Upload
doque
View
214
Download
0
Embed Size (px)
Citation preview
UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)
UvA-DARE (Digital Academic Repository)
Microparticles in pregnancy and preeclampsia
Lok, C.A.R.
Link to publication
Citation for published version (APA):Lok, C. A. R. (2008). Microparticles in pregnancy and preeclampsia.
General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, statingyour reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Askthe Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,The Netherlands. You will be contacted as soon as possible.
Download date: 09 Aug 2019
Microparticles
in
pregnancy and preeclampsia
Publication of this thesis was generously sponsored by:
Stichting Wetenschappelijk Onderzoek Gynaecologie en Obstetrie Spaarne Ziekenhuis
Leerhuis Spaarnepoort
IQ products
Hagamedical B.V.
Ferring Pharmaceuticles
Bayer Health Care
Medical Dynamics
The Department of Obstetrics and Gynaecology of the Academic Medical Center
The Faculty of Medicine of the Academic Medical Center
Microparticles in pregnancy and preeclampsia
Christine A.R. Lok
PhD Thesis, University of Amsterdam - with summary in Dutch
ISBN: 978-90-9022936-2
Printed by: Ponsen & Looijen B.V.
Cover: K. Boer
Lay-out: H. Lok
© C.A.R. Lok, Hoofddorp, The Netherlands, 2008
Microparticles
in
pregnancy and preeclampsia
ACADEMISCH PROEFSCHRIFT
ter verkrijging van de graad van doctor
aan de Universiteit van Amsterdam
op gezag van de Rector Magnificus
prof. dr. D.C. van den Boom
ten overstaan van een door het college voor promoties
ingestelde commissie,
in het openbaar te verdedigen in de Aula der Universiteit
op woensdag 18 juni 2008, te 10:00 uur
door
Christine Anne Rachel Lok
Geboren te Hoofddorp
Promotiecommissie:
Promotores Prof. dr. J.A.M. van der Post
Prof. dr. A. Sturk
Co-promotores Dr. K. Boer
Dr. R. Nieuwland
Overige leden Dr. M.H. Emanuel
Prof. dr. H.P. van Geijn
Prof. dr. M.J. Heineman
Prof. dr. C.J.F. van Noorden
Prof. dr. H. Pannekoek
Prof. dr. I.L. Sargent
Faculteit der Geneeskunde
Aan mijn ouders
Contents
7
CO�TE�TS Part I General introduction
Chapter 1 Introduction and aim of the thesis 11
Chapter 2 Microparticles and exosomes: impact on normal and
complicated pregnancy
33
Part II Microparticle numbers and characteristics in
pregnancy and preeclampsia
Chapter 3 Changes in microparticle numbers and cellular origin
during pregnancy and preeclampsia
61
Chapter 4 Microparticle-associated P-selectin reflects platelet
activation in preeclampsia
79
Chapter 5 Circulating platelet- and placenta-derived microparticles
expose Flt-1 in preeclampsia
95
Part III Microparticles and inflammation
Chapter 6 Expression of inflammation-related genes in endothelial
cells is not directly affected by microparticles from
preeclamptic patients
113
Chapter 7 Leukocyte activation and circulating leukocyte-derived
microparticles in preeclampsia
135
Chapter 8 Cell-derived microparticles and complement activation in
preeclampsia versus normal pregnancy
157
Part IV General discussion, future perspectives and summary
Chapter 9 General discussion and future perspectives 177
Chapter 10 Summary 193
Samenvatting 199
Co-authors 207
Bibliography 209
Dankwoord 211
Curriculum vitae 215
9
PART I
General introduction
Chapter 1
Introduction and aim of the thesis
Chapter 1
12
I�TRODUCTIO� A�D AIM OF THE THESIS
1.1 General introduction
1.2 Preeclampsia
1.2.1 Clinical aspects of preeclampsia
1.2.2 Theories on the pathophysiology of preeclampsia
- The role of the placenta
- Endothelial dysfunction
- Inflammation
- Haemostasis
1.3 Aim and outline of the thesis
Introduction and aim of the thesis
13
1 1.1 GE�ERAL I�TRODUCTIO�
Preeclampsia is a pregnancy specific multisystem disorder, occurring in the second half of
pregnancy. The incidence in unselected populations is 2.6%1. Still, it is a major cause of
maternal and fetal morbidity and mortality. Preeclampsia is a syndrome, defined by
hypertension and proteinuria2-4. Clinical features, like edema, headache, visual
disturbances, nausea and pain in the upper abdominal region differ from patient to patient.
Preeclampsia can present as asymptomatic hypertension and proteinuria, but in rare cases it
can also evolve into multi-organ failure with complications like convulsions, cerebral
hemorrhage, liver failure, acute renal failure or respiratory insufficiency5. In addition,
preeclampsia may present with placental hypoperfusion which compromises the fetus and
subsequently leads to fetal growth retardation and distress, sometimes resulting in intra-
uterine fetal death.
The exact etiology of preeclampsia is still a matter of debate and many theories
have been proposed. A generally accepted hypothesis is the two-stage model of
preeclampsia (Figure 1)5.
Early in pregnancy, a defective trophoblast invasion into the spiral arteries of the
uterus occurs and these arteries fail to become low-resistance vessels. This results in a
disturbance of uteroplacental perfusion with subsequent placental hypoxia and oxidative
stress. In the second half of pregnancy, this leads to the release of factors from the placenta
into the maternal circulation and/or activation of leukocytes and platelets, all contributing to
a systemic inflammatory response characterized by an impairment of the endothelial
function2,6.
Since not all preeclamptic patients show these signs of hypoplacentation, however,
poor placentation is unlikely to be the exclusive cause for the development of preeclampsia.
