1 µm. In contrast to MP, exosomes are secreted from intracellular

multi-vesicular bodies (MVB) and range in size from 30–90 nm (Figure 1). Figure 1. Microparticles and exosomes

Figure 1. This figure shows the formation of an endosome by invagination. By inward

blebbing of the endosomal membrane, intraluminal vesicles are formed. Endosomes

containing intraluminal vesicles are called multivesicular bodies (MVB). Cells release the

contents of their MVB when the membrane of the MVB fuses with the plasma membrane. In

contrast to exosomes, MP are formed by major structural rearrangements of the

cytoskeleton and are ‘budded’ off from the outer cell membrane.

Chapter 2

36

MP are widely distributed and commonly occur in cell cultures in vitro and in body fluids

in vivo. For instance, human blood contains MP as well as exosomes originating from

various types of cells5. Many studies on MP showed that their numbers, cellular origin,

composition and function(s) are disease (state) dependent, but whether or not these changes

are related to disease development or are a consequence of the disease process itself is still

debated. Proteomes of MP, isolated from human platelets, endothelial cells, malignant cells,

lymphocytes and plasma, have been published6-9. These studies identified a myriad of

proteins, including structural proteins, metabolic enzymes, integrins and membrane fusion

proteins.

Exosomes

Exosomes were described in the early 1980's as 5’-nucleotidase activity-containing

vesicles.10 Subsequently, exosomes were shown to be involved in the removal of the

transferrin receptor from maturing reticulocytes. This surface receptor internalizes by

“inward” blebbing. These blebs (endosomes) pinch off very small (30-90 nm)

“intraluminal” vesicles. Endosomes containing “intraluminal vesicles” are called MVB.

Finally, once 'intraluminal' vesicles become secreted, i.e. after membrane fusion of MVB

and the surrounding plasma membrane, they are called exosomes11-13.

Similar to MP, exosomes are also widely distributed and commonly occur in cell

cultures in vitro and in body fluids in vivo5. Exosomes are smaller than (most) MP and their

proteomes differ14. Exosomes contain cytosolic proteins or proteins from the endocytic

compartment or plasma membrane, whereas proteins of nuclear, mitochondrial,

endoplasmic-reticulum or Golgi-apparatus origin are absent15. About 80% of exosomal

proteins are conserved among species, and characteristic (but not distinctive) protein

families include tetraspannins, heat shock proteins and MHC class I and II molecules15.

Also proteomes of exosomes from various human body fluids have been determined16-17.

It should be mentioned, that isolation procedures of MP and exosomes often differ

between investigators18. To exclude contamination of small cells (e.g. platelets), loss of

vesicles and functional changes, isolation procedures of MP and exosomes need to be taken

into account when data from different research groups are compared. For instance, the in

vitro methods to isolate syncytiotrophoblast-derived MP (STBM) strongly affect their

effects on T lymphocytes19. Also the use of different CD markers for identification,18,20-22

age23 and food consumption24,25 may affect circulating numbers of MP and, possibly, also

exosomes. Figure 2 illustrates the increasing scientific and clinical interest in MP and

exosomes. This increase may be explained by the long and ever increasing list of

biologically relevant functions that have been attributed to these vesicles, and their

association with disease (progression).


37

2

Figure 2. Scientific interest in microparticles and exosomes (1965–2005)

Figure 2. This overview shows the growing scientific interest in extracellular vesicles.(a)

Scientific publications on microparticles from platelets, erythrocytes, leukocytes,

endothelial cells, tumor cells, and other cells.(b) Exosomes. This figure was produced from

PubMed, using as searchstring in All indexed fields [microparticle\*] OR [vesicle\*] OR

[bleb\*]OR [particle\*] AAD All indexed fields [erythrocyte\*] OR [platelet\*]

OR[thrombocyte\*] OR [granulocyte\*] OR [monocyte\*] OR [endothelial\*].For tumor-

derived vesicles, a different search string was used: Title[particle\*] OR [vesicle\*] OR

[bleb\*] OR [microparticle\*] OR [microvesicle\*]OR [shed\*] AAD Title [tumour\*] OR

[tumor\*] OR [cancer\*]. For exosomes, the search string All fields [Exosome\*] was used.

This figure was prepared by R. J. Berckmans, PhD (AMC, the Aetherlands).

MP are best known for their coagulant properties, especially platelet-derived MP

(PMP) which expose (per surface area, compared to platelets) high numbers of binding sites

for (activated) coagulation factors, thereby enabling formation of tenase- and

prothrombinase complexes. According to most investigators, PMP are by far the most

common MP occurring in human blood. MP of various cellular origin, including PMP, may

expose tissue factor (TF), the initiator of coagulation in vivo,26-29 and this TF may be

transferred to other cells30-31. Alternatively, by binding to cells, MP also trigger expression

and production of TF. At least in vitro, PMP facilitate inactivation of coagulation factors

Va and VIIIa by activated protein C. Thus, (P)MP may also possess anti-coagulant

properties32. MP support coagulation in vitro as well as in vivo, and increased numbers of

MP from various cell types have been reported to occur in diseases associated with a

procoagulant state (summarized in Table 1).

Chapter 2

38

Table 1. Cellular origin of circulating microparticles in prothrombotic diseases

Disease Cellular origin of MP Reference(s) Anti-Phospholipid Syndrome Monocytes 104 Endothelial cells 105 Atherosclerosis Leukocytes 106 Coronary Artery Disease Platelets 107 Endothelial cells 108 Monocytes 109 Cancer Platelets 110 Diabetes Mellitus Platelets 111 Granulocytes 112 Monocytes 113 Heparine-induced Platelets 114 thrombocytopenia Hypertension Platelets 115 Monocytes 116 Idiopathic Thrombocytopenia Platelets 117 Paroxysmal nocturnal Platelets 118 hemoglobinuria Sepsis Platelets, Granulocytes 28 Leukocytes 119 Systemic Lupus Erythematosus Platelet 120 Thrombotic Thrombocytopenic Endothelium 121 purpura Uraemia Platelets 122 Vasculitis Endothelial cells 22 Neutrophils, Platelets 123 Sickle cell Disease Erythrocytes 124 Endothelial cells, Monocytes 125

Functions of microparticles and exosomes

The list of MP functions is growing rapidly and include not only coagulation but also

inflammation33, leukocyte adhesion and aggregation34, angiogenesis35, vasoconstriction36,

immune modulation37-39, and endothelial dysfunction36,40. Since most functions were

established only in vitro by using isolated vesicle preparations in model systems, we (still)

do not know to which extent MP also exhibit such functions in vivo. With regard to

coagulation, however, there is direct evidence that MP promote coagulation and thrombus

formation in vivo26, 41.


39

2

Initially, exosomes were considered to be “dustbins” used by cells to remove

redundant molecules, e.g. the transferrin receptors. Recent findings that caspase 3, heat-

shock proteins and cytostatic drugs may accumulate in exosomes (and MP), are in line with

this function42-46. Exosomes may also contribute to a change in haemostatic balance

towards a procoagulant state. In vitro-prepared exosomes from mast cells support thrombin

generation and induce endothelial expression of plasminogen activator inhibitor-147. In

general, cell-derived vesicles may transmit infectious agents or receptors that facilitate the

uptake of infectious agents into (target) cells. Exosomes facilitate spreading of prion

proteins,48 and MP may transfer various receptors that facilitate cellular uptake of human

immunodeficiency virus-149,50. Gould and coworkers proposed the ‘Trojan exosome’

hypothesis, in which they postulated that retroviruses may use exosomes as vehicles for

extracellular traffic and infection.

The most important function of cell-derived vesicles, however, seems to be

intercellular communication. By exposing cell-type specific adhesion receptors or ligands,

vesicles can bind to particular cells and deliver their “message” (e.g. bioactive lipids,

cytokines and growth factors)51. It has become firmly established that exosomes modulate

the immune response15. On the one hand they can facilitate antigen presentation, and on the

other hand suppress the immune response e.g. by exposing FasL52,53. Exosomes from

antigen-presenting (dendritic) cells, “dexosomes”, expose MHC class I and II molecules15.

Dexosomes have been tested in clinical trials as adjuvant anti-cancer therapy, they suppress

graft-versus-host disease in various animal models and protect against Toxoplasma gondii

infection54-57. Although the functions of MP and exosomes are many, their true (patho)

physiological functions in vivo are still unknown.

MICROPARTICLES A�D EXOSOMES I� �ORMAL PREG�A�CY

The success of human pregnancy depends on various physiologic processes. First,

pregnancy is an immunological phenomenon as the semiallogeneic fetus is not rejected and

second, the maternal haemostatic balance shifts towards a procoagulatory state. Therefore,

immunologic disorders and coagulation abnormalities can lead to adverse pregnancy

outcomes58. Paternal genes are expressed preferentially in the syncytiotrophoblasts (ST)

and immune tolerance towards the fetus requires specific suppression of the maternal

immune system59. How fetal trophoblast cells escape the maternal immune response is

unknown, but clonal deletion of immune cells recognizing paternal antigens in the placenta

is thought to play a role59-64. T lymphocytes that recognize fetal antigens decrease during

pregnancy and remain low postpartum to protect the fetus against the maternal immune

system. Placental FasL triggers local depletion of activated maternal (Fas-exposing) T

Chapter 2

40

lymphocytes that recognize placental paternal antigens,65-68 and FasL-exposing trophoblasts

induce Fas-dependent apoptosis of activated T lymphocytes66,68-69.

Exosomes, often supposed to originate at least in part from the placenta, have been

implicated in the establishment of an immune privilege for the developing fetus39,60,70-73.

Figure 3. A flow-chart showing the different populations of circulating vesicles from

placenta (STBM, exosomes) and from other cells (endothelial cells, platelets, leukocytes,

erythrocytes) and the processes thought to be affected by these vesicles related to normal or

complicated pregnancies.

Compared to non-pregnant women, increased levels of exosomes occur in pregnant

women. Incubation of T lymphocytes (Jurkat cells) with such exosomes resulted in down-

regulation of the expression of both CD3-ξ and Janus kinase 3 (JAK 3), as well as in

caspase 3 activation. These responses correlated to exposed FasL of the exosomal

fractions39,71,73. CD3-ξ affects the clonal selection of T lymphocytes, which leads to

Figure 3. Cell-derived vesicles in pregnancy

PlacentaEndothelial cell

Blood cells

CoagulationEndothelial dysfunction

ImmunomodulationInflammation

Normal& Complicatedpregnancy

STBMExosomes

MicroparticlesExosomes

Circulatingmicroparticles


41

2

decreased T lymphocyte-mediated responses and an increased rate of antibody production

protective in human pregnancy (elevated Th2/Th1 immune response). Expression and

activation of JAK3 is a key regulatory link between CD3-ξ expression and apoptosis, thus

contributing to establishment of immune privilege at the feto-maternal interface73.

Although exosomes from human first trimester trophoblast cells do not expose

(membrane-associated) FasL, they contain a biologically active (37 kDa) form of

“encapsulated” (intravesicular) FasL that triggers (Fas-mediated) T-cell apoptosis following

disruption of exosomes (Figure 3, 4)60,70.

Figure 4. Syncytiotrophoblast-derived microparticles

Figure 4. According to the studies of Fränsmyr and Abrahams60 as well as Mincheva-

Ailsson72, FasL (1)- and MIC-loaded (2) microvesicles are synthesized in the RER and

Golgi-apparatus of syncytiotrophoblasts, transported to cytoplasmic granules and stored or

secreted via exocytosis. AC= nucleus; CG= cytoplasmic granules

Mincheva-Nilsson et al., investigated the effect of soluble MHC class I chain-related

proteins A and B (MIC) on the expression of natural killer cell receptors (NKG2D) in

peripheral blood mononuclear cells (PBMC)72. They showed that MIC expression in

placenta was restricted to apical and basal cell membranes of ST and to “cytoplasmic

vacuoles as MIC-loaded microvesicles/exosomes” of these cells72. Since soluble MIC

molecules were present at elevated levels in maternal blood throughout normal pregnancy

and were released by placental explants in vitro, MIC-containing exosomes may be released

from placental villi into the maternal blood. As the human placenta also expresses several

Chapter 2

42

matrix metalloproteases, however, it can not be ruled out that soluble MIC is a cleavage

product in the circulation of pregnant women (Figure 4)70,72. Evidently, by transporting

bio-molecules that modulate the immune response, like FasL or MIC, placental-derived

vesicles may be considered as a “new physiological mechanism of silencing the maternal

immune system”, thereby promoting “fetal allograft immune escape”. As many adverse

pregnancy outcomes can result from the failure to adequately suppress T lymphocyte

activation pathways, defining the mechanism through which circulating placenta-derived

vesicles modulate activation components, such as CD3-ξ, JAK3 and MIC/NKG2D, may

possibly provide new therapeutic targets.

MP A�D EXOSOMES I� COMPLICATED PREG�A�CY

Early pregnancy loss

Between 25-50% of reproductive-aged women experience one or more miscarriages, often

due to fetal chromosomal abnormalities, especially with increasing maternal age58,74. The

WHO classification defines the occurrence of three or more consecutive spontaneous

miscarriages regardless of previous live births as recurrent fetal abortion (RSA)75. RSA

affects about 1-3% of women during child-bearing years76. Known risk factors are genetic

abnormalities, uterine pathologies, endocrine dysfunctions, autoimmune diseases, acquired

and inherited thrombophilic disorders, and environmental factors77. In nearly 50% of

affected women, the cause of RSA remains unknown78.

Trophoblast invasion into the uterine spiral arteries and development and

maintenance of adequate utero-placental circulation are prerequisites for successful

pregnancy79. This invasion may be promoted by (trophoblast-released) soluble FasL-

induced apoptosis of smooth muscle cells in the spiral arteries, thus contributing to utero-

placental circulation80.

During normal pregnancy, the haemostatic balance shifts towards a procoagulatory

state with an increase in clotting factors and fibrinogen as well as a decrease in

anticoagulant factors and fibrinolytic activity58, 81. In RSA, fibrin deposits are present in the

intervillous space of the placenta, raising the question whether RSA may be secondary to an

exaggerated haemostatic response during pregnancy79,82,83. This “hypercoagulability” may

involve other procoagulant factors, including MP and exosomes47,84. In 2001, Laude et al.,

used a prothrombinase assay to study the coagulation-promoting capacity of circulating MP

in 74 non-pregnant women with idiopathic RSA and 50 non-pregnant controls. RSA

patients were divided into two groups: 49 women with more than 3 RSA and less than 10

weeks gestational age, and 25 women with more than 1 late pregnancy loss (gestational age

>10 weeks)85. Isolated MP fractions from RSA women (55%) showed an increased


43

2

coagulation-promoting capacity, 29 (59%) in the early and 12 (48%) in the late pregnancy

loss group.

Carp et al., evaluated the numbers of CD51+/CD31+-positive MP, i.e. MP

presumably of endothelial cell origin, in non-pregnant women with RSA (n=96; ≥3 RSA)

versus non-pregnant women without a history of miscarriage (n=90)86. They reported

increased numbers of endothelial MP in 12 patients (12.5%) and in 2 controls (2%;

p<0.008). Furthermore, injection of artificially prepared procoagulant phospholipid

vesicles, i.e. vesicles containing phosphatidylserine, into pregnant mice induced thrombosis

in the placental bed and lead to reduced birth weight87. Taken together, the presence of

circulating (procoagulant) MP in women with RSA seems to be an acquired thrombophilia,

becoming clinically manifest during pregnancy79,83,85,86. The mechanisms underlying the

presence and contribution of these MP to the pathophysiology of miscarriage, however, are

unclear and additional studies are essential to specify their precise role in the development

of RSA.

Premature labour

Preterm labour is a major obstetric problem occurring in 5-7% of pregnant women. The

premature fetus can develop neurological, gastrointestinal, infectious and other disorders.

One of the most important causes for preterm labour is (sub clinical) infection. Recently, a

role for exosomes in immune suppression during premature labour has been suggested.

Levels of exosomes in sera from pregnant women were shown to be almost two-fold higher

in those delivering at term compared to women delivering preterm. Concurrently, exosomes

of women delivering at term contained higher levels of FasL and HLA-DR and elicited

greater suppression of CD3-ξ and JAK339. Although the underlying pathophysiology

remains unknown, these data implicate that exosomes may be involved in suppressing T

lymphocyte activation during pregnancy, thereby contributing to an immune privilege for

the developing fetus, necessary to achieve a term pregnancy.

Preeclampsia

Preeclampsia is a heterogenic multisystem disorder characterized by hypertension and

proteinuria and develops in the second half of pregnancy. The incidence is 2-5%, and

preeclampsia is a major cause of maternal and fetal morbidity and mortality. Although the

exact etiology is unknown, a general accepted hypothesis is the following two stage model.

Insufficient trophoblast invasion into spiral arteries of the uterus early in pregnancy results

in abnormal placentation with subsequent placental hypoperfusion. In the second stage,

placental factors are released into the maternal circulation, leading to a systemic

inflammatory response and endothelial dysfunction88.

Chapter 2

44

MP may modulate or reflect several of the key-processes in preeclampsia,

including inflammation, coagulation, platelet activation and endothelial dysfunction. The

first scientific papers reporting on the occurrence of MP in preeclampsia, focused on total

numbers of MP in preeclampsia compared to normotensive pregnant and non-pregnant

women. A summary of these articles can be found in Table 2. Obviously, circulating MP

originate from various types of cells and their composition depends on the status of the

parental cells. Data from different studies on circulating MP in preeclampsia are

inconsistent. Several studies reported a decrease in circulating numbers of PMP and an

increase in endothelial cell-derived MP (EMP). Decreased numbers of PMP may be related

to decreased platelet numbers in the maternal circulation, and/or (increased) attachment of

MP to the endothelium or other cells in the maternal circulation. Despite the overall

decrease of PMP, however, subpopulations of PMP exposing a well-established platelet

activation marker (P-selectin) were found to be increased (15.4%) compared to

normotensive pregnant and non-pregnant controls (10.9% and 8.0%, respectively)89. The

observed increase of EMP in preeclampsia may reflect endothelial-cell activation,90 and

increases in (numbers of) leukocyte-derived MP may reflect inflammation91, 92.

Complement activation may be part of the systemic inflammatory response in

preeclampsia. MP activate complement via the classical pathway in vitro. Isolated MP from

preeclamptic patients, however, exposed no increased levels of bound C1q, C3 and C4.

Interestingly, increased numbers of MP were present exposing C-reactive protein (CRP), a

well known complement activator molecule, suggesting that circulating MP may be

involved in complement activation93.

Circulating MP are known to affect endothelial function. Incubation of myometrial

arteries with MP from preeclamptic patients impaired bradykinin-mediated relaxation40, 94.

MP from preeclamptic women also induced vascular hyporeactivity to serotonin in human

omental arteries and aortas from pregnant and non-pregnant mice, and these effects were

associated with increased nitric oxide production91.

MP may contribute to preeclampsia by enhancing coagulation activation that

already occurs during normal pregnancy. Since the capacity of MP from preeclamptic

patients to promote coagulation (thrombin generation assay) was not increased, it seems

unlikely that circulating MP are directly involved in coagulation activation95. In addition,

MP from preeclamptic patients also failed to affect RNA expression of inflammation-

related genes and genes encoding adhesion receptors in endothelial cells96. Thus, MP seem

to modulate some but not all (patho)physiological processes, at least in vitro, that may play

a role in (the development of) preeclampsia.

Table 2. �

umbers of circulating microparticles in normal and com

plicated pregnancy

Table 2. Overview of studies mea

suring circu

lating numbers of MP in norm

al and complica

ted pregnancy; * significantly different

from pregnant co

ntrols; Eq P

S: eq

uivalents of phosphatidylserine; control: not pregnant; P

R: pregnant; P

E: preeclampsia; IU

GR:

intra-uterine gro

wth retardation; PIH

: pregnancy-induced hyp

ertension; Ref: references, A

D: not detectable.

Cellular origin

Marker

Control

PR

PE

IUGR

PIH

Units

Ref

Total

Pla

tele

ts

End

othe

lial

cel

ls

Annexin V

CD

41

CD

51

122 39 7

429

193 13

260

*37.

5 9

182 90

12

M

P/µ

L

126

End

othe

lial

cel

ls

End

othe

lial

cel

ls

CD

62e

CD

31

71

2 61

19

*193

0 *1

0497

822

6768

Cou

nts/µL

12

7

End

othe

lial

cel

ls

Pla

tele

ts

CD

31+/C

D41

- CD

31+/C

D42

+

8,

4 7,

9 *1

4,72

3 10

,751

Cou

nts/µL

90

Pla

tele

ts

CD

61

49

33

39

109 /L

128

Pla

tele

ts

CD

61

6.

6%

*3.7

%

% o

f pl

atel

ets

129

Total

Pla

tele

ts

Lym

phoc

ytes

Annexin V

CD

31

CD

11a

7.

5 4.

2 2.

9

*11.

68

*5.8

3 *5

.85

Nm

ol/L

Eq

PS

91

Total

Pla

tele

ts

T c

ells

T c

ells

Gra

nulo

cyte

s B c

ells

Mon

ocyt

es

Ery

thro

cyte

s End

othe

lial

cel

ls

Annexin V

CD

61

CD

4 CD

8 CD

66

CD

20

D14

CD

234

CD

62e

2357

20

14

13

12 7 3

ND

15

0 11

1960

16

18

ND

N

D 8 10

ND

12

2 N

D

2256

18

18

*29

*15

*79 5

ND

23

4 23

106 /L

92

Total

Pla

tele

ts

Annexin V

CD

61

6.7

6.6

5.1

4.9

*2.6

*2

.2

109 /L

89

Chapter 2

46

Since mice infused with in vitro prepared (artificial) phosphatidyl-

serine/phosphatidylcholine vesicles developed symptoms characteristic of preeclampsia, a

role for MP in the pathophysiological development of preeclampsia seems likely97.

Despite the fact that STBM constitute only a small fraction of the total number of

circulating MP in the maternal blood, still significantly elevated numbers of STBM have

been reported in preeclamptic women compared to normal pregnancy98. In contrast, STBM

were not increased in late onset preeclampsia or IUGR99. Perfusion of subcutaneous fat

arteries with in vitro prepared STBM altered the relaxation response to acetylcholine,100 but

in vivo concentrations of STBM did not have such an effect. STBM inhibited endothelial

cell proliferation,101 activate neutrophils and influence proliferation and activation of T

lymphocytes19, 102. Similar to the before mentioned MP from preeclamptic patients, STBM

hardly affected endothelial gene expression: the expression of 28 genes changed 2-fold or

more out of 10,000 genes examined by microarray. The observed changes were related to

inhibition of endothelial cell proliferation103. Taken together, the exact contribution of

STBM to the etiology of preeclampsia needs further investigation.

The role of exosomes in preeclampsia has not been investigated yet. As

immunologic factors certainly contribute to the development of preeclampsia and

immunologic maladaptation may be one of the underlying phenomena in preeclampsia, this

would be very interesting.

CO�CLUSIO�S

Cell-derived vesicles like MP and exosomes have been investigated in many different

diseases. So far, their pathophysiologic relevance in cardiovascular, thromboembolic as

well as inflammatory and immunologic disorders has been proven mainly in vitro. To

which extent MP and exosomes contribute, affect and/or reflect disease development,

however, is to be determined. Due to lack of standardized protocols to isolate MP and

exosomes from human body fluids such as blood, additional studies are required to

precisely determine the role of these different types of vesicles in normal and complicated

pregnancy.

In normal pregnancy, placenta-derived exosomes expressing or containing FasL

(and possibly MIC) may promote a state of immune privilege for the semiallogeneic fetus

by silencing the maternal immune response. As complicated pregnancies can result from an

inadequate suppression of maternal T lymphocyte activation, this mechanism may

constitute a new therapeutic target. Circulating MP with increased procoagulant potential in

women with RSA may be a chronic phenomenon, comparable to acquired thrombophilia,

possibly becoming clinically manifested during pregnancy. Whether these MP are


47

2

secondary to RSA or already existent before pregnancy, however, is still unknown. Recent

data indicate that women with premature labour have decreased numbers of circulating

placenta-derived exosomes, possibly indicating inappropriate down-regulation of the

maternal immune system. Although data are lacking on the presence of exosomes in

preeclampsia, there is growing evidence that MP are somehow associated with the

pathophysiology underlying disease acquisition and progression. Nevertheless, there is no

clear correlation between circulating numbers of MP and the disease state in different

women suffering from preeclampsia.

Taken together, ongoing research is essential to further elucidate the impact of

circulating MP and exosomes in normal and complicated pregnancy.

REFERE�CES

1. Chargaff E, West R. The biological significance of the thromboplastic protein of

blood. J Biol Chem 1946;166:189-97.

2. Wolf P. The nature and significance of platelet products in human placenta. Br J

Haematol 1967;13:269-88.

3. Sims PJ, Wiedmer T, Esmon CT, Weiss HJ, Shattil SJ. Assembly of the platelet

prothrombinase complex is linked to vesiculation of the platelet plasma membrane.

Studies in Scott syndrome: an isolated defect in platelet procoagulant activity. J Biol

Chem 1989;264:17049-57.

4. Weiss HJ, Vicic WJ, Lages BA, Rogers J. Isolated deficiency of platelet procoagulant

activity. Am J Med 1979;67:206-13.

5. Caby MP, Lankar D, Vincendeau-Scherrer C, Raposo G, Bonnerot C. Exosomal-like

vesicles are present in human blood plasma. Int Immunol 2005;17:879-87.

6. Garcia BA, Smalley DM, Cho H, Shabanowitz J, Ley K, Hunt DF. The platelet

microparticle proteome. J Proteome Res 2005;4:1516-21.

7. Jin M, Drwal G, Bourgeois T, Saltz J, Wu HM. Distinct proteome features of plasma

microparticles. Proteomics 2005;5:1940-52.

8. Miguet L, Pacaud K, Felden C, Hugel B, Martinez MC, Freyssinet JM, Herbrecht R,

Potier N, van DA, Mauvieux L. Proteomic analysis of malignant lymphocyte

membrane microparticles using double ionization coverage optimization. Proteomics

2006;6:153-71.

9. Wubbolts R, Leckie RS, Veenhuizen PT, Schwarzmann G, Mobius W,

Hoernschemeyer J, Slot JW, Geuze HJ, Stoorvogel W. Proteomic and biochemical

analyses of human B cell-derived exosomes. Potential implications for their function

and multivesicular body formation. J Biol Chem 2003;278:10963-72.

Chapter 2

48

10. Trams EG, Lauter CJ, Salem N, Jr., Heine U. Exfoliation of membrane ecto-enzymes

in the form of micro-vesicles. Biochim Biophys Acta 1981;645:63-70.

11. Harding C, Heuser J, Stahl P. Receptor-mediated endocytosis of transferrin and

recycling of the transferrin receptor in rat reticulocytes. J Cell Biol 1983;97:329-39.

12. Johnstone RM. Revisiting the road to the discovery of exosomes. Blood Cells Mol Dis

2005;34:214-19.

13. Pan BT, teng K, Wu C, Adam M, Johnstone RM. Electron microscopic evidence for

externalization of the transferrin receptor in vesicular form in sheep reticulocytes. J

Cell Biol 1985;101:942-48.

14. Thery C, Boussac M, Veron P, Ricciardi-Castagnoli P, Raposo G, Garin J, Amigorena

S: Proteomic analysis of dendritic cell-derived exosomes. a secreted subcellular

compartment distinct from apoptotic vesicles. J Immunol 2001;166:7309-18.

15. Thery C, Zitvogel L, Amigorena S. Exosomes: composition, biogenesis and function.

Nat Rev Immunol 2002;2:569-79.

16. Bard MP, Hegmans JP, Hemmes A, Luider TM, Willemsen R, Severijnen LA, van

Meerbeeck JP, Burgers SA, Hoogsteden HC, Lambrecht BN. Proteomic analysis of

exosomes isolated from human malignant pleural effusions. Am J Respir Cell Mol

Biol 2004;31:114-21.

17. Pisitkun T, Shen RF, Knepper MA. Identification and proteomic profiling of exosomes

in human urine. Proc Natl Acad Sci U S A 2004;101:13368-73.

18. Jy W, Horstman LL, Jimenez JJ, Ahn YS, Biro E, Nieuwland R, Sturk A, Dignat-

George F, Sabatier F, Camoin-Jau L, Sampol J, Hugel B, Zobairi F, Freyssinet JM,

Nomura S, Shet AS, Key NS, Hebbel RP. Measuring circulating cell-derived

microparticles. J Thromb Haemost 2004;2:1842-3.

19. Gupta AK, Rusterholz C, Holzgreve W, Hahn S. Syncytiotrophoblast micro-particles

do not induce apoptosis in peripheral T lymphocytes, but differ in their activity

depending on the mode of preparation. J Reprod Immunol 2005;68:15-26.

20. Abid Hussein MN, Meesters EW, Osmanovic N, Romijn FP, Nieuwland R, Sturk A.

Antigenic characterization of endothelial cell-derived microparticles and their

detection ex vivo. J Thromb Haemost 2003;1:2434-43.

21. Arteaga RB, Chirinos JA, Soriano AO, Jy W, Horstman L, Jimenez JJ, Mendez A,

Ferreira A, de ME, Ahn YS. Endothelial microparticles and platelet and leukocyte

activation in patients with the metabolic syndrome. Am J Cardiol 2006;98:70-4.

22. Brogan PA, Shah V, Brachet C, Harnden A, Mant D, Klein N, Dillon MJ. Endothelial

and platelet microparticles in vasculitis of the young. Arthritis Rheum 2004;50:927-36.

23. Van der Zee PM, Biro E, Ko Y, de Winter RJ, Hack CE, Sturk A, Nieuwland R. P-

selectin- and CD63-exposing platelet microparticles reflect platelet activation in

peripheral arterial disease and myocardial infarction. Clin Chem 2006;52:657-64.


49

2

24. Ferreira AC, Peter AA, Mendez AJ, Jimenez JJ, Mauro LM, Chirinos JA, Ghany R,

Virani S, Garcia S, Horstman LL, Purow J, Jy W, Ahn YS, de ME. Postprandial

hypertriglyceridemia increases circulating levels of endothelial cell microparticles.

Circulation 2004;110:3599-603.

25. Tushuizen ME, Nieuwland R, Scheffer PG, Sturk A, Heine RJ, Diamant M. Two

consecutive high-fat meals affect endothelial-dependent vasodilation, oxidative stress

and cellular microparticles in healthy men. J Thromb Haemost 2006;4:1003-10.

26. Biro E, Sturk-Maquelin KN, Vogel GM, Meuleman DG, Smit MJ, Hack CE, Sturk A,

Nieuwland R. Human cell-derived microparticles promote thrombus formation in vivo

in a tissue factor-dependent manner. J Thromb Haemost 2003;1:2561-8.

27. Nieuwland R, Berckmans RJ, Rotteveel-Eijkman RC, Maquelin KN, Roozendaal KJ,

Jansen PG, ten HK, Eijsman L, Hack CE, Sturk A. Cell-derived microparticles

generated in patients during cardiopulmonary bypass are highly procoagulant.

Circulation 1997;96:3534-41.

28. Nieuwland R, Berckmans RJ, McGregor S, Boing AN, Romijn FP, Westendorp RG,

Hack CE, Sturk A. Cellular origin and procoagulant properties of microparticles in

meningococcal sepsis. Blood 2000;95:930-5.

29. Satta N, Toti F, Feugeas O, Bohbot A, chary-Prigent J, Eschwege V, Hedman H,

Freyssinet JM. Monocyte vesiculation is a possible mechanism for dissemination of

membrane-associated procoagulant activities and adhesion molecules after stimulation

by lipopolysaccharide. J Immunol 1994;153:3245-55.

30. Del Conde I, Shrimpton CN, Thiagarajan P, Lopez JA. Tissue-factor-bearing

microvesicles arise from lipid rafts and fuse with activated platelets to initiate

coagulation. Blood 2005;106:1604-11.

31. Falati S, Liu Q, Gross P, Merrill-Skoloff G, Chou J, Vandendries E, Celi A, Croce K,

Furie BC, Furie B. Accumulation of tissue factor into developing thrombi in vivo is

dependent upon microparticle P-selectin glycoprotein ligand 1 and platelet P-selectin.

J Exp Med 2003;197:1585-98.

32. Tans G, Rosing J, Thomassen MC, Heeb MJ, Zwaal RF, Griffin JH. Comparison of

anticoagulant and procoagulant activities of stimulated platelets and platelet-derived

microparticles. Blood 1991;77:2641-8.

33. Berckmans RJ, Nieuwland R, Kraan MC, Schaap MC, Pots D, Smeets TJ, Sturk A,

Tak PP. Synovial microparticles from arthritic patients modulate chemokine and

cytokine release by synoviocytes. Arthritis Res Ther 2005;7:R536-44.

34. Forlow SB, McEver RP, Nollert MU. Leukocyte-leukocyte interactions mediated by

platelet microparticles under flow. Blood 2000;95:1317-23.

35. Kim HK, Song KS, Chung JH, Lee KR, Lee SN. Platelet microparticles induce

angiogenesis in vitro. Br J Haematol 2004;124:376-84.

Chapter 2

50

36. Boulanger CM, Scoazec A, Ebrahimian T, Henry P, Mathieu E, Tedgui A, Mallat Z.

Circulating microparticles from patients with myocardial infarction cause endothelial

dysfunction. Circulation 2001;104:2649-52.

37. Albanese J, Meterissian S, Kontogiannea M, Dubreuil C, Hand A, Sorba S, Dainiak N.

Biologically active Fas antigen and its cognate ligand are expressed on plasma

membrane-derived extracellular vesicles. Blood 1998;91:3862-74.

38. Peche H, Heslan M, Usal C, Amigorena S, Cuturi MC. Presentation of donor major

histocompatibility complex antigens by bone marrow dendritic cell-derived exosomes

modulates allograft rejection. Transplantation 2003;76:1503-10.

39. Taylor DD, Akyol S, Gercel-Taylor C. Pregnancy-associated exosomes and their

modulation of T cell signaling. J Immunol 2006;176:1534-42.

40. Vanwijk MJ, Svedas E, Boer K, Nieuwland R, Vanbavel E, Kublickiene KR. Isolated




41. McGill M, Fugman DA, Vittorio N, Darrow C. Platelet membrane vesicles reduced

microvascular bleeding times in thrombocytopenic rabbits. J Lab Clin Med

1987;109:127-33.

42. Abid Hussein MN, Nieuwland R, Hau CM, Evers LM, Meesters EW, Sturk A. Cell-

derived microparticles contain caspase 3 in vitro and in vivo. J Thromb Haemost

2005;3:888-96.

43. Clayton A, Turkes A, Navabi H, Mason MD, Tabi Z. Induction of heat shock proteins

in B-cell exosomes. J Cell Sci 2005;118:3631-8.

44. De Gassart A., Geminard C, Fevrier B, Raposo G, Vidal M. Lipid raft-associated

protein sorting in exosomes. Blood 2003;102:4336-44.

45. Safaei R, Larson BJ, Cheng TC, Gibson MA, Otani S, Naerdemann W, Howell SB.

Abnormal lysosomal trafficking and enhanced exosomal export of cisplatin in drug-

resistant human ovarian carcinoma cells. Mol Cancer Ther 2005;4:1595-1604.

46. Shedden K, Xie XT, Chandaroy P, Chang YT, Rosania GR. Expulsion of small

molecules in vesicles shed by cancer cells: association with gene expression and

chemosensitivity profiles. Cancer Res 2003;63:4331-7.

47. Al-Nedawi K, Szemraj J, Cierniewski CS. Mast cell-derived exosomes activate

endothelial cells to secrete plasminogen activator inhibitor type 1. Arterioscler Thromb

Vasc Biol 2005;25:1744-9.

48. Fevrier B, Vilette D, Archer F, Loew D, Faigle W, Vidal M, Laude H, Raposo G. Cells

release prions in association with exosomes. Proc Natl Acad Sci U S A

2004;101:9683-8.

49. Mack M, Kleinschmidt A, Bruhl H, Klier C, Nelson PJ, Cihak J, Plachy J,


51

2

Stangassinger M, Erfle V, Schlondorff D. Transfer of the chemokine receptor CCR5

between cells by membrane-derived microparticles: a mechanism for cellular human

immunodeficiency virus 1 infection. Nat Med 2000;6:769-75.

50. Rozmyslowicz T, Majka M, Kijowski J, Murphy SL, Conover DO, Poncz M,

Ratajczak J, Gaulton GN, Ratajczak MZ. Platelet- and megakaryocyte-derived

microparticles transfer CXCR4 receptor to CXCR4-null cells and make them

susceptible to infection by X4-HIV. AIDS 2003;17:33-42.

51. Barry OP, Pratico D, Lawson JA, FitzGerald GA. Transcellular activation of platelets

and endothelial cells by bioactive lipids in platelet microparticles. J Clin Invest

1997;99:2118-27.

52. Abusamra AJ, Zhong Z, Zheng X, Li M, Ichim TE, Chin JL, Min WP. Tumor

exosomes expressing Fas ligand mediate CD8+ T-cell apoptosis. Blood Cells Mol Dis

2005;35:169-73.

53. Kim SH, Bianco N, Menon R, Lechman ER, Shufesky WJ, Morelli AE, Robbins PD.

Exosomes derived from genetically modified DC expressing FasL are anti-

inflammatory and immunosuppressive. Mol Ther 2006;13:289-300.

54. Aline F, Bout D, Amigorena S, Roingeard P, mier-Poisson I. Toxoplasma gondii

antigen-pulsed-dendritic cell-derived exosomes induce a protective immune response

against T. gondii infection. Infect Immun 2004;72:4127-37.

55. Chaput N, Flament C, Viaud S, Taieb J, Roux S, Spatz A, Andre F, LePecq JB,

Boussac M, Garin J, Amigorena S, Thery C, Zitvogel L. Dendritic cell derived-

exosomes: biology and clinical implementations. J Leukoc Biol 2006;80:471-8.

56. Peche H, Renaudin K, Beriou G, Merieau E, Amigorena S, Cuturi MC. Induction of

tolerance by exosomes and short-term immunosuppression in a fully MHC-

mismatched rat cardiac allograft model. Am J Transplant 2006;6:1541-50.

57. Taieb J, Chaput N, Zitvogel L. Dendritic cell-derived exosomes as cell-free peptide-

based vaccines. Crit Rev Immunol 2005;25:215-23.

58. Rai R, Regan L. Recurrent miscarriage. Lancet 2006;368:601-11.

59. Tafuri A, Alferink J, Moller P, Hammerling GJ, Arnold B. T cell awareness of

paternal alloantigens during pregnancy. Science 1995;270:630-3.

60. Abrahams VM, Straszewski-Chavez SL, Guller S, Mor G. First trimester trophoblast

cells secrete Fas ligand which induces immune cell apoptosis. Mol Hum Reprod

2004;10:55-63.

61. Holmes CH, Simpson KL, Wainwright SD, Tate CG, Houlihan JM, Sawyer IH,

Rogers IP, Spring FA, Anstee DJ, Tanner MJ. Preferential expression of the

complement regulatory protein decay accelerating factor at the fetomaternal interface

during human pregnancy. J Immunol 1990;144:3099-105.

62. Hsi BL, Hunt JS, Atkinson JP. Differential expression of complement regulatory

Chapter 2

52

proteins on subpopulations of human trophoblast cells. J Reprod Immunol

1991;19:209-23.

63. Loke YW, King A. Immunology of implantation. Baillieres Best Pract Res Clin Obstet

Gynaecol 2000;14:827-37.

64. Munn DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C,

Mellor AL. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science

1998;281:1191-3.

65. Hammer A, Dohr G. Expression of Fas-ligand in first trimester and term human

placental villi. J Reprod Immunol 2000;46:83-90.

66. Jiang SP, Vacchio MS. Multiple mechanisms of peripheral T cell tolerance to the fetal

"allograft". J Immunol 1998;160:3086-90.

67. Kauma SW, Huff TF, Hayes N, Nilkaeo A. Placental Fas ligand expression is a

mechanism for maternal immune tolerance to the fetus. J Clin Endocrinol Metab

1999;84:2188-94.