Women with relatively large placentas (like in diabetes mellitus, multiple pregnancies or
hydatidiform mole pregnancies) are at risk of developing preeclampsia probably because of
a higher amount of factors released from the placenta. In this respect, the placental factors
STBM (syncytiotrophoblast basal membrane fragments or placenta-derived microparticles
(MP)) and sFlt-1 (soluble fms-like tyrosine kinase) are of particular interest and they will
be discussed in one of the following paragraphs.
Also, maternal susceptibility to “placental” factors is important. Patients with
thrombophilia, the metabolic syndrome, a genetic predisposition and preexisting vascular
disease have a higher chance of developing preeclampsia5. Thus, risk factors can be
identified although prediction of preeclampsia remains difficult. Preventive strategies have
been investigated extensively, but their efficacy appears variable and therefore, they are not
generally applied in clinical practice7.
Chapter 1
14
In short, preeclampsia is a trophoblast-induced disorder of pregnancy with
characteristics of a multisystem disease, resulting from an adverse maternal response to (in
part) allogenic placental tissue for which there seems to be only one causal therapy, i.e.
delivery of the placenta.
Figure 1. Two stage development of preeclampsia
Figure 1. A schematic representation of the currently adapted hypothesis that preeclampsia
develops in two stages. (I) Early in pregnancy a defective trophoblast invasion into the
spiral arteries of the uterus results in a high-resistance vasculature in the placenta with a
disturbance in uteroplacental perfusion. The risk of poor placentation is influenced by
genetic factors, immunologic factors and preexisting vascular disease. (II) In the second
half of pregnancy this results in oxidative stress and the release of factors from the
placenta into the maternal circulation or activation of leukocytes and platelets, all
contributing to a systemic inflammatory response characterized by an impairment of the
endothelial function.
Introduction and aim of the thesis
15
1 1.2 PREECLAMPSIA
1.2.1 Clinical aspects of preeclampsia
Preeclampsia is defined as de novo proteinuria and hypertension occurring after the 20th
week of pregnancy. The relation between preeclampsia and eclampsia became apparent in
the 18th century when Alexander Hamilton, Professor of Midwifery at the university of
Edinborough, described the symptoms that often preceed eclampsia (“pre”eclampsia)8. The
name preeclampsia strongly suggests that eclampsia is always preceded by preeclampsia.
However, the impressive clinical picture of eclampsia with generalized convulsions in
pregnant women without a history of epilepsy also develops in women without
hypertension or preeclampsia. Other related disorders are the HELLP syndrome (an
acronym of Hemolysis Elevated Liver Enzymes and Low Platelets) and AFLP (Acute Fatty
Liver of Pregnancy). Although HELLP is considered a severe complication of
preeclampsia, one third of the HELLP patients does not develop a blood pressure over 90
mmHg diastolic and/or proteinuria. AFLP is considered an often lethal complication in
pregnant women with HELLP syndrome, necessitating immediate delivery.
Preeclampsia is a heterogeneous disorder, making generalization of results from
different studies difficult. To solve this problem, several institutions have developed
definitions of preeclampsia. The most widely used criteria to define preeclampsia are those
of the ISSHP (International Society to the Studies of Hypertension in Pregnancy)3 which
are summarized in Table 1. These criteria are also used in this thesis. For HELLP
syndrome, we used the criteria described by Sibai (Table 2)9.
Table 1. The definition of preeclampsia
Criteria of preeclampsia from the ISSHP
1. Systolic blood pressure ≥140 mmHg or diastolic blood pressure ≥90 mmHg measured
on two separate occasions
2. Development of symptoms after 20th week of gestation
3. Urinary excretion of ≥0.3 gram protein in a 24-hour specimen
4. Normalization of blood pressure within 3 months after delivery
Different forms of hypertension may occur in pregnancy. A classification of hypertensive
disorders in pregnancy is presented in the report of the National High Blood Pressure
Education Program Working Group on High Blood Pressure in Pregnancy4. Four different
forms are described: 1) chronic hypertension, 2) preeclampsia, 3) preeclampsia
superimposed on chronic hypertension and 4) gestational hypertension.
Chronic hypertension is defined as hypertension observed before pregnancy or diagnosed
Chapter 1
16
before the 20th week of gestation. Hypertension that is diagnosed for the first time during
pregnancy and that does not resolve post partum is also classified as chronic hypertension.
Gestational blood pressure elevation is defined as a blood pressure ≥140 mmHg systolic or
≥90 mmHg diastolic, in a woman who was normotensive before 20 weeks’ gestation. It is
recommended that the diagnosis gestational blood pressure elevation is based on at least
two determinations of the blood pressure. Proteinuria is defined as the urinary excretion of
≥0.3 g protein in a 24-hour specimen. Preeclampsia is the combination of gestational
hypertension with proteinuria. If a patient with chronic hypertension develops symptoms of
preeclampsia, superimposed preeclampsia is present. Finally, gestational hypertension is
defined as transient hypertension of pregnancy with preeclampsia not being present at the
time of delivery and blood pressure normalizing within 3 months after delivery. Still, in
spite of the progress made in standardizing definitions, no real uniformity with respect to
the diagnosis of preeclampsia exists. This hampers research since preexisting hypertension
and kidney disease share common clinical features with preeclampsia but probably no
common cause.
Table 2. The definition of HELLP syndrome
1.2.2 Theories on the pathophysiology of preeclampsia
Preeclampsia has been called “the disease of theories” because of the large number of
hypotheses that have been postulated in an attempt to solve the etiology of preeclampsia in
order to find a cure for this syndrome. Although interesting findings have been reported,
preeclampsia still is “the great imposter”10. It is unlikely that a single factor underlies the
development of preeclampsia. The most important pathophysiologic mechanisms in
preeclampsia are summarized in this paragraph. One has to realize, however, that these
mechanisms may overlap considerably.