68. Mor G, Gutierrez LS, Eliza M, Kahyaoglu F, Arici A. Fas-fas ligand system-induced

apoptosis in human placenta and gestational trophoblastic disease. Am J Reprod

Immunol 1998;40:89-94.

69. Griffith TS, Ferguson TA. The role of FasL-induced apoptosis in immune privilege.

Immunol Today 1997;18:240-4.

70. Frangsmyr L, Baranov V, Nagaeva O, Stendahl U, Kjellberg L, Mincheva-Nilsson L.

Cytoplasmic microvesicular form of Fas ligand in human early placenta: switching the

tissue immune privilege hypothesis from cellular to vesicular level. Mol Hum Reprod

2005;11:35-41.

71. Gercel-Taylor C, O'Connor SM, Lam GK, Taylor DD: Shed membrane fragment

modulation of CD3-zeta during pregnancy: link with induction of apoptosis. J Reprod

Immunol 2002;56:29-44.

72. Mincheva-Nilsson L, Nagaeva O, Chen T, Stendahl U, Antsiferova J, Mogren I,

Hernestal J, Baranov V: Placenta-derived soluble MHC class I chain-related molecules

down-regulate NKG2D receptor on peripheral blood mononuclear cells during human

pregnancy: a possible novel immune escape mechanism for fetal survival. J Immunol

2006;176:3585-92.

73. Sabapatha A, Gercel-Taylor C, Taylor DD. Specific isolation of placenta-derived

exosomes from the circulation of pregnant women and their immunoregulatory

consequences. Am J Reprod Immunol 2006;56:345-55.

74. Regan L, Rai R. Epidemiology and the medical causes of miscarriage. Baillieres Best

Pract Res Clin Obstet Gynaecol 2000;14:839-54.

75. Stephenson MD. Management of recurrent early pregnancy loss. J Reprod Med

2006;51:303-10.


53

2

76. Carrington B, Sacks G, Regan L. Recurrent miscarriage: pathophysiology and

outcome. Curr Opin Obstet Gynecol 2005;17:591-7.

77. Li TC, Makris M, Tomsu M, Tuckerman E, Laird S. Recurrent miscarriage: aetiology,

management and prognosis. Hum Reprod Update 2002;8:463-81.

78. Chung PH, Yeko TR. Recurrent miscarriage: causes and management. Hosp Pract

(Minneap) 1996;31:157-64.

79. Greer IA. Thrombophilia: implications for pregnancy outcome. Thromb Res

2003;109:73-81.

80. Harris LK, Keogh RJ, Wareing M, Baker PN, Cartwright JE, Aplin JD, Whitley GS.

Invasive trophoblasts stimulate vascular smooth muscle cell apoptosis by a fas ligand-

dependent mechanism. Am J Pathol 2006;169:1863-74.

81. Pechet L, Alexander B: Increased clotting factors in pregnacy. N Engl J Med

1961;265:1093-7.

82. Dolitzky M, Inbal A, Segal Y, Weiss A, Brenner B, Carp H. A randomized study of

thromboprophylaxis in women with unexplained consecutive recurrent miscarriages.

Fertil Steril 2006;86:362-6.

83. Rai R, Tuddenham E, Backos M, Jivraj S, El'Gaddal S, Choy S, Cork B, Regan L.

Thromboelastography, whole-blood haemostasis and recurrent miscarriage. Hum

Reprod 2003;18:2540-3.

84. Vanwijk MJ, Vanbavel E, Sturk A, Nieuwland R. Microparticles in cardiovascular

diseases. Cardiovasc Res 2003;59:277-87.

85. Laude I, Rongieres-Bertrand C, Boyer-Neumann C, Wolf M, Mairovitz V, Hugel B,

Freyssinet JM, Frydman R, Meyer D, Eschwege V. Circulating procoagulant

microparticles in women with unexplained pregnancy loss: a new insight. Thromb

Haemost 2001;85:18-21.

86. Carp H, Dardik R, Lubetsky A, Salomon O, Eskaraev R, Rosenthal E, Inbal A.

Prevalence of circulating procoagulant microparticles in women with recurrent

miscarriage: a case-controlled study. Hum Reprod 2004;19:191-5.

87. Sugimura M, Kobayashi T, Shu F, Kanayama N, Terao T. Annexin V inhibits

phosphatidylserine-induced intrauterine growth restriction in mice. Placenta

1999;20:555-60.

88. Sargent IL, Borzychowski AM, Redman CW. Immunoregulation in normal pregnancy

and pre-eclampsia: an overview. Reprod Biomed Online 2006;13:680-6.

89. Lok CA, Nieuwland R, Sturk A, Hau CM, Boer K, Vanbavel E, Vanderpost JA.

Microparticle-associated P-selectin reflects platelet activation in preeclampsia.

Platelets 2007;18:68-72.

90. Gonzalez-Quintero VH, Jimenez JJ, Jy W, Mauro LM, Hortman L, O'Sullivan MJ,

Ahn YS. Elevated plasma endothelial microparticles in preeclampsia. Am J Obstet

Chapter 2

54

Gynecol 2003;189:589-93.

91. Meziani F, Tesse A, David E, Martinez MC, Wangesteen R, Schneider F,

Andriantsitohaina R. Shed membrane particles from preeclamptic women generate

vascular wall inflammation and blunt vascular contractility. Am J Pathol

2006;169:1473-83.

92. Vanwijk MJ, Nieuwland R, Boer K, van der Post JA, Vanbavel E, Sturk A.

Microparticle subpopulations are increased in preeclampsia: possible involvement in

vascular dysfunction? Am J Obstet Gynecol 2002;187:450-6.

93. Biro E, Lok CA, Hack CE, van der Post JA, Schaap MC, Sturk A, Nieuwland R. Cell-

Derived Microparticles and Complement Activation in Preeclampsia Versus Normal

Pregnancy. Placenta 2007;28:928-35.

94. Tesse A, Meziani F, David E, Carusio N, Kremer H, Schneider F, Andriantsitohaina R.

Microparticles from preeclamptic women induce vascular hyporeactivity in vessels

from pregnant mice through an overproduction of Nitric Oxide. Am J Physiol Heart

Circ Physiol 2007;293:H520-5.

95. Vanwijk MJ, Boer K, Berckmans RJ, Meijers JC, van der Post JA, Sturk A, Vanbavel

E, Nieuwland R. Enhanced coagulation activation in preeclampsia: the role of APC

resistance, microparticles and other plasma constituents. Thromb Haemost

2002;88:415-20.

96. Lok CA, Boing AN, Reitsma PH, van der Post JA, van BE, Boer K, Sturk A,

Nieuwland R. Expression of inflammation-related genes in endothelial cells is not

directly affected by microparticles from preeclamptic patients. J Lab Clin Med

2006;147:310-20.

97. Omatsu K, Kobayashi T, Murakami Y, Suzuki M, Ohashi R, Sugimura M, Kanayama

N. Phosphatidylserine/phosphatidylcholine microvesicles can induce preeclampsia-like

changes in pregnant mice. Semin Thromb Hemost 2005;31:314-20.



Gynaecol 1998;105:632-40.

99. Goswami D, Tannetta DS, Magee LA, Fuchisawa A, Redman CW, Sargent IL, von

DP. Excess syncytiotrophoblast microparticle shedding is a feature of early-onset pre-

eclampsia, but not normotensive intrauterine growth restriction. Placenta 2006;27:56-

61.

100. Cockell AP, Learmont JG, Smarason AK, Redman CW, Sargent IL, Poston L. Human



101. Smarason AK, Sargent IL, Starkey PM, Redman CW. The effect of placental

syncytiotrophoblast microvillous membranes from normal and pre-eclamptic women


55

2

on the growth of endothelial cells in vitro. Br J Obstet Gynaecol 1993;100:943-9.

102. Gupta AK, Hasler P, Holzgreve W, Gebhardt S, Hahn S: Induction of neutrophil

extracellular DNA lattices by placental microparticles and IL-8 and their presence in

preeclampsia. Hum Immunol 2005;66:1146-54.

103. Hoegh AM, Tannetta D, Sargent I, Borup R, Nielsen FC, Redman C, Sorensen S,

Hviid TV. Effect of syncytiotrophoblast microvillous membrane treatment on gene

expression in human umbilical vein endothelial cells. BJOG 2006;113:1270-9.

104. Nagahama M, Nomura S, Kanazawa S, Ozaki Y, Kagawa H, Fukuhara S. Significance

of anti-oxidized LDL antibody and monocyte-derived microparticles in anti-

phospholipid antibody syndrome. Autoimmunity 2003;36:125-31.

105. Dignat-George F, Camoin-Jau L, Sabatier F, Arnoux D, Anfosso F, Bardin N, Veit V,

Combes V, Gentile S, Moal V, Sanmarco M, Sampol J. Endothelial microparticles: a

potential contribution to the thrombotic complications of the antiphospholipid

syndrome. Thromb Haemost 2004;91:667-73.

106. Chironi G, Simon A, Hugel B, Del PM, Gariepy J, Freyssinet JM, Tedgui A.

Circulating leukocyte-derived microparticles predict subclinical atherosclerosis burden

in asymptomatic subjects. Arterioscler Thromb Vasc Biol 2006;26:2775-80.

107. Mallat Z, Benamer H, Hugel B, Benessiano J, Steg PG, Freyssinet JM, Tedgui A.

Elevated levels of shed membrane microparticles with procoagulant potential in the

peripheral circulating blood of patients with acute coronary syndromes. Circulation

2000;101:841-3.

108. Bernal-Mizrachi L, Jy W, Jimenez JJ, Pastor J, Mauro LM, Horstman LL, de ME, Ahn

YS. High levels of circulating endothelial microparticles in patients with acute

coronary syndromes. Am Heart J 2003;145:962-70.

109. Matsumoto N, Nomura S, Kamihata H, Kimura Y, Iwasaka T. Increased level of

oxidized LDL-dependent monocyte-derived microparticles in acute coronary

syndrome. Thromb Haemost 2004;91:146-54.

110. Kim HK, Song KS, Park YS, Kang YH, Lee YJ, Lee KR, Kim HK, Ryu KW, Bae JM,

Kim S. Elevated levels of circulating platelet microparticles, VEGF, IL-6 and

RANTES in patients with gastric cancer: possible role of a metastasis predictor. Eur J

Cancer 2003;39:184-91.

111. Nomura S, Suzuki M, Katsura K, Xie GL, Miyazaki Y, Miyake T, Kido H, Kagawa H,

Fukuhara S. Platelet-derived microparticles may influence the development of

atherosclerosis in diabetes mellitus. Atherosclerosis 1995;116:235-40.

112. Diamant M, Nieuwland R, Pablo RF, Sturk A, Smit JW, Radder JK. Elevated numbers

of tissue-factor exposing microparticles correlate with components of the metabolic

syndrome in uncomplicated type 2 diabetes mellitus. Circulation 2002;106:2442-7.

113. Omoto S, Nomura S, Shouzu A, Nishikawa M, Fukuhara S, Iwasaka T. Detection of

Chapter 2

56

monocyte-derived microparticles in patients with Type II diabetes mellitus.

Diabetologia 2002;45:550-5.

114. Warkentin TE, Hayward CP, Boshkov LK, Santos AV, Sheppard JA, Bode AP, Kelton

JG. Sera from patients with heparin-induced thrombocytopenia generate platelet-

derived microparticles with procoagulant activity: an explanation for the thrombotic

complications of heparin-induced thrombocytopenia. Blood 1994;84:3691-9.

115. Preston RA, Jy W, Jimenez JJ, Mauro LM, Horstman LL, Valle M, Aime G, Ahn YS.

Effects of severe hypertension on endothelial and platelet microparticles. Hypertension

2003;41:211-7.

116. Nomura S, Kanazawa S, Fukuhara S. Effects of efonidipine on platelet and monocyte

activation markers in hypertensive patients with and without type 2 diabetes mellitus. J

Hum Hypertens 2002;16:539-47.

117. Jy W, Horstman LL, Arce M, Ahn YS. Clinical significance of platelet microparticles

in autoimmune thrombocytopenias. J Lab Clin Med 1992;119:334-45.

118. Wiedmer T, Hall SE, Ortel TL, Kane WH, Rosse WF, Sims PJ. Complement-induced

vesiculation and exposure of membrane prothrombinase sites in platelets of

paroxysmal nocturnal hemoglobinuria. Blood 1993;82:1192-6.

119. Fujimi S, Ogura H, Tanaka H, Koh T, Hosotsubo H, Nakamori Y, Kuwagata Y,

Shimazu T, Sugimoto H. Activated polymorphonuclear leukocytes enhance production

of leukocyte microparticles with increased adhesion molecules in patients with sepsis.

J Trauma 2002;52:443-8.

120. Pereira J, Alfaro G, Goycoolea M, Quiroga T, Ocqueteau M, Massardo L, Perez C,

Saez C, Panes O, Matus V, Mezzano D. Circulating platelet-derived microparticles in

systemic lupus erythematosus. Association with increased thrombin generation and

procoagulant state. Thromb Haemost 2006;95:94-9.

121. Jimenez JJ, Jy W, Mauro LM, Horstman LL, Ahn YS. Elevated endothelial

microparticles in thrombotic thrombocytopenic purpura: findings from brain and renal

microvascular cell culture and patients with active disease. Br J Haematol

2001;112:81-90.

122. Nomura S, Shouzu A, Nishikawa M, Kokawa T, Yasunaga K. Significance of platelet-

derived microparticles in uremia. Nephron 1993;63:485.

123. Daniel L, Fakhouri F, Joly D, Mouthon L, Nusbaum P, Grunfeld JP, Schifferli J,

Guillevin L, Lesavre P, Halbwachs-Mecarelli L. Increase of circulating neutrophil and

platelet microparticles during acute vasculitis and hemodialysis. Kidney Int

2006;69:1416-23.

124. Westerman MP, Unger L, Kucuk O, Quinn P, Lis LJ. Phase changes in membrane

lipids in sickle red cell shed-vesicles and sickle red cells. Am J Hematol 1998;58:177-

82.


57

2

125. Shet AS, Aras O, Gupta K, Hass MJ, Rausch DJ, Saba N, Koopmeiners L, Key NS,

Hebbel RP. Sickle blood contains tissue factor-positive microparticles derived from

endothelial cells and monocytes. Blood 2003;102:2678-83.

126. Bretelle F, Sabatier F, Desprez D, Camoin L, Grunebaum L, Combes V, D'Ercole C,

Dignat-George F. Circulating microparticles: a marker of procoagulant state in normal

pregnancy and pregnancy complicated by preeclampsia or intrauterine growth

restriction. Thromb Haemost 2003;89:486-92.

127. Gonzalez-Quintero VH, Smarkusky LP, Jimenez JJ, Mauro LM, Jy W, Hortsman LL,

O'Sullivan MJ, Ahn YS. Elevated plasma endothelial microparticles: preeclampsia

versus gestational hypertension. Am J Obstet Gynecol 2004;191:1418-24.

128. Harlow FH, Brown MA, Brighton TA, Smith SL, Trickett AE, Kwan YL, Davis GK.

Platelet activation in the hypertensive disorders of pregnancy. Am J Obstet Gynecol

2002;187:688-95.

129. Holthe MR, Lyberg T, Staff AC, Berge LN. Leukocyte-platelet interaction in

pregnancies complicated with preeclampsia. Platelets 2005;16:91-7.

59

PART II

Microparticle numbers and

characteristics in pregnancy and

preeclampsia

Chapter 3

Changes in microparticle numbers and

cellular origin during pregnancy and

preeclampsia

C.A.R. Lok, J.A.M.van der Post, I.L. Sargent, C.M. Hau, A. Sturk,

K. Boer, R. Nieuwland

Hypertension in Pregnancy (in press)

Chapter 3

62

ABSTRACT

Introduction. Microparticles (MP) are pro-coagulant vesicles derived from various cells.

Evidence is accumulating that MP are of pathophysiological relevance in autoimmune,

cardiovascular, thromboembolic diseases and inflammatory disorders. Therefore, their role

in the development of preeclampsia was investigated and MP from preeclamptic patients

influenced endothelial-dependent vasodilatation. Knowledge about changes in circulating

MP numbers during pregnancy and preeclampsia is lacking. We determined this

longitudinally and investigated whether these numbers related to the severity of

preeclampsia.

Methods. Samples were obtained from pregnant women and preeclamptic patients during

pregnancy and postpartum. MP were isolated and studied by flow cytometry.

Results. During pregnancy, MP were decreased at 12 weeks gestation and then returned to

postpartum values. In preeclampsia, MP numbers were reduced at 28 and 36 weeks (both

p=0.04). Monocyte-derived MP were elevated in preeclampsia at 28 (p=0.007), 32 (p=0.02)

and 36 weeks (p=0.01), as were erythrocyte-derived MP at 28 weeks (p=0.04). Placenta-

derived MP increased during pregnancy and preeclampsia. In pregnancy a correlation was

present between placenta-derived MP and systolic blood pressure (r=0.33, p=0.015). No

other correlations were found.

Conclusions. During pregnancy, numbers of MP initially decrease and subsequently

normalize. Placenta-derived MP increase, possibly because of placental growth. In

preeclampsia, reduced numbers of PMP are due to decreased platelet counts. Increased

numbers of monocyte-derived MP reflect monocyte activation, which may be an expression

of the systemic inflammation in preeclampsia. Lack of correlation between numbers of MP

and severity of preeclampsia suggests that MP numbers alone do not explain the reported

vascular effects of MP.


63

3

I�TRODUCTIO�

MP are small, procoagulant membrane vesicles, which are budded from the cell surface and

released into the circulation during apoptosis or activation of blood cells or endothelial

cells. Microparticles (MP) play a definite role in both inflammation and coagulation1,2.

Since normotensive pregnancy and, even more, preeclampsia are both characterized by

activation of coagulation pathways and an altered inflammatory state3, changes in

circulating MP numbers or their cellular origin and function may underlie the activation of

these processes.

Previously, we showed that the majority of MP originates from platelets4. This

subpopulation is often decreased in preeclampsia, depending on the patient selection5.

Despite their decrease in preeclampsia, a subpopulation of PMP exposing P-selectin, i.e.

MP originating from activated platelets, was increased compared to pregnant and non-

pregnant controls6. Furthermore, numbers of T-cell- and granulocyte-derived MP were

significantly elevated in preeclampsia compared to controls4. These elevations could be a

part of the exaggerated inflammatory response of preeclampsia. The contribution of MP to

the development of preeclampsia, however, is still not completely understood. Whereas MP

from women with preeclampsia impaired endothelium-dependent vasodilatation in isolated

myometrial arteries7, the RNA expression of inflammation-related genes in endothelial cells

was unaffected8. Impairment of endothelial dilatation was also found when small arteries

were incubated with placenta-derived MP9. Although placenta-derived MP constitute only a

small fraction of the total number of circulating MP in the maternal blood, elevated

numbers of placenta-derived MP have been reported in preeclamptic women compared to

normotensive pregnant controls10.

In non-pregnant hypertensive patients significant correlations were reported

between blood pressure and both endothelium-derived MP and PMP11. Currently, data on

changes in MP numbers or subpopulations during the time course of uncomplicated

pregnancies are not available. Moreover, it is unclear how changes in circulating MP are

associated with the severity of preeclampsia.

At present, MP numbers and cellular origin in preeclampsia have always been

investigated in cross-sectional studies in the second half of pregnancy. In the present study,

we analyzed MP in a longitudinal design. Thus, we investigated circulating MP numbers

throughout normotensive pregnancy, and evaluated whether MP or subsets thereof are

related to disease severity in preeclampsia and/or to numbers of circulating blood cells.

Chapter 3

64

MATERIALS A�D METHODS

Patients

The study was approved by the medical ethical committee of the Academic Medical Center

and written consent was obtained from all study patients prior to blood collection. Blood

samples were collected from randomly chosen healthy normotensive pregnant patients not

using any medication (n=8) between 12-14, 19-21, 23-26, 27-29, 30-34, 34-38 weeks

gestation and at 6 weeks postpartum. Preeclamptic patients (n=11) were included upon

admission to the hospital and multiple blood samples were obtained weekly until delivery

and 6 weeks postpartum. Preeclampsia was defined as: (I) diastolic blood pressure of 110

mmHg or more on any occasion or 90 mmHg or more measured on two separate occasions

at least four hours apart and (II) proteinuria of at least 0.3 gram / 24 hours (III) developing

after 20 weeks gestational age. Data concerning age, parity, medical history, blood pressure

at 12 weeks gestational age, Body Mass Index (BMI) and laboratory results (level of

hemoglobin, liver enzymes and platelets) were collected from the patient files. The delivery

method, birth weight and gestational age at delivery were recorded postpartum.

Collection of blood samples

Two blood samples were taken from the antecubital vein without tourniquet through a 20-

gauge needle with a vacutainer system. The first sample was collected into a 4.5 mL tube

containing 0.105 M buffered sodium citrate (Becton Dickinson, San Jose, CA). Within 30

minutes after collection, cells were removed by centrifugation for 20 minutes at 1560 g and

20 °C. Plasma samples were then divided in 250 µL aliquots, immediately snap frozen in

liquid nitrogen to preserve MP structure and then stored at -80 °C until further analysis.

The second sample was collected in a 4.5 mL tube containing ethylenediaminetetraacetic

acid (EDTA; Becton Dickinson; San Jose, CA) and used to determine numbers of

erythrocytes, platelets and leukocytes.

Reagents and assays

Fluorescein isothiocyanate (FITC)-labeled IgG1 and phycoerythrin (PE)-labeled IgG1

and monoclonal antibodies directed against Tsuppressor-cells (anti-CD8-PE), monocytes (anti-

CD14-PE) and B-cells (anti-CD20-FITC) were obtained from Becton Dickinson (San Jose,

CA). To detect Thelper-cells and granulocytes, anti-CD4-FITC and anti-CD66e-FITC were

purchased from the Central Laboratory Bloodtransfusion (Amsterdam, The Netherlands).

Anti-CD61-FITC (anti-GP-IIIa) was obtained from Pharmingen (San Jose, CA) and

CD62e-PE (anti-E-selectin) from Ancell (Bayport, MN). Antibodies directed against P-

selectin (anti-CD62p-PE) and anti-CD63-PE were purchased from Immuno Quality

Products (Groningen, The Netherlands) and anti-glycophorin A-FITC was obtained from


65

3

DakoCytomation (Carpionteria, CA). Allophycocyanin (APC)-conjugated annexin V was

purchased from Caltag (Burlingame, CA). ED822, an antibody to an unknown antigen

expressed on the apical surface of the syncytiotrophoblast used to detect trophoblastic

cells12, was a kind gift from dr. S. F. Sooranna from the Department of Maternal Fetal

Medicine, Imperial College School of Medicine (London, UK). This antibody was shown to

be more specific than other suggested antibodies used to detect trophoblast cells with flow

cytometry10. The alternative antibody, NDOG2, seemed to be less specific in an earlier

study by our group4. The second antibody for the indirect labelling with ED822,

GAM(Fab)2-FITC was obtained from Dako (Glostrup; Denmark). The following final

dilutions of antibodies were used: IgG1-FITC (1:10), IgG1-PE (1:10), anti-CD4-FITC

(1:2.5), anti-CD8-PE (1:5), anti-CD14-PE (1:20), anti-CD20-FITC (1:10), anti-CD61-FITC

(1:30), anti-CD62p-PE (1:15), CD62e-PE (1:30), anti-CD63 (1:5), anti-CD66e-FITC

(1:10), anti-glycophorin A-FITC (1:5), annexin V-APC (1:40), ED822 (1:2.5) GAM(Fab)2-

FITC (1:20).

Whole blood erythrocyte, platelet and leukocyte counts were determined with a

Cell-Dyn 4000 (Abbott Diagnostics Division; Abbott Laboratories; Hoofddorp, The

Netherlands) at the department of Clinical Chemistry (Academic Medical Center;

Amsterdam, The Netherlands).

Isolation of microparticles

A sample of 250 µL frozen plasma was thawed on ice and centrifuged for 30 minutes at

18890 g and 20 ºC to pellet the MP. With this centrifugation condition it is possible to

pellet the MP without simultaneous pelleting exosomes13. After centrifugation, 225 µL of

the supernatant was removed. The MP pellet and remaining supernatant were resuspended

in 225 µL phosphate-buffered saline (PBS) with citrate (154 mmol/L NaCl, 1.4 mmol/L

phosphate, 10.9 mmol/L trisodium citrate, pH 7.4). After centrifugation for 30 minutes at

18890 g and 20 ºC, 225 µL of the supernatant was removed again. The MP pellet was then

resuspended in 75 µL PBS-citrate.

Flow cytometry

Five µL of the MP suspension was diluted in 35 µL CaCl2 (2.5 mmol/L)-containing PBS.

Then 5 µL APC-labeled annexin V was added to all tubes plus 5 µL of the cell-specific

monoclonal antibody or isotype-matched control antibodies. The samples were then

incubated in the dark for 15 minutes at room temperature. After incubation, 900 µL of

calcium-containing PBS was added to all tubes (except to the annexin V control, to which

900 µL PBS-citrate was added). Samples were analyzed for one minute in a fluorescence

automated cell sorter (FACS Calibur) with CellQuest software (Becton Dickinson; San

Jose, CA). Both forward scatter (FSC) and sideward scatter (SSC) were set at a logarithmic

Chapter 3

66

gain. MP were identified on basis of their size and density (FSC and SSC respectively) and

on their capacity to bind annexin V. Annexin V measurements were corrected for

autofluorescence. Labeling with cell-specific monoclonal antibodies was corrected for

identical concentrations of isotype-matched control antibodies. The number of MP per liter

plasma was calculated using the following formula: Number/L = N x (100/5) x (955/flow) x

(106/250), in which N is the number of events that stained positive for both annexin V and a

cell-specific antibody, 100 (µL) is the (total) volume of the MP suspension after isolation,

from which 5 (µL) is used for labeling, 955 (µL) is the total volume of the labeled MP

suspension after dilution, flow is the volume (µL) analyzed per minute by the

flowcytometer, multiplied by 106 (from µL to L) and finally, 250 (µL) was the original

volume of the plasma aliquot from which MP were isolated.

Flow cytometric analysis of placenta-derived MP was performed using an indirect

staining procedure. MP (5 µL aliquots) were incubated for 15 minutes at room temperature

in a final volume of 55 µL of PBS containing 2.5 mmol/L CaCl2 (PBS/Ca, pH 7.4) and

unlabeled ED822. After incubation, MP were washed with 200 µL of PBS/Ca.

Subsequently, GAM(Fab)2-FITC (5 µL) was added for 15 minutes at room temperature,

and labeling was terminated by addition of 300 µL buffer. Numbers were estimated using a

comparable formula as mentioned before.

Statistical analysis

Data were analyzed with Statistical Package of the Social Science software for Windows,

release 11.5 (SPSS Benelux BV, Gorinchem, The Netherlands). Differences between

demographic data were analyzed with Mann-Whitney U tests. Dichotomous variables were

compared with a Chi-square test. For groups <5, a Fisher’s exact test was used. A mixed

model (ANOVA for repeated measurements with corrections for missing values) was used

to analyze MP numbers as a function of gestational age (repeated measurements).

Differences between the normotensive pregnant patients and the preeclamptic patients for

the different sampling periods were analyzed with Mann-Whitney U tests (cross-sectional

measurements). If more than one sample was available of one preeclamptic patient for a

certain period, the mean was calculated and used for the analysis. Correlations were

analyzed with a Pearsons bivariate two-sided test. Differences were considered significant

if p <0.05.


67

3

RESULTS

Patient characteristics

Patient characteristics are summarized in Table 1. The median age in the normotensive

pregnant women was 30.8 years compared to 26.5 years in the preeclamptic patients. As

expected, both systolic and diastolic blood pressures were elevated in the preeclampsia

compared normotensive pregnancy. Although, this difference in blood pressure was already

present at a gestational age of 12 weeks, none of these patients were hypertensive before 20

weeks gestation. The majority of the preeclamptic patients was nulliparous.

Table 1. Patient characteristics

�ormotensive

pregnancy

(n=8)

Preeclampsia

(n=11) P

Age (years) 30.8 (25.5-34.5) 26.5 (20.8-33.0) 0.03

Blood pressure 12 wks*

Systolic (mmHg)

Diastolic (mmHg)

95 (70-110)

58 (50-70)

120 (110-155)

75 (65-90)

0.0001

0.001

Highest blood pressure

Systolic (mmHg)

Diastolic (mmHg)

108 (100-120)

68 (55-75)

160 (140-210)

115 (90-130)

0.0001

0.0001

Parity

Nulliparous

Multiparous

2

6

10

1

0.006

Proteinuria (g/24 h) - 9.3 (0.7-16.3) -

Platelets (109/L) 252 (107-408) 206 (42-568) 0.03

BMI (kg/m2) 23.8 (18.2-31.9) 21.6 (20.0-40.8) NS

Delivery

GA (weeks)

Cesarean section

Vaginal birth

39.3 (37.4-42.0)

1

7

34.3 (26.1-36.6)

8

3

0.0001

0.03

Birth weight (gram) 3450 (2940-3870) 1355 (470-2310) 0.0001

Table 1. Data are presented as median (range). P: probability value for differences

between the preeclamptic group and the normotensive pregnant group. AS: non-significant.

BMI: body mass index. GA: gestational age. * In the preeclamptic patients, the blood

pressure at 12 weeks was retrospectively found in the files of the prenatal care.

Chapter 3

68

Four women in the normotensive group and two preeclamptic patients had a first trimester

pregnancy loss before the present pregnancy. One woman in the normotensive group was

pregnant after assisted reproductive treatment. Two normotensive pregnant women and one

preeclamptic patient smoked during the present pregnancy. Most study subjects were

Caucasian (ten preeclamptic patients and four controls). Six preeclamptic patients had

abnormal liver function tests or decreased platelet counts, but they did not fulfill the criteria

for HELLP (hemolysis, elevated liver enzymes, low platelets) syndrome. Although none of

the preeclamptic patients had an eclamptic episode, five patients needed preventive

treatment with magnesium sulphate. None of the women suffered from thromboembolic

complications. Blood pressure and laboratory values returned to normal after delivery. Like

mentioned in the method section data was extracted from the medical files concerning BMI,

birth weight, gestational age at delivery and the method of delivery. These data showed that

the BMI was comparable between groups and birth weight and gestational age at delivery

were significantly lower in the preeclamptic women compared to the normotensive

pregnant women. Furthermore, most preeclamptic patients delivered by cesarean section.

�ormotensive pregnancy

Total numbers of circulating MP were

longitudinally determined throughout

pregnancy in the plasma from normotensive

pregnant women. Figure 1 shows that the

number of MP was decreased at 12 weeks

gestation (median number of MP 2.9

*109/L, p=0.04) compared to postpartum.

Then the MP number gradually normalized

to the postpartum values during pregnancy

(p=0.02) with a maximum number at a

gestational age of 28 weeks (7.3*109/L).

The majority of MP (97%-99%) originated

from platelets (PMP, Table 2). Numbers of

PMP correlated with platelet counts

(r=0.32, p=0.02) and the PMP/platelet ratio

remained constant (0.02-0.03) during the

course of pregnancy. A minor fraction

(0.6%-2.7%) of the MP originated from

erythrocytes. No correlation was present

between the numbers of erythrocyte-

derived MP and erythrocytes.

Figure 1. The number of annexin V-positive

MP in normotensive pregnancies is plotted

against the gestational age. Data are

presented as median with the interquartile

range (25%-75%). In normotensive women,

blood collection started at 12 weeks. *:

p=0.04 compared to postpartum values.

Figure 1. The number of microparticles during normotensive pregnancy

Table 2. C

ellular origin of circulating microparticles in normotensive pregnant wom

en

Gestational age

12

20

24

28

32

36

pp

Tot

al M

P (10

9 /L)

2.9

(1.8

-7.2

)

5.8

(3.4

-10.

0)

5.1

(2.1

-13.

3)

7.3

(2.2

-10.

5)

5.7

(2.7

-11.

7)

5.5

(2.0

-17.

9)

7.3

(1.5

-9.9

)

% P

late

let-de

rive

d M

P

97.0

(95.

2-98

.1)

97.9

(94.

6-99

.5)

99.0

(97.

1-99

.6 )

97.9

(96.

2-98

.8)

97.2

(95.

1-99

.5)

98.1

(88.

3-99

.8)

98.1

(83.

6-98

.9)

% E

ryth

rocy

te-d

eriv

ed M

P

2.7

(0.7

-4.0

)

1.0

(0.4

-4.6

)

0.6

(0.3

-1.9

)

1.6

(0.2

-2.5

)

1.3

(0.4

-3.4

)

1.4

(0-6

.4)

1.9

(1.2

-15.

3)

% T

help

er-c

ell-de

rive

d M

P

0.2

(0-1

.8)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

% M

onoc

yte-

derive

d M

P

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

% B

-cel

l-de

rive

d M

P

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

< 0

.1

(ND

)

% E

ndot

helial

-cel

l-de

rive

d M

P

1.0

(0-1

.6)

0.8

(0-1

.7)

0.4

(0-1

.8)

0.9

(0-2

.4)

0.8

(0-3

.0)

0.9

(0-5

.3)

0.7

(0-2

.7)

% P

lace

nta-

derive

d M

P

2.3

(0.6

-5.6

)

1.6

(0.8

-3.4

)

1.9

(0.7

-5.4

)

1.5

(0.6

-5.7

)

1.8

(1.0

-4.0

)

3.0

(1.9

-7.0

)

1.1

(0.6

-1.7

)

Table 2. The total number of annexin V-positive M

P is presented as med

ian (ra

nge; m

in-m

ax). The subpopulations are exp

ressed

as

med

ian percentage of the total number of MP. Percentages w

ere ca

lculated for every patien

t indep

enden

tly. Therefore, the sum of the

med

ian percentages of all subgroups approach

es 100% and is not exactly 100%; pp: postpartum, AD: not detectable. The percentage

of Tsu

ppressor-cell-derived

MP and G

ranulocyte-derived

MP are <

0.1% for all gestational ages

.

Chapter 3

70

Numbers of circulating leukocyte-derived

MP, staining for CD4, CD8, CD14,

CD20 or CD66e, were negligible and

did not correlate with the number of

leukocytes. Finally, 0.4%-1.0% of MP

stained for E-selectin, which implies an

endothelial cell source.

During normotensive preg-

nancy, the percentage of placenta-

derived MP ranged between 1.5 and

3%. A significant increase of the

absolute number of placenta-derived

MP was found during pregnancy

(p=0.005), with the highest level at 36

weeks gestational age (Figure 2).

Postpartum the percentage decreased to

1.1%. A modest correlation between the

total number of placenta-derived MP and

systolic blood pressure was present

(r=0.33, p=0.015). In five male

volunteers and five healthy non-pregnant

women (mean age 36 years and not using

any medication including oral

contraceptives), no relevant staining for

ED822 to detect placenta-derived MP

was found.

Preeclampsia

The number of MP was weekly determined in plasma from preeclamptic patients after

admission to the hospital. The total number of MP did not change during preeclampsia in

the period between 28 and 36 weeks gestation (Figure 3), but total numbers of MP were

reduced in preeclamptic patients compared to normotensive controls of the same gestational

age. At 28 and 36 weeks gestational age, these differences were statistically significant

(both p=0.04). Six weeks postpartum, MP numbers had increased again to normal levels

(p=0.001) compared to numbers during preeclampsia, but these (postpartum) numbers were

similar to those of normotensive pregnant women. Similar to normotensive pregnancy, the

majority of MP originated from platelets (93-98%, Table 3). Again, numbers of PMP

Figure 2. The number of MP originating from

the placenta in normotensive pregnancies is

plotted against the gestational age. The X-axis

represents the gestational age in weeks and

the Y-axis the number of placenta-derived

MP. Data are presented as median with the

interquartile range (25%-75%). A significant

increase of the absolute number of placenta-

derived MP was found during pregnancy

(p=0.005), with the highest level at 36 weeks

gestational age.

Figure 2. Placenta-derived microparticles

during normotensive pregnancy


71

3

correlated with platelet counts (r=0.73,

p=0.0001). The ratio between PMP and

platelets was constant throughout

pregnancy and comparable to normotensive

pregnancy. Compared to normotensive

pregnant women, absolute PMP numbers

were significantly decreased at 28 weeks in

preeclamptic patients (p=0.03). The

fraction of erythrocyte-derived MP varied

between 1.1% and 5.3%. The absolute

number of erythrocyte-derived MP was

increased at 28 weeks (p=0.04), 32 weeks

(p=0.05) and 36 weeks (p=0.06) compared

to normotensive pregnancy, but the fraction

of such MP (Table 3) was only

significantly elevated at 28 weeks (p=0.04).

Leukocyte-derived MP, staining

for CD4, CD8, CD14 and CD20 had

negligible (<0.1%) numbers in normo-

tensive pregnancy. In contrast, Thelper-cell-

derived MP were detectable (but not

significantly elevated) in preeclamptic

patients at 28 and 32 weeks gestational age

(Table 3). Tsuppressor-cell-derived MP were

present only at 28 weeks (p=0.02).

Monocyte-derived MP were significantly

elevated in preeclampsia at 28 weeks

(p=0.007), 32 weeks (p=0.04) and 36 weeks

(p=0.03) but not postpartum. In

preeclampsia, significantly more B-cell-

derived MP (exposing CD20) were present at 36 weeks (p=0.008) compared to

normotensive pregnancies. Finally, granulocyte-derived MP were not detectable. The

fraction of endothelium-derived MP ranged between 0.5% and 1.2% of the total MP

number. Numbers of endothelium-derived MP were not elevated in preeclampsia.

During normotensive pregnancy, the percentage of placenta-derived MP was

higher (2.2-5.6%) than postpartum (0.9%). The total number of placenta-derived MP did

not change significantly during preeclampsia if measured as function of gestational age

(Figure 4).

Figure 3. The number of annexin V-

positive MP in preeclampsia is plotted

against the gestational age. Blood

collection started at admission to the

hospital mostly around 28 weeks gestation.

Each preeclamptic patient has a separate

marker because not all patients are

represented in all gestational age groups.

The median for each gestational age is

presented as a short interrupted line.

Compared to normotensive controls of the

same gestational age, there were

significant differences at both 28 and 36

weeks gestational age (p=0.04 for both).

Figure 3. The number of microparticles in

preeclampsia

Table 3. C

ellular origin of circulating microparticles in preeclamptic patients

Gestational age

12

20

24

28

32

36

pp

Tot

al M

P (10

9 /L)

- -

- 2.

3* (↓)

(1.1

-4.5

)

3.3

(1.9

-6.6

)

2.3*

(↓)

(1.2

-5.6

)

7.2

(2.6

-24.

8)

% P

late

let-de

rive

d M

P

- -

- 95

.2 (↓)

(90.

0-98

.8)

95.0

*(↓)

(92.

4-98

.4)

93.2

(82.

4-98

.9)

98.0

(87.

1-99

.2)

% E

ryth

rocy

te-d

eriv

ed M

P

- -

- 5.

3* ( ↑

)

( 1.

5-12

.3)

2.9

(↑)

(0.6

-5.8

)

4.8

(↑)

(0.7

-12.

6 )

1.1

(0.3

-12.

6 )

% T

help

er-c

ell-de

rive

d M

P

- -

- 0.

6

(0-5

.3)

0.4

(0-4

.3)

< 0

.1

(ND

)

< 0

.1

(ND

)

% M

onoc

yte-

derive

d M

P

- -

- 2.

1* (↑)

(0.9

-3.5

)

1.3*

(↑)

(0-3

.7)

1.5*

(↑)

(0.2

-3.6

)

< 0

.1

(ND

)

% B

-cel

l-de

rive

d M

P

- -

- < 0

.1

(ND

)

< 0

.1

(ND

)

0.3*

(↑)

(0-0

.8)

< 0

.1

(ND

)

% E

ndot

helial

-cel

l-de

rive

d M

P

- -

- 0.

6

(0-0

.8)

0.8

(0-3

.0)

1.2

(0.4

-4.9

)

0.5

(0-1

.1)

% P

lace

nta-

derive

d M

P

- -

- 2.

2

(1.3

-3.3

)

3.9

(1.3

-10.

0)

5.6

(1.8

-10.