The role of the placenta
Although the precise etiology of preeclampsia is unclear, the placenta undoubtedly plays a
central role in preeclampsia. Delivery of the placenta leads to rapid recovery from all
symptoms. In diseases with an increased placental volume, the risk of preeclampsia is
elevated. The importance of the placenta also became clear from observations in patients
Criteria of HELLP syndrome
1. Signs of hemolysis (peripheral blood smear, lactate dehydrogenase >600 U/L or serum
bilirubin ≥1,2 mg/dL)
2. Elevated liver enzymes (aspartate aminotransferase ≥70 U/L)
3. Low platelet counts (<100*109/L)
Introduction and aim of the thesis
17
1 suffering from (complete) hydatidiform mole. These patients, presenting with an excessive
amount of abnormally developing trophoblast without embryonic tissue, can develop
symptoms of preeclampsia already early in pregnancy. Currently, these cases are hardly
seen in developed countries because of the early (ultrasonic) detection of hydatidiform
moles. However, cases of (in particular partial) molar pregnancies complicated by
gestational hypertension, preeclampsia or even eclampsia before 24 weeks gestational age
are still incidentally reported11,12. The exact cause of the preeclampsia in these cases is
unknown but it seems likely that the excess of placental volume composed of mainly
paternally-derived allogenic tissue, leading to an elevated release of placental factors into
the maternal circulation, plays a major role. Unfortunately, concentrations of e.g. placenta-
derived MP or sFlt-1 have not been investigated in gestational trophoblastic disease.
The chain of events leading from a hypoperfused placenta to the systemic
symptoms of preeclampsia is still obscure and multiple factors probably contribute to its
development. Factors of placental origin that have been suggested to play a role are the
release of trophoblast-debris into the maternal circulation, the increased production of (anti)
angiogenic factors, oxidative stress and the elevated release of inflammatory mediators.
Trophoblast-debris (STBM or placenta-derived MP) is also detectable in the
circulation of normotensive pregnant women. MP are membrane vesicles released from
trophoblastic cells, blood cells or endothelial cells upon activation or during apoptosis. MP
are released from cells by “shedding” and range in size between 0.1-1 µm. Cell-derived MP
in plasma predominantly originate from platelets. Increased numbers of MP from various
cell types have been reported to occur in diseases associated with a procoagulant state
(Chapter 2). MP, including placenta-derived MP, may modulate or reflect several of the
key-processes in preeclampsia, including endothelial dysfunction, inflammation and
coagulation. Although placenta-derived MP only compose a small fraction of the total
number of MP, elevated numbers have been reported in preeclamptic women compared to
normotensive pregnancy13. In contrast, placenta-derived MP were not increased in late
onset preeclampsia or intrauterine growth retardation (IUGR)14. Such MP’s were reported
to impair the relaxation of subcutaneous arteries15 and to activate neutrophils and T-cells in
vitro16,17 (see also Chapter 2). Circulating placenta-derived MP can bind to monocytes and
stimulate the production of the pro-inflammatory cytokines tumor necrosis factor-alpha
(TNFα), interleukin (IL)-12 and IL-1818. Therefore, subsets of MP may be involved in the
systemic inflammatory response in preeclampsia, but their exact contribution needs further
investigation.
Several anti-angiogenic factors are produced in the placenta. The concentrations
of both soluble (s) Flt-1 and soluble endoglin (sEng) in plasma are elevated in preeclampsia
and they are likely to play a role in the development of preeclampsia19. In fact, sFlt-1 and
sEng were reported to be elevated in plasma already before the onset of preeclampsia. Flt-1
Chapter 1
18
is one of the receptors of vascular endothelial growth factor (VEGF), but also binds the pro-
angiogenic placental growth factor (PlGF). VEGF is produced by several tissues including
the placenta and plays an important role in angiogenesis, regulation of the vascular tone and
thus blood pressure. In preeclampsia, the plasma concentration of VEGF is decreased due
to elevated concentrations of sFlt-1 (see Chapter 8), thereby inhibiting the biological
activity of VEGF. Indeed, in rat renal arterioles, the VEGF-induced relaxation is inhibited
by sFlt-1, and administration of sFlt1 to pregnant rats induces hypertension, proteinuria and
glomerular endotheliosis, symptoms classic for preeclampsia20. Adenovirus-mediated
overexpression of sEng in rodents leads to mild hypertension and elevated vascular
permeability21. The combined overexpression of sFlt-1 and sEng causes vascular damage
with severe hypertension and proteinuria, laboratory abnormalities and growth restriction22.
An imbalance between anti- and pro-angiogenic factors seems of high importance in the
development of preeclampsia. However, the specific roles of sFlt-1 and sEng in vivo still
have to be determined. It is not yet understood how underdevelopment and hypoxia of the
placenta lead to release of anti-angiogenic factors. Whether or not there is a role for
placenta-derived MP in delivering Flt-1 to the maternal tissues is also not known.