3)

0.9

(0.1

-6.2

)

Table 3. MP numbers are presented as med

ian (range (m

in-m

ax)). T

he subpopulations are exp

ressed

as med

ian percentage of the

total number of MP. Percentages w

ere ca

lculated for every patien

t indep

enden

tly. Therefore, the sum of the med

ian percentages of all

subgroups appro

ach

es 100% and is not exactly 100%. pp: postpartum, AD: not detectable. Differences in the fraction of MP between

preeclamptic patien

ts and the norm

otensive w

omen

with a probability va

lue of <0.05 w

ere co

nsidered

statistically significant (*),↑:

elevated or ↓: decreased (total number or fraction of MP) co

mpared to norm

otensive pregnant women

. Granulocyte-derived

MP

were < 0.1% for all gestational ages. The percentage of Tsu

ppressor-cell-derived

MP w

as only >

0.1% at 28 w

eeks (0.3%, ra

nge 0-0.8%)

but this w

as not significantly different co

mpared to norm

otensive pregnant women

.


73

3

The highest median value was measured

at 36 weeks gestational age. Although

the percentages of placenta-derived MP

were higher than in normal pregnancy at

28, 32 and 36 weeks gestation, the

differences did not reach statistical

significance (resp. p=0.864, p=0.056,

p=0.196). However, it should be noted

that some preeclamptic patients showed

a high number of this subset of MP.

These patients did not distinguish

themselves clinically from the other

patients. The hypothesis that placenta-

derived MP are not continuously shed

into the circulation but episodically,

possibly after placental incidents like

ischemia, has been proposed before10. If

this is true, we possibly sampled some

patients during such moments. To

illustrate the presence or absence of

placenta-derived MP, examples of

representative dot plots are shown in

Figure 5. Samples of a healthy non-

pregnant woman and a male volunteer

are shown for comparison with the

samples of normotensive pregnant

women and preeclamptic patients

(Figure 5A and B). During

normotensive pregnancy, some placenta-

derived MP are detectable (5C), and

these MP disappear postpartum (5D).

Some preeclamptic patients showed a

high count of this subset of MP (5E), and after delivery the placenta-derived MP were not

detectable in the maternal circulation anymore (5F).

No correlations were found between MP (or subgroups) with systolic or diastolic

blood pressure, birth weight and proteinuria as markers of the severity of the preeclampsia

(data not shown).

Figure 4. The number of MP originating

from the placenta in pregnancies

complicated by preeclampsia is plotted

against the gestational age. The X-axis

represents the gestational age in weeks and

the Y-axis the number of placenta-derived

MP. Each preeclamptic patient has a

separate marker because not all patients are

represented in all gestational age groups.

The median for each gestational age is

presented as a short interrupted line.

Figure 4. Placenta-derived microparticles in

preeclampsia

Chapter 3

74

Figure 5. Placenta-derived microparticles in pregnancy and preeclampsia

Figure 5. Representative dot plots of a non-pregnant woman (A), a male control (B), a

normotensive pregnant woman during pregnancy (C) and postpartum (D), and a

preeclamptic patient during pregnancy (E) and postpartum (F). All dots are annexin V-

binding MP, the MP binding ED822, i.e. MP of placental origin, occur on the right site of

the fluorescent threshold (vertical line).

DISCUSSIO�

The present study shows that the number of circulating MP in the maternal venous

circulation in normotensive pregnancy is decreased at 12 weeks gestational age compared

to postpartum, and gradually increases towards the postpartum values during pregnancy.

Compared to the normotensive pregnancy, decreased numbers of circulating MP in

pregnancies complicated by preeclampsia were found, which is in line with earlier

reports14,15.

The majority of MP (>95%) originated from platelets and a positive correlation

between PMP numbers and platelet counts was present. This correlation, however, could


75

3

only partially explain the variation in numbers of PMP. Another possible explanation may

be that at least some PMP originate directly from megakaryocytes16. The PMP/platelet ratio

was comparable at all time points between normotensive pregnancy and preeclampsia.

Thus, PMP may reflect the turnover of platelets in plasma. As a consequence, the decreased

platelet counts in preeclampsia may explain the decreased number of circulating (P)MP. If

true, than the increase of MP after delivery reflects normalization and sometimes elevation

of the platelet count in the maternal blood of preeclamptic patients.

Blood cells, endothelial- and trophoblast cells are presumed to release MP upon

activation and apoptosis. However, cell lysis and fragmentation can also be involved. The

latter explains the elevated percentages of erythrocyte-derived MP in preeclampsia, because

hemolysis frequently accompanies the syndrome.

Elevated numbers of leukocyte-derived MP may reflect activation of leukocytes,

which is one of the features of preeclampsia. Especially monocytes and neutrophils become

activated, possibly during placental passage17. Circulating monocytes of preeclamptic

patients express significantly higher levels of CD11b and CD1418 and produce elevated

levels of inflammatory cytokines (IL-1β, IL-6 and IL-8)19. Although the total number of

MP was decreased in preeclampsia, absolute numbers as well as percentages of monocyte-

derived MP were elevated compared to normotensive pregnant women, which probably

reflects activation of monocytes in preeclampsia as a consequence of the systemic

inflammatory response3.

A change in numbers of leukocyte-derived MP may be involved in the

development of endothelial dysfunction in preeclampsia, since leukocyte-derived MP

produced in vitro from a T-cell line, impair acetylcholine-induced relaxation of mouse

aortic rings20. A similar decrease in relaxation was seen in rat aortic rings incubated with

the total population of circulating MP from patients with myocardial infarction21.

Furthermore, impairment of bradykinin-mediated relaxation in isolated myometrial arteries

was demonstrated for the total population of circulating MP from preeclamptic patients7.

Thus, one of the leukocyte-derived MP subpopulations may be responsible for these

described effects. Although the fraction of leukocytes-derived MP is small, we cannot

exclude that the total number of such subpopulations are higher in vivo, because such MP

are likely to adhere to the endothelium of maternal blood vessels22.

Preeclampsia is thought to be a disorder of the maternal endothelium. Endothelial

cell activation may contribute both to the inflammatory response and to vasoconstriction.

Theoretically, endothelial cell activation should be detectable by elevated levels of

endothelial-derived MP. These circulating endothelium-derived MP affect the endothelium

and possibly aggravate pre-existing endothelial dysfunction23. However, we did not find a

difference in the number of endothelial–derived MP between normotensive women and

preeclamptic patients, which is in line with our previous work4 but contradictory to other

Chapter 3

76

authors24.

Placenta-derived MP increased significantly during normotensive pregnancy. This

is not surprising because of the increase in placental volume. This rise in placenta-derived

MP was also found when measured by ELISA with NDOG2 as capture antibody10,25. In our

study, the number of placenta-derived MP was not significantly elevated in preeclampsia

compared to normotensive pregnancy. This is in contrast to other authors9,25, who reported

elevated numbers of placenta-derived MP in preeclamptic women compared to normal

pregnant women. Placenta-derived MP were not found to be increased in late onset

preeclampsia or IUGR26. The difference in results between investigators may be due to

variation in patient characteristics, study design and antibodies used to detect placenta-

derived MP. Previously, we tested ED822 for the detection of placenta-derived MP. ED822

bound to artificially-prepared placenta-derived MP, but failed to detect these MP in diluted

samples and was therefore unlikely to detect placenta-derived MP in maternal peripheral

blood4. In that study, our isolation protocol contained a washing step that was omitted from

the current (isolation) protocol. Using this new procedure, the yield of MP (sub)

populations improved significantly, which is likely to explain the improved and specific

detection of placenta-derived MP in our present study. ED822 has been described in detail

and compared to other antibodies used to detect placenta-derived MP or STBM by Knight

et al10.

In conclusion, MP numbers change during normotensive pregnancy and are

decreased in preeclampsia. In preeclampsia, circulating MP may reflect activation,

apoptosis or hemolysis from parental cells, whereas decreased numbers of circulating PMP

and increased numbers of erythrocyte MP and monocyte-derived MP may reflect decreased

platelet counts, hemolysis and activation of monocytes, respectively.

REFERE�CES




2. Nieuwland R, Sturk, A. Platelet-derived Microparticles. In: Platelets; chapter 16,

Michelson AD: Academic Press, 2002:255-62.


2005;308:1592-4.

4. VanWijk MJ, Nieuwland R, Boer K, van der Post JA, van Bavel E, Sturk A.




77

3

5. Toth B, Lok CA, Böing A, Diamant M, van der Post JA, Friese K, Nieuwland R.

Microparticles and exosomes: impact on normal and complicated pregnancy. Am J

Reprod Immunol 2007;58:389-402.



Platelets 2007;18:68-72.

7. VanWijk MJ, Svedas E, Boer K, Nieuwland R, VanBavel E, Kublickiene KR. Isolated




8. Lok CA, Boing AN, Reitsma PH, van der Post JA, van BE, Boer K, Sturk A,



2006;147:310-20.

9. Cockell AP, Learmont JG, Smárason AK, Redman CW, Sargent IL, Poston L. Human





Gynaecol 1998;105:632-40.

11. Preston RA, Jy W, Jimenez JJ, Mauro LM, Horstman LL, Valle M, Aime G, Ahn YS.

Effects of severe hypertension on endothelial and platelet microparticles. Hypertension

2003;41:211-7.

12. Contractor SF, SR Sooranna. Monoclonal antibodies to cytotrophoblast and

syncytiotrophoblast of human placenta. J Dev Physiol 1986;8:277–82.

13. Biro E, Nieuwland R, Sturk A. Measuring circulating cell-derived microparticles. J

Thromb Haemost 2004;2:1843–4.



15. Bretelle F, Sabatier F, Desprez D, Camoin L, Grunebaum L, Combes V, D' Ercole C,



restriction. Thromb Haemost 2003;89:486-92

16. Flaumenhaft R. Formation and fate of platelet microparticles. Blood Cells Mol Dis

2006;36:182-7.




Chapter 3

78

18. Holthe MR, Staff AC, Berge LN, Lyberg T. Leukocyte adhesion molecules and

reactive oxygen species in preeclampsia. Obstet Gynecol 2004;103:913-22.

19. Luppi P, Deloia JA. Monocytes of preeclamptic women spontaneously synthesize pro-

inflammatory cytokines. Clin Immunol 2006;118:268-75.

20. Martin S, Tesse A, Hugel B, Martinez MC, Morel O, Freyssinet JM, Andriantsitohaina

R. Shed membrane particles from T lymphocytes impair endothelial function and

regulate endothelial protein expression. Circulation 2004;109:1653-9.

21. Boulanger CM, Scoazec A, Ebrahimian T, Henry P, Mathieu E, Tedgui A, Mallat Z.

Circulating microparticles from patients with myocardial infarction cause endothelial

dysfunction. Circulation 2001;104:2649-52.

22. Furie B, Furie BC. Role of platelet P-selectin and microparticle PSGL-1 in thrombus

formation. Trends Mol Med 2004;10:171-8.

23. Brodsky SV, Zhang F, Nasjletti A, Goligorsky MS. Endothelium-derived

microparticles impair endothelial function in vitro. Am J Physiol Heart Circ Physiol

2004;286:H1910-5.


O’Sullivan MJ, Ahn YS. Elevated plasma endothelial microparticles: preeclampsia







onset pre-eclampsia, but not normotensive intrauterine growth restriction. Placenta

2006;27:56-61.

Chapter 4

Microparticle-associated P-selectin reflects

platelet activation in preeclampsia

C.A.R. Lok, R. Nieuwland, A. Sturk, C.M. Hau, K. Boer,

E. van Bavel, J.A.M. van der Post

Platelets 2007;18:68-72

Chapter 4

80

ABSTRACT

Introduction. Platelet activation in preeclampsia is reflected by elevated levels of platelets

exposing P-selectin. In plasma, a non-cell bound (soluble) form of P-selectin is present.

Elevated levels of this soluble form of P-selectin have been reported in preeclampsia.

Plasma P-selectin can be divided in two fractions: microparticle (MP) associated P-selectin

and non-MP associated P-selectin. In the present cross-sectional study, we investigated to

which extent plasma P-selectin is microparticle (MP) exposed and whether the fraction of

P-selectin-exposing MP is elevated in preeclamptic patients.

Methods. Preeclamptic patients (n=10) were matched with normotensive pregnant women

(n=10) and non-pregnant controls (n=10). Plasma P-selectin was measured by ELISA. MP

were isolated, double labeled with anti-CD61 (GPIIIa) and anti-CD62p (P-selectin) and

subsequently analyzed with flow cytometry.

Results. Plasma P-selectin concentration was elevated in preeclamptic patients compared to

non-pregnant controls (p=0.007), but not compared to normotensive pregnant women

(p=0.210). Plasma P-selectin is partially MP associated (3-5%). In pregnancy, the fraction

of P-selectin exposing platelet-derived (P)MP (10.9%) was increased compared to non-

pregnant controls (8%; p=0.04). This fraction further increased in preeclamptic patients

(15.4%), and significantly differed from normotensive pregnant women (p=0.02).

Conclusions. A minor fraction of plasma P-selectin is associated with PMP. The fraction of

PMP exposing P-selectin, is increased in preeclamptic patients and to a lesser extent in

normotensive pregnancy. Because MP associated P-selectin exclusively originates from

platelets, this fraction indicates platelet activation. Platelet activation is prominent in

preeclampsia and at least a part of the plasma P-selectin originates from platelets.

Microparticle-associated P-selectin in preeclampsia

81

4

I�TRODUCTIO�

Platelet activation is evident in preeclamptic patients as indicated among others by an

elevated number of platelets exposing P-selectin molecules on their surface1-3 and by

elevated levels of β-thromboglobulin in plasma4. P-selectin becomes exposed on activated

platelets due to fusion of α-granule membranes with the platelet membrane. P-selectin

promotes platelet-leukocyte interactions, leukocyte rolling on the endothelium, platelet

aggregation and monocyte activation leading to the production of tissue factor (TF)5.

Furthermore, P-selectin is directly involved in local fibrin generation and thrombus

formation6. Therefore, P-selectin might be causally involved in endothelial dysfunction

which is a predominant factor in the development of preeclampsia. Interactions between the

endothelium and circulating activated cells are likely to contribute to vascular dysfunction.

In plasma, a soluble (non-cell bound) form of P-selectin is present. Elevated levels of

plasma P-selectin have been reported in preeclamptic patients (Table 1)7-11. This plasma P-

selectin can theoretically be divided into two fractions: MP-associated P-selectin and non-

MP-associated P-selectin. MP are small (less than 1 µm) procoagulant membrane vesicles

released from blood cells or endothelial cells on activation or during apoptosis.

Table 1. Overview of P-selectin in normotensive pregnancy and preeclampsia

Author Patients (n)

(PE/PR/NP)

Measurement

Method

Result

PE1

Result

PR2

Halim,1996 10/10/ND sP-selectin ELISA ↑ ND

Konijnenberg, 1997 10/10/ND P-selectin FACS ↑ ND

Heyl, 1999 22/20/20 sP-selectin ELISA = =

Bosio, 2001 20/26/ND sP-selectin ELISA ↑ ND

Chaiworapongsa, 2002 100/55/20 sP-selectin ELISA ↑ ↑

Yoneyama, 2001 18/18/ND P-selectin FACS ↑ ND

Aksoy, 2002 28/15/20 sP-selectin ELISA ↑ ↑

Holthe, 2004 20/20/12 P-selectin FACS ↑ =

Holthe, 2004 20/20/12 sP-selectin ELISA ↑ =

Table 1. sP-selectin: soluble P-selectin in plasma (both MP associated and non-MP

associated). P-selectin: platelet membrane bound P-selectin, PE: Preeclampsia, PR:

Aormotensive pregnancy, AP: Aon-pregnant, AD: not determined, ↑: elevated, =: no

difference, 1: compared to normotensive controls, 2: compared to non-pregnant controls.

In human blood, cell-derived MP predominantly originate from platelets. Platelet-derived

MP (PMP) are indisputable related to coagulation. They promote thrombin generation in

Chapter 4

82

vitro12 and initiate thrombus formation in vivo13. Absence or reduction of MP formation

leads to hemorrhage, like in Scott syndrome14 and Castaman’s defect15. The exact role of

MP in the coagulation cascade is unknown. Although elevated levels of PMP have been

reported in patients with hypertension and acute coronary disease16, they are not increased

in preeclamptic patients18. Yet, there is evidence that MP are responsible for the impairment

of endothelial function in preeclampsia19. MP associated P-selectin could contribute to the

damaging action of MP in preeclampsia. It is unknown to which extent plasma P-selectin is

associated with PMP in preeclamptic patients and controls.

Therefore, we investigated (A) the fraction of MP associated P-selectin in plasma

in preeclamptic patients, healthy normotensive pregnant women and non-pregnant controls,

(B) the numbers of P-selectin-exposing PMP in these patients and (C) the relation between

MP from preeclamptic patients and coagulation, reflected by the levels of the prothrombin

fragment F1+2.

MATERIALS A�D METHODS

Patients

The study was approved by the medical ethical committee of the Academic Medical Center.

After obtaining written informed consent, blood samples were obtained from preeclamptic

patients (n=10), normotensive pregnant women (n=10) and non-pregnant controls (n=10).

The women were matched for age (± five years) and parity. The preeclamptic patients and

normotensive pregnant women were also matched for gestational age (± two weeks).

Inclusion criteria for preeclampsia were based on the definition of the International Society

for the Studies of Hypertension in Pregnancy (ISSHP)20: (1) diastolic blood pressure of 110

mm Hg or more on any occasion or 90 mm Hg or more on two separate occasions at least

four hours apart, (2) proteinuria of at least 0.3 gram protein / 24 hours and (3) symptoms

developing after 20 weeks gestational age in a previously and subsequently normotensive

women.

Blood from preeclamptic patients was sampled on the first day of admission to the

Department of Obstetrics. Patients with diabetes, preexistent hypertension, vascular disease

or other co-morbidity were excluded. Patients using medication other than antihypertensive

treatment, and patients with only gestational hypertension or intra-uterine growth

retardation were also excluded. The control groups consisted of healthy women not using

any medication including oral contraceptives.


83

4


Two blood samples were taken from the antecubital vein without tourniquet through a 20-

gauge needle with a vacutainer system. The first sample was collected into a 4.5 mL tube

containing 0.105 M buffered sodium citrate (Becton Dickinson; San Jose, CA). Within 30



liquid nitrogen to preserve MP structure and then stored at –80 °C until further analysis.

The second sample was collected in a 4.5 mL tube containing ethylenediaminetetraacetic

acid (EDTA; Becton Dickinson; San Jose, CA) for determination of the total number of

platelets.

Reagents and assays

Fluorescein isothiocyanate (FITC)-labeled IgG1 and phycoerythrin (PE)-labeled IgG1 were

obtained from Becton Dickinson (San Jose, CA), anti-CD61-FITC from Pharmingen (San

Jose, CA) and anti-CD62p-PE from Immuno Quality Products (Groningen, The

Netherlands). Finally, allophycocyanin (APC)-conjugated annexin V was purchased from

Caltag (Burlingame, CA). The following final dilutions of antibodies were used: IgG1-FITC

(1:10), IgG1-PE (1:10), anti-CD61-FITC (1:30), anti-CD62p-PE (1:10) and annexin V-APC

(1:40). Plasma concentrations of P-selectin and the prothrombin fragments F1+2 were

determined using enzyme-linked immunosorbent assays (ELISA). Assays were performed

as described by the manufacturers (Parameter human sP-Selectin Immunoassay by R&D

Systems; Minneapolis, USA and Enzygnost F1+2 by Dade-Behring Diagnostics GmbH;

Marburg, Germany). The minimal detectable concentration of sP-selectin was <0.5 ng/mL.

The intra-assay variation coefficient was 4.9-5.6% and inter-assay variation 7.9-9.9%. The

minimal detectable concentration of F1+2 was 0.04 nmol/L with an intra assay variation of

5-7.5% and an inter-assay variation of 6-13%. Platelet counts were determined with a Cell-

Dyn 4000 (Abbott Diagnostics Division; Abbott Laboratories; Hoofddorp, The

Netherlands) at the department of Clinical Chemistry (Academic Medical Center;

Amsterdam, The Netherlands).



18890 g and 20 ºC to pellet the MP. After centrifugation, 225 µL of the supernatant was

removed. The MP pellet and remaining supernatant was resuspended in 225 µL phosphate-

buffered saline with citrate (154 mmol/L NaCl, 1.4 mmol/L phosphate, 10.9 mmol/L

trisodium citrate, pH 7.4). After centrifugation for 30 minutes at 18890 g and 20 ºC, 225 µL

of the supernatant was removed again. The MP pellet was then resuspended in 75 µL PBS-

citrate.

Chapter 4

84

Flow cytometry

Monoclonal antibodies directed against glycoprotein (GP) IIIa (CD61) and P-selectin

(CD62p) were used. Five µL of the MP suspension was diluted in 35 µL CaCl2 (2.5

mmol/L)-containing PBS. Then 5 µL APC-labeled annexin V was added to all tubes plus 5

µL of the cell-specific monoclonal antibody or isotype-matched control antibodies. The

samples were then incubated in the dark for 15 minutes at room temperature. After

incubation, 900 µL of calcium-containing PBS was added to all tubes (except to the

annexin V control, to which 900 µL citrate-containing PBS was added). Samples were

analyzed for one minute in a fluorescence automated cell sorter (FACS Calibur) with

CellQuest software (Becton Dickinson; San Jose, CA). Both forward scatter (FSC) and

sideward scatter (SSC) were set at logarithmic gain. MP were identified on basis of their

size and density and on their capacity to bind annexin V. Annexin V measurements were

corrected for auto fluorescence. Labeling with cell-specific monoclonal antibodies was

corrected for identical concentrations of isotype-matched control antibodies. The number of

MP per liter plasma was calculated using the following formula: Number/L = N x (100/5) x

(955/57) x (106/250), in which A is the number of events that stained positive for both

annexin V and a cell-specific antibody, 100 (µL) is the (total) volume of the MP suspension

after isolation, from which 5 (µL) is used for labeling, 955 (µL) is the total volume of the

labeled MP suspension after dilution, from which approximately 57 (µL) is analyzed per

minute by the flowcytometer, multiplied by 106 (from µL to L) and finally, 250 (µL) was

the original volume of the plasma aliquot from which MP were isolated.



release 11.5 (SPSS Benelux BV; Gorinchem, The Netherlands). The demographic

characteristics of patients are presented as medians with the minimal and maximal value.

Data were analyzed with a Mann-Whitney U Tests. The data of the flow cytometric

analysis and ELISA were analyzed with non-parametric tests because the relatively small

size of the groups and the variation in MP numbers. Differences among three groups were

compared with Kruskall Wallis tests and differences between two groups with Mann-

Whitney U test. A probability value of <0.05 was considered statistically significant.

Correlations were calculated with a two-sided bivariate Pearson correlation test.


85

4

RESULTS


Patient characteristics are summarized in Table 2. As expected, birth weight and

gestational age at delivery were significantly lower in the preeclamptic women and both

systolic and diastolic blood pressures were significantly higher compared to normotensive

pregnant women and the non-pregnant controls.


Table 2. Data are presented as median (range). BMI: Body Mass Index, SGOT: serum

glutamate oxaloacetate transaminase, LDH: lactate dehydrogenase. P: Statistical

difference between the preeclamptic patients with the normotensive pregnant women. P*:

Statistical difference between the preeclamptic patients and non-pregnant controls.

Preeclampsia

(n = 10)

Normotensive

pregnancy

(n = 10)

Non-pregnant

controls

(n = 10)

P P*

Age (years) 30.6 (20.8-35.0) 31.5 (21.4-39.2) 30.0 (20.0-36.0) NS NS

Gestational age

At study (wks)

At delivery (wks)

29.4 (24.8-32.1)

33.9 (26.1-36.1)

29.6 (24.9-32.7)

39.0 (36.1-42.1)

-

-

NS

0.001

-

-

Blood pressure

Systolic (mmHg)

Diastolic (mmHg)

163 (140-220)

115 (95-120)

110 (100-120)

65 (60-75)

108 (95-133)

69 (65-85)

0.0001

0.0001

0.0001

0.0001

BMI (kg/m2) 25.8 (20.0-51.9) 22.2 (19.7-31.9) - NS -

Proteinuria (g/L) 3.9 (0.37-6.97) - - - -

SGOT (U/L) 33.5 (19-310) - - - -

LDH (U/L) 259 (149-912) - - - -

Parity

Primiparous

Multiparous

7

3

7

3

7

3

-

-

-

-

Birth weight (gr) 1160 (470-2090) 3515 (2490-3870) - 0.001 -

Chapter 4

86

Most patients (9/10) developed an early onset preeclampsia (<32 weeks gestation) and one

patient developed preeclampsia after 32 weeks and one day. All blood samples were

collected between 9:00 and 11:00 a.m. One of the preeclamptic women developed HELLP

(hemolyse, elevated liver enzymes, low platelets ) syndrome. Analyses were also performed

without the HELLP patient. One preeclamptic patient was excluded from the MP analysis

because MP were hardly detectable due to loss of the MP pellet during the isolation

procedure. One normotensive pregnant woman was excluded from the F1+2 analysis,

because the concentration of F1+2 was above the upper detection limit of the ELISA (>10

nmol/L).

Levels of P-selectin fractions in plasma

The concentration of P-selectin in cell-free plasma of nine non-pregnant controls fell within

the normal range stated by the manufacturer (18-40 ng/mL), as did seven normotensive

pregnant women and four preeclamptic patients (Figure 1).

The median concentration of plasma P-selectin in the preeclamptic group was 51.0 ng/mL

which differed significantly from the non-pregnant controls (22.8 ng/mL, p=0.007), but not

from the normotensive pregnant women (35.5 ng/mL, p=0.1). Three to five percent of the

plasma P-selectin could be removed by high-speed centrifugation, indicating that this

fraction is MP associated (Table 3). This percentage did not differ significantly among

groups.

Figure 1. Plasma P-selectin concentration in preeclampsia, normotensive pregnancy

and non-pregnant controls Figure 1. The concentration of

plasma P-selectin (ng/mL) for

each individual is presented. The

short continuous lines indicate

the median of each separate

group. The two dotted lines

represent the reference range as

provided by the manufacturer

(18-40 ng/mL). The median

concentrations of the pregnant

and non-pregnant control groups

fall in this range. The

concentration in the preeclamptic

group is elevated.


87

4

Table 3. Plasma fractions of P-selectin (ng/mL)

Preeclampsia

(n =10)

Normotensive

pregnancy

(n = 10)

Non-pregnant

controls

(n = 10)

P

P*

Plasma

51.0 (25.2-73.8) 35.5 (24.8-55.0) 22.8 (18.6-56.8) NS 0.007

Supernatant

(Non-MP

associated)

46.4 (23.9-67.0) 31.8 (23.2-52.6) 22.2 (17.8-53.4) NS 0.002

MP

associated 3.3 % 3.9 % 5.3 % NS NS

Table 3. Data are presented as medians (min-max). P: Statistical difference between

preeclampsia and normotensive pregnancy. P*: Statistical difference between preeclampsia

and non-pregnant controls. The microparticle (MP) associated fraction of P-selectin is

presented as percentage of the plasma concentration of P-selectin. It is calculated for each

separate sample by subtracting the level of P-selectin in the (MP-free) supernatant from the

total P-selectin concentration in plasma. The p-value for the difference between

normotensive pregnancy and non-pregnant controls is for plasma and supernatant

respectively 0.03 and 0.02.

Platelets and MP

Whole blood platelet counts (Table 4) were significantly lower in the preeclamptic group

compared to normotensive pregnant women and non-pregnant controls. Only one patient

developed HELLP syndrome, but after excluding this patient, the number of platelets was

still significantly lower in the preeclamptic group. The majority of MP (85-98%) stained for

CD61, indicating that they originated from platelets. The numbers of MP and PMP were

comparable between the control groups, but reduced in preeclamptic patients. The ratio

between PMP counts and platelet numbers was consistent (0.02) in the three groups

studied; suggesting a direct association between the number of circulating platelets and the

number of PMP is present. Therefore, the lower number of PMP in the preeclamptic

patients most likely reflects the lower number of circulating platelets. The fraction of PMP

exposing P-selectin was increased in preeclamptic patients compared to normotensive

pregnant women (15.4% versus 10.9%; p=0.02) and compared to non-pregnant controls

(8.0%; p=0.001). These differences remained after excluding the HELLP patient. The use

of antihypertensive medication may affect the function of platelets and possibly the number

Chapter 4

88

of PMP. The median number of PMP was comparable between patients using medication

and patients not using antihypertensive medication.

Table 4. �umbers of circulating platelets and (platelet-derived) microparticles

Preeclampsia

(n = 9)

Normotensive

pregnancy

(n = 10)

Non-pregnant

controls

(n = 10)

P

P*

Platelets (*109/L) 149

(37-239)

238

(165-396)

304

(155-413)

0.003 0.02

MP (*109/L) 2.6

(1.3-7.8)

5.1

(1.5-12.8)

6.7

(2.2-16.6)

0.03 0.04

PMP (*109/L) 2.2

(0.8-7.3)

4.9

(1.4-14.9)

6.6

(1.9-15.6)

0.03 0.03

P-selectin-exposing

PMP (%)

15.4

(11.0-19.5)

10.9

(7.0-17.4)

8.0

(4.9-13.1)

0.02 0.001

Table 4. Data are presented as median (range). P: P-value of difference in medians

between preeclampsia and normotensive pregnant patients. P*: P-value of the difference in

medians between preeclampsia and non-pregnant controls. The p-value of the difference in

medians between normotensive pregnancy and non-pregnant controls was only significant

for the percentage of P-selectin exposing PMP (p=0.02). MP: microparticles. PMP:

Platelet-derived microparticles.

The percentage of P-selectin-exposing PMP in patients using medication was elevated to a

lesser extent (median 13.5%) than patients not using any medication (median 16.8%),

however, this difference was not significant. In Figure 2 the percentages of PMP exposing

P-selectin, for all individuals and the median for each group, is presented. Only in the

preeclamptic group a correlation was present between platelet numbers and P-selectin

exposing PMP while an association with total numbers of PMP was absent. No differences

were found in the mean fluorescence intensity of the P-selectin-exposing subpopulations of

PMP among groups, suggesting that the quantity of P-selectin exposed per MP was

comparable (data not shown).

Level of prothrombin fragment F1+2

Concentrations of the prothrombin fragment F1+2 of the non-pregnant controls were within

the reference range (0.4 to 1.1 nmol/L) except for one person (Figure 3). Both the

preeclamptic patients and the normotensive pregnant women had F1+2 levels higher than 1.1

nmol/L. The (median) concentration in the normotensive pregnant women was slightly


89

4

elevated (1.63 nmol/L, p=0.001) compared to non-pregnant controls. Further elevation was

found in the preeclamptic group (1.92 nmol/L, p=0.0001). No correlation was present

between F1+2 and the percentage of P-selectin-exposing PMP in the separate groups.

Furthermore, no correlations were found between F1+2, plasma P-selectin and MP numbers.

Figure 2. Percentages of P-selectin-

exposing PMP for each individual are

shown for the different groups. The short

horizontal lines show the median of each

group. The percentages in the

preeclamptic group are increased

(15.4%) compared to the pregnant

(10.9%) and non-pregnant controls

(8.0%).

Figure 3. Concentrations of F1+2

(nmol/L) for each individual are shown

for the different groups. The short

horizontal lines show the median of each

group. The two dotted lines represent the

reference range according to the

manufacturer (0.4 to 1.1 nmol/L). Only

the median concentration of the non-

pregnant group falls in this range (0.77

nmol/L). The concentrations in both the

preeclamptic and the normotensive

control group are elevated (respectively

1.92 nmol/L and 1.63 nmol/L).

Figure 3. F1+2 concentrations in plasma in preeclampsia, normotensive pregnancy

and non-pregnant controls

Figure 2. P-selectin-exposing platelet-derived microparticles in preeclampsia,

normotensive pregnancy and non-pregnant controls

Chapter 4

90

DISCUSSIO�

In the present study we demonstrate that a minor fraction of plasma P-selectin is associated

with MP. Although plasma P-selectin concentration was elevated in preeclamptic patients

compared to normotensive pregnant women, this elevation was statistically not significant.

This may be due to the relatively small number of women included.

P-selectin is present both in Weibel-Palade bodies of endothelial cells and in the

α-granules and dense bodies of platelets. Upon activation, P-selectin becomes exposed on

both cell types. This implies that P-selectin in plasma can originate from endothelial cells

and / or platelets. However, strong correlations between plasma P-selectin concentration

and platelet count21 as well as β-tromboglobulin levels5, and a lack of correlation with

endothelial activation markers22, suggest that plasma P-selectin most likely originates from

platelets. Increased levels of P-selectin in plasma from patients with platelet consumption

disorders, including preeclampsia, provide further evidence for the platelet origin of plasma

P-selectin23.

Our flow cytometry data show that all P-selectin-exposing MP double stain for

CD62p and CD61 (GPIIIa). Because it was recently demonstrated that MP originating from

human endothelial cells do not expose GPIIIa24, P-selectin-exposing MP in plasma samples

originate from platelets and therefore directly reflect platelet activation. To which extent the

non-MP associated fraction of the plasma P-selectin concentration originates from the

endothelium, however, remains to be determined.

In the present study, the overall numbers of PMP were decreased in the

preeclamptic group, probably due to the concurrent decrease in platelet numbers. Although

the number of PMP was lowest in the preeclamptic group, the fraction of PMP exposing P-

selectin was significantly elevated. Thus, subpopulations of PMP in vivo may reflect

platelet activation better than overall PMP numbers. These findings emphasize that the

composition and function of MP vary, depending on different (patho) physiological

circumstances.

Because the fraction of P-selectin-exposing PMP in preeclamptic patients did not

correlate with the prothrombin fragment F1+2, activation of the coagulation system and

platelets are not necessarily linked. This confirms that preeclampsia is a disease with a

heterogeneous pathophysiology, with platelet activation being more prominent in some

patients and coagulation activation in others.

Interactions between dysfunctional or damaged endothelium, platelets and MP are

likely to contribute to the development of preeclampsia. Recently, Vandendries et al.,

proposed a model, in which platelets adhere to damaged endothelium, become activated

and recruit tissue factor-bearing MP from the blood, leading to coagulation activation and

thrombus formation6. In their model, P-selectin plays a key role since it not only regulates


91

4

the initial interactions between leukocytes and the endothelium but also the interactions

between activated platelets and leukocytes. It is tempting to speculate that P-selectin-

exposing PMP adhere to the (damaged) endothelium in preeclamptic patients, thereby

contributing to the recruitment of leukocytes or their MP, leading to enhanced inflammation

and coagulation.

ACK�OWLEDGEME�TS We thank YungYung Ko for her technical assistance with the ELISA assays.

REFERE�CES



2004;190:1128-34.


Sturk A. Extensive platelet activation in preeclampsia compared with normal

pregnancy: enhanced expression of cell adhesion molecules. Am J Obstet Gynecol

1997;176:461-9.



2001;97:366-70.




5. Blann AD, Nadar SK, Lip GY. The adhesion molecule P-selectin and cardiovascular

disease. Eur Heart J 2003;24:2166-79.

6. Vandendries ER, Furie BC, Furie B. Role of P-selectin and PSGL-1 in coagulation

and thrombosis. Thromb Haemost 2004;92:459-66.

7. Aksoy H, Kumtepe Y, Akcay F, Yildirim AK. Correlation of P-selectin and

lipoprotein(a), and other lipid parameters in preeclampsia. Clin Exp Med 2002;2:39-

43.

8. Bosio PM, Cannon S, McKenna PJ, O'Herlihy C, Conroy R, Brady H. Plasma P-

selectin is elevated in the first trimester in women who subsequently develop pre-

eclampsia. BJOG 2001;108:709-15.

9. Halim A, Kanayama N, el Maradny E, Nakashima A, Bhuiyan AB, Khatun S, Terao

Chapter 4

92

T. Plasma P selectin (GMP-140) and glycocalicin are elevated in preeclampsia and

eclampsia: their significances. Am J Obstet Gynecol 1996;174:272-7.

10. Heyl W, Handt S, Reister F, Gehlen J, Mittermayer C, Rath W. The role of soluble

adhesion molecules in evaluating endothelial cell activation in preeclampsia. Am J


11. Chaiworapongsa T, Romero R, Yoshimatsu J, Espinoza J, Kim YM, Park K, Kalache

K, Edwin S, Bujold E, Gomez R. Soluble adhesion molecule profile in normal

pregnancy and pre-eclampsia. J Matern Fetal Neonatal Med 2002;12:19-27.

12. VanWijk MJ, Boer K, Berckmans RJ, Meijers JC, van der Post JA, Sturk A, VanBavel

E, Nieuwland. Enhanced coagulation activation in preeclampsia: the role of APC

resistance, microparticles and other plasma constituents. Thromb Haemost

2002;88:415-20.

13. Biro E, Sturk-Maquelin KN, Vogel GM, Meuleman DG, Smit MJ, Hack CE, Sturk A,

Nieuwland R. Human cell-derived microparticles promote thrombus formation in vivo

in a tissue factor-dependent manner. J Thromb Haemost 2003;1:2561-68.

14. Sims PJ, Wiedmer T, Esmon CT, Weiss HJ, Shattil SJ. Assembly of the platelet

prothrombinase complex is linked to vesiculation of the platelet plasma membrane.

Studies in Scott syndrome: an isolated defect in platelet procoagulant activity. J Biol

Chem 1989;264:17049-57.

15. Castaman G, Yu-Feng L, Battistin E, Rodeghiero F. Characterization of a novel

bleeding disorder with isolated prolonged bleeding time and deficiency of platelet

microvesicle generation. Br J Haematol 1997;96:458-63.

16. Tate DA, Bode AP, Nichols TC, Dehmer GJ. Platelet activation detected by platelet-

derived microparticles in coronary sinus blood from patients with unstable coronary

syndromes. Circulation 1992;86:3193A.




1999;101:841-3.








20. Perry IJ, Beevers DG. The definition of pre-eclampsia. BJOG 1994;101:587-91.

21. Semenov AV, Romanov YA, Loktionova SA, Tikhomirov OY, Khachikian MV,


93

4

Vasil'ev SA, Mazurov AV. Production of soluble P-selectin by platelets and

endothelial cells. Biochemistry 1999;64:1326-35.

22. Semenov AV, Kogan-Ponomarev MI, Ruda MI, Komarov AL, Panchenko EP,

Chazova IE, Mazurov AV. Soluble P-selectin - a marker of platelet activation and

vessel wall injury: increase of soluble P-selectin in plasma of patients with myocardial

infarction, massive atherosclerosis and primary pulmonary hypertension. Ter Arkh

2000;72:15-20.

23. Chong BH, Murray B, Berndt MC, Dunlop LC, Brighton T, Chesterman CN. Plasma

P-selectin is increased in thrombotic consumptive platelet disorders. Blood

1994;83:1535-41.




Chapter 5

Circulating platelet- and placenta-derived

microparticles expose Flt-1 in

preeclampsia

C.A.R. Lok, A.N. Böing, I.L. Sargent, S.R. Sooranna, J.A.M. van der Post,

R. Nieuwland, A. Sturk

provisionally accepted

Chapter 5

96

ABSTRACT

Introduction. The soluble (non-cell bound) vascular endothelial growth factor (VEGF)

receptor fms-like tyrosine kinase 1 (Flt-1) is secreted by trophoblast cells and elevated

concentrations occur in preeclampsia. By binding VEGF, Flt-1 deprives the endothelium of

this important mediator of angiogenesis and regulator of vascular tone and blood pressure.

Microparticles (MP) from preeclamptic patients affect vascular behavior and may also

expose Flt-1. Whether Flt-1 is associated with such MP is unknown. We determined

whether non-cell bound Flt-1 is associated with MP from preeclamptic patients and whether

levels of Flt-1-exposing MP are increased in preeclampsia. Furthermore, we established the

cellular origin of Flt-1-exposing MP and investigated whether full-length or truncated Flt-1

is associated with MP.