Because of the abnormal development of the placental vasculature in preeclampsia
it is generally assumed that both the subsequent ischemia and elevated rate of apoptosis are
caused by hypoxia. Pathological evidence of placental ischemia includes intravascular
fibrin depositions, intimal thickening, necrosis, atherosclerosis, endothelial damage and
placental infarcts22. These placental abnormalities are not uniformly present in cases of
preeclampsia. No direct measurements are available to confirm that hypoxia itself causes
these placental changes. Rather than merely hypoxia, an alteration between hypoxia and
reoxygenation leading to the production of oxygen radicals, the so-called oxidative stress,
seems responsible for the local damage in the placenta in preeclampsia23. Redman and
Sargent proposed that oxidative stress induces increased syncytiotrophoblast apoptosis and
necrosis, thereby increasing the shedding of placenta-derived MP24. Indeed, oxidative stress
causes apoptosis in numerous cell lines and triggers the production of cytokines like TNFα
in the placenta, which can lead to peroxidation of plasma lipids during placental passage
and to activation of maternal neutrophils25,26. Treating women at risk for preeclampsia with
anti-oxidants, i.e. vitamin A and E, however, did not prevent the development of
preeclampsia27. Although there is evidence of placental oxidative stress, the clinical
consequences are still unclear and other factors are likely to contribute to the development
of preeclampsia.
Pregnancy is a mild inflammatory state which is even more prominent in
preeclampsia2. Evidence that this systemic inflammation is initiated by inflammatory
mediators originating in the placenta is lacking. However, there are some findings that
suggest a placental origin of inflammation. It has been reported that leukocytes, especially
Introduction and aim of the thesis
19
1 neutrophils and monocytes, become activated during placental passage in preeclampsia28.
Whether this is the underlying cause of the elevated cytokine production in preeclampsia,
however, is unknown. On the other hand, hypoxia triggers the production of TNFα, IL-1α
and IL-1β in villous explants from human placenta29, but data from studies investigating the
expression of inflammation-related genes (especially TNFα, IL-1α, IL-1β, and IL-6) in
placental tissue from preeclamptic patients and normotensive pregnant women are
inconclusive30,31.
Endothelial dysfunction
There is convincing evidence that the endothelium is involved in the development of
preeclampsia. This evidence is based on electron microscopy findings, soluble markers of
endothelial cell activation, in vitro experiments with isolated arteries and in vivo
experiments in preeclamptic patients (see below). Still, there is no proof of a causative role
in the maternal syndrome.
Endothelial cell activation results in an altered function, more precise dysfunction,
of the maternal endothelium in preeclampsia. This dysfunction induces vasoconstriction
through an imbalance in the production of vasodilators and vasoconstrictors. An altered
vascular tone in small arteries changes the peripheral resistance and thus blood pressure.
Furthermore, endothelial cell activation leads to increased small vessel permeability
causing generalized edema. The endothelial damage in the kidney (also called glomerular
endotheliosis), which is characterized by enlargement of the endothelial cells with
vacuolization and a diminished capillary lumen, is likely to cause the proteinuria in
preeclampsia32.
Electron microscopy revealed that endothelial cells in myometrial arteries from
normotensive pregnant women show a continuous sheath of tightly connected and
elongated endothelial cells with intact cytoplasma membranes. In contrast, the arteries of
preeclamptic patients showed a disorganized lining of endothelial cells with shrunken cells
and detachment and blebbing of the cytoplasma membranes and attachment of protein
aggregates33.
Soluble markers of endothelial cell activation are summarized in Table 3. The
increase of some markers may predate the onset of symptoms and indicate that endothelial
function is indeed involved in the etiology of preeclampsia and not only a secondary
phenomenon.
In vitro experiments with wire-myography showed that endothelial-dependent
dilatation is impaired in isolated sub-cutaneous fat arteries41 and myometrial arteries42 from
preeclamptic patients. Furthermore, flow-mediated dilatation measured with perfusion-
myography is also impaired in sub-cutaneous fat arteries43 and myometrial arteries44 from
preeclamptic patients. These studies did not determine the underlying cause of the impaired
Chapter 1
20
endothelium-dependent dilatation. Incubation of myometrial vessels with MP from
preeclamptic patients caused reduced dilatation of the vessels45 and similar experiments
with comparable results were performed with placenta-derived MP15.
Table 3. Soluble markers of endothelial cell injury in preeclampsia
Marker Increase or decrease References
Cellular fibronectin ↑ 36
Endothelin-1 ↑ 34
sE-selectin ↑ 35
PAI-1/PAI-2 ratio ↑ 38
Prostacyclin ↓ 39
Trombomodulin ↑ 37
sVCAM-1 ↑ 35
Von Willebrand factor ↑ 40
Finally, in vivo evidence of endothelial dysfunction is difficult to obtain.
Ultrasonic measurement of the brachial artery after forearm cuff occlusion is often used to
evaluate flow-mediated dilatation in patients and controls. Such experiments show a
reduced dilatation in patients with preeclampsia46. These alterations already occur before
the onset of clinical symptoms of preeclampsia47.
Inflammation
Activation of many parts of the inflammatory network, like leukocyte activation, cytokine
release, leukocyte / endothelial interactions, activation of endothelial cells and stimulation
of the clotting cascade are present in preeclampsia. These changes reflect a sterile
inflammation brought about by pregnancy itself instead of infection. Although a mild
systemic inflammatory response in pregnancy is physiological, in preeclampsia this
response is much more intense24. Signs of inflammation in preeclampsia are summarized in
Table 4.
In preeclampsia, elevated numbers of leukocytes occur with signs of activation,
such as an intracellular rise of calcium, elevated expression of adhesion molecules and
complement-related markers on the leukocyte membrane51. Additionally, degranulation
products of neutrophils which are released upon cell activation, including myeloperoxidase,
lactoferrin and elastase, are elevated in preeclampsia51-53.