Methods. Samples were obtained from preeclamptic patients, normotensive pregnant and

non-pregnant women (each n=20). Concentrations of VEGF and non-cell bound Flt-1 were

measured by ELISA. MP were isolated and characterized by flow cytometry. Western blot

determined which form of Flt-1 is associated with MP.

Results. Non-cell bound Flt-1 was elevated in preeclampsia compared to pregnant and non-

pregnant women. A fraction of this Flt-1 (5%) was associated with MP in preeclampsia.

Flt-1-exposing MP were elevated in preeclampsia compared to normotensive pregnancy

(p=0.02), and they were predominantly of platelet and placental origin. Full-length Flt-1,

was identified in isolated MP but not in corresponding (MP-free) plasma samples.

Conclusions. Full-length Flt-1 is exclusively associated with platelet-derived and placenta-

derived MP. It is possible that the presentation of Flt-1 on the membrane of a MP might

alter its function, particularly if it acts in synergism with other vasoactive molecules

expressed alongside it on the MP.

Platelet- and placenta-derived microparticles expose Flt-1

97

5

I�TRODUCTIO�

To accommodate the vascular challenges of pregnancy, many growth factors are produced,

including vascular endothelial growth factor (VEGF). VEGF is produced by several organs

including the placenta, and plays an important role in angiogenesis, regulation of vascular

tone and blood pressure. To exert these functions, VEGF binds to one of its transmembrane

receptors, VEGFR-1 (fms-like tyrosine kinase 1 (Flt-1)) or VEGFR-2 (kinase-insert domain

region (KDR)) which are exposed by endothelial cells and other cells. The biological

activity of VEGF is -at least in part- regulated by binding to a circulating, non-cell bound

(‘soluble’) form of the Flt-1 receptor (sVEGFR-1 or sFlt-1)1. sFlt-1 is an alternatively

spliced product of the Flt-1 gene, which is released by various cell types into the blood and

elevated concentrations have been reported in placental tissue and in maternal serum in

preeclampsia2. Furthermore, this non-cell bound Flt-1 has been reported to be elevated in

plasma already before the onset of preeclampsia3.

Trophoblast cells expose Flt-1 and release non-cell bound Flt-1. These cells also

release small vesicles, so called (placenta-derived) microparticles (MP) from their outer

membrane into the circulation. Concurrently, MP are also released from maternal

leukocytes, endothelial cells and platelets. MP have been suggested to play a role in the

development of preeclampsia because they impair endothelial function in vitro4,5. In

preeclampsia, both non-cell bound Flt-1 as well as the numbers of placenta-derived MP are

increased compared to normal pregnancy2, 6. Since the concentrations of non-cell bound Flt-

1 are usually measured in cell-free plasma which contains MP, it is unclear whether the Flt-

1 that is detected is (partly) associated with and/or exposed on these circulating MP.

The aims of the present study were (I) to determine whether non-cell bound Flt-1

is associated with MP in plasma of patients with preeclampsia, (II) to evaluate whether the

numbers of Flt-1-exposing MP are increased in preeclampsia compared to normal

pregnancy, (III) to establish the cellular origin of Flt-1-exposing MP, and (IV) to determine

which forms of non-cell bound Flt-1 (full-length or truncated Flt-1) are associated with

circulating MP.

MATERIALS A�D METHODS Patients



patients (n=20), normotensive pregnant women (n=20) and non-pregnant controls (n=20).

The women were matched for maternal age (± five years) and parity. The preeclamptic

Chapter 5

98

patients and normotensive pregnant women were also matched for gestational age (± two

weeks). Preeclampsia was defined as: (1) diastolic blood pressure of 110 mmHg or more on

any occasion or 90 mmHg or more on two separate occasions at least four hours apart, (2)

proteinuria of ≥0.3 gram protein / 24 hours and (3) symptoms developing after 20 weeks

gestational age and values returning to normal within 3 months after delivery. The control

groups consisted of healthy women not using any medication.


Two blood samples (9 ml) were taken from the antecubital vein without a tourniquet

through a 20-gauge needle using a vacutainer system. The samples were collected into two

4.5 mL tubes containing 0.105 M buffered sodium citrate (Becton Dickinson; San Jose,

CA). Within 30 minutes after collection, cells were removed by centrifugation for 20

minutes at 1560 g and 20 °C. Plasma samples were then divided in 250 µL aliquots,

immediately snap frozen in liquid nitrogen to preserve MP structure and then stored at

-80 °C until further analysis.

ELISA

The concentration of both VEGF165 and (non-cell bound) sFlt-1 in MP-containing plasma

and in MP-free plasma (supernatant obtained after centrifugation of the MP-containing

plasma for 30 min at 18890 g) were determined by ELISA according to the protocol of the

manufacturer (Quantikine, R&D Systems; Abingdon, UK) in 10 patients from each group.

The intra-assay variation of the VEGF assay was 4.5-6.7%, the inter-assay variation

6.2-8.8% and the minimal detectable level 5.0 pg/mL. The intra-assay variation coefficient

of the sFlt-1 assay was 2.6-3.8% and the inter-assay variation 7.0-8.1%. The sensitivity of

the assay was 1.63-14.4 pg/mL.

Cell-specific Antibodies

Fluorescein isothiocyanate (FITC)-labeled IgG1 and phycoerythrin (PE)-labeled IgG1 and

anti-CD8-PE were obtained from Becton Dickinson (San Jose, CA). Allophycocyanin

(APC)-conjugated annexin V was purchased from Caltag (Burlingame, CA). Monoclonal

antibodies directed against endothelial cells (CD62e-FITC) and (s)Flt-1 (Flt-1-PE) were

obtained from R&D (Minneapolis, MN) and CD62e-PE from Ancell (Bayport, MN). Anti-

CD61-FITC (anti-GP-IIIa) and anti-glycophorin A-FITC were obtained from

DakoCytomation (Glostrup, Denmark). Anti-CD4-FITC was purchased from Sanquin

(Amsterdam, The Netherlands). Anti-CD66b was obtained from Immunotech (Beckman

Coulter; Mijdrecht, The Netherlands). ED822, a mouse monoclonal antibody to an

unknown antigen expressed on the apical surface of the syncytiotrophoblast was used to

detect trophoblastic cells7,8. The second antibody for the indirect labelling with ED822,


99

5

GAM(Fab)2-FITC was obtained from Dako (Glostrup, Denmark). The following final

dilutions of antibodies were used: IgG1-FITC (1:10), IgG1-PE (1:10), annexin V-APC

(1:20), anti-CD4-FITC (1:2.5), anti-CD8-PE (1:5), anti-CD61-FITC (1:30) anti-CD62e-PE

(1:20), anti-CD62e-FITC (1:5), anti-CD66b (1:20), anti-Flt-1-PE (1:15), anti-GlycoA-FITC

(1:5), ED822 (1:2.5) and GAM(Fab)2-FITC (1:20).







of the supernatant was removed again. The MP pellet was then resuspended in 75 µL PBS-

citrate.

Flow cytometry



monoclonal antibody or isotype-matched control antibodies. The samples were then



900 µL citrate-containing PBS was added). Samples were analyzed for one minute in a

flow cytometer (FACS Calibur) with CellQuest software (Becton Dickinson; San Jose,

CA). Both forward scatter (FSC) and sideward scatter (SSC) were set on logarithmic gain.

MP were identified on the basis of their size and density and on their capacity to bind

annexin V. Annexin V measurements were corrected for autofluorescence. Labeling with

cell-specific monoclonal antibodies was corrected for using identical concentrations of

isotype-matched control antibodies. Double labeling of anti-CD4-FITC, anti-CD8-PE, anti-

CD61-FITC, anti-CD62e-FITC, anti-CD66b and anti-GlycoA-FITC with anti-Flt-1-PE

were performed to investigate the origin of the Flt-1-exposing MP. Calculation of the

number of MP per liter plasma was based upon the particle count per unit time, the flow

rate of the flow cytometer, and the net dilution during sample preparation of the analyzed

MP suspension.

Double labeling of ED822 and Flt-1

Samples with high numbers of Flt-1-exposing MP were selected to investigate whether they

originated from trophoblast cells, using an indirect staining procedure. Samples with low

numbers of Flt-1-exposing MP were not investigated, since the losses due to the two

Chapter 5

100

washing steps, which were necessary to enable indirect staining of MP, result in very low

MP numbers for analysis. MP (5 µL aliquots) were incubated for 15 minutes at room

temperature in a final volume of 50 µL of PBS containing 2.5 mmol/L CaCl2 (PBS/Ca, pH

7.4) and unlabeled ED822, anti-Flt-1-PE and annexin V-APC. After incubation with the

antibody, the MP were washed with 200 µL of PBS/Ca. Then, 5 µL GAM(Fab)2-FITC was

added, and the mixtures were again incubated for 15 minutes at room temperature.

Subsequently, 300 µL of buffer was added and the MP were analyzed by flow cytometry.

Western Blotting

Because the ELISA does not discriminate between full-length Flt-1 and alternatively

spliced Flt-1, the elevated plasma levels of non-cell bound Flt-1 in preeclampsia may be

either “truly soluble” Flt-1 or transmembrane Flt-1 associated with MP. These forms can be

discriminated by Western blot analysis.

For Western blotting, the total MP population was isolated from 750 µL plasma by

centrifugation for 1 hour at 18890 g. Because of the higher volume of this plasma sample,

1 hour of centrifugation was necessary to pellet all MP. Then, 725 µL MP-free plasma

(supernatant) was removed and stored. The remaining 25 µL plasma containing the MP was

resuspended in 725 µL PBS and then centrifuged again for 1 hour at 18890 g and 20 °C.

Then, 740 µL of the supernatant was removed. The MP pellet was dissolved in reducing

sample buffer (final volume 25 µL) and 6 µL MP-free plasma was diluted with 210 µL

PBS. The diluted MP-free plasma was further diluted twofold with reducing sample buffer

(final dilution 72 times, which is the same concentration as the residual plasma in the MP

samples). The samples (10 µL) were transferred to gradient gels (4-15%) and blotted to

PVDF (both from BioRad; Hercules, CA). Membranes were blocked with 5% BSA (Sigma

Aldrich; Zwijndrecht, The Netherlands) for 1 hour. Western blots were labelled with an

antibody recognizing full-length Flt-1 as well as its truncated, non-cell bound form, in

2.5 % BSA (Abcam; Cambridge, UK). For staining, goat anti-rabbit peroxidase-labelled

was used (Dako; Glostrup, Denmark). For detection, a Lumi-light plus conjugate was used

(Roche; Indianapolis, IN). A lysate from IL-1α stimulated human umbilical vein

endothelial cells (HUVEC, 1 hour, 5 ng/mL) was used as positive control.


Data were analyzed with the Statistical Package of the Social Science software for

Windows, release 11.5 (SPSS Benelux BV; Gorinchem, The Netherlands). The

demographic characteristics of patients were normally distributed and therefore presented

as means ± SD and compared with ANOVA and Bonferroni post-hoc tests. The data from

the flow cytometric analysis and ELISA were not normally distributed and therefore

presented as medians and ranges and analyzed with Kruskal Wallis Tests for differences


101

5

among the three study groups and Mann-Whitney U Tests for comparisons between the

preeclampsia and normotensive pregnancy group or the non-pregnant controls. If the

concentration of a sample was below the detection limit of the ELISA assay, calculations

were performed with the lowest measurable concentration. A probability value of <0.05

was considered statistically significant. Correlations were calculated with a two-sided

bivariate Pearson correlation test.

RESULTS


Patient characteristics are summarized in Table 1. Age and body mass index (BMI) were

comparable between groups. As expected, birth weight and gestational age at delivery were

significantly lower in the preeclamptic women compared to normotensive pregnant women.

Both systolic and diastolic blood pressures were significantly higher in preeclampsia

compared to the control groups. The majority of women were primiparous in both the

preeclamptic and normotensive pregnant groups. In the preeclamptic group, 12 patients

used antihypertensive medication (60%) and 5 patients (25%) suffered from HELLP

(hemolysis, elevated liver enzymes, low platelets) syndrome besides preeclampsia.

Plasma concentrations of VEGF and sFlt-1

The plasma concentrations of VEGF were below the detection limit in all preeclamptic

patients (<7.8 pg/mL; Figure 1A). The concentration of VEGF was 8.1 pg/mL (range 7.8-

44.5 pg/mL) in normotensive pregnant patients and 16.7 pg/mL (range 11.1-24.4 pg/mL) in

non-pregnant women. In contrast to VEGF, the concentration of non-cell bound Flt-1 was

significantly elevated in preeclampsia (Figure 1B; 2288 pg/mL, range 1106-4763 pg/mL)

compared to normotensive pregnant women (227 pg/mL, range 153-369 pg/mL) and non-

pregnant women (31.2 pg/mL, range 31.2-65.0 pg/mL).

When the plasma was centrifuged to remove MP, about 95% of non-cell bound

Flt-1 remained in the MP-free supernatant from preeclamptic patients. Thus, about 5%

(range 0-13%) of non-cell bound Flt-1 was associated with MP in this group.

Chapter 5

102


Table 1. P: difference between preeclampsia and normotensive pregnant controls. P*:

difference between preeclampsia and non-pregnant controls. BMI: Body Mass Index.

Figure 1. Concentrations of VEGF and non-cell bound Flt-1 in plasma

Figure 1. The concentrations of (A) VEGF and (B) non-cell bound Flt-1 are shown. Each

dot represents one patient. The dotted lines represent the lower detection limit of these

assays.

Preeclampsia

(n = 20)

Normotensive

pregnancy

(n = 20)

Non-pregnant

controls

(n = 20)

P P*

Age (years) 30.0 ± 4.9 29.2 ± 3.6 29.9 ± 3.6 NS NS

Gestational age

At study (wks)

At delivery (wks)

29.4 ± 2.2

31.9 ± 3.1

30.3 ± 3.0

39.1 ± 1.8

-

-

NS

0.0001

-

-

Blood pressure

Systolic (mmHg)

Diastolic (mmHg)

159 ± 15

99 ± 9

114 ± 13

67 ± 9

113 ± 15

70 ± 9

0.0001

0.0001

0.0001

0.0001

BMI (kg/m2) 27.1 ± 6.1 23.7 ± 4.9 21.9 ± 2.1 NS NS

Proteinuria (g/L) 6.1 ± 4.7 - - - -

Parity

Primiparous

Multiparous

18

2

18

2

-

-

-

-

-

-

Birth weight (gr) 1324 ± 566 3351 ± 585 - 0.0001 -


103

5

Circulating MP expose non-cell bound Flt

Total numbers of MP were decreased in preeclampsia compared to both normotensive

pregnant women and non-pregnant controls (Figure 2A). There were no correlations

between the number of MP with either blood pressure, proteinuria or birth weight. The

majority of the MP (94-98%) originated from platelets in all groups (data not shown). The

number of endothelial cell-derived MP did not differ between groups (Figure 2B). Figure 2. Circulating microparticles in preeclampsia

Figure 2. This figure shows box-plots of the number of (A) total MP, (B) endothelial cell-

derived MP, (C) Flt-1-exposing MP and (D) the proportion of Flt-1-exposing MP.

Chapter 5

104

In contrast, the numbers of MP exposing Flt-1 were elevated in preeclamptic patients

compared to normotensive pregnant women (Figure 2C; p=0.02). Moreover, the fraction of

Flt-1-exposing MP (Figure 2D) was elevated in preeclampsia (1.36%, range 0-16%)

compared to normotensive pregnancy (0.23%, range 0-40%; p=0.001) and non-pregnant

controls (median 0.30%, range 0-4%; p=0.0001).

Further characterization of MP-associated (non-cell bound) Flt-1

Figure 3A shows placenta-derived MP exposing Flt-1. In Figure 3B a representative

Western blot of MP fractions and MP-free plasma is presented.

Figure 3. Flt-1 is associated with circulating microparticles

Figure 3. A: Dot plot of a single experiment showing the staining of isolated MP from

preeclamptic plasma labeled with either anti-Flt-1 or its negative control antibody. B:

Western blot showing lysates of MP and corresponding MP-free plasma of 2 normotensive

pregnant and 2 preeclamptic patients. MP lysates contain a 150 kDa band corresponding

full-length Flt-1. HUVEC: A culture supernatant of HUVEC used as a positive control for

the Flt-1 analyses.


105

5

Two different concentrations of HUVEC lysate were used as positive controls, showing a

single 150 kDa (full-length) form of Flt-1. Lysates from isolated MP fractions and the

corresponding MP-free plasma samples of two preeclamptic patients and two pregnant

controls are presented. All MP lysates contained detectable amounts of 150 kDa Flt-1,

suggesting that MP expose the transmembrane form of Flt-1. Since the corresponding (MP-

free) plasma samples did not contain a full-length form, this 150 kDa Flt-1 is exclusively

associated with circulating MP.

Cellular origin of MP exposing non-cell bound Flt-1

A clearly detectable population of circulating Flt-1-exposing MP was present in plasma

samples from 13 women (9 patients with preeclampsia and 4 women with a normotensive

pregnancy). To establish the cellular origin of these circulating Flt-1-exposing MP, double

labeling experiments were performed using a panel of various cell-specific antibodies. MP

originating from erythrocytes, Thelper-cells, Tsuppressor-cells, granulocytes or endothelial cells

did not stain for Flt-1.

Figure 4. The percentage of Flt-exposing platelet- and placenta-derived microparticles

Figure 4. The percentage of Flt-1-exposing PMP is presented in figure A. Each dot

represents one patient. The second graph (B) shows the Flt-1-exposing MP derived from

the placenta. The staining procedure of these placenta-derived MP with Flt-1 differs from

the procedure to stain PMP (see Methods). Therefore, the percentages presented in B

cannot be added to the percentages in A.

Chapter 5

106

The majority of the Flt-1-exposing MP (77-86%) originated from platelets (Figure 4A).

The other Flt-1 exposing MP (approximately 19% in the preeclamptic patients) double

stained with ED822, confirming their placental origin (Figure 4B). A representative

example of placenta-derived MP exposing Flt-1 in the plasma of a patient with

preeclampsia is shown in Figure 5. Although the majority of the Flt-1-exposing MP was

derived from platelets, this was only a minor fraction of all platelet-derived MP (PMP).

Nevertheless, this fraction was elevated in preeclampsia (0.7%, range 0.20-1.60%)

compared to normotensive pregnant controls (0.3%, range 0.1-0.6%; p=0.01) but not to

non-pregnant controls (0.6%, range 0.1-3.4%; p>0.05). There was no correlation between

the number of PMP and the number of Flt-1-exposing MP. In contrast, a strong correlation

was present between the total number of ED822-exposing MP and Flt-1-exposing MP

(r=0.744, p= 0.009).

Figure 5. Placenta-derived microparticles expose Flt-1

Figure 5. A representative example of placenta-derived MP exposing Flt-1 in the plasma of

a patient with preeclampsia is shown.


107

5

DISCUSSIO�

In the present study, we confirmed that the concentration of non-cell bound Flt-1 is elevated

in preeclampsia compared to normotensive pregnancies and non-pregnant controls. A

fraction of non-cell bound Flt-1 is associated with MP. Thus, at least two different forms of

non-cell bound Flt-1 concurrently occur in plasma of preeclamptic patients. First, a major

fraction of (truly) “soluble” Flt-1, and a second, minor fraction of full-length Flt-1 which is

exclusively associated with MP.

Total numbers of MP were decreased in preeclampsia probably reflecting the

decreased platelet count in preeclampsia9. Our present study shows that plasma from

preeclamptic patients contains substantial numbers of platelet-derived and placenta-derived

MP exposing Flt-1. It is tempting to speculate that the increased presence of such MP

contributes to the reported effects of MP on the endothelium. Various in vitro models of

angiogenesis have shown that serum of pregnant women induced endothelial cells to form

tube-like structures whereas serum from preeclamptic patients inhibited this formation1.

Moreover, addition of non-cell bound Flt-1 to normal serum also inhibited this tube

formation. This inhibitory action could be overcome by addition of VEGF and Placental

Growth Factor. In fact, administration of non-cell bound Flt-1 to rats mimics several of the

clinical symptoms of preeclampsia, including hypertension and glomerular endotheliosis1.

In an animal model, MP also induced various features characteristic of preeclampsia. Mice

infused with in vitro prepared (artificial) phosphatidylserine/phosphatidylcholine vesicles,

developed symptoms characteristic of preeclampsia10, and incubation of myometrial

arteries with MP from preeclamptic patients impaired bradykinin-mediated relaxation11,12.

We found that the majority of Flt-1-exposing MP originated from platelets. This is

not surprising, because PMP compose the largest subgroup of MP in both pregnant women

and preeclamptic patients. Moreover, Flt-1 has been shown to be exposed on activated

platelets enabling a feed forward of VEGF on thrombin-activated platelets13. The remaining

Flt-1-exposing MP originated from placenta. Despite the fact that these MP constitute only

a relatively small fraction of the total number of circulating MP in the maternal blood, still

significantly elevated numbers are present in plasma from preeclamptic women compared

to normal pregnancy6,14. Plasma of some patients contained substantial numbers of Flt-1

exposing MP. This variation between patients can be caused by the time of sample

collection. In our measurements, we assume that MP are continuously shed into the

circulation. However, it has been postulated that e.g. placenta-derived MP are episodically

shed into the circulation, possibly after placental incidents like ischemia6. This may also

apply to other subpopulations of MP. It also should be mentioned that MP isolated from

plasma do not reflect the entire in vivo situation, since particular subsets of MP may already

have been removed from the circulation, either by clearance or by adherence to the

Chapter 5

108

(damaged) endothelium or to other cells. Indeed, it has been shown that placenta-derived

MP can be taken up by monocytes8. Thus, the true proportion of Flt-1-exposing MP

originating from the placenta may be higher in vivo.

Perfusion of subcutaneous fat arteries with in vitro prepared placenta-derived MP

impaired the relaxation response, suggesting that such MP are indeed capable of

modulating endothelial “dysfunction”5. Taken together, these data may point to a possible

effect of MP containing Flt-1. This study is the first step to elucidate the role of differences

in particular subsets of MP in preeclampsia. Additional studies in small resistance arteries

are essential to demonstrate the functional consequences of these differences.

Non-glycosylated full-length Flt-1 has a molecular weight of 150 kDa15. The non-

cell bound (and non-MP associated) Flt-1 molecule lacks the transmembrane and

cytoplasmic regions, and has a lower molecular weight. Different molecular weights of the

truly soluble Flt-1 have been reported in the literature, depending on the origin and the

glycosylation status of the molecule. Our finding of full-length Flt-1 with a molecular

weight of 150 kDa in the MP fractions is in line with earlier reports15. To which extent the

biological activity of MP-bound Flt-1 in our study contributes to the pathophysiological

development of preeclampsia, however, remains to be determined.

In conclusion, the concentration of non-cell bound Flt-1 is significantly elevated in

plasma from preeclamptic patients. Different forms of non-cell bound Flt-1 coexist in such

plasma samples, i.e. a minor fraction of a full-length (transmembrane) form (150 kDa) that

is associated with MP, and a major fraction of truncated Flt-1, which is truly “soluble”. The

biological activities of the coexisting forms of (s) Flt-1 in preeclampsia are of great interest

and remain to be established. It is possible that the presentation of Flt-1 on the membrane of

a MP might alter its function, particularly if it acts in synergism with other vasoactive

molecules expressed alongside it on the MP.

ACK�OWLEDGEME�TS

The authors wish to thank Chi Hau and Anita Grootemaat for their technical assistance.

REFERE�CES

1. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S Libermann TA, Morgan

JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP, Karumanchi SA. Excess

placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial


109

5

dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest

2003;111:649-58.

2. McKeeman GC, Ardill JE, Caldwell CM, Hunter AJ, McClure N. Soluble vascular

endothelial growth factor receptor-1 (sFlt-1) is increased throughout gestation in

patients who have preeclampsia develop. Am J Obstet Gynecol 2004;191:1240-6.

3. Chaiworapongsa T, Romero R, Kim YM, Kim GJ, Kim MR, Espinoza J Bujold E,

Gonçalves L, Gomez R, Edwin S, Mazor M. Plasma soluble vascular endothelial

growth factor receptor-1 concentration is elevated prior to the clinical diagnosis of

pre-eclampsia. J Matern Fetal Neonatal Med 2005;17:3-18.










Gynaecol 1998;105:632-40.

7. Contractor SF, SR Sooranna. Monoclonal antibodies to cytotrophoblast and

syncytiotrophoblast of human placenta. J Dev Physiol 1986;8:277–82.






Platelets 2007;18:68-72.

10. Omatsu K, Kobayashi T, Murakami Y. Phosphatidylserine/phosphatidylcholine

microvesicles can induce preeclampsia-like changes in pregnant mice. Semin Thromb

Hemost 2005;31:314-20.

11. Tesse A, Meziani F, David E Carusio N, Kremer H, Schneider F, Andriantsitohaina R.

Microparticles from preeclamptic women induce vascular hyporeactivity in vessels







Chapter 5

110

13. Sellheim F, Holmsen H, Vassbotn, FS. Identification of functional VEGF receptors on

human platelets. FEBS letters 2002;512:107-10.

14. Goswami D, Tannetta DS, Magee LA. Excess syncytiotrophoblast microparticle

shedding is a feature of early-onset pre-eclampsia, but not normotensive

15. Banks RE, Forbes MA, Searles J Pappin D, Canas B, Rahman D, Kaufmann S,

Walters CE, Jackson A, Eves P, Linton G, Keen J, Walker JJ, Selby PJ. Evidence for

the existence of a novel pregnancy-associated soluble variant of the vascular

endothelial growth factor receptor, Flt-1. Mol Hum Reprod 1998;4:377-86.

intrauterine growth restriction. Placenta 2006;27:56-61.

111

PART III

Microparticles and inflammation

Chapter 6

Expression of inflammation-related genes

in endothelial cells is not directly affected

by microparticles from preeclamptic

patients

C.A.R. Lok, A.N. Böing, P.H. Reitsma, J.A.M. van der Post, E. van Bavel,

K. Boer, A. Sturk, R. Nieuwland

J. Lab. Clin. Med. 2006;147:310-20

Chapter 6

114

ABSTRACT

Introduction. Inflammation and endothelial dysfunction are prominent in preeclampsia.

Microparticles (MP) may link these processes, as MP induce the production of pro-

inflammatory cytokines by endothelial cells and cause endothelial dysfunction. Aim: To

study changes in expression of inflammation-related genes in human endothelial cells in

response to MP from preeclamptic patients.

Methods. Human umbilical vein endothelial cells (HUVEC) were incubated for various

time intervals in the absence or presence of isolated MP fractions from preeclamptic

patients (n=3), normotensive pregnant women (n=3), non-pregnant controls (n=3) and

interleukin (IL)-1α as a positive control. Total RNA was isolated and used for Multiplex

Ligation-dependent Probe Amplification (MLPA) and real-time PCR.

Results. IL-1α enhanced the expression of IL-1α, IL-2, IL-6, IL-8, nuclear factor of kappa

light chain enhancer in B-cells (NFκB)-1, NFκB-2, NFκB-inhibitor, cyclin dependent

kinase inhibitor and monocyte chemotactic protein-1 and transiently increased tissue factor

expression. RNA expression of inflammation-related genes and genes encoding adhesion

receptors, however, were unaffected by any of the MP fractions tested.

Conclusions. MLPA is a suitable assay to test the inflammatory status of endothelial cells,

since incubation with IL-1α triggered substantial changes in RNA expression in endothelial

cells. Taken together, it seems unlikely that MP from preeclamptic patients induce

endothelial dysfunction by directly affecting the expression of inflammation-related genes

in these cells.

Microparticles and endothelial gene expression

115

6

I�TRODUCTIO�

Inflammation and endothelial dysfunction are both prominent in the development of

preeclampsia1. The activated endothelium plays a pivotal role by the production of

inflammatory mediators such as cell-adhesion receptors, growth factors, cytokines and

mediators that influence the vascular tone. However, the factors that initiate this

inflammatory response are still unknown.

Microparticles (MP), small membrane vesicles released from activated or

apoptotic blood- or endothelial cells, modulate endothelial cell function since MP from

preeclamptic patients impair endothelium-mediated relaxation in isolated myometrial

arteries2. In addition, in vitro generated platelet-derived MP (PMP) trigger the production

of interleukin (IL)-1β, IL-6 and IL-8 in endothelial cells, as reflected by both elevated

mRNA and protein levels3. Leukocyte-derived MP induced the production of the pro-

inflammatory cytokines IL-6 and monocyte chemotactic protein (MCP)-1 by endothelial

cells4,5, and leukocyte MP from synovial fluid of arthritic joints triggered the production of

IL-8 and MCP-1 by fibroblast-like synoviocytes6. Elevated levels of MP from leukocytes

have been reported in preeclampsia7. Whether isolated MP fractions from preeclamptic

patients affect the expression of inflammation-related genes or genes encoding adhesion

receptors in endothelial cells is the focus of this study.

To study possible MP-induced changes in RNA expression of endothelial cells, a

novel method, Multiplex Ligation-dependent Probe Amplification (MLPA)8 was used. In

parallel experiments, the suitability of this method in endothelial cells was investigated by

measuring time-dependent changes in (m)RNA-expression of 40 different inflammation-

related genes induced by the pro-inflammatory cytokine IL-1α. Real-time PCR was used to

determine RNA expression levels of various adhesion receptors produced by endothelial

cells after incubation with MP or IL-1α

MATERIALS A�D METHODS Patients

The study was approved by the medical ethical committee of the Academic Medical Center

and was carried out according to the principles of the Declaration of Helsinki. After

obtaining written informed consent, blood samples were obtained from preeclamptic

patients (n=3), normotensive pregnant women (n=3) and non-pregnant controls (n=3). The

women were matched for maternal age (± five years) and parity. The preeclamptic patients

and normotensive pregnant women were also matched for gestational age (± two weeks).

The non–pregnant controls were healthy women not using any medication, including oral

Chapter 6

116

contraceptives. Preeclampsia was defined according to the definitions of the International

Society for the Studies of Hypertension in Pregnancy (ISSHP): (1) diastolic blood pressure

of 110 mm Hg or more on any occasion or 90 mm Hg or more on two separate occasions at

least four hours apart, (2) proteinuria of 0.3 gram protein in 24 hours developing after 20

weeks gestational age and (3) values returning to normal within 3 months after delivery.

In each group, two patients were primiparous and one patient was multiparous. As

expected, the systolic and diastolic blood pressures were significantly higher in the

preeclamptic group compared with the normotensive pregnant women and the non-pregnant

controls. The birth weight was lower in the preeclamptic group compared with the

normotensive pregnant women. No other differences existed (Table 1).


Samples were taken from the antecubital vein without a tourniquet through a 20-gauge

needle with a vacutainer system. The samples were collected into a 4.5 mL tube containing

0.105 M (3.2%) buffered sodium citrate (Becton Dickinson; San Jose, CA). Within 30



liquid nitrogen to preserve MP structure and then stored at –80 °C until further analysis.


Plasma (8 aliquots) was thawed on melting ice, pooled in two aliquots of 1 mL and

centrifuged for 60 minutes at 18890 g and 20 ºC to pellet the MP. After centrifugation, 975

µL of the supernatant was removed from each aliquot. The MP pellets (25 µL) were then

resuspended in 500 µL culture medium and 25 µL of the MP-free plasma was also diluted

in 500 µL culture medium.

Endothelial cell isolation

Umbilical cords were collected on the delivery ward at the Academic Medical Center. Only

umbilical cords from healthy pregnant women with uncomplicated singleton pregnancies

were used. Our procedures for endothelial cell isolation have been described before9. As the

addition of serum is essential for the survival of endothelial cells, MP from human serum

were removed by centrifugation. In the third passage, HUVEC were transferred to a 24-well

plate coated with gelatin. After confluence, the cells were maintained for 2-3 days until

steady state was achieved before the experiments were started.


117

6


Preeclampsia

(n = 3)

�ormotensive

pregnancy

(n = 3)

�on-

pregnant

controls

(n = 3)

P P*

Age (years) 29.1 ± 5.5 29.6 ± 5.0 25.7 ± 4.6 NS NS

Gestational age (wks) 30.2 ± 2.7 31.2 ± 1.2 NS

Blood pressure

Systolic (mmHg)

Diastolic (mmHg)

163 ± 7.6

112 ± 10.4

107 ± 5.8

65 ± 5.0

122 ± 14.9

69 ± 5.3

0.002

0.001

0.008

0.001

Body Mass Index

(kg/m2)

25.0 ± 7.5 25.0 ± 8.2 NS

Birth weight 1460 ± 370 3295 ± 572 0.02

Table 1. Data are presented as mean ± SD. AS: not significant. P: P-value of difference in

means between preeclampsia and normotensive pregnancy.P*: P-value of the difference in

means between preeclampsia and non-pregnant controls.

Incubation and R�A isolation

For the initial experiments with IL-1α to study the time-dependent changes in mRNA

expression in activated HUVEC and the suitability of the MLPA assay, culture medium of

the confluent cells was replaced by culture medium containing IL-1α (5 ng/mL, Sigma-

Alderich Chemie; Zwijndrecht, The Netherlands) or by culture medium without IL-1α

(control). Endothelial cells were incubated at 37 °C with IL-1α or culture medium alone for

0, 30, 60, 90, 120 or 240 minutes. To analyze the possible effect of endothelial cell

subcultures on RNA expression, endothelial cells from two different umbilical cords were

cultured and RNA was isolated from the first and third passage cells. All measurements

were performed in triplicate. Cells were incubated without or with IL-1α for one hour and

four hours. RNA expression was analyzed by MLPA.

For the MP-experiments, endothelial cells were incubated with 500 µL culture

medium with either isolated MP or MP-free plasma. Previously, the cellular origin of

circulating MP in preeclamptic patients was determined and showed that >95% of these MP

are derived from platelets7. IL-1α and culture medium alone were used as positive and

negative controls. After 1 hour and 4 hours incubation, culture medium was removed and

cells were detached by incubation with 500 µL trypsin. Subsequently, the cell suspensions

were mixed with 500 µL culture medium and centrifuged for 10 minutes at 20 °C and

Chapter 6

118

300 g. The supernatant was removed and total RNA was isolated from the endothelial cells

using RNeasy columns (Qiagen; Hilden, Germany), according to the protocol of the

manufacturer. Total RNA was dissolved in 30 µL RNase-free water (Qiagen; Hilden,

Germany) and stored at –20 °C until further analysis.

MLPA

MLPA (kit P009, MRC-Holland; Amsterdam, The Netherlands) was performed with RNA

in a concentration of 40-60 ng RNA/µL. With the MLPA assay 40 different genes can be

determined simultaneously using 40 different probes8. The length of a MLPA probe varies

between 130-500 bp. Each probe consists of a short oligonucleotide that contains a target-

specific sequence at the 3’ end and a longer oligonucleotide that contains a target-specific

sequence at the 5’ phosphorylated end and a stuffer sequence of a variable length to enable

the separation of the different PCR products during electrophoresis. The MLPA assay

consists of six steps, of which the first five are schematically presented in Figure 1: (1)

isolation of RNA, (2) production of single strand cDNA, (3) hybridization and (4) ligation

of different probes, (5) PCR of the ligated probes and finally (6) capillary electrophoresis.

The RNA samples were thawed and 2.5 µL of each RNA sample was used. For the reverse

transcription (RT) reaction (2), a RT-primer mix, RT-buffer and dNTP’s were added to the

200 µL PCR tubes containing the RNA samples. Samples were heated at 80 °C for 1

minute in a high-speed thermal cycler with a heated lid (Biometra Uno II; Göttingen,

Germany) and incubated for 5 minutes at 45 °C. Reverse transcriptase was diluted to 20

U/µL and 1.5 µL was added per sample. After 15 minutes incubation at 37 °C, the samples

were heated at 98 °C for 2 minutes. In the hybridization phase (3), 1.5 µL buffer (1.5 M

KCl, 1 mM EDTA, 300 mM Tris-HCl, pH 8.5) and 1.5 µL probe mix (1-4 fmol of each

short probe oligonucleotide and each long probe oligonucleotide in Tris EDTA) were added

to the samples. The samples were then heated for 1 minute at 95 °C, followed by incubation

for 16 hours at 60 °C to allow complete hybridization. The procedure was continued with

the addition of a ligase enzyme at 54 °C for 15 minutes to enable ligation (4). The samples

were heated for 5 minutes at 98 °C. Then the PCR reaction was started with 5 µl of the

MLPA product (5) with the addition of an enzyme dilution buffer, PCR primers, water and

a polymerase mix. The amplification cycle (95 °C – 60 °C – 72 °C) was repeated 32 times.

ROX-500, a fluorescent marker, was added to the PCR product. Samples were purified with

Sephadex G-50 (Sigma-Alderich Chemie; Zwijndrecht, The Netherlands) in filter plates

(mahvn4550; Millipore; Billerica, USA) and analyzed by capillary electrophoresis (6) on a

capillary sequencer (ABI 3100, Applied Biosystems; Warrington, UK). The intensity and

size of the different probes were calculated with Genescan and Genotyper software

packages (Applied Biosystems; Warrington, UK).


119

6

Figure 1. Schematic overview of the MLPA procedure

Figure 1. The MLPA assay consists of six steps, of which the first five are shown: (1)

isolation of RAA, (2) production of single strand cDAA by a RT reaction, (3) overnight

hybridization of 40 pairs of a short probe oligonucleotide (A) and a long probe

oligonucleotide (B) with the cDAA (4) ligation of different probes by a ligase enzyme and

(5) PCR of the ligated probes 32 cycles. The last step (6), capillary electrophoresis is not

shown in this figure.

In line with the manufacturers’ instruction for the application of the MLPA kit in blood

cells, β-2-microglobulin (B2M) was chosen as a reference (household) gene for this study.

In preliminary experiments (data not shown), it was confirmed that changes in B2M

expression were minimal in both control cells and in response to IL-1α. In each experiment,

the expression of the B2M gene was arbitrarily set at 1.0 (i.e. 100%), to which changes in

gene expression were compared. (Figures 2 and 3).

Chapter 6

120

Real-time LightCycler PCR

Real-time PCRs were performed on a LightCycler System according to the protocol of the

manufacturer (Roche Diagnostics; Mannheim, Germany). RT was carried out at 42 °C for

60 minutes (first strand cDNA synthesis kit, Roche Molecular Biochemicals; Mannheim,

Germany). For each PCR reaction, 2 µL of cDNA and 18 µL reaction mixture were used.

The reaction mixture contained 2.0 µL DNA Master Mix SYBR Green I (Taq DNA

polymerase, SYBR Green I dye, 10 mmol/L MgCl2 and deoxynucleoside triphosphate mix),

0.5 µL (2.5 ng) of both the forward and reverse primer, 2.4 µL 4.0 mmol/L MgCl2 and 12.6

µL aqua dest. Primers for E-selectin, ICAM-1, VCAM-1, GAPDH and TF were obtained

from Biolegio; Nijmegen, The Netherlands, primers are summarized in Table 2. For DNA

amplification, 40 cycles of denaturation (95 °C, 30 s), annealing (10 s; primer-dependent,

see Table 2) and extension (72 °C, 10 s) were performed. Water was used as a negative

control. The melting curve analysis started at 95 °C, was then decreased to 5 °C below the

annealing temperature of each primer and then increased again to 95 °C at the rate of 0.2

°C/s. Quantification analysis was performed as described by Ramakers et al 10. In each

experiment, the expression of GAPDH was set at 1.0 (i.e. 100%), to which changes in E-

selectin, ICAM-1, VCAM-1 and TF expression were compared.