Introduction and aim of the thesis
21
1 Table 4. Signs of inflammation in preeclampsia
Signs of inflammation Increase or
decrease References
Clotting system activation ↑ Next paragraph
Complement activation ↑ / = Chapter 8
Endothelial cell activation ↑ Previous paragraph
Leukocytosis
Granulocytes
Lymfocytes
Monocytes
↑
=
↑
Chapter 7
48
49
Leukocyte activation
Adhesion molecules
Complement-related markers
Degranulation products
Intracellular calcium rise
↑
↑
↑
↑
28, 50
51
51
51-53, Chapter 7
54
Leukocyte phagocytosis ? 55*
Leukocyte priming ↑ 56*, 57
Platelet activation ↑ Next paragraph, Chapter 6
Plasma markers
CRP ↑ 47, 58
TNFα ↑ 18, 59-60
IL-1β ↑ / = 59, 60
IL-6 ↑ 59-61
IL-8 ↑ 18, 59, 61
IL-12 ↑ / = 18, 61-62
IL-18 ↑ / = 18, 63-64
IFNγ ↑ / = 18, 61
MCP-1 ↑ / = 61, 65
*Elevated in normal pregnancy, but not determined in preeclampsia
In pregnancy, adjustment of the immunological system is necessary to prevent rejection of
the (semi)allogenic fetus. One alteration that takes place is a shift towards Thelper (Th)2
immunity at the expense of cytotoxic Th1 responses. In preeclampsia, this shift fails to
develop with subsequent predominance of (pro- inflammatory) Th1 responses (Figure 2)66.
Chapter 1
22
Figure 2. Immunity response in pregnancy and preeclampsia
Figure 2. A mild systemic inflammatory response in pregnancy is physiological. In
preeclampsia, a predominance of (pro-inflammatory) Th1 response is present with the
cytokine balance changing in favor of pro-inflammatory cytokines.
Pro-inflammatory cytokines of potential importance for the inflammatory response in
preeclampsia are IL-1, IL-2, IL-6, IL-8, IL-12, IL-18, TNFα, IFNγ and MCP-1. In
preeclampsia, the balance between pro-inflammatory and anti-inflammatory agents is
changed in favor of the pro-inflammatory cytokines, and elevated levels of many of these
cytokines are observed in preeclampsia18,59,60,65. Also, an elevated concentration of C-
reactive protein (CRP), which is a marker of an overall increased inflammatory status, is
present in preeclampsia58 already before the onset of clinical symptoms47.
The complement system is an important part of the maternal immune system
(Figure 3). The complement system consists of several enzyme cascades which can be
triggered by various mechanisms. Activation products of the complement system induce
chemotaxis and activation of leukocytes. Hypothetically, complement activation may be
part of the systemic inflammatory response in preeclampsia. Therefore, the concentrations
Introduction and aim of the thesis
23
1 of complement factors and the role of classical pathway activation have been investigated
in preeclamptic patients and controls. The results from these studies, however, are
contradicting (see also Chapter 8) 51,67,68. The alternative pathway and the lectin pathway of
complement activation do not seem to be involved in the pathogenesis of preeclampsia,
although literature is scarce. Thus, a role for the complement system in the development of
preeclampsia is not yet definitely established.
Figure 3. Schematic representation of the complement cascade
Figure 3. There are three different pathways to initiate the complement cascade. The
classical pathway can be initiated by binding of C1q to the pathogen surface. This pathway
can also be activated by the binding of C1q to antibody-antigen complexes. The mannan-
binding lectin pathway is initiated by binding of mannan-binding lectin, a serum protein, to
mannose-containing carbohydrates on bacteria or viruses. Finally, the alternative pathway
can be initiated when a spontaneously activated complement component binds to the
surface of a pathogen. Each pathway follows a sequence of reactions to generate a
protease called C3 convertase. The C3 convertases then bind to the pathogen surface, and
cleave C3 into C3b, the main effector molecule of the complement system, and C3a, a
peptide mediator of inflammation.
Chapter 1
24
Haemostasis
Normal pregnancy is associated with extensive changes in haemostasis. Plasma
concentrations of prothrombin, factor VII, VIII, X and XII are increased in pregnancy. Also
prekallikrein and fibrinogen levels change. On the other (anti-coagulant and fibrinolytic)
side, activated protein C (APC) resistance is increased, and both plasminogen activator and
plasminogen activator inhibitor (PAI-1 and PAI-2) are elevated69. These changes in
haemostasis are essential to maintain uteroplacental blood flow during pregnancy and on
the other hand to control bleeding after parturition.
In preeclampsia, an increase of intravascular coagulation occurs, leading to
thrombus formation in the uteroplacental unit and other maternal organs. Intravascular
coagulation is reflected by an increased consumption of factor VIII and thrombin activity,
reduced levels of PAI-2 and an increased level of plasminogen activator. Since also
antitrombin levels are decreased in preeclampsia, the balance between coagulation and
anticoagulation systems is shifted towards coagulation, and thus a thrombotic tendency.
The impaired trophoblast invasion in the spiral arteries of the uterus in early pregnancy
leads to hypoperfusion and increased fibrin deposition in the placental vasculature.
Histologically, “acute sclerosis” can be found, which is characterized by fibrinoid necrosis,
accumulation of lipophages in the arterial wall and plaques on the intima of the vessels.
Another sign strongly suggesting a disturbance in the haemostatic balance in preeclampsia
is the elevated risk of patients with inherited trombophilias to develop this disease.
Platelets play an essential role in haemostasis. Activation of platelets is evident in
preeclamptic patients as indicated by an elevated number of platelets exposing P-selectin70-
72 and by elevated levels of β-thromboglobulin and soluble P-selectin in plasma70, 73. Upon
activation, platelets release MP. In human blood, circulating MP predominantly originate
from platelets. MP, especially platelet-derived MP (PMP), are known for their procoagulant
properties. They expose relatively high numbers of binding sites for activated coagulation
factors. MP of various cellular origin, including those of platelet origin, may expose tissue
factor (TF), or may trigger cellular expression and production of TF. MP support
coagulation in vitro as well as in vivo, and increased numbers of MP from various cell types
have been reported to occur in diseases associated with a procoagulant state (Chapter 2).
Introduction and aim of the thesis
25
1 1.3 AIM A�D OUTLI�E OF THE THESIS
As mentioned in the previous paragraphs, MP may modulate or reflect several of the key-
processes in preeclampsia, including endothelial dysfunction, inflammation and coagulation
activation. Therefore, MP may be one of the factors contributing to the development or
aggravation of preeclampsia. The aim of this thesis was to test the hypothesis that MP play
a role in the development or severity of preeclampsia.
A review of the current knowledge of MP in pregnancy and preeclampsia is
described in Chapter 2. As will become clear from this chapter, longitudinal data of MP
numbers during the course of a normotensive pregnancy are lacking. Thus, reference values
of physiologic pregnancies at different gestational ages are not available. Because normal
pregnancy causes hemodynamic, metabolic and immunological alterations and changes in
many plasma constituents, the effect of pregnancy itself, gestational age and the different
phases of placentation on MP formation could be anticipated and was therefore analyzed
longitudinally in healthy normotensive pregnant patients. This longitudinal study is
described in Chapter 3. In this study, we confirmed that platelet-derived MP (PMP)
compose 95-99% of the total MP population. This largest fraction was most likely to be
involved in the etiology of PE. Moreover, platelet activation is an important feature in
preeclampsia. Therefore, PMP were the focus of interest in Chapter 4 in which the
exposure of the adhesion molecule P-selectin on MP was analyzed. Whereas the increased
percentage of PMP reflected platelet activation, their absolute number decreased compared
to normotensive pregnancies. Thus, characteristics of MP are at least as important as total
MP numbers. Therefore, other subpopulations of MP were also investigated. Expression of
the anti-angiogenic VEGF receptor, Flt-1 (fms-like tyrosine kinase-1) on MP was analyzed
in Chapter 5. Since pro- and anti-angiogenic factors are likely to play a role in the
development of preeclampsia and the placenta is an important source for the production of
the soluble form of Flt-1, we investigated in this chapter whether Flt-1 is exposed by
placenta-derived MP.
Indeed, more MP characteristics proved to be different between preeclamptic
patients and pregnant and non-pregnant control patients. Therefore it was important to
investigate how MP from preeclamptic patients may affect endothelial cells. This was
analyzed in Chapter 6 by measuring the RNA expression of inflammation-related genes in
cultured endothelial cells in the presence of MP from preeclamptic patients or controls.
Although we could not establish an effect of MP on endothelial cell RNA expression in this
study, vascular effects of both total numbers of MP as well as subpopulations of MP have
been described by others.
In previous experiments there was evidence of increased numbers of leukocyte-
Chapter 1
26
derived MP in preeclamptic patients compared to normotensive pregnant controls. It is not
known, however, how this relates to leukocyte activation in the maternal circulation. In
Chapter 7, we studied whether the numbers of the different leukocyte-derived MP are
related to markers of leukocyte activation and to RNA expression of inflammation-related
genes in maternal leukocytes.
Another important part of the maternal immune system is the complement
cascade. Its involvement in the development of preeclampsia has been suggested by several
investigators. We tested in Chapter 8 whether MP expose complement factors and can be
associated with classical pathway activation.
In view of all these findings, a conclusion concerning the role of MP in
preeclampsia will be provided in Chapter 9 and possible goals for future research will be
defined.
REFERE�CES
1. Morris RK, Cnossen JS, Khan KS, Robson SC, Kleijnen J, Ter Riet G, Mol BW, Van
der Post JAM. Serum screening with Down’s syndrome markers to predict pre-
eclampsia and fetal growth restriction: Systematic review and meta-analysis. HTA
report 01/64/04 2008;12(6), (www.hta.ac.uk).
2. Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science
2005;308:1592-4.
3. Brown MA, Lindheimer MD, de SM, Van AA, Moutquin JM. The classification and
diagnosis of the hypertensive disorders of pregnancy: statement from the International
Society for the Study of Hypertension in Pregnancy (ISSHP). Hypertens Pregnancy
2001;20:IX-XIV.
4. Report of the National High Blood Pressure Education Program Working Group on
High Blood Pressure in Pregnancy. Am J Obstet Gynecol 2000;183:S1-S22.
5. Sibai B, Dekker G, Kupferminc M. Pre-eclampsia. Lancet 2005;365:785-99.
6. Borzychowski AM, Sargent IL, Redman CW. Inflammation and pre-eclampsia. Semin
Fetal Neonatal Med. 2006;11:309-16.
7. Meads CA, Khan KS, Hyde CJ, Cnossen JS, Meher S, Juarez-Garcia A, ter Riet G,
Duley L, Roberts TE, Mol BW, van der Post JA, Leeflang MM, Barton PM, Gupta JK.
Methods of prediction and prevention of pre-eclampsia – systematic reviews of
accuracy and effectiveness literature with economic modelling
(http://www.hta.ac.uk/1337).
8. Hamilton AM. History of a case of convulsions in pregnancy. Edinburgh medical and
surgical journal, and medical literature of Edinburgh 1824;20:318.
Introduction and aim of the thesis
27
1 9. Sibai BM. The HELLP syndrome (hemolysis, elevated liver enzyme levels, and low
platelets): much ado about nothing? Am J Obstet Gynecol 1990;162:311-6.
10. Goodlin RC. Preeclampsia as the great impostor. Am J Obstet Gynecol
1991;164:1577-80.