Table 2. Primers used for Real-time LightCycler PCR

Sequence (5' → 3' ) BP Annealing temp

ICAM-1 forward TTCCTCACCGTGTACTGGACT 228 bp 60 °C

reverse TCCATGGTGATCTCTCCTCA

E-selectin forward TGAGCATGGAAGCCTGGTTT 227bp 60 °C

reverse AGCTTCCAGGGTTTTGGAAA

TF forward TGAAGGATGTGAAGCAGACGT 237 bp 58 °C

reverse GGCTTAGGAAAGTGTTGTTCC

VCAM-1 forward GGAATTTCTGGAGGATGCAGA 226 bp 58 °C

reverse TTGCAGCTTTGTGGATGGAT

GAPDH forward GAAGGTGAAGGTCGGAGTC 225 bp 55 °C

reverse GAAGATGGTGATGGGATTTC

Statistics


release 11.5 (SPSS Benelux BV, Gorinchem, The Netherlands). The demographic

characteristics of patients were normally distributed and therefore analyzed with a one-way


121

6

analysis of variance test (ANOVA) for differences between three groups and Bonferroni

post hoc tests. RNA expression of each gene measured with MLPA or real-time PCR was

determined as a function of time and compared with the RNA expression of the endothelial

cells incubated with culture medium alone (control). A mixed model was used to analyze

expression of individual genes as a function of incubation time (repeat measures) and

incubation condition. Data were paired because endothelial cells from the same umbilical

cord were used for incubations with either MP, MP-free plasma or controls. If the p-value

of the interaction between incubation condition and time was <0.05, the difference was

considered significant.

RESULTS

Effect of IL-1αααα on mR�A expression in HUVEC

To validate the use of MLPA in endothelial cells and the effect of the pro-inflammatory

interleukin IL-1α, experiments were performed using HUVEC from 7 umbilical cords.

Incubation with IL-1α for different time intervals up to 24 hours showed maximal

expression of all tested genes within the first 4 hours after addition of IL-1α (data not

shown). Therefore, all further experiments were performed within this time interval.

Figure 2 shows changes in expression of interleukins (panels A and B), oncogenes

and transcription factors/inhibitors (C, D), various intracellular enzymes (E, F), and

chemokines, platelet-derived growth factor-B (PDGF-B), tissue factor (TF),

thrombospondin-1 (THBS-1) and tumor-necrosis factor receptor 1 (TNF-R1) (panel G, H).

Compared to control, especially the expression of genes coding for IL-8 (panel A), NFκB-

1, NFκB-1A and NFκB-2 (panel C) and MCP-1 (panel G) increased. TF expression was

transient and maximal after 1 hour.

Results of duplicate samples of the same umbilical cord prior to incubation were

almost identical, i.e. variation in expression was less than 1% (data not shown). When gene

expression was normalized to the mean expression of a series of relatively stable genes

(B2M, BMI (B lymphoma Mo-MLV insertion region) and PARN (poly-A specific

ribonuclease) plus TNF-R1) rather than B2M alone, similar expression patterns were

observed (data not shown). RNA expression of 37 genes was comparable between the first

and third passages. In the absence of IL-1α and compared to first passage cells, only the

expression of BMI (at one hour) and CDKN-1A (cyclin dependent kinase inhibitor; at one

hour and four hours) were increased.

Chapter 6

122

Table 3. Overview of presence of inflammatory genes in HUVEC

Probes MLPA Literature RefInterleukins IL-1α + + 13, 14 IL-1β + + 13, 15 IL-1RA - + 14, 16 IL-2 + - 13, 14 IL-4(R1) - - 13, 14 IL-4(R2) - - 15, 14 IL-6 + + 13, 14 IL-8 + + 13-15 IL-10 - - 13 IL-12(p35) - - 15 IL-12(p40) + - 13 IL-13 - - 13,14 IL-15(R1) + + 13 IL-15(R2) - + 15 IL-18 - + 17*Transcription factors/oncogenes BMI + MYC + + 18,19 NFκB-1 + + 20** NFκB-1A + + 21 NFκB-2 + - 22Enzymes/Enzyme-Inhibitors CDKN-1A + + 23 GST-P1 + + 24* PARN + PDE-4B + + 25,26 PTP-1B + + 27 PTP-4A + SERP-B9 + + 28 29Other cytokines B2M + + 30*** IFNγ - - 13,14 MIF + + 31 MCP-1 + + 14,32 MCP-2 + MIP-1A - + 33* MIP-1B - - 34 PDGF-B + + 35, 36 TF + + 37, 38 THBS-1 + + 39* TNF-α - + 13 TNF-R1 + + 40 TNF-β -


123

6

Endothelial cells stimulated with IL-1α showed an increased expression of CDKN-1A after

one hour but not after four hours, and expression of MYC was elevated (at one hour). BMI,

CDKN-1A and MYC all play a role in the cell-division-cycle control system, which seems

to be affected by cell passage. Because the expression of all other genes studied was hardly

affected, we decided to perform all our experiments with third passage endothelial cells to

circumvent the complication of combining endothelial cells from various umbilical cords in

order to obtain sufficient cells for the experimental set up.

In Table 3 an overview of the MLPA data of multiple experiments is summarized.

In this table, the frequencies of detectable quantities of RNA for individual genes in either

resting or (IL-1α) activated endothelial cells are indicated. Of the 40 genes studied, 27 were

expressed in HUVEC of which 20 genes had been demonstrated previously. The expression

of BMI, PARN, PTP-4A and MCP-2 has not been described in HUVEC before. BMI is an

oncogene, expressed in lymphomas and other malignancies10,11. PARN deadenylates

mRNA’s, and PTP-4A is a tyrosine phosphatase, important for cell development, growth

and differentiation. Finally, MCP-2 is a monocyte chemotactic protein. Current findings

also implicate that human endothelial cells may produce IL-2 and IL-12, and express the

transcription factor NFκB-2, which is a member of the NFκB/Rel gene family that regulates

acute phase and immune responses. Although others reported the expression of IL-1

receptor antagonist (RA), IL-18, MIP-1A and TNF-α in endothelial cells, we could not

detect their expression. This may be due to the use of different agonists.

Table 3. All probes of the MLPA assay are listed. “+” reflects detection of the RAA of

interest in at least two samples in the MLPA (3rd column) or reported in literature (4th

column), “-“means not detectable in any sample studied (n=84) in the MLPA (3rd column)

and not detected by other authors (4th column), not even at protein level; *protein level,

**activity measurement, *** flow cytometry.

Chapter 6

124

R�A expression after incubation with MP

Endothelial cells were incubated with isolated MP fractions or MP-free plasma from

patients with preeclampsia, normotensive pregnant women or healthy controls. IL-1α was

used as positive control and culture medium as negative control. Figure 3 shows the RNA

expression of individual cytokines after incubation with these MP fractions (A, C, E, G, I)

and MP-free plasma (B, D, F, H, J) and the controls. The incubation period was 1 hour (left

side of each graph) or 4 hours (right side of each graph). The pro-inflammatory interleukins

(IL-1α, IL-6 and IL-8) were not up-regulated after incubation with MP or MP-free plasma

in any of the three groups studied (A, B). Also, genes encoding oncogenes, transcription

factors (C, D), enzymes and enzyme-inhibitors (E, F, G, H) and MCP-1, (macrophage)

migration inhibitory factor (MIF), PDGF-B, TF and THBS-1 (I, J) were unaffected by

incubation with MP or MP-free plasma. In these experiments, the results for both IL-1α and

culture medium alone were comparable to the initial experiments, illustrating that HUVEC

were viable and sensitive to activation.

Figure 2. RAA expression induced by IL-1α (A, C, E, G) and control (B, D, F, H) of

interleukins (A, B), transcription factors and oncogenes (C, D), enzymes or enzyme

inhibitors (E, F) and other cellular factors (G, H). Incubation times were 0 (white), 30, 60,

90, 120 and 240 minutes (black). Statistically significant changes in expression are marked

with *. The Y-axis displays the relative expression of each probe compared to B2M (β-2-

microglobulin).

IL: interleukin, BMI: B lymphoma Mo-MLV (murine leukemia viral oncogene homolog)

insertion region, MYC: early-response (proto-oncogene) gene myc, AFκB: nuclear factor

of kappa light chain gene enhancer in B cells, AFκB-IA: nuclear factor of kappa light chain

gene enhancer in B cells inhibitor alpha (IκB), CDKA-1A: cyclin dependent kinase

inhibitor, GST: glutathione s-transferase, PARA: poly-A specific ribonuclease, PDE:

phosphodiesterase, PTP: protein-tyrosine phosphatase, SERP: serine proteinase inhibitor

B9, MCP: monocyte chemotactic protein, MIF: (macrophage) migration inhibitory factor,

PDGF: platelet derived growth factor, TF: tissue factor, THBS: thrombospondin and TAF-

R: tumor necrosis factor-receptor.


125

6

Figure 2. R�A expression in HUVEC after incubation with IL-1αααα

Chapter 6

126

Figure 3. R�A expression in HUVEC after incubation with microparticles


127

6

Figure 3. This figure shows the RAA expression in endothelial cells after incubation with

either MP (A, C, E, G, I) or MP-free plasma (B, D, F, H, J). The bars represent from the

left to the right: preeclampsia, normotensive pregnancy, non-pregnant controls, IL-1α (positive control) and culture medium alone (negative control). The left side of each graph

shows the results of 1 hour incubation and the right side of each graph shows the results of

4 hours incubation. The Y-axis displays the relative expression of each probe compared to

B2M. Significant changes in expression are marked with *.

Real-time PCR

To validate the sensitivity of MLPA in endothelial cells and to determine RNA expression

of well-known endothelial adhesion molecules not included in the MLPA assay, real-time

PCR was performed. Incubation with IL-1α resulted in a significant increase in expression

of ICAM-1, VCAM-1, E-selectin and TF (Figure 4). Expression of these adhesion

molecules and TF was unaffected by incubation with MP or MP-free plasma from patients

with preeclampsia, normotensive pregnant women or healthy controls.

DISCUSSIO�

In preeclampsia, the number of leukocyte-derived MP is elevated compared to

normotensive pregnant women and non-pregnant controls7. In vitro prepared leukocytic MP

trigger the release of IL-6 and MCP-1 from endothelial cells4,5 and leukocytic MP isolated

from synovial fluid of arthritic patients induce the release of cytokines from synoviocytes6.

Chapter 6

128

Figure 4. R�A expression in HUVEC measured with real-time PCR

Figure 4. Real-time PCR showing RAA expression in endothelial cells of adhesion

molecules and TF. The bars represent from the left to the right: preeclampsia,

normotensive pregnancy, non-pregnant controls, Il-1α (positive control) and culture medium alone (negative control). A: results of 1 hour incubation with MP, B: 4 hours

incubation with MP, C: 1 hour incubation with plasma, D: 4 hours incubation with plasma.

The Y-axis displays the relative expression of each probe compared to GAPDH. Significant

changes in expression are marked with *.

This shows that leukocytic MP promote inflammation. Therefore, we hypothesized that MP

from preeclamptic patients may directly affect expression of inflammation-related genes in

endothelial cells.

Inflammation and endothelial dysfunction are closely associated in preeclampsia,

and isolated MP from preeclamptic patients impair endothelial-dependent vasodilatation in


129

6

isolated resistance arteries2. Dilation of blood vessels results from complex interactions

between the endothelium and the underlying smooth muscle cells. MP may either impair

dilatation by directly affecting endothelial cells, smooth muscle cells or their interaction. In

the present study, the first possibility, i.e. whether MP exert their action directly on

endothelial cells was assessed. It was demonstrated that MP from preeclamptic patients did

not affect the RNA expression of the studied genes in endothelial cells, not even with

higher numbers than in vivo. It cannot be excluded that the expression of other genes in

endothelial cells, i.e. genes not included in the MLPA, may be affected by MP. The second

option, i.e. the direct binding of circulating MP to vascular smooth muscle cells, seems

unlikely, because an intact endothelium prevents binding of MP to these cells. However, in

preeclampsia, the endothelium is damaged leading possibly to exposure of the vascular

smooth muscle cells to circulating MP. Finally, MP may affect the interaction between

endothelial- and vascular smooth muscle cells because MP modulated isolated arteries.

The MLPA assay monitors changes in RNA expression of inflammation-related

genes in human endothelial cells. This study is the first to use the MLPA for analysis of

endothelial RNA expression. IL-1α induced a significant inflammatory response in

endothelial cells. An effect of MP could not be monitored. However, it cannot be excluded

that subtle changes in gene expression induced by MP were not detected. Additional studies

will be necessary to determine if minimal changes in RNA expression in endothelial cells

can be accurately determined with MLPA. Also, it can not be excluded that MP target the

endothelium of small arterioles. However, isolating sufficient RNA from such vessels is

difficult and carries the risk of contamination by RNA from other cell types, e.g. vascular

smooth muscle cells, which complicates the interpretation of the results. We did not

investigate the effect of MP on first passage endothelial cells, because preliminary

experiments showed only minimal differences in gene expression between the first and

third passage endothelial cells. Therefore, it is unlikely that MP would affect RNA

expression of first passage cells differently.

In conclusion, the MLPA assay can be used to monitor changes in inflammation-

related genes in human endothelial cells in vitro, but a direct effect of isolated MP from

preeclamptic patients on the expression of either inflammation-related genes or genes

encoding adhesion receptors in endothelial cells could not be demonstrated.


We thank Arnold vd Spek, Hella Aberson and Chi Hau for their technical advices and

assistance.

Chapter 6

130

REFERE�CES

1. Redman CW, Sacks GP, Sargent IL. Preeclampsia: an excessive maternal

inflammatory response to pregnancy. Am J Obstet Gynecol 1999;180:499-506.





3. Nomura S, Tandon NN, Nakamura T, Cone J, Fukuhara S, Kambayashi J. High-shear-

stress-induced activation of platelets and microparticles enhances expression of cell

adhesion molecules in THP-1 and endothelial cells. Atherosclerosis 2001;158:277-87.

4. Mesri M, Altieri DC. Endothelial cell activation by leukocyte microparticles. J

Immunol 1998;161:4382-7.

5. Mesri M, Altieri DC. Leukocyte microparticles stimulate endothelial cell cytokine

release and tissue factor induction in a JNK1 signaling pathway. J Biol Chem

1999;274:23111-8.

6. Berckmans RJ, Nieuwland R, Kraan MC, Schaap MC, Pots D, Smeets TJM Sturk A,






8. Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative

quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe

amplification. Nucleic Acids Res 2002;30:e57.




10. Ramakers C, Ruijter JM, Lekanne Deprez RH, Moorman AFM. Assumption-free

analysis of quantitative real-time polymerase chain rection (PCR) data. Neuroscience

Letters 2003;339:62-6.

11. Kim JH, Yoon SY, Kim CN, Joo JH, Moon SK, Choe IS, Choe YK, Kim JW. The

Bmi-1 oncoprotein is overexpressed in human colorectal cancer and correlates with

the reduced p16INK4a/p14ARF proteins. Cancer Lett 2004;203:217-24.

12. Shah A, Unger E, Bain MD, Bruce R, Bodkin J, Ginnetti J, Wang WC, Seon B,

Stewart CC, Evans SS. Cytokine and adhesion molecule expression in primary human

endothelial cells stimulated with fever-range hyperthermia. Int J Hyperthermia

2002;18:534-51.


131

6

13. Nilsen EM, Johansen FE, Jahnsen FL, Lundin KE, Scholz T, Brandtzaeg P, Haraldsen

G. Cytokine profiles of cultured microvascular endothelial cells from the human

intestine. Gut 1998;42:635-42.

14. Krishnaswamy G, Smith JK, Mukkamala R, Hall K, Joyner W, Yerra L, Chi DS.

Multifunctional cytokine expression by human coronary endothelium and regulation

by monokines and glucocorticoids. Microvasc Res 1998;55:189-200.

15. Inoue I, Goto S, Mizotani K, Awata T, Mastunaga T, Kawai S, Nakajima T, Hokari S,

Komoda T, Katayama S. Lipophilic HMG-CoA reductase inhibitor has an anti-

inflammatory effect: reduction of MRNA levels for interleukin-1beta, interleukin-6,

cyclooxygenase-2, and p22phox by regulation of peroxisome proliferator-activated

receptor alpha (PPARalpha) in primary endothelial cells. Life Sci 2000;67:863-76.

16. Dewberry R, Holden H, Crossman D, Francis S. Interleukin-1 receptor antagonist

expression in human endothelial cells and atherosclerosis. Arterioscler Thromb Vasc

Biol 2000;20:2394-400.

17. Takeuchi M, Okura T, Mori T, Akita K, Ohta T, Ikeda M, Ikegami H, Kurimoto M.

Intracellular production of interleukin-18 in human epithelial-like cell lines is

enhanced by hyperosmotic stress in vitro. Cell Tissue Res 1999;297:467-73.

18. Chettab K, Zibara K, Belaiba SR, McGregor JL. Acute hyperglycaemia induces

changes in the transcription levels of 4 major genes in human endothelial cells:

macroarrays-based expression analysis. Thromb Haemost 2002;87:141-8.

19. Hsieh HJ, Li NQ, Frangos JA. Pulsatile and steady flow induces c-fos expression in

human endothelial cells. J Cell Physiol 1993;154:143-51.

20. Sonoki K, Iwase M, Iino K, Ichikawa K, Ohdo S, Higuchi S, Yoshinari M, Iida M.

Atherogenic role of lysophosphatidylcholine in low-density lipoprotein modified by

phospholipase A2 and in diabetic patients: protection by nitric oxide donor.

Metabolism 2003;52:308-14.

21. Wagner M, Klein CL, Kleinert H, Euchenhofer C, Forstermann U, Kirkpatrick CJ.

Heavy metal ion induction of adhesion molecules and cytokines in human endothelial

cells: the role of NF-kappaB, I kappaB-alpha and AP-1. Pathobiology 1997;65:241-

52.

22. Franzen B, Duvefelt K, Jonsson C, Engelhardt B, Ottervald J, Wickman M, Yang Y,

Schuppe-Koistinen I. Gene and protein expression profiling of human cerebral

endothelial cells activated with tumor necrosis factor-alpha. Brain Res Mol Brain Res

2003;115:130-46.

23. Kim J, Cheon IS, Won YJ, Na HJ, Kim YM, Choe J. IL-4 inhibits cell cycle

progression of human umbilical vein endothelial cells by affecting p53, p21(Waf1),

cyclin D1, and cyclin E expression. Mol Cells 2003;16:92-6.

Chapter 6

132

24. Bruneel A, Labas V, Mailloux A, Sharma S, Vinh J, Vaubourdolle M, Boudin B.

Proteomic study of human umbilical vein endothelial cells in culture. Proteomics

2003;3:714-23.

25. Favot L, Keravis T, Holl V, Le Bec A, Lugnier C. VEGF-induced HUVEC migration

and proliferation are decreased by PDE2 and PDE4 inhibitors. Thromb Haemost

2003;90:334-43.

26. Koga S, Morris S, Ogawa S, Liao H, Bilezikian JP, Chen G, Thompson WJ, Ashikaga

T, Brett J, Stern DMPinsky DJ. TNF modulates endothelial properties by decreasing

cAMP. Am J Physiol 1995;268:C1104-13.

27. Norris K, Norris F, Kono DH, Vestergaard H, Pedersen O, Theofilopoulos AN, Moller

NP. Expression of protein-tyrosine phosphatases in the major insulin target tissues.

FEBS Lett 1997;415:243-8.

28. Morikawa S, Takabe W, Mataki C, Kanke T, Itoh T, Wada Y, Izumi A, Saito Y,

Hamakubo T, Kodama T. The effect of statins on mRNA levels of genes related to

inflammation, coagulation, and vascular constriction in HUVEC. Human umbilical

vein endothelial cells. J Atheroscler Thromb 2002;9:178-83.

29. Mussoni L, Banfi C, Sironi L, Arpaia M, Tremoli E. Fluvastatin inhibits basal and

stimulated plasminogen activator inhibitor 1, but induces tissue type plasminogen

activator in cultured human endothelial cells. Thromb Haemost 2000;84:59-64.

30. Wedgwood JF, Hatam L, Bonagura VR. Effect of interferon-gamma and tumor

necrosis factor on the expression of class I and class II major histocompatibility

molecules by cultured human umbilical vein endothelial cells. Cell Immunol

1988;111:1-9.

31. Nishihira J, Koyama Y, Mizue Y. Identification of macrophage migration inhibitory

factor (MIF) in human vascular endothelial cells and its induction by

lipopolysaccharide. Cytokine 1998;10:199-205.

32. Lee YW, Hennig B, Toborek M. Redox-regulated mechanisms of IL-4-induced MCP-

1 expression in human vascular endothelial cells. Am J Physiol Heart Circ Physiol

2003;284:H185-H192.

33. Cha JK, Jeong MH, Bae HR, Han JY, Jeong SJ, Jin HJ, Lim YJ, Kim SH, Kim JW.

Activated platelets induce secretion of interleukin-1beta, monocyte chemotactic

protein-1, and macrophage inflammatory protein-1alpha and surface expression of

intercellular adhesion molecule-1 on cultured endothelial cells. J Korean Med Sci

2000;15:273-8.

34. Shukaliak JA, Dorovini-Zis K. Expression of the beta-chemokines RANTES and

MIP-1 beta by human brain microvessel endothelial cells in primary culture. J

Neuropathol Exp Neurol 2000;59:339-52.


133

6

35. Hsieh HJ, Li NQ, Frangos JA. Shear stress increases endothelial platelet-derived

growth factor mRNA levels. Am J Physiol 1991;260:H642-6.

36. Cenni E, Granchi D, Ciapetti G, Savarino L, Corradini A, Di Leo A. Cytokine

expression in vitro by cultured human endothelial cells in contact with polyethylene

terephthalate coated with pyrolytic carbon and collagen. J Biomed Mater Res

2000;15;50:483-9.

37. Grabowski EF, Carter CA, Ingelfinger JR, Tsukurov O, Conroy N, Abbott WM, Orkin

RW. Comparison of tissue factor pathway in human umbilical vein and adult

saphenous vein endothelial cells: implications for newborn hemostasis and for

laboratory models of endothelial cell function. Pediatr Res 1999;46:742-7.

38. Langer F, Morys-Wortmann C, Kusters B, Storck J. Endothelial protease-activated

receptor-2 induces tissue factor expression and von Willebrand factor release. Br J

Haematol 1999;105:542-50.

39. Bonnefoy A, Harsfalvi J, Pfliegler G, Fauvel-Lafeve F, Legrand C. The

subendothelium of the HMEC-1 cell line supports thrombus formation in the absence

of von Willebrand factor and collagen types I, III and VI. Thromb Haemost

2001;85:552-9.

40. Berger AC, Alexander HR, Wu PC, Tang G, Gnant MF, Mixon A, Turner ES, Libutti

SK. Tumour necrosis factor receptor I (p55) is upregulated on endothelial cells by

exposure to the tumour-derived cytokine endothelial monocyte- activating polypeptide

II (EMAP-II). Cytokine 2000;12:992-1000.

Chapter 7

Leukocyte activation and circulating

leukocyte-derived microparticles in

preeclampsia

C.A.R. Lok, J. Jebbink, R. Nieuwland, M.M. Faas, K. Boer,

A. Sturk, J.A.M. van der Post

submitted

Chapter 7

136

ABSTRACT

Introduction. Preeclampsia shows characteristics of an inflammatory disease including

leukocyte activation, reflected by elevated numbers of circulating leukocytes exposing

adhesion molecules and aberrant levels of soluble activation markers. Analyses of

leukocyte-derived microparticles (MP) and mRNA expression of inflammation-related

genes in maternal leukocytes may establish which subgroups of leukocytes are activated

and contribute to the development of preeclampsia.

Methods. Blood samples were obtained from preeclamptic patients, normotensive pregnant

and non-pregnant controls. Concentrations of sL-selectin and elastase were measured by

ELISA. mRNA was isolated from maternal leukocytes and expression of inflammation-

related genes determined by multiplex ligation-dependent probe amplification (MLPA). MP

were isolated by centrifugation and characterized by flow cytometry.

Results. Decreased concentrations of sL-selectin and elevated concentrations of elastase

confirmed leukocyte activation in preeclampsia and to a lesser extent in normotensive

pregnancy. Leukocytes of preeclamptic patients showed up-regulation of NFκB-1A

(nuclear factor of kappa light chain gene enhancer in B cells inhibitor or IκB) and

CDKN-1A (cyclin dependent kinase inhibitor) compared to pregnant controls. IL-1RA and

TNF-R1 were increased compared to non-pregnant controls. Monocyte-derived MP were

elevated in preeclamptic patients compared to normotensive pregnant women. Both the

numbers of Tsuppressor-cell-derived and granulocyte-derived MP were elevated compared to

non-pregnant women.

Discussion. Leukocytes are activated in preeclampsia as reflected by changed levels of

elastase and sL-selectin. A pro-inflammatory gene expression profile is not prominent in

the total population of leukocytes, though differences in mRNA expression can be detected.

Increased levels of particular subsets of leukocyte-derived MP reflect activation of their

parental cells in preeclampsia.

Leukocyte activation and microparticles in preeclampsia

137

7

I�TRODUCTIO�

Preeclampsia is a pregnancy-specific multisystem disorder, occurring in the second half of

pregnancy with an incidence in unselected populations of 2.6%1. It is a major cause of

maternal and fetal morbidity and mortality of which the exact cause remains unclear.

Preeclampsia is considered an exaggerated systemic inflammatory response to pregnancy2,

with activation of many parts of the inflammatory network, including leukocyte activation.

Indeed, signs of activation of granulocytes, monocytes and lymphocytes have been

reported.

Evidence for the activation of granulocytes in preeclampsia is based upon the

elevated expression of adhesion molecules and complement-related markers3-5, the

production of reactive oxygen species3,6 and an increase of soluble markers like elastase

and lactoferrin in the plasma of preeclamptic patients7,8. Furthermore, granulocyte counts

are elevated in preeclamptic patients compared to non-preeclamptic women9,10.

Monocytes from preeclamptic patients express significantly higher levels of cell-

surface activation markers (CD11b , CD11c and CD14) and produce more reactive oxygen

species compared to normotensive pregnant women5.

T lymphocytes are divided in Thelper-cells and Tsuppressor-cells. Thelper-cells are further

subdivided into type 1 and type 2 lymphocytes based on their cytokine production profile.

The balance between these two subtypes is of importance in pregnancy and preeclampsia.

In normotensive pregnancy, suppression of cell-mediated immunity is reflected by a

predominance of type 2 cytokines because production of the pro-inflammatory type 1

cytokines decreases11. In contrast, preeclampsia is characterized by a predominance of

Thelper1-cell immunity resulting in a more pro-inflammatory cytokine profile12,13. Also

cytotoxic T-cells and NK cells seem to demonstrate such a polarity and especially the latter

show a type 1 preference in preeclampsia11,14.

More evidence for activation of leukocytes comes from increased numbers of

circulating leukocyte-derived microparticles (MP) during preeclampsia15. MP are small

membrane vesicles, which are budded from the cell surface and released into the circulation

during apoptosis or activation of blood cells or endothelial cells. Thus, activation of

leukocytes results in the production of leukocyte-derived MP.

The production of cytokines is also indicative of the pro-inflammatory state of

leukocytes. Changes in cytokine production in preeclampsia are comparable to those found

in sepsis16,17. Sepsis can be mimicked by administration of endotoxin to healthy subjects.

Isolated leukocytes from these subjects show increased mRNA expression of Macrophage

Inflammatory Protein (MIP)-1A, MIP-1B, Interleukin (IL)-8, IL-1β, IL-1 Receptor

Antagonist (RA) and Nuclear Factor of Kappa light chain gene enhancer in B Cells

inhibitor (NFκB-1A or IκB)18. Changes in the levels of plasma proteins encoded by most of

Chapter 7

138

the above mentioned genes have been investigated previously in preeclamptic patients. The

results from these studies, however, are contradictory19-26. Therefore, in the present study

we determined the activation state of leukocytes by measuring mRNA expression of

inflammation-related genes using multiplex ligation-dependent probe amplification

(MLPA). In addition, we analyzed circulating numbers of leukocyte-derived MP and

subgroups thereof as additional putative markers of leukocyte activation, as well as

differential leukocyte counts, and plasma sL-selectin- and elastase concentrations as

markers of inflammation and leukocyte activation.

METHODS

Patients



patients (n=10), normotensive pregnant women (n=10) and non-pregnant women (n=10).

The women were matched for age (± five years) and parity. The preeclamptic patients and

normotensive pregnant women were also matched for gestational age (± two weeks).

Inclusion criteria for preeclampsia were: (1) diastolic blood pressure of 110 mmHg or more

on any occasion or 90 mmHg or more on two separate occasions at least four hours apart,

(2) proteinuria of ≥ 0.3 gram protein / 24 hours and (3) symptoms developing after 20

weeks of gestation in previously normotensive women. The control groups consisted of

healthy women not using any medication or oral contraceptives.


Three blood samples (13,5 ml) were taken from the antecubital vein without tourniquet

through a 20-gauge needle with a vacutainer system. The first sample was collected into a

4.5 mL tube containing 0.105 M buffered sodium citrate (Becton Dickinson, San Jose, CA).

Within 30 minutes after collection, cells were removed by centrifugation for 20 minutes at

1560 g and 20 °C. Plasma samples were then divided in 250 µL aliquots, immediately snap

frozen in liquid nitrogen to preserve MP structure and then stored at –80 °C until further

analysis. The second sample was collected in a 4.5 mL tube containing 0.054 mL (15%)

ethylenediaminetetraacetic acid (EDTA; Becton Dickinson; San Jose, CA) for

determination of the total number of leukocytes. The third sample was also collected in a

4.5 mL tube containing EDTA and immediately used for RNA isolation.


139

7

ELISA

Plasma concentrations of sL-selectin (sL-selectin, R&D Systems; Abingdon, United

Kingdom) and elastase (Human PMN elastase, Bender Medsystems; Vienna, Austria) were

determined using enzyme-linked immunosorbent assays (ELISA). Assays were performed

as described by the manufacturers. The minimal detectable concentration of elastase was

1.98 ng/mL. The intra-assay variation coefficient was 4.8% and inter-assay variation 5.6%.

The minimal detectable concentration of sL-selectin was <0.3 ng/mL with an intra-assay

variation of 3.7% and an inter-assay variation of 4.2%.

R�A isolation

Total RNA was isolated from peripheral whole blood using RNeasy columns (Qiagen;

Hilden, Germany), according to the protocol of the manufacturer. Total RNA was dissolved

in 30 µL RNase-free water (Qiagen; Hilden, Germany) and stored at –20 °C until further

analysis.

MLPA

Multiplex Ligation-dependent Probe Amplification (MLPA) is an established technique

used for the detection of chromosomal abnormalities but can also be applied to study

inflammation-related gene-expression. MLPA data proved to correlate well with other

established techniques such as quantative RT-PCR and microarray27.

MLPA (kit P009, MRC-Holland; Amsterdam, The Netherlands) was performed

with total RNA in a concentration of 40-60 ng RNA/µL. With this MLPA assay 40

different genes can be determined simultaneously using 40 different probes. The MLPA

procedure has been described by us before28. In short, after isolation of RNA, single

stranded cDNA is produced with a RT reaction in a high-speed thermal cycler with a heated

lid (Biometra Uno II; Goettingen, Germany). After addition of 1.5 µL buffer (1.5 M KCl, 1

mM EDTA, 300 mM Tris-HCl, pH 8.5) and 1.5 µL probe mix (1-4 fmol of each short

probe oligonucleotide and each long probe oligonucleotide in Tris EDTA) hybridization

was allowed for 16 hours. The procedure was continued with the addition of a ligase

enzyme enabling ligation of different probes. Then amplification of the ligated probes was

performed with 32 cycles of a polymerase chain reaction (PCR). The PCR-product was

stained with ROX-500. Samples were purified with Sephadex G-50 (Sigma-Alderich

Chemie; Zwijndrecht, The Netherlands) in filter plates (mahvn4550, Millipore; Billerica,

USA) and analyzed by capillary electrophoresis on a capillary sequencer (ABI 3100,

Applied Biosystems; Warrington, UK). The intensity and size of the different probes were

calculated with Genescan and Genotyper software packages (Applied Biosystems;

Warrington, UK). β-2-microglobulin (B2M) was chosen as a reference (household) gene.

Chapter 7

140

Reagents and assays

Antibodies and dilution

Fluorescein isothiocyanate (FITC)-labeled IgG1 and phycoerythrin (PE)-labeled IgG1 and

monoclonal antibodies directed against Tsuppressor-cells (anti-CD8-PE), monocytes (anti-

CD14-PE) and B-cells (anti-CD20-FITC) were obtained from Becton Dickinson (San Jose,

CA). To detect Thelper-cells and granulocytes, anti-CD4-FITC and anti-CD66e-FITC were

purchased from the Central Laboratory of Blood Transfusion (Amsterdam, The

Netherlands). Anti-CD61-FITC (anti-GP-IIIa) was obtained from Pharmingen (San Jose,

CA). Allophycocyanin (APC)-conjugated annexin V was purchased from Caltag

(Burlingame, CA). The following final dilutions of antibodies were used: IgG1-FITC

(1:10), IgG1-PE (1:10), anti-CD4-FITC (1:2.5), anti-CD8-PE (1:5), anti-CD14-PE (1:20),

anti-CD20-FITC (1:10), anti-CD61-FITC (1:30), anti-CD66e-FITC (1:10) and annexin V-

APC (1:40).

Leukocyte counts

Leukocyte counts were determined with a Cell-Dyn 4000 (Abbott Diagnostics Division,

Abbott Laboratories; Hoofddorp, The Netherlands) at the department of Clinical Chemistry

(Academic Medical Center; Amsterdam, The Netherlands).







of the supernatant was removed again. The MP pellet was then resuspended after addition

of 75 µL PBS-citrate.

Flow cytometry



monoclonal antibody or isotype-matched control antibody. The samples were then



900 µL citrate-containing PBS was added). Samples were analyzed for one minute in a

fluorescence automated cell sorter (FACS Calibur) with CellQuest software (Becton

Dickinson; San Jose, CA). Both forward scatter (FSC) and sideward scatter (SSC) were set


141

7

at a logarithmic gain. MP were identified on basis of their size and density and on their

capacity to bind annexin V. Annexin V measurements were corrected for auto-fluorescence.

Labeling with cell-specific monoclonal antibodies was corrected for identical

concentrations of isotype-matched control antibodies. The number of MP per liter plasma

was calculated using the following formula: Number/L = N x (100/5) x (955/57) x

(106/250), in which A is the number of events that stained positive for both annexin V and a

cell-specific antibody, 100 (µL) is the (total) volume of the MP suspension after isolation,

from which 5 (µL) is used for labeling, 955 (µL) is the total volume of the labeled MP

suspension after dilution, from which approximately 57 (µL) is analyzed per minute by the

flow cytometer, multiplied by 106 (from µL to L) and finally, 250 (µL) was the original

volume of the plasma aliquot from which MP were isolated.

Statistical analysis Data were analyzed with Statistical Package of the Social Science software for Windows,

release 11.5 (SPSS Benelux BV; Gorinchem, The Netherlands). The demographic

characteristics of patients are presented as means with standard deviations. The three study

groups are compared with ANOVA and Bonferroni post-hoc tests. These tests were also

used for the MLPA data. Data of the ELISA and flowcytometry were not normally

distributed and therefore analyzed with Kruskall Wallis tests for differences among three

groups and Mann-Whitney U test’s for differences between two groups. The presence

(independent of the extent of expression) of mRNA expression of the different genes was

compared with Chi-square tests. Correlations were analyzed with a Pearsons bivariate two-

sided test. Probability values of <0.05 were considered statistically significant.

RESULTS


Patient characteristics are presented in Table 1. Preeclamptic patients were older and had a

higher body mass index (BMI) compared to normotensive women and non-pregnant

controls. As by definition, the systolic blood pressure and diastolic blood pressure were

significantly elevated in preeclamptic patients compared to both control groups. In contrast,

birth weight and gestational age at delivery were significantly decreased in the preeclamptic

women compared to normotensive pregnant women.

Chapter 7

142


Characteristics Preeclampsia

(n=10)

�ormotensive

pregnancy

(n=10)

�on-pregnant

women

(n=10)

P P*

Age (years) 33.1 ± 3.4 30.5 ± 1.6 30.3 ± 1.6 NS 0.04

BMI 26.5 ± 5.2 21.4 ± 1.1 21.9 ± 2.1 0.006 0.02

Blood pressure

Systolic

Diastolic

164 ± 16

96 ± 8

122 ± 9

73 ± 8

108 ± 14

68 ±10

0.0001

0.0001

0.0001

0.0001

Proteinuria 7.1 ± 5.5 - - - -

Gestational age

At sampling

At delivery

28.9 ± 1.9

31.3 ± 3.4

30.2 ± 3.2

39.1 ± 1.6

-

-

NS

0.0001

-

-

Birth weight 1267 ± 648 3262 ± 607 - 0.0001 -

Table 1. All patients were nulliparous and matched for age (± 5 years). Preeclamptic

patients and normotensive pregnant women were also matched for gestational age (± 2 weeks). Data are presented as mean ± SD. P: statistical difference between preeclamptic

patients and normotensive controls. P*: statistical difference between preeclamptic patients

and non-pregnant controls.

General markers of leukocyte activation in pregnancy and preeclampsia

Aumbers of circulating leukocytes

As a general marker of inflammation, we determined the total number of leukocytes in

maternal blood. Their number was elevated in normotensive pregnant women (9.4*106/L)

compared to non-pregnant controls (6.0*106/L, p=0.026). This number was even higher in

the preeclamptic patients (12.8*106/L, p=0.004 and p=0.08 compared to non-pregnant

controls and pregnant women, respectively). This is due to an increase in the number of

(neutrophilic) granulocytes, which were significantly elevated in both preeclampsia and

normotensive pregnancy compared to non-pregnant women (both p=0.001). The absolute

numbers of leukocyte subgroups did not differ between normotensive pregnant and

preeclamptic women. The percentages of granulocytes, monocytes and lymphocytes are

shown in Figure 1.


143

7

Figure 1. Leukocyte counts

Figure 1. The percentages of the different leukocyte subpopulations are shown for

preeclamptic patients, normotensive pregnant women and non-pregnant controls.

Figure 2. Concentration of sL-selectin

Figure 2. The concentration of

sL-selectin in preeclamptic

patients, normotensive

pregnant women and non-

pregnant controls is presented.

Every dot represents one

patient. The short interrupted

lines represent the median

value of each group.

Chapter 7

144

Levels of sL-selectin in maternal plasma

A widely accepted marker of leukocyte activation is sL-selectin. The median concentration

of sL-selectin in cell-free citrated plasma of the preeclamptic patients was 449 ng/mL

(range 397-659 ng/mL; Figure 2). This concentration was significantly decreased

compared to both normotensive pregnant women (575 ng/mL, range 480-756 ng/mL),

p=0.015) and the non-pregnant controls (770 ng/mL, range 629-979 ng/mL, p=0.001).

Leukocyte mRAA expression

Of the 40 inflammation-related genes studied by MLPA, 23 genes were expressed in total

circulating leukocytes in >50% of the preeclamptic patients, normotensive pregnant women

and non-pregnant controls (Table 2). The overall expression pattern of these genes,

however, did not differ between groups. In preeclampsia, two genes were up-regulated

compared to normotensive pregnancy (Figure 3): NFκB-1A (p=0.004) and CDKN-1A

(cyclin dependent kinase inhibitor, p=0.02) and three genes showed an elevated expression

compared to non-pregnant controls: NFκB-1A (p=0.001), IL-1RA, (p=0.003), TNF-R1

(p=0.004), whereas the expression of GST-P1 was decreased (p=0.002). The expression of

IL-1RA, TNF-R1 and GST-P1 did not differ between the patients with preeclampsia and

normotensive pregnant controls (p=0.76, p=0.33 and p=0.76 respectively).

Table 2. All probes of the MLPA assay are listed in the second column. Values are relative peak

areas compared to B2M. Some genes are not regularly detected (<50% of the samples). The results of

the preeclamptic patients are presented in the third column, of the normotensive pregnant patients in

the fourth column and of the non-pregnant controls in the fifth column. IL: interleukin, BMI: B

lymphoma Mo-MLV (murine leukemia viral oncogene homolog) insertion region, MYC: early-

response (proto-oncogene) gene myc, AFκB: nuclear factor of kappa light chain gene enhancer in B

cells, AFκB-IA: nuclear factor of kappa light chain gene enhancer in B cells inhibitor alpha (IκB),

CDKA-1A: cyclin dependent kinase inhibitor, GST: glutathione s-transferase, PARA: poly-A specific

ribonuclease, PDE: phosphodiesterase, PTP: protein-tyrosine phosphatase, SERP: serine proteinase

inhibitor B9, B2M: beta-2- microglobulin, IFA: interferon, MIF: (macrophage) migration inhibitory

factor, MCP: monocyte chemotactic protein, MIP: macrophage inflammatory protein, PDGF:

platelet derived growth factor, TF: tissue factor, THBS: thrombospondin, TAF: tumor necrosis factor

and TAF-R: TAF-receptor. * significant difference with pregnant or non-pregnant controls.


145

7

Table 2. Overview of presence of inflammatory genes in leukocytes

Genes Preeclampsia �ormotensive pregnancy

�on-pregnant women

Reference gene B2M 1 1 1 Interleukins IL-1α - - -

IL-1β 0.24 0.27* 0.16 IL-1RA 0.45* 0.40* 0.27 IL-2 - - - IL-4(R1) - - - IL-4(R2) - - - IL-6 - - - IL-8 0.19 0.14 0.21 IL-10 - - - IL-12(p35) - - - IL-12(p40) - - - IL-13 - - - IL-15(R1) 0.03 0.03 0.03 IL-15(R2) - - - IL-18 - - - Transcription BMI 0.06 0.05* 0.08 factors/oncogenes MYC 0.30 0.22* 0.31 NFκB-1 0.29 0.29 0.26 NFκB-1A 0.45* 0.30 0.27 NFκB-2 0.07 0.08 0.08 Enzymes/Enzyme- CDKN-1A 0.09* 0.07 0.09 Inhibitors GST-P1 0.03* 0.03* 0.05 PARN 0.10 0.10* 0.14 PDE-4B 0.31 0.25 0.25 PTP-1B 0.07 0.07 0.08 PTP-4A 0.80 0.78 0.83 SERP-B9 0.24 0.20 0.25 Other cytokines IFNγ - - - MIF 0.18 0.15* 0.20 MCP-1 - - - MCP-2 - - - MIP-1A 0.03 0.02 0.03 MIP-1B 0.09 0.05* 0.09 PDGF-B - - 0.02 TF - - - THBS-1 0.06 0.07 0.08 TNF-α 0.03 0.03 0.04 TNF-R1 0.48* 0.51* 0.36 TNF-β 0.04 0.03 0.04

Chapter 7

146

Nine genes differed in the extent of mRNA expression between normotensive pregnant

women and non-pregnant controls. Three genes were up-regulated: IL-1β (p=0.01), IL-1RA

(p=0.002) and TNF-R1 (tumor necrosis factor-receptor 1, p=0.001), and six genes were

down-regulated: MYC (early-response (proto-oncogene) gene myc, p=0.008), MIP-1B

(p=0.005), PARN (poly-A specific ribonuclease, p=0.005), BMI-1 (B lymphoma Mo-MLV

(murine leukemia viral oncogene homolog) insertion region 1, p=0.003), MIF (macrophage

migration inhibitory factor, p=0.001) and GST-P1 (glutathione s transferase-p1, p=0.003).

Figure 3. mR�A expression of IL-1ß, IL-1RA, T�F-R1, �FĸB-1A, CDK�-1A, and

GST-P1

Figure 3. mRAA expression of IL-1ß, IL-1RA, TAF-R1, AFĸB-1A, CDKA-1A, and GST-P1.

The relative mRAA expression compared to B2M expression of several inflammation-

related genes differentially expressed in either pregnancy, preeclampsia or both compared

to non-pregnant women.


147

7

Markers reflecting activation of leukocyte subsets in pregnancy and preeclampsia

Circulating MP

The activation status of leukocytes and subpopulations thereof was determined by

measuring numbers of circulating leukocyte-derived MP. Total numbers of MP and the

number of platelet-derived MP (PMP) were decreased in preeclampsia compared to

normotensive pregnant women (p=0.008 and p=0.004 respectively) and compared to non-

pregnant controls (p=0.001 and p=0.001 respectively, data not shown). In contrast, the total

numbers of leukocyte-derived MP were comparable between groups (Figure 4A). The level

of granulocyte-derived MP was elevated in normotensive pregnancy (p=0.022) and

preeclampsia (p=0.007) compared to non-pregnant controls and tended to be increased in

preeclampsia compared to pregnant women, but this difference did not reach statistical

significance (p=0.086, Figure 4B). MP from monocytes were elevated in preeclamptic

patients compared to normotensive pregnant women (p=0.049), but not compared to non-

pregnant women (Figure 4C). The number of B-cell-derived MP did not differ between

groups (Figure 4D) nor did the level of Thelper-cell-derived MP (Figure 4E). The number of

Tsuppressor-cell-derived MP was elevated in preeclampsia, but the difference was only

significant compared to non-pregnant women (p=0.019, Figure 4F). There was no

difference in the numbers of Tsuppressor-cell-derived MP between the pregnant and non-

pregnant controls. Both types of T-cell-derived MP correlated with the number of

lymphocytes in the maternal blood in preeclampsia (respectively r=0.678, p=0.045 and

r=0.681, p=0.044). Strikingly, the percentages of leukocyte-derived MP differed

substantially from the distribution of their parental cells. Based on the numbers of

circulating subsets of MP (Figure 5), especially lymphocytes and monocytes seem to be

activated.

Level of elastase in maternal plasma

To confirm activation of granulocytes in preeclamptic patients, we measured the plasma

levels of elastase. The concentration of elastase was significantly elevated in the

preeclamptic patients (median 59 ng/mL, range 29-96 ng/mL) compared to pregnant

women (33 ng/mL, range 26-66 ng/mL, p=0.009) and non-pregnant controls (28 ng/mL,

range 13-40, p=0.001, Figure 6).

Chapter 7

148

Figure 4. �umbers of leukocyte-derived microparticles


149

7

Figure 4. This Figure presents the total number of leukocyte-derived MP (A) and the

subgroups of leukocyte-derived MP: Granulocyte-derived MP (B), Monocyte-derived MP

(C), B-cell-derived MP(D), Thelper-cell-derived MP (E) and Tsuppressor-cell-derived MP (F).

Data are presented as medians with ranges. One outlier was excluded from the

normotensive patients in these data.

DISCUSSIO�

In the present study, we investigated with different techniques the extent of activation of

leukocytes and subgroups thereof in preeclampsia. An elevated number of leukocytes was

present in preeclampsia compared to pregnant women and non-pregnant controls. Plasma

levels of sL-selectin were decreased in pregnancy and even more in preeclampsia, and

expression of several inflammation-related genes were differentially expressed in

preeclamptic patients. Changes in numbers of circulating subsets of leukocyte-derived MP

and an elevated concentration of elastase indicated activation of particular subgroups of

leukocytes in preeclampsia. Leukocyte activation in general was confirmed by altered

concentrations of sL-selectin in preeclampsia and to a lesser extent in normotensive

pregnancy.

Chapter 7

150

Figure 5. Percentages of leukocyte-derived microparticles

Figure 5. The fraction of the different leukocyte-derived MP is shown. In contrast to the

parental cells (Figure 1), granulocyte-derived MP compose the smallest fraction of the

leukocyte-derived MP, followd by monocytes-derived MP. The largest fraction is composed

of lymphocyte-derived MP.

L-selectin is exposed on leukocytes and is proteolytically cleaved and shed from

the cell surface during activation (sL-selectin). Therefore, the concentration of sL-selectin

is increased in acute inflammatory processes29, but may be decreased in chronic

inflammatory processes30. Decreased concentrations of sL-selectin have also been reported

in other vascular diseases, including (un)stable angina and acute myocardial infarction30.

Based on our current results and those of others3,31, preeclampsia seems to be a disease

characterized by a more chronic type of inflammation.

Data describing gene-expression in circulating leukocytes from the maternal blood

to assess the activation status is limited. In the present study, an altered gene profile of

inflammation-related and cell-cycle-related genes was found in normotensive pregnancy

compared to non-pregnant controls. Nevertheless, no specific predominance of type 2 (e.g.

IL-4, IL-5, IL-6 or IL-13) cytokines was present. Also, no down-regulation of type 1 (IL-2,

IL-12, TNF-α) cytokines occurred. These results are in line with previous observations that

lymphocytes and monocytes of preeclamptic women only produce cytokines after

stimulation in vitro11,17. MRNA expression of the pro-inflammatory IL-1β gene in

leukocytes was up-regulated in pregnancy, showing that inflammation is also present in

normotensive pregnancy, and that circulating leukocytes may contribute to this

inflammation. In preeclampsia, mRNA expression of IL-1β was also elevated, but this

increase was not significant compared to non-pregnant women. Moreover, there was also

no difference between preeclamptic patients and normotensive pregnant women.


151

7

Figure 6. Plasma concentrations of elastase

Figure 6. The concentrations of elastase in plasma of preeclamptic patients, normotensive

pregnant women and non-pregnant controls are shown. Every dot represents one patient.

The short interrupted lines represent the median value of each group. The minimal

detectable level of elastase is 1.98 ng/mL.

An elevated plasma level of IL-1β in normal pregnancy but not in preeclampsia has been

reported by others21. Endothelial cells are a target for IL-1β. Its effects are modulated by

IL-1RA, which is produced by monocytes and macrophages. In the present study, IL-1RA

was up-regulated in both pregnancy and preeclampsia compared to non-pregnant controls.

Elevated plasma levels of IL-1RA in preeclampsia have been described before32. Since IL-

1RA is an inhibitor of IL-1ß33, the up-regulation of this gene may be a protective response.

Although we found no differences in expression of TNF-α between the groups,

mRNA for TNF-R1 was up-regulated in pregnancy and preeclampsia. This may suggest

that pregnant and preeclamptic women are both more sensitive to the effects of TNF-α. We

Chapter 7

152

detected up-regulation of the expression of NFκB-1A in leukocytes from preeclamptic

patients. NFκB-1A (or IκB) is an inhibitor of NFκB. NFκB is a transcription factor which

plays an important role in immunomodulation by regulating the expression of a wide

variety of genes. NFκB is present in the cytoplasma bound to NFκB-1A. After degradation

of NFκB-1A, translocation of NFκB to the nucleus occurs, resulting in pro-inflammatory

gene expression. Although up-regulation of NFκB-1A mRNA in pregnancy and

preeclampsia seems to be contradictory with the inflammatory hypothesis, also circulating

leukocytes isolated from septic patients showed a similar decreased expression18.

Furthermore, it remains uncertain to which extent changes in expression levels of the

NFκB-1A gene triggers changes in protein expression, since McCracken et al., reported

down regulation of NFκB-1A protein during pregnancy and preeclampsia34.

CDKN-1A plays a role in the cell cycle. The role of CDKN or its inhibitor in

preeclampsia has not been investigated in humans yet. Pregnant mice, however, which are

heterogeneous deficient for p57Kip2, i.e. a potent inhibitor of several cyclin/cyclin dependent

kinase complexes, display symptoms similar to preeclampsia35. Therefore, the clinical

relevance of our finding remains unclear. Finally, the expression of GST-P1 was decreased

compared to non-pregnant controls. GST plays a role in the removal of reactive oxygen

species. Since elevated concentrations of GST are present in plasma from preeclamptic

patients36, it seems unlikely that GST in plasma from preeclamptic patients originates from

circulating leukocytes.

The total number of MP was decreased in preeclampsia, probably due to a

decreased platelet count37. We also studied the presence of subsets of leukocyte-derived MP

to determine whether particular types of leukocytes become activated during preeclampsia

and contribute to the inflammatory response.

Granulocyte-derived MP were elevated compared to the non-pregnant state. These

MP are also elevated in patients suffering from multi-organ failure or sepsis compared to

healthy controls, and their numbers strongly correlated with plasma levels of elastase38.

Similarly, we confirmed this correlation in our present study. Elastase is a degranulation

product of neutrophils, and elevated concentrations have been reported in preeclampsia7,8.

Elevated levels of monocyte-derived MP were present in preeclampsia compared

to normotensive pregnancy and Tsuppressor-cell-derived MP were elevated compared to the

non-pregnant state, reflecting activation of both monocytes and Tsuppressor-cells. Whether the

different subpopulations of leukocyte-derived MP have a role in the development of

preeclampsia or merely reflect cell activation, however, remains to be elucidated. Effects of

these MP in in vitro studies have been reported previously. T-cell-derived MP impair

relaxation of mouse aortic rings in vitro39, and leukocyte-derived MP induce the production

of the pro-inflammatory cytokines IL-6 and monocyte chemotactic protein (MCP)-1 by


153

7

endothelial cells40,41. On the other hand, we found no direct effect of MP from preeclamptic

patients on RNA expression of inflammation-related genes by endothelial cells in vitro28.

Activation of leukocytes leads to production and exposure of adhesion molecules.

As a consequence, activated cells may quickly bind to other cells within the blood or to the

endothelium. To which extent this also applies to MP from such cells, is unknown.

Therefore, it can not be excluded that circulating cells and MP derived there from do not

necessarily represent the entire in vivo situation.

In conclusion, our findings confirm the occurrence of leukocyte activation in

general and of particular leukocyte subgroups in preeclampsia and to a lesser extent in

normotensive pregnancy. Changes in leukocyte-derived MP coincide with altered levels of

sL-selectin and elastase, but there is no clear pro-inflammatory mRNA expression profile

although in preeclampsia differences in mRNA expression levels of NFkB-1A, CDKN-1A,

IL-1RA, TNF-R1 and GST-were present. To which extent activated leukocytes are rapidly

removed from the blood, thereby triggering leukocyte production within the bone marrow

on the one hand and preventing the remaining cells from showing a full blown pro-

inflammatory phenotype on the other hand, remains open for discussion.


The authors are grateful to Chi M. Hau and Anita N. Böing for their assistance in the

technical work.

REFERE�CES

1. Morris RK, Cnossen JS, Khan KS, Robson SC, Kleijnen J, Ter Riet G, Mol BW, Van

der Post JAM. Serum screening with Down’s syndrome markers to predict pre-

eclampsia and fetal growth restriction: Systematic review and meta-analysis. (HTA

2008, in press, www.hta.ac.uk/***).


2005;308:1592-4.

3. Sacks GP, Studena K, Sargent K, Redman CW. Normal pregnancy and preeclampsia

both produce inflammatory changes in peripheral blood leukocytes akin to those of

sepsis. Am J Obstet Gynecol 1998;179:80-6.




Chapter 7

154

5. Holthe MR, Staff AC, Berge LN, Lyberg T. Leukocyte adhesion molecules and

reactive oxygen species in preeclampsia. Obstet Gynecol 2004;103:913-22.

6. Tsukimori K, Nakano H, Wake N. Difference in neutrophil superoxide generation

during pregnancy between preeclampsia and essential hypertension. Hypertension

2007;49:1436-41.

7. Belo L, Santos-Silva A, Caslake M, Cooney J, Pereira-Leite L, Quintanilha A, Rebelo

I. Neutrophil activation and C-reactive protein concentration in preeclampsia.


8. Gupta AK, Gebhardt S, Hillermann R, Holzgreve W, Hahn S. Analysis of plasma

elastase levels in early and late onset preeclampsia. Arch Gynecol Obstet

2006;273:239-42.

9. Lurie S, Frenkel E, Tuvbin Y. Comparison of the differential distribution of

leukocytes in preeclampsia versus uncomplicated pregnancy. Gynecol Obstet Invest

1998;45:229–31.

10. Matsuo K, Ushioda N, Harman CR, Kimura T. Increased leukocyte distribution in the

pre-clinical stage of pre-eclampsia. Int J Gynaecol Obstet 2007;96:31-2.

11. Veenstra van Nieuwenhoven AL, Bouman A, Moes H, Heineman MJ, de Leij LF,

Santema J, Faas MM. Cytokine production in natural killer cells and lymphocytes in

pregnant women compared with women in the follicular phase of the ovarian cycle.

Fertil Steril 2002;77:1032-7.

12. Saito S, Shiozaki A, Nakashima A, Sakai M, Sasaki Y. The role of the immune

system in preeclampsia. Mol Aspects Med 2007;28:192-209.

13. Sargent IA, Borzychowski AM, Redman WG. NK cells and human pregnancy – an

inflammatory view. Trends in Immunol 2006;27:399-404.

14. Borzychowski AM, Croy BA, Chan WL, Redman CW, Sargent IL. Changes in

systemic type 1 and type 2 immunity in normal pregnancy and pre-eclampsia may be

mediated by natural killer cells. Eur J Immunol 2005;35:3054-63.

15. Lok CAR, Van der Post JAM, Sargent IL, Hau CM, Sturk A, Boer K, Nieuwland R.

Changes in microparticle numbers and cellular origin during pregnancy and

preeclampsia. Hypertens in Pregnancy (in press).

16. Luppi P, Deloia JA. Monocytes of preeclamptic women spontaneously synthesize

pro-inflammatory cytokines. Clin Immunol 2006;118:268-75.

17. Veenstra van Nieuwenhoven AL, Bouman A, Moes H, Heineman MJ, de Leij LF,

Santema J, Faas MM. Endotoxin-induced cytokine production of monocytes of third-

trimester pregnant women compared with women in the follicular phase of the

menstrual cycle. Am J Obstet Gynecol 2003;188:1073-7.

18. Spek CA, Verbon A, Aberson H, Pribble JP, McElgunn CJ, Turner T, Axtelle T,

Schouten J, Van Der Poll T, Reitsma PH. Treatment with an anti-CD14 monoclonal


155

7

antibody delays and inhibits lipopolysaccharide-induced gene expression in humans

in vivo. J Clin Immunol 2003;23:132-40.




20. Koçyigit Y, Atamer Y, Atamer A, Tuzcu A, Akkus Z. Changes in serum levels of

leptin, cytokines and lipoprotein in pre-eclamptic and normotensive pregnant women.

Gynecol Endocrinol 2004;19:267-73.

21. Conrad KP, Miles TM, Benyo DF. Circulating levels of immunoreactive cytokines in

women with preeclampsia. Am J Reprod Immunol 1998;40:102-11.

22. Jonsson Y, Rubèr M, Matthiesen L, Berg G, Nieminen K, Sharma S, Ernerudh J,

Ekerfelt C. Cytokine mapping of sera from women with preeclampsia and normal

pregnancies. J Reprod Immunol 2006;70:83-91.

23. Daniel Y, Kupferminc MJ, Baram A, Jaffa AJ, Fait G, Wolman I, Lessing JB. Plasma

interleukin-12 is elevated in patients with preeclampsia. Am J Reprod Immunol

1998;39:376-80.

24. Adams KM, Mandel LS, Guthrie KA, Atkinson MW. Interleukin-18 in the plasma of

women with preeclampsia. Am J Obstet Gynecol 2003;188:1234-7.

25. Sakai M, Shiozaki A, Sasaki Y, Yoneda S, Saito S. The ratio of interleukin (IL)-18 to

IL-12 secreted by peripheral blood mononuclear cells is increased in normal pregnant

subjects and decreased in pre-eclamptic patients. J Reprod Immunol 2004;61:133-43.

26. Kauma S, Takacs P, Scordalakes C, Walsh S, Green K, Peng T. Increased endothelial

monocyte chemoattractant protein-1 and interleukin-8 in preeclampsia. Obstet

Gynecol 2002;100:706-14.

27. Eldering E, Spek CA, Aberson HL, Grummels A, Derks IA, de Vos AF, McElgunn

CJ, Schouten JP. Expression profiling via novel multiplex assay allows rapid

assessment of gene regulation in defined signalling pathways. Nucleic Acids Res

2003;31:153.

28. Lok CA, Böing AN, Reitsma PH, van der Post JA, van Bavel E, Boer K, Sturk A,



2006;147:310-20.

29. Gearing AJ, Newman W. Circulating adhesion molecules in disease. Immunol Today

1993;14:506-12.

30. Haught WH, Mansour M, Rothlein R, Kishimoto TK, Mainolfi EA, Hendricks JB,

Hendricks C, Mehta JL. Alterations in circulating intercellular adhesion molecule-1

and L-selectin: further evidence for chronic inflammation in ischemic heart disease.

Am Heart J 1996;132:1-8.

Chapter 7

156

31. Chaiworapongsa T, Romero R, Yoshimatsu J, Espinoza J, Kim YM, Park K, Kalache

K, Edwin S, Bujold E, Gomez R. Soluble adhesion molecule profile in normal

pregnancy and pre-eclampsia. J Matern Fetal Neonatal Med 2002;12:19-27.

32. Greer IA, Lyall F, Perera T, Boswell F, Macara LM. Increased concentrations of

cytokines interleukin-6 and interleukin-1 receptor antagonist in plasma of women

with preeclampsia: a mechanism for endothelial dysfunction? Obstet Gynecol

1994;84:937-40.

33. Arend WP, Welgus HG, Thompson RC, Eisenberg SP. Biological properties of

recombinant human monocyte-derived interleukin 1 receptor antagonist. J Clin Invest

1990;85:1694-7.

34. McCracken SA, Drury CL, Lee HS, Morris JM. Pregnancy is associated with

suppression of the nuclear factor kappaB/IkappaB activation pathway in peripheral

blood mononuclear cells. J Reprod Immunol 2003;58:27-47.

35. Kanayama N, Takahashi K, Matsuura T, Sugimura M, Kobayashi T, Moniwa N,

Tomita M, Nakayama K. Deficiency in p57Kip2 expression induces preeclampsia-

like symptoms in mice. Mol Hum Reprod 2002;8:1129-35.

36. Kumtepe Y, Börekçi B, Aksoy H, Altinkaynak K, Ingeç M, Ozdiller O. Measurement

of plasma glutathione S-transferase in hepatocellular damage in pre-eclampsia. J Int

Med Res 2002;30:483-7.



Platelets 2007;18, 68-72.

38. Joop K, Berckmans RJ, Nieuwland R, Berkhout J, Romijn FP, Hack CE, Sturk A.

Microparticles from patients with multiple organ dysfunction syndrome and sepsis

support coagulation through multiple mechanisms. Thromb Haemost 2001;85:810-20.

39. Martin S, Tesse A, Hugel B, Martinez MC, Morel O, Freyssinet JM,

Andriantsitohaina R. Shed membrane particles from T lymphocytes impair

endothelial function and regulate endothelial protein expression. Circulation

2004;109:1653-9.

40. Mesri M, Altieri DC. Endothelial cell activation by leukocyte microparticles. J

Immunol 1998;161:4382-7.

41. Mesri M, Altieri DC. Leukocyte microparticles stimulate endothelial cell cytokine

release and tissue factor induction in a JNK1 signaling pathway. J Biol Chem

1999;274:23111-8.

Chapter 8

Cell-derived microparticles and complement

activation in preeclampsia versus normal

pregnancy

É. Biró, C.A.R. Lok, C.E. Hack, J.A.M. van der Post, M.C.L. Schaap,

A. Sturk, R. Nieuwland

Placenta 2007;28:928-35

The first two authors contributed equally to this study

Chapter 8

158

ABSTRACT

Introduction. Inflammation plays a major role in the vascular dysfunction seen in

preeclampsia, and several studies suggest involvement of the complement system. The

objectives of the present study were to investigate whether complement activation on the

surface of microparticles (MP) is increased in plasma of preeclamptic patients versus

healthy pregnant controls.

Methods. MP from plasma of preeclamptic (n=10), healthy pregnant (n=10) and healthy

non-pregnant (n=10) women were analyzed by flow cytometry for bound complement

components (C1q, C4, C3) and complement activator molecules (C-reactive protein (CRP),

serum amyloid P-component (SAP), immunoglobulin (Ig)M, IgG). Fluid phase complement

activation products and activator molecules were also determined.

Results. Levels of MP with bound complement components showed no increase in

complement activation on the MP surface in preeclamptic women, in line with levels of

fluid phase complement activation products. In healthy non-pregnant and pregnant women,

bound CRP was associated with classical pathway activation on the MP surface, and in

healthy pregnant women IgM and IgG molecules also contributed. In preeclamptic women,

MP with bound SAP and those with IgG seemed to contribute to C1q binding without a

clear association to further classical pathway activation. Furthermore, significantly

increased levels of MP with bound CRP were present in preeclamptic compared with

healthy pregnant women (median 178 x106/L versus 47 x106/L, P <0.01), but without

concomitant increases in complement activation.

Conclusions. We found no evidence of increased complement activation on the MP surface

in preeclamptic women. MP with bound CRP were significantly increased, but in contrast

to healthy pregnant and non-pregnant women, this was not associated with increased

classical pathway activation on the surface of the MP.

Microparticles and complement activation in preeclampsia

159

8

I�TRODUCTIO�

Vascular dysfunction plays a central role in preeclampsia. The early phase of the disease is

characterized by suboptimal placentation1,2 and hemodynamic maladaptation to pregnancy3,

while at later stages generalized vascular dysfunction develops4,5 leading to the clinical

syndrome of preeclampsia. The pathogenesis of the disease is not yet fully understood, but

inflammatory processes seem to play a major role6. An important inflammatory mechanism

is complement activation. However, the role of the complement system in preeclampsia is

not clear. Decreased levels of C4 and C3, decreased CH50 values8, and increased plasma

levels of the anaphylatoxins C3a and C5a9-11 have been found in preeclamptic patients, as

well as decreased C1-inhibitor antigen and activity and decreased C4b-binding protein in

plasma12,13. Furthermore, in the placenta of preeclamptic patients, increased deposition of

C1q, C3d and the terminal complement complex were found14,15. Activation products of the

complement system induce chemotaxis and activation of leukocytes, and accordingly,

Haeger et al., found a correlation between levels of C5a in preeclamptic patients and

concentrations of elastase, a marker of neutrophil activation11. These results argue in favour

of a role for the complement system in preeclampsia. In contrast, Massobrio et al., found no

differences in serum C4, C3, or in plasma C3d concentrations when comparing

preeclamptic, healthy pregnant, and healthy non-pregnant women16, and Mellembakken et

al., found only decreased plasma concentrations of C4 in preeclamptic patients versus

healthy pregnant women, but no differences in plasma C3, C4b/c, C3b/c, C9, C4b-binding

protein, or C1-inhibitor17. Thus, a role for the complement system in the development of

preeclampsia is not yet definitely established.

Cell-derived microparticles (MP) are small vesicles released from cells upon

activation or apoptosis. They may play a role in inflammatory processes by activating or

altering the function of various cells types such as endothelial cells, monocytes, or

neutrophil granulocytes, via transfer of bioactive molecules, or ligand-receptor

interactions18-21. In addition, MP may also play a role in complement activation via the

classical pathway, as demonstrated in vitro by Nauta et al., and Gasser et al22,23. They

showed the binding of C1q (the first component of the classical pathway of complement) to

MP, and the deposition of C4 and C3, two components of the complement cascade

downstream of C1q, that are known to bind covalently to complement activating

surfaces24,25.

Recently, in synovial fluid of patients suffering from rheumatoid arthritis (RA), we

showed the presence of high levels of cell-derived MP with bound C1q, C4 and C3. Plasma

of these patients and of healthy individuals contained much lower levels of such MP26. The

results obtained in that study also suggested that in RA synovial fluid immunoglobulin G

(IgG) and IgM molecules were involved in complement activation on the surface of the

Chapter 8

160

MP, while in plasma of both RA patients and healthy individuals, CRP27. All three of these

molecules, as well as serum amyloid P component (SAP) can bind C1q and thereby activate

the classical pathway27-34. MP with activated complement components on their surface are

likely to play a role in the inflammatory processes in the joints of RA patients by

chemotaxis and activation of leukocytes26. Similarly, if present in the circulation of

preeclamptic patients, they might contribute to the generalized vascular dysfunction seen in

this disorder.

In the present study we investigated whether complement activation on the surface

of circulating MP is increased in patients suffering from preeclampsia compared with

healthy pregnant controls. Levels of circulating MP with bound C1q and activated C4

and/or C3 were assessed, as well as levels of MP binding the complement activator

molecules CRP, SAP, IgM and IgG.

METHODS

Patients and healthy controls

Preeclamptic (n=10), healthy pregnant (n=10) and healthy non-pregnant women (n=10)

were included in the study, both pregnant groups having singleton pregnancies.

Preeclampsia was defined according to the International Society for the Study of

Hypertension in Pregnancy: diastolic blood pressure of at least 110 mmHg on any occasion,

or at least 90 mmHg on two separate occasions at least four hours apart, and proteinuria of

at least 300 mg protein/24 hours, both developing after 20 weeks gestational age and

returning to normal values within 3 months after delivery35. The pregnant control group

consisted of healthy normotensive women with uncomplicated pregnancies, not using any

medication. The non-pregnant control group comprised healthy normotensive women, not

using any medication including oral contraceptives. The women in the three groups were

matched for age (± 5 years) and parity. The preeclamptic and healthy pregnant women were

also matched for gestational age (± 2 weeks). The demographic and clinical characteristics

of all study subjects are summarized in Table 1. Two of the women had received

betamethasone 12 mg (the first of two identical doses, administered at an interval of 24h)

the day before blood sampling, to promote fetal lung maturation. The other women either

received no corticosteroids (n=5) or received their first dose after blood sampling for this

study (n=3). The two women that had received corticosteroids did not form outliers when

compared with the rest of the preeclamptic women (data not shown). This study was

approved by the ethical committee of the Academic Medical Center of the University of

Amsterdam and complies with the principles of the Declaration of Helsinki. All patients

and healthy subjects had given their informed consent.


161

8

Table 1. Demographic and clinical characteristics of the healthy non-pregnant,

healthy pregnant and preeclamptic women

Healthy non-pregnant (n = 10)

Healthy pregnant (n = 10)

Preeclamptic (n = 10)

At time of sampling

Age (years) 31.0 (25.5–36.0) 31.5 (25.2–35.3) 30.6 (26.5–33.5)

Gestational age (weeks) – 31.0 (28.1–32.3) 29.4 (27.2–30.9)

Parity

Nulliparous 7 7 7

Multiparous 3 3 3

Blood pressure

Systolic (mmHg) 115.0 (107.5–126.5) 110.0 (107.5–115.0) 160.0 (142.5–175.0)

Diastolic (mmHg) 70.0 (65.0-80.0) 65.0 (60.0–75.0) 112.5 (98.8–120.0)

Body mass index (kg/m2) - 22.3 (20.6–30.9) 25.8 (20.3–40.8)

At delivery

Gestational age (weeks) - 39.5 (37.8–41.0) 33.9 (27.9–34.6)

Birth weight (g) - 3515 (2860–3690) 1160 (945–1818)

Table 1. Data are presented as median and interquartile range, except for parity, where the

numbers of nulliparous and multiparous women are provided.

Sample collection

Venous blood of patients and controls was collected without the use of a tourniquet into 0.1

volume of 105 mmol/L trisodium citrate. Blood cells were removed by centrifugation

(1550g, 20 minutes, room temperature) immediately after sample collection, and the plasma

was aliquotted, snapfrozen in liquid nitrogen and stored at –80°C.

Measurement of fluid phase complement activation products and complement

activator molecules

Plasma samples (250 µL aliquots) were thawed on melting ice and made MP-free by

centrifugation at 18890 g for 60 minutes at 4°C. The upper 200 µL of the microparticle-free

supernatants were collected and analyzed for concentrations of the soluble complement

activation products C4b/c (C4b, inactivated C4b and its further degradation product C4c)

and C3b/c (C3b, inactivated C3b and its further degradation product C3c) as well as SAP,

as described previously, by enzyme-linked immunosorbent assays36,37. CRP, IgM and IgG

concentrations were analyzed on the automated clinical chemistry analyzer Modular

Analytics P800 using Tina-quant reagents (Roche Diagnostics, Basel, Switzerland).

Chapter 8

162

Flow cytometric analysis of microparticles and bound complement components or

complement activator molecules

MP were isolated from plasma as we described previously38. Samples (250 µL aliquots)

were thawed on melting ice, then centrifuged at 18890 g for 30 minutes at room

temperature to pellet the MP. Subsequently, 225 µL of the supernatants were removed, and

225 µL of phosphate-buffered saline (PBS; 154 mmol/L NaCl, 1.4 mmol/L phosphate, pH

7.4) containing 10.5 mmol/L trisodium citrate (PBS/citrate) were added. MP were

resuspended, then again pelleted by centrifugation, after which 225 µL of supernatant were

again removed. To the remaining 25 µL MP pellet 75 µL of PBS/citrate buffer were added,

and the MP were resuspended.

Flow cytometric analysis was performed using an indirect staining procedure39.

MP (5 µL aliquots) were incubated for 30 minutes at room temperature in a final volume of

50 µL of PBS containing 2.5 mmol/L CaCl2 (PBS/Ca, pH 7.4) and unlabeled mouse

monoclonal antibodies against bound complement factors (C1q, C4, C3) or bound

complement activator molecules (CRP, SAP, IgM, IgG), or the respective isotype-matched

control antibodies (clones MOPC-31C (IgG1) and G155-178 (IgG2a) from Becton,

Dickinson and Company (BD) Pharmingen; San Jose, CA, USA). The monoclonal

antibodies against C1q, C4, C3, CRP and SAP (clones C1q-2, C4-4, C3-15, 5G4, and SAP-

14, respectively) were described previously37,40-42. Antibodies against the heavy chains of

IgM and IgG molecules (clones MH15-1 and MH16-1, respectively) were obtained from

Sanquin, Amsterdam, the Netherlands. After incubation with the antibodies, the

microparticles were washed with 200 µL of PBS/Ca. Then, rabbit anti-mouse F(ab’)2-

phycoerythrin (F(ab’)2-PE; Dako, Glostrup, Denmark; 5 µL) was added, and the mixtures

were again incubated for 30 minutes at room temperature.

Subsequently, 400 µL of buffer were added and the MP analyzed on a FACS

Calibur flow cytometer with CELLQuest 3.1 software (BD Immunocytometry Systems;

San Jose, CA, USA). Acquisition was performed for 1 minute per sample, during which the

flow cytometer analyzed approximately 60 µL of the suspension. Forward scatter and side

scatter were set at logarithmic gain. To identify marker positive events, thresholds were set

based on microparticle samples incubated with similar concentrations of isotype-matched

control antibodies. Calculation of the number of microparticles per liter plasma was based

upon the particle count per unit time, the flow rate of the flow cytometer, and the net

dilution during sample preparation of the analyzed microparticle suspension.


Data were analyzed with GraphPad PRISM 3.02 (GraphPad Software, Inc., San Diego, CA,

USA). Differences between groups were analyzed with the Friedman test, followed by

Dunn’s post test. Correlations were determined using Spearman’s correlation test.


163

8

Differences and correlations were considered significant at P <0.05. Data are presented as

median and interquartile range.

RESULTS

Healthy pregnant versus non-pregnant women

Levels of the fluid phase complement activation products C4b/c and C3b/c in MP-free

plasma of healthy pregnant women indicated a tendency towards increased complement

activation when compared with healthy non-pregnant controls (Table 2) but the differences

did not reach statistical significance (P >0.05). Analyzing levels of the complement

activator molecules in MP-free plasma (Table 2), we found no differences in

concentrations of CRP, SAP, IgM or IgG between healthy pregnant and non-pregnant

women (P >0.05 for all).

Table 2. Concentrations of fluid phase complement activation products and

complement activator molecules in plasma of healthy non-pregnant, healthy pregnant

and preeclamptic women

Healthy non-pregnant (n = 10) Pa

Healthy pregnant (n = 10) Pb

Preeclamptic

(n = 10) Pc

C4b/c (nmol/L) 4.1 (3.3–10.7) N.S.

9.4 (5.6–22.3) N.S. 10.3 (8.5–14.1) *

C3b/c (nmol/L) 14.8 (10.7–20.0) N.S.

19.5 (14.7–31.9) N.S. 20.6 (17.9–27.2) N.S.

CRP (mg/L) 1.3 (0.4–2.5) N.S.

4.8 (2.9–12.8) * 14.5 (6.6–61.2) ***

SAP (mg/L) 47.2 (38.8–67.4) N.S.

57.5 (57.1–70.4) N.S. 66.1 (52.0–81.4) *

IgM (g/L) 0.9 (0.6–1.6) N.S.

1.1 (0.6–1.7) N.S. 0.6 (0.5–1.8) N.S.

IgG (g/L) 9.8 (9.4–11.9) N.S.

7.8 (6.6–10.1) N.S. 6.3 (4.5–7.4) **

Table 2. Data are presented as median and interquartile range. Differences were analyzed

with the Friedman test, followed by Dunn’s post test. Two-tailed significance levels are

provided (P), which were considered significant at P <0.05. *P <0.05; **P <0.01; ***P

<0.001. CRP: C-reactive protein, IgG: immunoglobulin G, IgM: immunoglobulin M, A.S.:

not significant, and SAP: serum amyloid P component. aDifferences between healthy

pregnant and healthy non-pregnant women. bDifferences between preeclamptic and healthy

pregnant women. cDifferences between preeclamptic and non-pregnant women.

Chapter 8

164

The total concentration of MP did not differ between healthy pregnant and non-

pregnant women (median and interquartile range 1207 (876–2057) x106/L versus 1126

(910–2455) x106/L, respectively, P >0.05). The concentrations of MP with the complement

activator molecules CRP, SAP, IgM, and/or IgG bound to their surface are shown in Figure

1. No differences were found between healthy pregnant and non-pregnant women regarding

these (P >0.05 for all). MP with C1q, C4 and/or C3 on their surface (Figure 2) were present

at relatively low levels in plasma of both healthy pregnant and non-pregnant women, with

no detectable differences regarding MP with bound C1q or C4 (P >0.05 for both), and

somewhat lower levels of MP with bound C3 in plasma of healthy pregnant versus healthy

non-pregnant women (P < 0.05).

Table 3. Correlations between the concentrations of microparticles binding the

various complement activator molecules or complement components in plasma of

healthy non-pregnant, healthy pregnant and preeclamptic women

Healthy non-

pregnant

(n = 10)

Healthy

pregnant

(n = 10)

Preeclamptic

(n = 10)

r P r P r P

CRP pos. MP vs. C1q pos.

MP

0.832

8 0.005 0.939

4 0.000 0.5394 0.114

SAP pos. MP vs. C1q pos.

MP

0.454

5 0.191 0.563

6 0.096 0.7576 0.015

IgM pos. MP vs. C1q pos.

MP

0.381

8 0.279 0.818

2 0.006 -0.0424 0.918

IgG pos. MP vs. C1q pos.

MP

0.503

0 0.144 0.656

5 0.044 0.8303 0.005

C1q pos. MP vs. C4 pos.

MP

0.781

8 0.011 0.733

3 0.020 0.5273 0.123

C1q pos. MP vs. C3 pos.

MP

0.757

6 0.015 0.614

0 0.067 0.5289 0.123

Table 3. Correlation analysis was performed using Spearman’s correlation test (r:

correlation coefficient, P: two-tailed significance level, considered significant at P <0.05).

CRP: C-reactive protein, IgG: immunoglobulin G, IgM: immunoglobulin M: and SAP:

serum amyloid P component.

As shown in Table 3, in plasma of healthy pregnant women, the concentration of MP with

CRP, IgM or IgG on their surface correlated with those binding C1q (CRP: r=0.9394, P

<0.001; IgM: r=0.8182, P <0.01; IgG: r=0.6565, P <0.05), while in plasma of healthy non-

pregnant women, only the concentrations of MP with CRP on their surface correlated with

those binding C1q (r=0.8328, P <0.01). Furthermore, in healthy pregnant women, the con-


165

8

Figure 1. Concentrations of microparticles with bound complement activator molecules in

plasma of healthy non-pregnant, healthy pregnant, and preeclamptic women

Figure 1. Concentrations of MP

with bound complement activator

molecules CRP (A), SAP (B), IgM

(C) or IgG (D) in plasma of healthy

non-pregnant, healthy pregnant,

and preeclamptic women. Data are

presented as median and quartiles.

(The box extends from the 25th

percentile to the 75th percentile,

with a line at the median, and the

whiskers show the minimum and

maximum values.) Differences were

analyzed with the Friedman test,

followed by Dunn’s post test. Two-

tailed significance levels are

provided (P), which were

considered significant at P <0.05.

**P <0.01. CRP: C-reactive

protein, IgG: immunoglobulin G,

IgM: immunoglobulin M, A.S.: not

significant, and SAP: serum

amyloid P component.