11. Wong LF, Stuart B, Gleeson N. Triploidy partial mole and proteinuric hypertension. J
Obstet Gynaecol 2007;27:424-5.
12. Prasannan-Nair C, Reynolds SF, Budden G. Partial molar pregnancy with severe pre-
eclampsia at 19 weeks' gestation. J Obstet Gynaecol 2006;26:817.
13. Knight M, Redman CW, Linton EA, Sargent IL. Shedding of syncytiotrophoblast
microvilli into the maternal circulation in pre-eclamptic pregnancies. Br J Obstet
Gynaecol 1998;105:632-40.
14. Goswami D, Tannetta D, Magee LA, Fuchisawa A, Redman CWG, Sargent IL,
Dadelszen P. Excess syncytiotrophoblast microparticle shedding is a feature of early-
onset pre-eclampsia, but not either late-onset pre-eclampsia or normotensive
intrauterine growth restriction. Placenta 2006;27:56-61.
15. Cockell AP, Lear mont JG, Smarason AK, Redman CW, Sargent IL, Poston L. Human
placental syncytiotrophoblast microvillous membranes impair maternal vascular
endothelial function. Br J Obstet Gynaecol 1997;104:235-40.
16. Gupta AK, Hasler P, Holzgreve W, Gebhardt S, Hahn S. Induction of neutrophil
extracellular DNA lattices by placental microparticles and IL-8 and their presence in
preeclampsia. Hum Immunol 2005;66:1146-54.
17. Gupta AK, Rusterholz C, Holzgreve W, Hahn S. Syncytiotrophoblast micro-particles
do not induce apoptosis in peripheral T lymphocytes, but differ in their activity
depending on the mode of preparation. J Reprod Immunol 2005;68:15-26.
18. Germain SJ, Sacks GP, Sooranna SR, Sargent IL, Redman CW. Systemic
inflammatory priming in normal pregnancy and preeclampsia: the role of circulating
syncytiotrophoblast microparticles. J Immunol 2007;178:5949-56.
19. Levine RJ, Lam C, Qian C, Yu KF, Maynard SE, Sachs BP, Sibai BM, Epstein FH,
Romero R, Thadhani R, Karumanchi SA; CPEP Study Group. Soluble endoglin and
other circulating antiangiogenic factors in preeclampsia. N Engl J Med 2006;355:992-
1005.
20. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann TA, Morgan
JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP, Karumanchi SA. Excess
placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial
dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest
2003;111:649-58.
21. Venkatesha S, Toporsian M, Lam C, Hanai J, Mammoto T, Kim YM, Bdolah Y, Lim
KH, Yuan HT, Libermann TA, Stillman IE, Roberts D, D'Amore PA, Epstein FH,
Chapter 1
28
Sellke FW, Romero R, Sukhatme VP, Letarte M, Karumanchi SA. Soluble endoglin
contributes to the pathogenesis of preeclampsia. Nat Med 2006;12:642-9.
22. Maynard S, Epstein FH, Karumanchi SA. Preeclampsia and angiogenic imbalance.
Annu Rev Med 2008;59:61-78.
23. Hung T, Skepper JN, Charnock-Jones, S, Burton GJ. Hypoxia-reoxygenation. A
potent inducer of apoptotic changes in the human placenta and possible etiological
factor in preeclampsia. Circ Res 2002;90:1274-81.
24. Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science
2005:308;1592-4.
25. Jauniaux E, Poston L, Burton GJ. Placental-related diseases of pregnancy:
involvement of oxidative stress and implications in human evolution. Hum Reprod
Update 2006;12:747-55.
26. Poston L, Endothelial dysfunction in pre-eclampsia. Pharmacological Reports
2006;57:69-74.
27. Poston L, Briley AL, Seed PT, Kelly FJ, Shennan AH. Vitamins in Pre-eclampsia
(VIP) Trial Consortium. Vitamin C and vitamin E in pregnant women at risk for pre-
eclampsia (VIP trial): randomised placebo-controlled trial. Lancet 2006;367:1145-54.
28. Mellembakken JR, Aukrust P, Olafsen MK, Ueland T, Hestdal K, Videm V.
Activation of leukocytes during the uteroplacental passage in preeclampsia.
Hypertension 2002;39:155-60.
29. Benyo DF, Miles TM, Conrad KP. Hypoxia stimulates cytokine production by villous
explants from the human placenta. J Clin Endocrinol Metab 1997;82:1582-8.
30. Rinehart BK, Terrone DA, Lagoo-Deenadayalan S, Barber WH, Hale EA, Martin JN
Jr, Bennett WA. Expression of the placental cytokines tumor necrosis factor alpha,
interleukin 1beta, and interleukin 10 is increased in preeclampsia. Am J Obstet
Gynecol 1999;181:915-20.
31. Benyo DF, Smarason A, Redman CW, Sims C, Conrad KP. Expression of
inflammatory cytokines in placentas from women with preeclampsia. J Clin
Endocrinol Metab 2001;86:2505-12.
32. Gaber LW, Spargo BH, Lindheimer MD. Renal pathology in pre-eclampsia. Baillieres
Clin Obstet Gynaecol 1987;1:971-95.
33. Svedas E, Nisell H, Vanwijk MJ, Nikas Y, Kublickiene KR. Endothelial dysfunction
in uterine circulation in preeclampsia: can estrogens improve it? Am J Obst Gyn
2002;187:1608-16.
34. Schiff E, Ben-Baruch G, Peleg E, Rosenthal T, Alcalay M, Devir M, Mashiach S.
Immunoreactive circulating endothelin-1 in normal and hypertensive pregnancies. Am
J Obstet Gynecol 1992;166:624-8.