Chapter 8

166

centrations of MP binding C1q correlated with those binding C4 (r=0.7333, P <0.05), and

in healthy non-pregnant women, they correlated with those binding C4 (r=0.7818, P <0.05)

as well as those binding C3 (r=0.7576, P <0.05). These results suggest that in healthy

pregnant and non-pregnant women MP had induced classical pathway activation via bound

CRP, and that in healthy pregnant women MP-bound IgM or IgG was also involved.

Figure 2. Concentrations of microparticles with bound complement components

Figure 2. Concentrations

of MP with bound

complement components

C1q (A), C4 (B) or C3 (C)

in plasma of healthy non-

pregnant, healthy pregnant,

and preeclamptic women.

Data are presented as

median and quartiles. (The

box extends from the 25th

percentile to the 75th

percentile, with a line at the

median, and the whiskers

show the minimum

and maximum values.)

Differences were analyzed

with the Friedman test,

followed by Dunn’s post

test. Two-tailed sig-

nificance levels are

provided (P), which were

considered significant at P

<0.05. *P <0.05. A.S.: not

significant.


167

8

Preeclamptic versus healthy pregnant women

Levels of the fluid phase complement activation products C4b/c and C3b/c in MP-free

plasma of preeclamptic patients did not differ from those in plasma of healthy pregnant

controls (P >0.05, Table 2). Likewise, there were no differences between preeclamptic and

healthy pregnant women regarding plasma levels of SAP, IgM and IgG (P >0.05 for all,

Table 2). However, we found significantly increased concentrations of CRP in

preeclamptic patients compared with healthy pregnant controls (P <0.05). The total

concentration of MP in plasma did not differ between preeclamptic and healthy pregnant

women (1232 (818–1653) x106/L versus 1207 (876–2057) x106/L, respectively, P >0.05).

As shown in Figure 1, in preeclamptic patients, MP with bound CRP were present at

significantly higher concentrations when compared with healthy pregnant women (178 (72–

718) x106/L versus 47 (15–75) x106/L, P < 0.01), while the MP with SAP, IgM, and/or IgG

on their surface were present at similar concentrations in the two groups (P >0.05). In

Figure 3 representative histogram plots of microparticles with bound CRP are provided. In

spite of the increased levels of MP with CRP bound to their surface, MP with C1q, C4

and/or C3 on their surface were not increased in preeclamptic women compared with

Figure 3. Representative histogram plots of microparticles with bound CRP in plasma

Figure 3. Representative histogram plots of MP with bound CRP in plasma of a healthy

non-pregnant (A), a healthy pregnant (B), and a preeclamptic woman (C). Fluorescence

intensity (x-axis) vs. MP count (y-axis) is shown. Binding of the isotype-matched control

antibody is depicted with the filled histogram, and binding of the specific antibody with the

open histogram. CRP: C-reactive protein.

healthy pregnant controls (P >0.05, Figure 2), and levels of MP binding CRP did not

correlate with those binding C1q (P >0.05, Table 3) in preeclamptic women. In this patient

group, the concentration of MP binding SAP and those binding IgG correlated with those

binding C1q (SAP: r=0.7576, P <0.05, IgG: r=0.8303, P <0.01, Table 3). As discussed

before, in plasma of healthy pregnant women, the concentration of MP binding CRP, IgM

Chapter 8

168

as well as IgG correlated with those binding C1q (Table 3). In preeclamptic women a

correlation between MP binding C1q and those binding C3 or C4 was absent, again in

contrast to healthy pregnant women.

DISCUSSIO�

The results of this study indicate that there are no differences in complement activation on

the MP surface when comparing healthy non-pregnant, healthy pregnant, and preeclamptic

women, apart from a slightly higher concentration of MP with bound C3 on their surface in

healthy non-pregnant women when compared to healthy pregnant women. This is consistent

with the levels of the fluid phase complement activation products C4b/c and C3b/c in

plasma, which are also similar in the three groups. Furthermore, our results suggest that in

healthy non-pregnant and pregnant women, bound CRP molecules are involved in the

classical pathway activation on the surface of MP, and that in healthy pregnant women IgM

and especially IgG molecules also contribute. Interestingly, in plasma of preeclamptic

women we found significantly higher levels of MP with bound CRP on their surface,

compared with both healthy pregnant and non-pregnant women, but this was not associated

with increased activation of the classical pathway of complement in preeclamptic women.

CRP binds to phosphorylcholine (the polar head group of phosphatidylcholine and

sphingomyelin) in the outer leaflet of membranes in the presence of sufficient amounts of

lysophosphatidylcholine43 or to oxidized phosphatidylcholine44. Ligand-complexed CRP

can bind C1q and activate the classical pathway of complement27,31,42. In a previous study26,

we found that in RA patients and healthy individuals levels of circulating MP with CRP on

their surface correlated with levels of circulating MP with C1q. These in turn correlated

with MP with bound C4 on their surface, suggesting classical pathway activation by CRP

bound to the MP. The same phenomenon could be observed in the present study in plasma

of healthy non-pregnant as well as healthy pregnant women. In plasma of preeclamptic

women, however, such a relationship was absent. CRP is known to exert direct opsonic

effects by binding to FcγRI and FcγRII on monocytes and neutrophils45. Possibly, in

women with preeclampsia the balance between complement activation and direct

opsonization by CRP is shifted towards the latter, or perhaps another mechanism is

responsible for inhibition of complement activation in plasma of preeclamptic women.

Interestingly, in a previous study we found that isolated MP from preeclamptic patients but

not healthy pregnant women can cause endothelial dysfunction in isolated myometrial

arteries from healthy pregnant women, but that this effect is abolished by the presence of

plasma from the patients47. Explaining this phenomenon and our present results showing


169

8

the absence of complement activation in the presence of relatively high concentrations of

MP binding CRP will require further investigations.

It should be mentioned, that in contrast to healthy non-pregnant women, where

only CRP seems to be involved in the low-level complement activation on the MP surface

by binding and activating C1q, in healthy pregnant women IgM and IgG molecules also

seem to participate. IgM molecules can bind to oxidized phospholipids and

lysophospholipids32,48 while the binding specificities of IgG molecules have not yet been

elucidated. In preeclamptic women SAP (which binds to phosphatidylethanolamine37,49,50)

and IgG seem to contribute, though in this study group MP binding C1q did not correlate

with those binding C4 or C3, suggesting the classical pathway is either (partly) inhibited at

the level of C1q, or that other pathways might also be involved. In spite of the questions

that still remain open, these results do illustrate the altered inflammatory state of

preeclamptic and even healthy pregnant women, when compared to healthy non-pregnant

controls, as described previously7.

There are data indicating that early-onset and late-onset preeclampsia might be

qualitatively different diseases51. In line with this, in a study examining the extent of

shedding of syncytiotrophoblast MP into the maternal circulation, Goswami et al., found a

difference between early-onset (before 34 weeks of gestation) and late-onset (later than 34

weeks of gestation) preeclampsia, with increased levels in the former group and no

difference in the latter, compared with matched healthy pregnant women52. In this regard it

should be mentioned that our study group consisted entirely of early-onset preeclamptic

women, and we observed no association between gestational age and the measured

parameters within this group (data not shown). However, such a relationship cannot be

excluded based on the present data. A study on preeclamptic women encompassing a wider

range of gestational ages at disease onset, including women with later-onset preeclampsia

than our study group, might reveal differences associated with gestational age at disease

onset.

In conclusion, we did not find increased levels of MP with bound C1q, C4 or C3 in

preeclamptic women, in accordance with similar levels of fluid phase complement

activation products in these women. Plasma of preeclamptic women did contain

significantly increased levels of microparticles binding CRP, but in contrast to healthy

pregnant and non-pregnant women, this was not associated with classical pathway

activation on the surface of the MP in these patients.


The authors are grateful to L.M. Pronk for her technical assistance.

Chapter 8

170

REFERE�CES

1. Pijnenborg R, Anthony J, Davey DA, Rees A, Tiltman A, Vercruysse L, van Assche

A. Placental bed spiral arteries in the hypertensive disorders of pregnancy. Br J Obstet

Gynaecol 1991;98:648-55.

2. Meekins JW, Pijnenborg R, Hanssens M, McFadyen IR, van Asshe A. A study of

placental bed spiral arteries and trophoblast invasion in normal and severe pre-

eclamptic pregnancies. Br J Obstet Gynaecol 1994;101:669-74.

3. Easterling TR, Benedetti TJ, Schmucker BC, Millard SP. Maternal hemodynamics in

normal and preeclamptic pregnancies: a longitudinal study. Obstet Gynecol

1990;76:1061-9.

4. Roberts JM. Endothelial dysfunction in preeclampsia. Semin Reprod Endocrinol

1998;16:5-15.

5. Taylor RN, de Groot CJ, Cho YK, Lim KH. Circulating factors as markers and

mediators of endothelial cell dysfunction in preeclampsia. Semin Reprod Endocrinol

1998;16:17-31.

6. Taylor RN. Review: immunobiology of preeclampsia. Am J Reprod Immunol

1997;37:79-86.

7. Redman CW, Sacks GP, Sargent IL. Preeclampsia: an excessive maternal

inflammatory response to pregnancy. Am J Obstet Gynecol 1999;180:499-506.

8. Houwert-de Jong MH, Claas FH, Gmelig-Meyling FH, Kalsbeek GL, Valentijn RM,

te Velde ER, Schuurman HJ. Humoral immunity in normal and complicated

pregnancy. Eur J Obstet Gynecol Reprod Biol 1985;19:205-14.

9. Haeger M, Bengtson A, Karlsson K, Heideman M. Complement activation and

anaphylatoxin (C3a and C5a) formation in preeclampsia and by amniotic fluid. Obstet

Gynecol 1989;73:551-6.

10. Haeger M, Unander M, Bengtsson A. Complement activation in relation to

development of preeclampsia. Obstet Gynecol 1991;78:46-9.

11. Haeger M, Unander M, Norder-Hansson B, Tylman M, Bengtsson A. Complement,

neutrophil, and macrophage activation in women with severe preeclampsia and the

syndrome of hemolysis, elevated liver enzymes, and low platelet count. Obstet

Gynecol 1992;79:19-26.

12. Halbmayer WM, Hopmeier P, Mannhalter C, Heuss F, Leodolter S, Rubi K, Fischer

M. C1-esterase inhibitor in uncomplicated pregnancy and mild and moderate

preeclampsia. Thromb Haemost 1991;65:134-8.

13. Schjetlein R, Haugen G, Sandset PM, Wisloff F. Reduced C4b-binding protein in

preeclampsia. Thromb Res 1997;85:153-8.


171

8

14. Sinha D, Wells M, Faulk WP. Immunological studies of human placentae:

complement components in pre-eclamptic chorionic villi. Clin Exp Immunol

1984;56:175-84.

15. Tedesco F, Radillo O, Candussi G, Nazzaro A, Mollnes TE, Pecorari D.

Immunohistochemical detection of terminal complement complex and S protein in

normal and pre-eclamptic placentae. Clin Exp Immunol 1990;80:236-40.

16. Massobrio M, Benedetto C, Bertini E, Tetta C, Camussi G. Immune complexes in

preeclampsia and normal pregnancy. Am J Obstet Gynecol 1985;152:578-83.

17. Mellembakken JR, Hogasen K, Mollnes TE, Hack CE, Abyholm T, Videm V.

Increased systemic activation of neutrophils but not complement in preeclampsia.


18. Jy W, Mao WW, Horstman L, Tao J, Ahn YS. Platelet microparticles bind, activate

and aggregate neutrophils in vitro. Blood Cells Mol Dis 1995;21:217-31.

19. Barry OP, Pratico D, Lawson JA, FitzGerald GA. Transcellular activation of platelets

and endothelial cells by bioactive lipids in platelet microparticles. J Clin Invest

1997;99:2118-27.

20. Forlow SB, McEver RP, Nollert MU. Leukocyte-leukocyte interactions mediated by

platelet microparticles under flow. Blood 2000;95:1317-23.

21. Mause SF, von Hundelshausen P, Zernecke A, Koenen RR, Weber C. Platelet

microparticles: a transcellular delivery system for RANTES promoting monocyte

recruitment on endothelium. Arterioscler Thromb Vasc Biol 2005;25:1512-8.

22. Nauta AJ, Trouw LA, Daha MR, Tijsma O, Nieuwland R, Schwaeble WJ, Gingras

AR, Mantovani A, Hack EC, Roos A. Direct binding of C1q to apoptotic cells and cell

blebs induces complement activation. Eur J Immunol 2002;32:1726-36.

23. Gasser O, Schifferli JA. Microparticles released by human neutrophils adhere to

erythrocytes in the presence of complement. Exp Cell Res 2005;307:381-7.

24. Campbell RD, Dodds AW, Porter RR. The binding of human complement component

C4 to antibody-antigen aggregates. Biochem J 1980;189:67-80.

25. Law SK, Lichtenberg NA, Levine RP. Evidence for an ester linkage between the

labile binding site of C3b and receptive surfaces. J Immunol 1979;123:1388-94.

26. Biró É, Nieuwland R, Tak PP, Pronk LM, Schaap MC, Sturk A, Hack CE. Activated

complement components and complement activator molecules on the surface of cell-

derived microparticles in patients with rheumatoid arthritis and healthy individuals.

Ann Rheum Dis 2007;66:1085-92.

27. Kaplan MH, Volanakis JE. Interaction of C-reactive protein complexes with the

complement system. I. Consumption of human complement associated with the

reaction of C-reactive protein with pneumococcal C-polysaccharide and with the

choline phosphatides, lecithin and sphingomyelin. J Immunol 1974;112:2135-47.

Chapter 8

172

28. Füst G, Medgyesi GA, Rajnavölgyi E, Csecsi-Nagy M, Czikora K, Gergely J. Possible

mechanisms of the first step of the classical complement activation pathway: binding

and activation of C1. Immunology 1978;35:873-84.

29. Bruggemann M, Williams GT, Bindon CI, Clark MR, Walker MR, Jefferis R,

Waldmann H, Neuberger MS. Comparison of the effector functions of human

immunoglobulins using a matched set of chimeric antibodies. J Exp Med

1987;166:1351-61.

30. Ying SC, Gewurz AT, Jiang H, Gewurz H. Human serum amyloid P component

oligomers bind and activate the classical complement pathway via residues 14-26 and

76-92 of the A chain collagen-like region of C1q. J Immunol 1993;150:169-76.

31. Agrawal A, Shrive AK, Greenhough TJ, Volanakis JE. Topology and structure of the

C1q-binding site on C-reactive protein. J Immunol 2001;166:3998-4004.

32. Kim SJ, Gershov D, Ma X, Brot N, Elkon KB. I-PLA(2) activation during apoptosis

promotes the exposure of membrane lysophosphatidylcholine leading to binding by

natural immunoglobulin M antibodies and complement activation. J Exp Med

2002;196:655-65.

33. Ciurana CL, Zwart B, van Mierlo G, Hack CE. Complement activation by necrotic

cells in normal plasma environment compares to that by late apoptotic cells and

involves predominantly IgM. Eur J Immunol 2004;34:2609-19.

34. Zwart B, Ciurana C, Rensink I, Manoe R, Hack CE, Aarden LA. Complement

activation by apoptotic cells occurs predominantly via IgM and is limited to late

apoptotic (secondary necrotic) cells. Autoimmunity 2004;37:95-102.

35. Davey DA, MacGillivray I. The classification and definition of the hypertensive

disorders of pregnancy. Am J Obstet Gynecol 1988;158:892-8.

36. Wolbink GJ, Bollen J, Baars JW, ten Berge RJ, Swaak AJ, Paardekooper J, Hack CE.

Application of a monoclonal antibody against a neoepitope on activated C4 in an

ELISA for the quantification of complement activation via the classical pathway. J

Immunol Methods 1993;163:67-76.

37. Familian A, Zwart B, Huisman HG, Rensink I, Roem D, Hordijk PL, Aarden LA,

Hack CE. Chromatin-independent binding of serum amyloid P component to

apoptotic cells. J Immunol 2001;167:647-54.

38. Berckmans RJ, Nieuwland R, Böing AN, Romijn FP, Hack CE, Sturk A. Cell-derived

microparticles circulate in healthy humans and support low grade thrombin

generation. Thromb Haemost 2001;85:639-46.

39. Biró É, Nieuwland R, Sturk A. Measuring circulating cell-derived microparticles. J

Thromb Haemost 2004;2:1843-4.

40. Hack CE, Paardekooper J, Smeenk RJ, Abbink J, Eerenberg AJ, Nuijens JH.

Disruption of the internal thioester bond in the third component of complement (C3)


173

8

results in the exposure of neodeterminants also present on activation products of C3.

An analysis with monoclonal antibodies. J Immunol 1988;141:1602-9.

41. Hoekzema R, Martens M, Brouwer MC, Hack CE. The distortive mechanism for the

activation of complement component C1 supported by studies with a monoclonal

antibody against the "arms" of C1q. Mol Immunol 1988;25:485-94.

42. Wolbink GJ, Brouwer MC, Buysmann S, Ten Berge IJ, Hack CE. CRP-mediated

activation of complement in vivo: assessment by measuring circulating complement-

C-reactive protein complexes. J Immunol 1996;157:473-9.

43. Volanakis JE, Wirtz KW. Interaction of C-reactive protein with artificial

phosphatidylcholine bilayers. Nature 1979;281:155-7.

44. Chang MK, Binder CJ, Torzewski M, Witztum JL. C-reactive protein binds to both

oxidized LDL and apoptotic cells through recognition of a common ligand:

Phosphorylcholine of oxidized phospholipids. Proc Natl Acad Sci U S A

2002;99:13043-8.

45. Crowell RE, Du Clos TW, Montoya G, Heaphy E, Mold C. C-reactive protein

receptors on the human monocytic cell line U-937. Evidence for additional binding to

Fc gamma RI. J Immunol 1991;147:3445-51.

46. Bharadwaj D, Stein MP, Volzer M, Mold C, Du Clos TW. The major receptor for C-

reactive protein on leukocytes is fcgamma receptor II. J Exp Med 1999;190:585-90.





48. Shaw PX, Horkko S, Chang MK, Curtiss LK, Palinski W, Silverman GJ, Witztum JL.

Natural antibodies with the T15 idiotype may act in atherosclerosis, apoptotic

clearance, and protective immunity. J Clin Invest 2000;105:1731-40.

49. Schwalbe RA, Dahlback B, Coe JE, Nelsestuen GL. Pentraxin family of proteins

interact specifically with phosphorylcholine and/or phosphorylethanolamine.

Biochemistry 1992;31:4907-15.

50. Emsley J, White HE, O'Hara BP, Oliva G, Srinivasan N, Tickle IJ, Blundell TL, Pepys

MB, Wood SP. Structure of pentameric human serum amyloid P component. Nature

1994;367:338-45.

51. von Dadelszen P, Magee LA, Roberts JM. Subclassification of preeclampsia.




onset pre-eclampsia, but not normotensive intrauterine growth restriction. Placenta

2006;27:56-61.

175

PART IV

General discussion, future perspectives

and summary

Chapter 9

General discussion and

future perspectives

Chapter 9

178

GE�ERAL DISCUSSIO� A�D FUTURE PERSPECTIVES

9.1 Aim of the thesis

9.2 Concentration and origin of microparticles in pregnancy and preeclampsia

9.3 Effects of microparticles in pregnancy and preeclampsia

9.3.1 Endothelial dysfunction

9.3.2 Inflammation

9.3.3 Other effects

9.4 Future perspectives

General discussion

179

9

9.1 AIM OF THE THESIS

Preeclampsia is a pregnancy-specific syndrome defined by hypertension and proteinuria.

The exact etiology of preeclampsia is still unclear, although endothelial dysfunction, an

exaggerated inflammatory response and coagulation are involved. Since these processes are

all affected by cell-derived microparticles (MP), we hypothesized that MP contribute to the

development or aggravation of preeclampsia. MP are vesicles released from the cell surface

by blebbing of the plasma membrane. Their composition depends on their cellular origin

but may differ from the parental cell. The release and formation of MP are also affected by

the activation or apoptosis status of the releasing cell.

9.2 CO�CE�TRATIO� A�D ORIGI� OF MICRPARTICLES I� PREG�A�CY

A�D PREECLAMPSIA

Differences in MP measurements

At present, there is no consensus in the literature with regard to the concentration of MP or

subpopulations thereof in preeclampsia (Chapter 2). These differences are due to

variations in patient selection, methodological differences and intra-individual variations.

First, preeclampsia is a heterogeneous disease and clinical symptoms may vary

from asymptomatic women to critically ill patients. Since our hospital is a tertiary referral

center and admits ill patients with often an early onset of preeclampsia, patients included in

our studies are more likely to suffer from thrombocytopenia and hemolysis, i.e. processes

which clearly affect the MP concentration. An influence of disease severity has been

demonstrated for placenta-derived MP1. Taken together, differences in patient selection

may complicate comparison of data between investigators.

Secondly, laboratories use different isolation- and detection protocols, other

definitions of MP, and different cluster of differentiation (CD) markers for MP

identification. These variables explain differences in MP numbers between our present data

and those reported in studies from others2-7. An improvement in our isolation protocol

accounts for the lower concentrations of MP obtained in our earlier studies8.

Thirdly, variations in MP numbers may depend on age9 and food consumption10,11.

Also many pre-analytical variables, such as the time between collection and handling of the

blood, markedly affect the measured concentrations of MP. Furthermore, we and others

assume that MP are continuously shed into the circulation. However, this is not necessarily

true for all cell types, since placenta-derived MP were shown to be episodically released

into the circulation, e.g. after placental incidents like ischemia12. Whether or not this also

applies to the release of other subpopulations of MP, is unknown.

Chapter 9

180

Finally, in pregnancy, the circulating blood volume is increased considerably.

Therefore, a decreased concentration of MP may be anticipated. This is not confirmed by

our results, possibly due to a concurrent activation of platelets and leukocytes. In contrast,

in preeclampsia haemoconcentration occurs due to fluid leakage to the extravascular space.

Furthermore, platelets and leukocytes are activated and also lysis of erythrocytes

contributes to altered concentrations of MP and subpopulations thereof. The overall

decreased MP concentration in preeclampsia is most likely explained by a decreased

platelet count which is often found in preeclampsia.

Total concentrations versus subpopulations

With regard to pregnancy and preeclampsia, most studies on the occurrence of MP thus far

particularly focused on the total concentration of circulating MP compared to control

populations 6,7,13. It should be mentioned that by determination of the concentration of MP

in cell-free plasma samples, only those MP will be obtained that are present within the

maternal plasma. In other words, MP isolated from plasma samples do not reflect the real in

vivo situation, since particular subpopulations of MP may already have been removed from

the circulation by clearance or by adherence to the (damaged) endothelium or to other

circulating cells14. Despite the fact that such subpopulations are important with regard to

the development or aggravation of preeclampsia, they are not easily accessible for clinical

research.

Despite these limitations, our present data suggest that especially subpopulations

or characteristics of circulating MP may be of equal relevance as the total concentration of

MP. In our studies, the majority of circulating MP originated from platelets in preeclampsia

as well as in normotensive pregnancies (Chapter 3). Minor fractions of circulating MP

originated from erythrocytes, leukocytes, endothelial cells and trophoblast cells. In

preeclamptic patients, increased numbers of erythrocyte-derived MP and leukocyte-derived

MP were present compared to normotensive controls of the same gestational age.

Although the biological or (patho-)physiological role of changes in circulating

concentrations of MP subpopulations is unclear, they most likely reflect changes of their

parental cells. For instance, elevated numbers of circulating P-selectin-exposing PMP in

preeclampsia (Chapter 4) reflect platelet activation, which is supported by the current

literature15-18. Elevated concentrations of circulating erythrocyte-derived MP in

preeclampsia reflect haemolysis or haemoconcentration, and increased numbers of

circulating leukocyte-derived MP indicate cellular activation (see next paragraph). Elevated

numbers of circulating endothelial cell-derived MP have been proposed to reflect

endothelial activation or dysfunction4,19,20. Since we found comparable numbers of

endothelial-derived MP in plasma samples of preeclamptic patients and controls, we

assume that endothelial activation is similar in our preeclamptic patients and controls. The

General discussion

181

9

elevated number of placenta-derived MP in the third trimester in pregnancy reflects most

likely an increased placenta volume with more trophoblast cells shedding MP. The

gestational age-dependent increase in the circulating number of placenta-derived MP is in

accordance with Germain et al14. Alternatively, hypoxia and subsequent apoptosis may

affect the release of such MP in preeclampsia21.

9.3 EFFECTS OF MICROPARTICLES I� PREG�A�CY A�D PREECLAMPSIA

MP may modulate endothelial dysfunction, inflammation, haemostasis and angiogenesis

(Figure 1), which will be discussed in the following paragraphs. It should be mentioned

that most of these effects were established in vitro using isolated fractions of MP. Whether

or not MP also exert such functions in vivo, however, is only partially known.

Figure 1. Possible functions of microparticles in preeclampsia

Figure 1. A schematic representation of the possible functions of MP and exosomes in

preeclampsia described in literature and in this thesis.

Chapter 9

182

9.3.1 Endothelial dysfunction

Previously, we and others showed that isolated fractions of MP from plasma of

preeclamptic patients impaired endothelial-dependent dilatation in isolated resistance

arteries22,23. On the other hand, MP from preeclamptic patients were reported to induce

vascular hyporeactivity of human omental arteries and aortas from mice2. The difference

with the study of Van Wijk22 may be attributed to differences in experimental conditions.

Several lines of evidence suggest that subpopulations of MP may (differentially)

affect endothelial function. Meziani et al., showed that incubation with PMP resulted in the

release of vasodilative NO metabolites, whereas incubation with leukocyte-derived MP

stimulated not only NO release but also production of vasoconstrictive COX-2 metabolites.

Also placenta-derived MP and T-cell-derived MP affect endothelial relaxation response in

vitro23,24. Thus, the overall effect of MP isolated from plasma samples on the endothelium

is likely to be a subtle balance between the various pro- and antagonistic effects of the

many subpopulations of MP being present in such samples.

9.3.2 Inflammation

Inflammation may underlie the before mentioned vascular effects of MP2,25. Therefore, we

investigated whether MP from preeclamptic patients induced changes in RNA expression of

inflammation-related genes in human umbilical endothelial cells (Chapter 6). Gene

expression, however, was found to be unaffected. It cannot be excluded from these

experiments that incubation of other types of endothelial cells with MP or by using

endothelial cells cultured under flow conditions would have resulted in a different outcome.

Moreover, we also cannot exclude that MP most effective in modulating endothelial gene

expression or function were already removed from the circulation and therefore absent in

our plasma samples. Our data are confirmed by Donker et al., who showed that incubation

of either human umbilical endothelial cells or human glomerular microvascular endothelial

cells with MP-containing plasma of preeclamptic patients failed to trigger cytokine release

or changes in gene expression26. Interestingly, plasma from preeclamptic patients triggered

cytokine production in monocyte cultures27. Thus, MP, which are present in plasma, may

exert an indirect effect on the endothelium via monocyte activation (Figure 2). This is

supported by the finding that T-cell-derived MP trigger cytokine production in

monocytes28. Again, the exerted effects of MP on the endothelium seem to differ between

subpopulations, since incubation of human umbilical endothelial cells with placenta-

derived MP hardly affected gene expression29.

The inflammatory response is a complex system of many interacting processes.

Not only endothelial activation plays a central role, but also leukocyte adhesion and

activation, immune modulation, platelet-activation and haemostasis. In the next paragraphs,

General discussion

183

9

the presence and contribution of MP subpopulations in preeclampsia to inflammation,

based on this thesis, will be briefly discussed.

Figure 2. Microparticles with different characteristics circulate in preeclampsia

Figure 2. MP originate from blood cells, endothelial cells and trophoblast cells.

Depending on their origin, they expose different molecules. As a result,, they exert different

effects on the endothelium. Flt-1 exposed on placenta-derived MP or PMP may bind

circulating VEGF. Hypothetically, the effect of MP on the endothelium may be exerted

indirectly via the activation of monocytes. Possibly this effect is mediated through the

adhesion receptor P-selectin. The overall balance between circulating or attached

(subpopulations of) MP determines their final biological action.

We found elevated concentrations of monocyte-derived MP in plasma samples of

preeclamptic patients compared to controls (Chapters 3 and 7). Since the numbers of

monocytes were not increased (Chapter 7), this increase may reflect activation of

monocytes in preeclampsia, which is in line with the current literature15. Monocyte-derived

MP may affect other cells, e.g. synovial MP trigger cytokine production by fibroblast-like

synoviocytes. A major fraction of synovial MP originates from monocytes, although also

Chapter 9

184

MP from granulocytes and T-cells are present. Monocyte-derived MP also trigger the

expression and production of tissue factor and von Willebrand factor by endothelial cells in

vitro31. It seems unlikely, however, that monocyte-derived MP substantially contribute to

inflammation in preeclampsia, since we found no changes in expression of inflammation-

related genes in endothelial cells after incubation with MP (Chapter 6). Since monocytes

as well as monocyte-derived MP constitute relatively minor fractions of the total population

of leukocytes and circulating MP, respectively, their effects may be masked by other more

prominent (sub)populations of cells and MP.

Compared to non-pregnant women, elevated concentrations of granulocyte-derived

MP are present in preeclamptic patients and in pregnant women (Chapter 7)8. This may be

due to elevated numbers of granulocytes32-34. Although granulocytes compose about 75% of

the leukocytes in pregnancy, the percentage of granulocyte-derived MP was only 17-25 %

(Chapter 7), suggesting that subpopulations show different rates of MP release and/or

removal from the circulation.

In our longitudinal study (Chapter 3), relatively small numbers of granulocyte-

derived MP (<0.1%) were detected. In Chapter 7, however, the median fraction of

granulocyte MP (of the total number of MP) was 2.7% in preeclampsia (versus 0.6% in

pregnancy and 0.2% in non-pregnant controls. Whereas the experimental conditions of

these studies were comparable, patients included in the longitudinal study suffered from

more severe preeclampsia than those included in the cross sectional study (Chapters 3 and

7, respectively). We hypothesize that the severity of preeclampsia may affect the interaction

between (activated) leukocytes, their MP and the endothelium. Since adhesion of

granulocytes to endothelial cells from preeclamptic pregnancies is increased compared to

granulocyte adhesion to endothelial cells from control pregnancies, there is some evidence

to support this hypothesis35. Possibly, also the binding of granulocyte-derived MP to

endothelial cells may be disease state dependent.

Also Tsuppressor-cell-derived MP were increased in preeclampsia compared to non-

pregnant controls, suggesting activation of Tsuppressor-cells. An elevated level of T-cell-

derived MP is in line with the study of Van Wijk et al8. T-cell-derived MP trigger

expression and production of interleukin (IL)-1ß and IL-1 receptor antagonist (RA) by

monocytes in vitro28. Although it is unknown whether T-cell derived MP bind to monocytes

in vivo, we found increased expression of both IL-1ß and IL-1RA in leukocytes from

pregnant and preeclamptic patients (Chapter 7). Also placenta-derived MP are capable of

binding to monocytes, and trigger the expression and production of pro-inflammatory

cytokines14. Thus, it may be worthwhile to study the occurrence of complexes of monocytes

and MP of various cellular origins ex vivo.

In Chapter 8, we showed that isolated fractions of MP from preeclamptic patients

showed no increased signs of complement activation compared to controls. Only the

General discussion

185

9

concentration of MP exposing C-reactive protein (CRP) was elevated. CRP is a

complement activator molecule, which binds to phosphatidylcholine exposed on the MP

surface. Surface-exposed CRP activates the complement system. Furthermore, CRP triggers

the expression and production of cytokines and tissue factor by monocytes36,37. Thus, the

biological role of MP-exposed CRP in preeclampsia remains to be determined, but such MP

are likely to contribute to the pro-inflammatory phenotype of preeclampsia.

9.3.3 Other effects

Platelets rapidly adhere to damaged endothelium, become activated and form a platelet

plug. Activated platelets capture tissue factor (TF)-exposing MP from the blood, thereby

initiating coagulation38. In the interaction between cells and between cells and MP, P-

selectin plays an essential role. Since we found P-selectin to be exposed on circulating PMP

(Chapter 4), such MP may have an increased ability to adhere to cells or other MP.

We showed that plasma from preeclamptic patients contains substantial numbers

of platelet-derived and placenta-derived MP exposing Flt-1 (Chapter 5). Although

composing only a minor fraction of the total concentration of non-cell bound Flt-1 in

plasma, the biological activity of MP-exposed Flt-1 may differ from truly soluble (non-

membrane associated) Flt-1. A pro-angiogenic effect of PMP was observed in vitro39,40. In

contrast, endothelial-derived MP impaired angiogenesis41. Again, the overall effect of MP

is likely to be a balance between the pro- and anti angiogenic effects of the various

subpopulations of MP. One may speculate that Flt-1 exposed by MP may be transferred to

“target” cells in a same mechanism as previously described for tissue factor42. If so,

transferred Flt-1 may function as a transmembrane receptor for VEGF, thereby enabling

angiogenesis.

9.4 FUTURE PERSPECTIVES

Until now, most research focused on the question: “What are the effects of MP?”.

However, the question “Why do cells release MP?” may be equally interesting (Figure 3).

The release of MP is an important and conserved cellular feature. One may hypothesize that

cells unable to release MP are more stressed and likely to die, because their ability to

remove dangerous intracellular substances such as caspases is impaired. In this theory, the

ability of cells to release sufficient MP may be affected by two major causes. First, since

MP shedding is an active process which requires energy, energy depletion may impair their

release. Second, there may also be a genetic cause, e.g. gene polymorphisms, affecting the

ability of cells to release MP. Thus, analysis of genes already known to be involved in MP

release may provide new insights. In our studies, we persistently found decreased numbers

Chapter 9

186

of PMP (and platelets) in preeclampsia compared to normotensive women (Chapter 3, 4, 5

and 7), which seems to be in line with the before mentioned hypothesis. Since others

reported elevated concentrations of (P)MP43 and endothelial-derived MP19 in other vascular

diseases, however, a more thorough analysis seems essential.

Figure 3. The reason and effect of microparticles release

Figure 3. The release of MP by cells may be at least as important as the biological effects

of MP. The inability of cells to release MP induces apoptosis. Whereas release of MP may

be beneficial to the releasing cell, uncontrolled release may constitute a potential

“environmental hazard”.

MP may have both biologically or clinically positive (‘good’) and negative (‘bad’)

effects (Figure 4). First, MP are involved in intercellular communication. Proteins, mRNA,

receptors and organelles can be transferred from MP to target cells44. Second, MP may

contribute to cellular survival, because inhibition of MP release triggers apoptosis45. In this

model, MP are cellular dustbins, which protect the cells against intracellular accumulation

of harmful enzymes or other substances. Third, the release of E-selectin from the

endothelial cell surface by shedding E-selectin-exposing MP may prevent leukocyte

attachment to the endothelium. Whereas release of MP may be beneficial to the releasing

cell, uncontrolled release may constitute a potential “environmental hazard”. For example,

MP are generally considered to be procoagulant and contribute to haemostasis. Their

uncontrolled release, however, may lead to hypercoagulation with vascular disease as a

consequence. These positive and/or negative effects of MP are at least partially dependent

on the status of the parental cell. MP from apoptotic T-cells impair relaxation, whereas MP

from activated T-cells expose sonic hedgehog (SHH) proteins and increase NO release, thus

promoting vasodilation46. MP exposing SHH proteins can even reverse endothelial

General discussion

187

9

dysfunction and in the future it will become clear whether there is a therapeutic role for

SHH-exposing MP.

Figure 4. The balance between beneficial and harmful effects of microparticles

Figure 4. MP affect the delicate balance of various clinically relevant processes.

Imbalance contributes to disease development.

The role of exosomes in preeclampsia has not been thoroughly investigated yet.

Evidence is accumulating that exosomes modulate the immune response47. They facilitate

antigen presentation, but are also capable of suppressing the immune response by exposing

FasL48,49. Exosomes may be involved in suppressing T lymphocyte activation during

pregnancy, thereby contributing to an immune privilege for the developing fetus, which is

necessary to achieve a term pregnancy50. Immunologic maladaptation may be one of the

underlying phenomena in preeclampsia. Therefore, additional studies on exosomes may

give new clues in the search for the etiology of preeclampsia.

In conclusion, despite many remaining questions, the role of various types of cell-

derived vesicles in disease development, including preeclampsia, is slowly becoming

apparent. The possibilities of research on such vesicles and their putative clinical relevance

are exiting and promising.

Chapter 9

188

REFERE�CES


DP. Excess syncytiotrophoblast microparticle shedding is a feature of early-onset pre-

eclampsia, but not normotensive intrauterine growth restriction. Placenta 2006;27:56-

61.

2. Meziani F, Tesse A, David E, Martinez MC, Wangesteen R, Schneider F,

Andriantsitohaina R. Shed membrane particles from preeclamptic women generate

vascular wall inflammation and blunt vascular contractility. Am J Pathol

2006;169:1473-83.


O'Sullivan MJ, Ahn YS. Elevated plasma endothelial microparticles: preeclampsia


4. Gonzalez-Quintero VH, Jimenez JJ, Jy W, Mauro LM, Hortman L, O'Sullivan MJ,

Ahn YS. Elevated plasma endothelial microparticles in preeclampsia. Am J Obstet

Gynecol 2003;189:589-93.

5. Bretelle F, Sabatier F, Desprez D, Camoin L, Grunebaum L, Combes V, D'Ercole C,



restriction. Thromb Haemost 2003;89:486-92.

6. Harlow FH, Brown MA, Brighton TA, Smith SL, Trickett AE, Kwan YL, Davis GK.

Platelet activation in the hypertensive disorders of pregnancy. Am J Obstet Gynecol

2002;187:688-95.





vascular dysfunction? Am J Obstet Gynecol 2002;187:450-6

9. Van der Zee PM, Biro E, Ko Y, de Winter RJ, Hack CE, Sturk A, Nieuwland R. P-

selectin- and CD63-exposing platelet microparticles reflect platelet activation in

peripheral arterial disease and myocardial infarction. Clin Chem 2006;52:657-64.

10. Ferreira AC, Peter AA, Mendez AJ, Jimenez JJ, Mauro LM, Chirinos JA, Ghany R,

Virani S, Garcia S, Horstman LL, Purow J, Jy W, Ahn YS, de ME. Postprandial

hypertriglyceridemia increases circulating levels of endothelial cell microparticles.

Circulation 2004;110:3599-3603.

11. Tushuizen ME, Nieuwland R, Scheffer PG, Sturk A, Heine RJ, Diamant M. Two

consecutive high-fat meals affect endothelial-dependent vasodilation, oxidative stress

and cellular microparticles in healthy men. J Thromb Haemost 2006;4:1003-10.

General discussion

189

9



Gynaecol 1998;105:632-40.

13. Desprez D, Zobairi F, Aucouturier JS, Leymarie F, Freyssinet JM, Grunebaum L, de

Raucourt E. Evolution of circulating procoagulant microparticles during normal

pregnancy. Blood Coagul Fibrinolysis 2008;19:179-81.






2004;190:1128-34.


Sturk A. Extensive platelet activation in preeclampsia compared with normal

pregnancy: enhanced expression of cell adhesion molecules. Am J Obstet Gynecol.

1997;176:461-9.



2001;97:366-70.




19. Bernal-Mizrachi L, Jy W, Jimenez JJ, Pastor J, Mauro LM, Horstman LL, de ME,

Ahn YS. High levels of circulating endothelial microparticles in patients with acute

coronary syndromes. Am Heart J 2003;145:962-70.

20. Brodsky SV, Zhang F, Nasjletti A, Goligorsky MS. Endothelium-derived

microparticles impair endothelial function in vitro. Am J Physiol Heart Circ Physiol

2004;286:H1910-5.


2005:308;1592-4.

22. VanWijk MJ, Svedas E, Boer K, Nieuwland R, Vanbavel E, Kublickiene KR. Isolated




23. Martin S, Tesse A, Hugel B, Martinez MC, Morel O, Freyssinet JM,

Andriantsitohaina R. Shed membrane particles from T lymphocytes impair endothelial

function and regulate endothelial protein expression. Circulation 2004;109:1653-9.

Chapter 9

190




25. Tesse A, Meziani F, David E, Carusio N, Kremer H, Schneider F, Andriantsitohaina

R. Microparticles from preeclamptic women induce vascular hyporeactivity in vessels



26. Donker RB, Asgeirsdóttir SA, Gerbens F, van Pampus MG, Kallenberg CG, te

Meerman GJ, Aarnoudse JG, Molema G. Plasma factors in severe early-onset

preeclampsia do not substantially alter endothelial gene expression in vitro. J Soc

Gynecol Investig 2005;12:98-106.

27. Faas MM, Donker RB, van Pampus MG, Huls AM, Salomons J, de Vos P, Aarnoudse

JG. Plasma of pregnant and preeclamptic women activates monocytes in vitro. Am J

Obstet Gynecol. 2008 (in press)

28. Scanu A, Molnarfi N, Brandt KJ, Gruaz L, Dayer JM, Burger D. Stimulated T cells

generate microparticles, which mimic cellular contact activation of human monocytes:

differential regulation of pro- and anti-inflammatory cytokine production by high-

density lipoproteins. J Leukoc Biol. 2008;83.

29. Hoegh AM, Tannetta D, Sargent I, Borup R, Nielsen FC, Redman C, Sorensen S,

Hviid TV. Effect of syncytiotrophoblast microvillous membrane treatment on gene

expression in human umbilical vein endothelial cells. BJOG 2006;113:1270-79.




31. Essayagh S, Xuereb JM, Terrisse AD, Tellier-Cirioni L, Pipy B, Sié P. Microparticles

from apoptotic monocytes induce transient platelet recruitment and tissue factor

expression by cultured human vascular endothelial cells via a redox-sensitive

mechanism. Thromb Haemost 2007;98:831-7.

32. Lurie S, Frenkel E, Tuvbin Y. Comparison of the differential distribution of

leukocytes in preeclampsia versus uncomplicated pregnancy. Gynecol Obstet Invest

1998;45:229–31.

33. Matsuo K, Ushioda N, Harman CR, Kimura T. Increased leukocyte distribution in the

pre-clinical stage of pre-eclampsia. Int J Gynaecol Obstet 2007;96:31-2.

34. Von Dadelszen P, Watson RW, Noorwali F, Marshall JC, Parodo J, Farine D, Lye SJ,

Ritchie JW, Rotstein OD. Maternal neutrophil apoptosis in normal pregnancy,

preeclampsia, and normotensive intrauterine growth restriction. Am J Obstet Gynecol.

1999;181:408-14.

General discussion

191

9

35. Wang Y, Adair CD, Coe L, Weeks JW, Lewis DF, Alexander JS. Activation of

endothelial cells in preeclampsia: increased neutrophil-endothelial adhesion correlates

with up-regulation of adhesion molecule P-selectin in human umbilical vein

endothelial cells isolated from preeclampsia. J Soc Gynecol Investig 1998;5:237-43.

36. Ballou, SP, Lozanski, G. Induction of inflammatory cytokine release from cultured

human monocytes by C-reactive protein. Cytokine 1992;4:361-8.

37. Cermak, J, Key, NS, Bach, RR, Balla J, Jacobs HS, Vercellotti GM. C-reactive protein

induces human peripheral blood monocytes to synthesize tissue factor. Blood

1993;82:513-20.

38. Vandendries ER, Furie BC, Furie B. Role of P-selectin and PSGL-1 in coagulation

and thrombosis. Thromb Haemost 2004;92:459-66.

39. Brill A, Dashevsky O, Rivo J, Gozal Y, Varon D. Platelet-derived microparticles

induce angiogenesis and stimulate post-ischemic revascularization. Cardiovasc Res.

2005;67:30-8

40. Kim HK, Song KS, Chung JH, Lee KR, Lee SN. Platelet microparticles induce

angiogenesis in vitro. Br J Haematol. 2004;124:376-84.

41. Mezentsev A, Merks RM, O'Riordan E, Chen J, Mendelev N, Goligorsky MS,

Brodsky SV. Endothelial microparticles affect angiogenesis in vitro: role of oxidative

stress. Am J Physiol Heart Circ Physiol. 2005;289:H1106-14.

42. Del Conde I, Shrimpton CN, Thiagarajan P, Lopez JA. Tissue-factor-bearing

microvesicles arise from lipid rafts and fuse with activated platelets to initiate

coagulation. Blood 2005;106:1604-11.




2000;101:841-3.

44. Ratajczak J, Wysoczynski M, Hayek F, Janowska-Wieczorek A, Ratajczak MZ.

Membrane-derived microvesicles: important and underappreciated mediators of cell-

to-cell communication. Leukemia 2006;20:1487-95.

45. Abid Hussein MN, Böing AN, Sturk A, Hau CM, Nieuwland R. Inhibition of

microparticle release triggers endothelial cell apoptosis and detachment. Thromb

Haemost 2007;98:1096-107.

46. Agouni A, Mostefai HA, Porro C, Carusio N, Favre J, Richard V, Henrion D,

Martínez MC, Andriantsitohaina R. Sonic hedgehog carried by microparticles corrects

endothelial injury through nitric oxide release. FASEB J 2007;21:2735-41.

47. Thery C, Zitvogel L, Amigorena S. Exosomes: composition, biogenesis and function.

Nat Rev Immunol 2002;2:569-79.

Chapter 9

192

48. Abusamra AJ, Zhong Z, Zheng X, Li M, Ichim TE, Chin JL, Min WP. Tumor

exosomes expressing Fas ligand mediate CD8+ T-cell apoptosis. Blood Cells Mol Dis

2005;35:169-173.

49. Kim SH, Bianco N, Menon R, Lechman ER, Shufesky WJ, Morelli AE, Robbins PD.

Exosomes derived from genetically modified DC expressing FasL are anti-

inflammatory and immunosuppressive. Mol Ther 2006;13:289-300.

50. Taylor DD, Akyol S, Gercel-Taylor C. Pregnancy-associated exosomes and their

modulation of T cell signaling. J Immunol 2006;176:1534-42.

Chapter 10

Summary

Summary

195

10

Chapter 1. Preeclampsia is a pregnancy specific syndrome defined by hypertension and

proteinuria. It is a major cause of maternal and fetal morbidity and mortality. Abnormal

placentation early in pregnancy underlies the development of a systemic inflammatory

response in the second half of pregnancy. The exact etiology of preeclampsia is still

unclear, although the placenta plays a central role. In addition, also endothelial dysfunction,

exaggerated inflammation and altered haemostasis are involved. Microparticles (MP), small

cell-derived vesicles that are released from cells upon activation or apoptosis, have been

suggested to affect the before mentioned processes. In this thesis, changes in MP

concentration in normotensive pregnancy and their role in the development or aggravation

of preeclampsia were investigated.

Chapter 2. MP are released from cells by budding of the plasma membrane and range in

size between 0.1-1.0 µm. MP in blood are predominantly of platelet origin. MP

concentrations are changed in many autoimmune, cardiovascular and thromboembolic

diseases, as well as in inflammatory and infectious disorders. Exosomes are even smaller

vesicles, 20-90 nm, which are released into the blood when endosomes containing

intraluminal vesicles fuse with the plasma membrane. Exosomes modulate the immune

response, but are also involved in haemostasis and intercellular communication. MP and

exosomes may play a role in recurrent miscarriage, premature delivery and preeclampsia,

although our knowledge of their precise contribution to the pathophysiology of these

diseases is still incomplete.

Chapter 3. Knowledge about changes in circulating MP concentrations during

normotensive pregnancy and preeclampsia was lacking. Therefore, numbers and cellular

origin of circulating MP were determined longitudinally during the course of normotensive

pregnancy and preeclampsia. Furthermore, their relation to the severity of preeclampsia was

investigated. During normotensive pregnancy, numbers of MP initially decreased and

subsequently normalized. In preeclampsia, the number of circulating MP and platelet-

derived MP (PMP) were found to be reduced, whereas monocyte-derived MP and

erythrocyte-derived MP were elevated. There were no correlations between the

concentration of MP and the severity of preeclampsia, suggesting that their numbers are not

necessarily associated with their vascular effects.

Chapter 4. Platelet activation in preeclampsia is reflected by elevated levels of platelets

exposing P-selectin and in plasma a non-cell bound (“soluble”) form of this P-selectin is

present. Elevated levels of plasma P-selectin have been reported in preeclampsia. This non-

cell bound P-selectin may be MP associated. We investigated to which extent plasma P-

selectin is MP associated and whether the fraction of P-selectin-exposing MP is elevated in

Chapter 10

196

preeclamptic patients. We showed that a minor fraction of plasma P-selectin was indeed

associated with PMP. This fraction was increased in preeclampsia compared to

normotensive pregnant and non-pregnant women. Because MP-associated P-selectin was

exclusively associated with PMP, this fraction reflects platelet activation in preeclampsia.

Chapter 5. The soluble VEGF receptor, Flt-1 is secreted by trophoblast cells and elevated

concentrations occur in preeclampsia. By binding VEGF, Flt-1 deprives the endothelium of

this mediator of angiogenesis and regulator of vascular tone and thus blood pressure. MP

from preeclamptic patients affect vascular behavior and may also expose Flt-1. We

determined whether non-cell bound Flt-1 is associated with MP from preeclamptic patients

and whether levels of Flt-1-exposing MP are increased in preeclampsia. Furthermore, we

established the cellular origin of Flt-1-exposing MP and investigated whether full-length or

truncated Flt-1 is associated with MP. Non-cell bound Flt-1 and the number of MP

exposing Flt-1 were shown to be elevated in preeclampsia compared to controls. Flt-1-

exposing MP originated predominantly from platelets and trophoblast cells. Full-length Flt-

1 (150 kda) was associated with MP and absent in MP-free plasma samples. The biological

activities of these coexisting forms of Flt-1 remain to be established. The presence of Flt-1

on the membrane of a MP might alter its function, particularly if it acts in synergism with

other vasoactive molecules expressed alongside it on the MP.

Chapter 6. Inflammation and endothelial dysfunction are prominent features of

preeclampsia. The activated endothelium plays a pivotal role by the production of

inflammatory mediators. The factors initiating this inflammatory response, however, are

still unknown. MP may underlie this response in preeclampsia because they are known to

induce the expression and production of pro-inflammatory cytokines by e.g. endothelial

cells and induce endothelial dysfunction. We investigated the RNA expression of

inflammation-related genes in cultured endothelial cells after incubation with MP from

preeclamptic patients, normotensive pregnant women and non-pregnant women. The RNA

expression of such genes was unaffected by any of these MP fractions. Thus, it seems

unlikely that circulating MP isolated from plasma from preeclamptic patients cause

endothelial dysfunction directly by affecting the expression of inflammation-related genes.

Chapter 7. Preeclampsia shows characteristics of an inflammatory disease including

leukocyte activation, reflected by elevated numbers of circulating leukocytes exposing

adhesion molecules, and aberrant levels of soluble activation markers. Analyses of

leukocyte-derived MP and mRNA expression of inflammation-related genes in maternal

leukocytes may establish which subgroups of leukocytes are activated and contribute to the

development of preeclampsia. We confirmed the occurrence of activation of leukocytes and

Summary

197

10

of particular leukocyte subgroups in preeclampsia, and to a lesser extent in normotensive

pregnancy. Although an overall pro-inflammatory gene expression profile could not be

detected within the total population of leukocytes, differences in mRNA of some genes

were observed. The increased levels of circulating MP from monocytes, granulocytes and

Tsuppressor-cells reflected activation of their parental cells in preeclampsia.

Chapter 8. An important inflammatory mechanism is complement activation. The role of

the complement system in preeclampsia is unclear because both elevated and comparable

levels of complement factors and complement activation molecules have been reported in

preeclamptic patients compared to normotensive controls. We investigated whether

complement activation on the surface of circulating MP is increased in plasma of

preeclamptic patients versus pregnant controls. Although numbers of CRP-exposing MP

were significantly increased in preeclampsia, this increase was not associated with elevated

complement activation.

Samenvatting

Samenvatting

201

10

Hoofdstuk 1. Preëclampsie is een syndroom dat uitsluitend voorkomt tijdens de

zwangerschap en wordt gekenmerkt door een hoge bloeddruk en eiwitverlies in de urine.

Het is een belangrijke oorzaak van maternale en foetale morbiditeit en mortaliteit. Een

gestoorde ontwikkeling van de placenta vroeg in de zwangerschap lijkt ten grondslag te

liggen aan de klinische symptomen die zichtbaar worden tijdens de tweede helft van de

zwangerschap. De exacte etiologie van preëclampsie is nog onduidelijk, maar het niet goed

functioneren van maternale endotheelcellen, een overmatige ontstekingsrespons en een

veranderende hemostase zijn van belang bij de pathofysiologie van dit syndroom.

Micropartikels zijn kleine blaasjes, welke variëren in grootte tussen 0.1-1.0 µm en met

name worden afgesnoerd door geactiveerde cellen en door cellen die geprogrammeerde

celdood ondergaan. Omdat micropartikels de bovengenoemde processen, die betrokken zijn

bij de pathofysiologie van preëclampsie, kunnen beïnvloeden, onderzochten wij in dit

proefschrift de veranderingen van concentraties en eigenschappen van micropartikels in

ongecompliceerde zwangerschappen en in preëclampsie.

Hoofdstuk 2. In dit hoofdstuk wordt een overzicht gegeven van de huidige kennis over

micropartikels in gezonde en gecompliceerde zwangerschappen. Micropartikels worden

afgesnoerd van het oppervlak van circulerende cellen in het bloed en van endotheelcellen.

Micropartikels in het bloed zijn met name afkomstig van bloedplaatjes. Het is bekend dat

de concentratie van micropartikels afwijkend is bij verschillende auto-immuunziekten,

cardiovasculaire aandoeningen en tromboembolische processen, evenals in inflammatoire

ziekten en tijdens sepsis. Exosomen zijn nog kleinere blaasjes, variërend in grootte tussen

20-90 nm. Exosomen komen in het bloed als de membranen van intracellulaire ”multi-

vesicular bodies” fuseren met de plasma membraan waardoor er intraluminale blaasjes vrij

komen. Exosomen beïnvloeden niet alleen de immuunrespons, maar zijn ook betrokken bij

hemostase en intercellulaire communicatie. Micropartikels en exosomen spelen mogelijk

een rol bij herhaalde miskramen, partus prematurus en preëclampsie. Echter, de kennis over

de exacte bijdragen van micropartikels en exosomen aan deze ziekten is beperkt.

Hoofdstuk 3. Het is onbekend hoe de concentratie of de herkomst van circulerende

micropartikels is veranderd bij preëclampsie in vergelijking met ongecompliceerde

zwangerschappen. Daarom zijn de aantallen en de cellulaire herkomst van circulerende

micropartikels longitudinaal gemeten in bloedmonsters van zowel normotensieve zwangere

vrouwen als van preëclamptische patiënten. Tevens is onderzocht of er een verband bestaat

tussen aantallen micropartikels en de ernst van preëclampsie. In het begin van een

normotensieve zwangerschap is de concentratie micropartikels afgenomen, daarna vindt er

een geleidelijke stijging plaats. Bij preëclampsie worden verlaagde aantallen micropartikels

en van plaatjes afkomstige micropartikels gevonden, terwijl micropartikels afkomstig van

Chapter 10

202

monocyten en erythrocyten juist zijn verhoogd. Er zijn geen correlaties gevonden tussen de

micropartikels concentraties en de ernst van preëclampsie, hetgeen suggereert dat de

concentratie micropartikels niet noodzakelijkerwijs is geassocieerd met de ernst van

klinische verschijnselen.

Hoofdstuk 4. Activatie van bloedplaatjes bij preëclampsie kan worden afgemeten aan

verhoogde aantallen bloedplaatjes die P-selectine exposeren. In plasma is een circulerende

niet cel-gebonden vorm van P-selectine aanwezig. Verhoogde concentraties van deze vorm

van P-selectine zijn aangetoond in preëclampsie. Wij hebben onderzocht in hoeverre dit

circulerende P-selectin geassocieerd is met micropartikels en of het aantal micropartikels

dat P-selectine exposeert, is toegenomen tijdens preëclampsie. Wij hebben aangetoond dat

een klein deel (3-5%) van het plasma P-selectine inderdaad gebonden is aan micropartikels

die afkomstig zijn van bloedplaatjes. In preëclampsie bleek dit micropartikel-gebonden P-

selectine te zijn toegenomen ten opzichte van normotensive zwangere en niet-zwangere

vrouwen. Omdat het aan micropartikel-gebonden P-selectine uitsluitend aantoonbaar was

op micropartikels afkomstig van plaatjes is dit dus een maat voor de mate van activatie van

bloedplaatjes tijdens preëclampsie.

Hoofdstuk 5. De circulerende VEGF (vascular endothelial growth factor) receptor, Flt-1,

wordt geproduceerd door trofoblast cellen en het is bekend dat verhoogde concentraties zijn

gevonden in plasma van vrouwen met preëclampsie. Door VEGF te binden, voorkomt sFlt-

1 dat het endotheel in contact komt met deze belangrijke angiogenese-inducerende factor en

regulator van de bloeddruk. Omdat bekend is dat micropartikels van preëclamptische

patiënten de functionaliteit van bloedvaten kunnen beïnvloeden, hebben wij onderzocht of

micropartikels Flt-1 exposeren. Wij hebben gemeten of het niet cel-gebonden Flt-1

geassocieerd is met circulerende micropartikels van preëclamptische patiënten, en of het

aantal Flt-1-exposerende micropartikels is toegenomen in preëclampsie. Bovendien hebben

we de herkomst van Flt-1-exposerende micropartikels vastgesteld en onderzocht of het

intacte (“full-length”) Flt-1 of een verkorte vorm van Flt-1 op micropartikels aanwezig is.

De concentratie van circulerend Flt-1 en van Flt-1-exposerende micropartikels was

verhoogd in preëclampsie ten opzichte van de controle groepen. Flt-1-exposerende

micropartikels waren voornamelijk afkomstig van bloedplaatjes en trofoblast cellen. Het

intacte Flt-1 (150 kDa) kon worden aangetoond op de micropartikels en niet in

micropartikel-vrij plasma. De biologische activiteit van deze naast elkaar bestaande vormen

van Flt-1 moet nog worden vastgesteld. De aanwezigheid van Flt-1 op de membraan van

micropartikels zou het effect van micropartikels op endotheelcellen kunnen beïnvloeden.

Samenvatting

203

10

Chapter 6. Onsteking en het niet goed functioneren van het endotheel zijn belangrijke

processen in het ontstaan van preëclampsie. Het geactiveerde endotheel speelt een

belangrijke rol door eiwitten te produceren die betrokken zijn bij de ontstekingsrespons. De

factoren die deze ontstekingsrespons kunnen initiëren zijn slechts ten dele bekend.

Micropartikels zouden ook betrokken kunnen zijn bij deze respons, omdat micropartikels

de aanmaak van ontstekingsmediatoren door endotheelcellen kunnen bevorderen en tevens

“endotheeldisfunctie” kunnen induceren. Wij onderzochten de RNA expressie van genen

die coderen voor ontstekingsmediatoren in gekweekte endotheelcellen na incubatie met

micropartikels van preëclamptische patiënten, normotensieve zwangeren en niet-zwangere

vrouwen. De RNA expressie van deze genen werd echter niet beïnvloed door de

toegevoegde micropartikels. Het lijkt dus onwaarschijnlijk dat circulerende micropartikels,

geïsoleerd uit plasma van preëclamptische patiënten, endotheeldisfunctie veroorzaken door

rechtstreeks de expressie van genen die coderen voor ontstekingsmediatoren, te stimuleren.

Hoofdstuk 7. Preëclampsie heeft kenmerken van een ontstekingsrespons, welke onder

andere wordt gekenmerkt door activatie van leukocyten. Dit blijkt bijvoorbeeld uit de

verhoogde aantallen circulerende leukocyten met adhesiemoleculen op het celoppervlak, en

uit de veranderde concentraties activatiemerkers die door leukocyten worden aangemaakt in

vergelijking met de normale zwangerschap. Naast de analyse van micropartikels, afkomstig

van leukocyten, kan de mRNA expressie van genen die coderen voor

ontstekingsbevorderende mediatoren in maternale leukocyten een aanwijzing zijn welke

subgroepen van leukocyten bijdragen aan het ontstaan van preëclampsie. Wij hebben

bevestigd dat leukocyten en diverse subgroepen geactiveerd zijn in preëclampsie en in

mindere mate in normotensieve zwangerschappen. Alhoewel in de totale leukocyten

populatie geen eenduidig ontstekingsbevorderend genexpressie profiel kon worden

vastgesteld, bleken wel verschillen aantoonbaar in de expressie van een beperkt aantal

genen. De verhoogde concentratie circulerende micropartikels afkomstig van monocyten,

granulocyten en Tsuppressor-cellen weerspiegelen de activatie van deze celtypen in

preëclampsie.

Hoofdstuk 8. Complementactivatie is een belangrijk onderdeel van de ontstekingsrespons.

De rol van dit systeem in preëclampsie is onduidelijk, omdat zowel verhoogde als

onveranderende concentraties van complementfactoren en activatoren zijn aangetoond in

preëclamptische patiënten ten opzichte van normotensieve controles. Wij hebben

onderzocht of merkers van complementactivatie in verhoogde mate aanwezig zijn op het

oppervlak van circulerende micropartikels bij preëclamptische patiënten versus zwangere

controles. Alhoewel de aantallen van CRP (C-reactive protein)-exposerende micropartikels

Chapter 10

204

significant waren verhoogd in preëclampsie, bleek deze toename niet geassocieerd te zijn

met complementactivatie.

Hoofdstuk 9. Het is duidelijk geworden dat naast de totale concentratie ook bepaalde

eigenschappen van circulerende micropartikels belangrijk zijn. Het biologische effect van

veranderingen hierin is echter niet bekend. Waarschijnlijk weerspiegelen micropartikels

veranderingen in cellulaire processen die gemeten kunnen worden in het bloed van

patiënten met preëclampsie, zoals hemolyse, bloedplaatjesactivatie en deling van

trofoblastcellen door placentaire groei. De concentratie micropartikels wordt mede bepaald

door de heterogeniciteit van preëclampsie, door de manier van isoleren en analyseren van

micropartikels en door de leeftijd en het dieet van de moeder. Mogelijk worden

micropartikels niet continu in het bloed afgescheiden, waardoor het moment van afname

een rol kan spelen bij de gemeten concentratie micropartikels. Ondanks dat micropartikels

een rol lijken te spelen bij endotheeldisfunctie, inflammatie, hemostase en angiogenese,

heeft het analyseren van micropartikels vooralsnog geen klinische toepassing. In de

toekomst moet worden onderzocht waarom cellen micropartikels afsnoeren en niet alleen

wat het effect is van de afgesnoerde micropartikels. Verder is de rol van exosomen in

preëclampsie nog niet onderzocht.

Bibliography

205

10

Co-authors

Bibliography

Dankwoord

Curriculum vitae

Co-authors

207

CO-AUTHORS

ACADEMIC MEDICAL CE�TER, AMSTERDAM, THE �ETHERLA�DS

Department of Obstetrics and Gynaecology

Dr. K. Boer

Drs. M. Buimer

Drs. J. Jebbink

Prof. dr. J.A.M. van der Post

Department of Clinical Chemistry

Drs. É. Biró

A.N. Böing

C.M. Hau

Dr. R. Nieuwland

M.C.L. Schaap

Prof. dr. A. Sturk

Department of Medical Physics

Prof. dr. E. van Bavel

U�IVERSITY MEDICAL CE�TER, FREE U�IVERSITY, AMSTERDAM, THE

�ETHERLA�DS

Department of Endocrinology

Dr. M. Diamant

Department of Immunology (pathophysiology of aspecific inflammation)

Prof. dr. C.E. Hack (Crucell Holland B.V., Leiden)

208

U�IVERSITY MEDICAL CE�TER GRO�I�GE�, GRO�I�GE�, THE

�ETHERLA�DS

Department of Pathology and Medical Biology

Dr. M.M. Faas

U�IVERSITY MEDICAL CE�TER LEIDE�, LEIDE�, THE �ETHERLA�DS

Department of Hematology (experimental molecular medicine)

Prof. dr. P.H. Reitsma

IMPERIAL COLLEGE SCHOOL OF MEDICI�E, CHELSEA A�D

WESTMI�STER HOSPITAL, LO�DO�, U�ITED KI�GDOM

Department of Maternal Fetal Medicine

Dr. S.R. Sooranna

LUDWIG-MAXIMILIA�S U�IVERSITY, MU�ICH, GERMA�Y

Department of Obstetrics and Gynaecology

Dr. K. Friese

Dr. B. Toth

U�IVERSITY OF OXFORD, THE WOME�'S CE�TRE, JOH� RADCLIFFE

HOSPITAL, OXFORD, U�ITED KI�GDOM

�uffield Department of Obstetrics and Gynaecology

Prof. dr. I.L. Sargent

Bibliography

209

BIBLIOGRAPHY

Full Articles (not published in this thesis)

• Lok CAR, Dijkema MWJ. Psychologische oorlogsvoering. Nieuwsbrief van de

Nederlandse Vereniging voor Medische Polemologie. Januari 1997.

• Brouwer CN, Lok CAR, Wolffers I, Sebagalls S. Psychosocial and economic aspects

of HIV/AIDS and counselling of caretakers of HIV-infected children in Uganda.

AIDS Care 2000;12:535-40.

• Papatsonis DN, Lok CAR, Bos JM, van Geijn HP, Dekker GA. Calcium channel

blockers in obstetrics: the management of preterm labor and hypertension in

pregnancy. Eur J Obstet Gyn Reprod Biol 2001;97:122-140.

• Lok CAR. Bleeding in early pregnancy. In: Evidence-based obstetrics, Chapter 6.

Eds: D.K.James et al. Saunders, London, 2003.

• Lok CAR, Houwen van der C, Kate-Booij ten MJ, Eijkeren van MA, Ansink AC.

Pregnancy after EMACO for gestational trophoblastic disease; a report from the

Netherlands. Br J Obstet Gynaecol 2003;110:560-6.

• Lok CAR, Böing A, van Bavel E. Kleine deeltjes met grote gevolgen. Wat is de rol

van micropartikels bij het veroorzaken van endotheelschade in preeclampsie? Analyse

2003;9:266-270.

• Lok CAR, Kate-Booij ten MJ, Ansink AC. Multichemotherapie voor hoog-risico

trofoblast tumoren; een follow-up studie. Ned Tijdschr Obstet Gyn 2004;117(5).

• Houwen, vd C, Rietbroek RC, ten Kate-Booij MJ, Lok CAR, Lammes FB, Ansink,

AC. Feasibility of central coordinated EMA/CO for gestational trophoblastic disease

in The Netherlands. Br J Obstet Gynaecol 2004;111:143-7.

• Lok CAR, Zürcher AF, Velden vd J. A case of a hydatidiform mole in a 56-year-old

woman. Int J Gynecol cancer 2005;14:1-5.

210

• Lok CAR, Reekers JA, Westermann AM, Van der Velden J. Embolization for

hemorrhage of liver metastases from choriocarcinoma. Gynecol Oncol 2005;98:506-9.

• Lok CAR, Ansink AC, Grootfaam D, van der Velden J, Verheijen RH, ten Kate-Booij

MJ. Treatment and prognosis of post term choriocarcinoma in The Netherlands.

Gynecol Oncol 2006;103:698-702.

• Papatsonis DNM, Bos JM, van Geijn HP, Lok CAR, Dekker GA. Nifedipine

pharmacokinetics and plasma levels in the management of preterm labor. Am J Ther

2007;14:346-50.

• Van Oppenraaij RHF, Goddijn M, Lok CAR, Exalto N. De jonge zwangerschap:

revisie van de Nederlandse benamingen voor klinische en echoscopische bevindingen.

Ned Tijdschr v Gen 2008;152:20-4.

• Ten Kate-Booij MJ, Lok CAR, Verheijen RH, Massuger LFAG, van Trommel NE.

Behandeling van persisterende trofoblastziekten anno 2007. Ned Tijdschr v Gen 2008

(in press).

Dankwoord

211

DA�KWOORD

Ik had al lang geleden bedacht dat mijn dankwoord uit het woord “Bedankt” zou bestaan. Kort en krachtig. Ik zou dan wel veel mensen te kort doen. Want promoveren kun je niet alleen! Daarom wil ik de volgende mensen heel hartelijk bedanken: Allereerst wil ik alle gezonde zwangere vrouwen en preëclamptische patiënten bedanken die zonder eigenbelang hun bloed hebben afgestaan in het kader van de wetenschap. Sommigen zelfs tot 7 keer aan toe! Zonder deze patiënten was het onderzoek onmogelijk geweest. Mijn promotoren Joris van der Post & Guus Sturk. Beste Joris, altijd druk en rennen. Toch wist je vaak tijd voor me vrij te maken. Als wetenschapper maar zeker ook als clinicus heb ik veel van je geleerd. Ik vind het erg leuk dat je inmiddels professor bent geworden en daarom mijn promotor kunt zijn. Beste Guus, ik ben jaloers op jouw scherpe geest. Na een blik op wat uitslagen, stelde jij de vragen waar ik natuurlijk weer geen antwoord op had. Het was altijd goed om bij je binnen te lopen voor onderzoeksvragen, maar je had ook tijd voor persoonlijke zaken, zoals een kraambezoek. Mijn co-promotoren Rienk �ieuwland & Kees Boer. Rienk, het is heel simpel, zonder jou had dit boekje er niet gelegen. Heel veel dank voor al die uren praten over resultaten, bedenken van experimenten en schrijven van artikelen. Ik vond het altijd erg gezellig bij je op de kamer met kopjes thee en kletsen over kinderen en vogels. Ik prijs me gelukkig dat jij mijn co-promotor was. Kees, jouw enthousiasme is volgens mij oneindig. Als agnio ben ik bij jou met onderzoek begonnen. Ik vind het leuk dat we dit wetenschappelijke project nu ook met elkaar afsluiten. Jouw creativiteit heeft ook iets heel moois van dit boekje gemaakt. Ed van Bavel. Beste Ed, jij bent steeds betrokken geweest bij het onderzoek al lag het meer op het terrein van de klinische chemie dan de medische fysica. Je was altijd weer in voor een nieuw idee en kwam ook enthousiast weer naar iedere vergadering. Ik hoop dat er een opvolger komt voor mij die weer meer functioneel onderzoek met jou gaat doen want er zijn nog een hoop leuke ideeën.

212

Mijn kamergenoten Liesbeth van Leeuwen & Petra Biewenga. Lieve Liesbeth, wat hebben we het gezellig gehad. Veel gelachen, soms ook wat tranen. Ik kon me geen betere kamergenoot wensen. Dat zulke tegenpolen het zo goed kunnen hebben op twee vierkante meter. Ik ben blij dat jij mijn paranimf wilt zijn. Lieve Petra. Jij kwam iets later op onze kamer en dat maakte het compleet. Moet soms wel moeilijk zijn geweest om zo in het midden te zitten tussen twee uitersten. Dank voor alle gezelligheid. Medewerkers van het LEKC: Anita, Chi, Yung, Dennis, Marianne, Rene, Frans, Mohammed, Éva, Marc & Maarten. Beste Anita, je hebt me veel geleerd over allemaal lastige technieken. We hebben veel gekletst over leuke dingen en over experimenten. Ik mocht je altijd weer lastig vallen met vragen via de mail. Ik vind het fantastisch dat jij ook gaat promoveren. Maar eerst nog even bevallen. Wel leuk dat ik jouw vragen daarover eens kon beantwoorden. Beste Chi, zonder jouw supersnelle pipetteren, zat ik nu nog buizen te facsen. Jij hebt enorm veel werk verzet en iedere keer met een lach en zonder mopperen. Heb ik nu mijn bolletje verdiend? Alle anderen van het lab, bedankt voor de ontzettend leuke en leerzame tijd die ik bij jullie op F1 heb gehad. Ik wist niet dat laboranten zo gezellig konden zijn! Mijn opleiders Otto Bleker, Maas-Jan Heineman & Mark-Hans Emanuel. Otto, jij hebt het mogelijk gemaakt dat ik in deze constructie als opleidingsassistent kon promoveren. Ook al wist je niet altijd waar het onderzoek over ging, als ik met uitslagen binnen liep, was je altijd enthousiast. Maas-Jan, ik vertrok net naar de periferie toen jij de plaats van Otto innam. Tijdens het schrijven van sommige hoofdstukken kwam ik er achter dat mijn onderzoek raakvlakken heeft met jouw onderzoek in Groningen. Daarom is het leuk dat je in mijn promotiecommissie zit. Mark-Hans, ik hoop dat ik een stukje van jouw enthousiasme en onderzoekergeest kan overnemen. Ik ben blij dat ik het laatste deel van mijn opleiding in het Spaarne kan doen en ik vind het leuk dat je deel hebt uitgemaakt van mijn promotiecommissie en je daarom door wat artikelen hebt heen geworsteld die niet helemaal op jouw terrein lagen. Mede-onderzoekers: Stef, Pieternel, Jan-Willem, Madelon, Henrike, Wouter, andere Wouter, Sebastiaan, Saskia, Etelka, Karlijn, Jiska, Wessel, Janne-Meije, Henrike, Madelon, Judith, Moira, Marianne, Marjolein en “last but not least” Maarten. Bedankt voor de gezelligheid en het binnenlopen bij elkaar. De

Dankwoord

213

maandagmiddaglunch was een heerlijke onderbreking van de dag en een goed moment om alle nieuwtjes te horen. Wouter, nu hebben we samen 3 boekjes. Maarten, we zaten deels in dezelfde richting met ons onderzoek, wat tot veel leuke discussies heeft geleid. Of kwam je toch alleen maar voor de dropjes naar H4-240? We promoveren nu ook nog vlak na elkaar. Succes volgende week! Jiska en Karlijn heel veel dank voor de hulp met het verzamelen van patiënten materiaal. De arts-assistenten & stafleden uit het AMC en Spaarne Ziekenhuis. Bedankt voor jullie interesse en bijdrage aan mijn opleiding en onderzoek. Ook hartelijk dank aan de arts-assistenten die bloed hebben afgestaan als gezonde controles. De verloskundigen & verpleegkundigen die mij attendeerden op mogelijke patiënten voor mijn onderzoek en die vele navelstrengen hebben verzameld voor mij (inclusief Henna). Hartelijk dank daarvoor. Secretaresses & poli-assistenten. Hartelijk dank voor alle logistieke onder-steuning. Mijn beste maatje Manje Dijkema. Lieve Manje, al in het eerste jaar van de studie hebben we elkaar ontmoet en we hebben daarna veel samen beleefd. Je was zo’n goede ceremoniemeester op mijn bruiloft dat je nu mijn paranimf “moet” zijn. Ik geniet ervan om met jou muziek te maken en te luisteren naar je prachtige verhalen. Maar ik geniet vooral van je omdat jij jij bent. Ik ben dankbaar dat ik zo’n goede vriend mag hebben. Goede vrienden zijn onbetaalbaar. Corine & Harry, Eveline, Ciska & Albert, Judy & Mike, �ashwan & Poupak, Susan & Eric, Tjalling & Vlada. Bedankt voor jullie interesse en voor alle gezelligheid. Ik hoop op nog vele leuke momenten met elkaar! Mijn ouders. Lieve pap & mam, zonder jullie was het een stuk moeilijker geweest om dit boekje te maken. Dat de inhoud van dit boekje er zo mooi uitziet heb ik helemaal aan jou te danken, pap. Er zijn heel wat uurtjes in gaan zitten, terwijl mam op Myrthe & Dafne paste. Maar ik ben er wel heel erg trots op! En ik denk jij eigenlijk ook wel. Maar ook bedankt voor jullie steun en interesse tijdens mijn hele studie en opleiding. Ik had eigenlijk het Sinterklaasgedicht over micropartikels als bijlage willen toevoegen, maar ik houd het toch maar voor mezelf.

214

Mijn (schoon)familie. Bedankt voor jullie interesse, het veelvuldig oppassen op mijn dochters en het zorgen voor ontspannende (soms muzikale) momenten tussen opleiding en promotie door. Mijn lieve en zorgzame Maarten, ik zou jou en de meiden eigenlijk als eerste moeten noemen want jullie zijn het allerbelangrijkste in mijn leven. Als ik ergens steun voor al mijn activiteiten kan vinden, is het wel bij jou. Nooit een onvertogen woord als ik weer eens laat thuis kom, weg moet of uren achter de computer zit. Samen chronisch vermoeid zijn door de nachtvoedingen en veel te lang opblijven om films te kijken nadat jij lekker gekookt hebt. Ik hoop nog veel samen met jou te mogen reizen en leuke dingen te doen, maar ik hoop vooral samen met jou en onze dochters oud te mogen worden. Mijn prachtige dochters, Myrthe & Dafne, jullie hebben onbewust een groot deel van het schrijven van dit proefschrift meegemaakt. Want met Sesamstraat aan de ene kant van het scherm en mijn Word document aan de andere kant, was iedereen tevreden. Een 20-inch breedbeeld computerscherm is onmisbaar voor iedere promoverende ouder met jonge kinderen.

Christianne

Curriculum Vitae

215

CURRICULUM VITAE

De auteur van dit proefschrift werd op 5 oktober 1973 in de (Haarlemmermeer)polder als

tweede dochter van Hans & Maaike Lok op de wereld gezet, met verloskundige begeleiding

van haar tante. Zij bracht haar jeugd door in Hoofddorp en bezocht de Jan van Nassau

school, waar zij in een klas zat met slechts vier andere meisjes. Inmiddels heeft zij bij twee

van hen de bevalling begeleid. De lagere schoolperiode werd afgerond op de Montessori

school in Hoofddorp. In 1992 behaalde zij haar VWO diploma aan het Atheneum “Adriaen

Pauw” in Heemstede.

Hierna studeerde zij Geneeskunde aan de Vrije Universiteit in Amsterdam. Tijdens

haar studie deed zij wetenschappelijk onderzoek bij Prof. dr. H.P. van Geijn en Dr. G.A.

Dekker op de afdeling Verloskunde van het Universitair Medisch Centrum van de Vrije

Universiteit (UMC-VU). Dit onderzoek betrof onder andere de farmacokinetiek van

nifedipine tijdens de behandeling van premature weeënactiviteit. Hierna heeft zij in

Oeganda meegewerkt aan onderzoek naar de verticale transmissie van HIV bij kinderen.

Extra co-schappen werden gevolgd op de afdelingen Neurochirurgie, Radiologie en

Cosmetische Chirurgie van het UMC-VU en de afdeling Internal Medicine van het Yeovil

District Hospital in Engeland.

Naast haar studie werkte zij als verzorgende in de thuiszorg en in een bejaardentehuis,

en als biometriste op de afdeling Verloskunde van het UMC-VU. In 1999 rondde zij haar

artsexamen cum laude af. Na het artsexamen werkte zij als arts-assistent niet in opleiding

op de afdelingen Verloskunde & Gynaecologie van het Kennemer Gasthuis in Haarlem, het

Academisch Medisch Centrum (AMC) in Amsterdam en het Medisch Centrum Alkmaar. In

het AMC begon zij onder leiding van Dr. A.C. Ansink met onderzoek naar verschillende

facetten van hoog-risico Trofoblast Ziekten.

In 2001 begon zij met de opleiding Verloskunde & Gynaecologie in het AMC met als

opleider Prof. dr. O.P. Bleker. Tussen januari 2003 en december 2004 werd de opleiding

tijdelijk onderbroken om basaal wetenschappelijk onderzoek te kunnen uitvoeren. Dit

onderzoek was een samenwerking tussen de afdelingen Verloskunde, Klinische Chemie en

Medische Fysica van het AMC. Dit proefschrift is het resultaat van deze samenwerking. In

april 2006 werd het AMC verlaten om in het Spaarne Ziekenhuis in Hoofddorp het laatste

deel van de specialistenopleiding te beginnen met Dr. M.H. Emanuel als opleider. In januari

2009 hoopt zij daar de opleiding af te ronden. Zij is getrouwd met Maarten Jansen en zij

hebben twee prachtige dochters: Myrthe (twee jaar oud) en Dafne (half jaar oud).

Documents

UvA-DARE (Digital Academic Repository) Microparticles in ... · pregnant women with HELLP syndrome, necessitating immediate delivery. Preeclampsia is a heterogeneous disorder, making