Introduction and aim of the thesis
29
1 35. Chaiworapongsa T, Romero R, Kim YM, Kim GJ, Kim MR, Espinoza J, Bujold E,
Gonçalves L, Gomez R, Edwin S, Mazor M. Plasma soluble vascular endothelial
growth factor receptor-1 concentration is elevated prior to the clinical diagnosis of
pre-eclampsia. J Matern Fetal Neonatal Med 2005;17:3-18.
36. Powers RW, Evans RW, Ness RB, Crombleholme WR, Roberts JM. Homocysteine
and cellular fibronectin are increased in preeclampsia, not transient hypertension of
pregnancy. Hypertens Pregnancy 2001;20:69-77.
37. Boffa MC, Valsecchi L, Fausto A, Gozin D, Vigano' D'Angelo S, Safa O, Castiglioni
MT, Amiral J, D'Angelo A. Predictive value of plasma thrombomodulin in
preeclampsia and gestational hypertension. Thromb Haemost 1998;79:1092-5.
38. Reith A, Booth NA, Moore NR, Cruickshank DJ, Bennett B. Plasminogen activator
inhibitors (PAI-1 and PAI-2) in normal pregnancies, pre-eclampsia and hydatidiform
mole. Br J Obstet Gynaecol 1993;100:370-4.
39. Suzuki Y, Hattori T, Kajikuri J, Yamamoto T, Suzumori K, Itoh T. Reduced function
of endothelial prostacyclin in human omental resistance arteries in pre-eclampsia. J
Physiol 2002;545:269-77.
40. Calvin S, Corrigan J, Weinstein L, Jeter M. Factor VIII: von Willebrand factor
patterns in the plasma of patients with pre-eclampsia. Am J Perinatol1988;5:29-32.
41. McCarthy AL, Woolfson RG, Raju SK, Poston L. Abnormal endothelial cell function
of resistance arteries from women with preeclampsia. Am J Obstet Gynecol
1993;168:1323-30.
42. Ashworth JR, Baker PN, Warren AY, Johnson IR. Mechanisms of endothelium-
dependent relaxation in myometrial resistance vessels and their alteration in
preeclampsia. Hypertens Pregnancy 1999;18:57-71.
43. Cockell AP, Poston L. Flow-mediated vasodilatation is enhanced in normal pregnancy
but reduced in preeclampsia. Hypertension 1997;30:247-51.
44. Kublickiene KR, Lindblom B, Krüger K, Nisell H. Preeclampsia: evidence for
impaired shear stress-mediated nitric oxide release in uterine circulation. Am J Obstet
Gynecol 2000;183:160-6.
45. Van Wijk MJ, Svedas E, Boer K, Nieuwland R, Vanbavel E, Kublickiene KR: Isolated
microparticles, but not whole plasma, from women with preeclampsia impair
endothelium-dependent relaxation in isolated myometrial arteries from healthy
pregnant women. Am J Obstet Gynecol 2002;187:1686-93.
46. Yamamoto T, Suzuki Y, Kojima K, Suzumori K. Reduced flow-mediated vasodilation
is not due to a decrease in production of nitric oxide in preeclampsia. Am J Obstet
Gynecol 2005;192:558-63.
47. García RG, Celedón J, Sierra-Laguado J, Alarcón MA, Luengas C, Silva F, Arenas-
Mantilla M, López-Jaramillo P. Raised C-reactive protein and impaired flow-mediated
Chapter 1
30
vasodilation precede the development of preeclampsia. Am J Hypertens 2007;20:98-
103.
48. Paeschke S, Chen F, Horn N, Fotopoulou C, Zambon-Bertoja A, Sollwedel A,
Zenclussen ML, Casalis PA, Dudenhausen JW, Volk HD, Zenclussen AC. Pre-
eclampsia is not associated with changes in the levels of regulatory T cells in
peripheral blood. Am J Reprod Immunol 2005;54:384-9.
49. Smárason AK, Gunnarsson A, Alfredsson JH, Valdimarsson H, Monocytosis and
monocytic infiltration of decidua in early pregnancy. J Clin Lab Immunol 1986;21:1–
5.
50. Sacks GP, Studena K, Sargent K, Redman CW. Normal pregnancy and preeclampsia
both produce inflammatory changes in peripheral blood leukocytes akin to those of
sepsis. Am J Obstet Gynecol 1998;179:80-6.
51. Mellembakken JR, Hogasen K, Mollnes TE, Hack CE, Abyholm T, Videm V.
Increased systemic activation of neutrophils but not complement in preeclampsia.
Obstet Gynecol 2001;97:371-4.
52. Gupta AK, Gebhardt S, Hillermann R, Holzgreve W, Hahn S. Analysis of plasma
elastase levels in early and late onset preeclampsia. Arch Gynecol Obstet
2006;273:239-42.
53. Belo L, Santos-Silva A, Caslake M, Cooney J, Pereira-Leite L, Quintanilha A, Rebelo
I. Neutrophil activation and C-reactive protein concentration in preeclampsia.
Hypertens Pregnancy 2003;22:129-41.
54. von Dadelszen P, Wilkins T, Redman CW. Maternal peripheral blood leukocytes in
normal and pre-eclamptic pregnancies. Br J Obstet Gynaecol 1999;106:576-81.
55. Koumandakis E, Koumandaki I, Kaklamani E, Sparos L, Aravantinos D, Trichopoulos
D. Enhanced phagocytosis of mononuclear phagocytes in pregnancy. Br J Obstet
Gynaecol 1986;93:1150-4.
56. Sacks GP, Redman CW, Sargent IL. Monocytes are primed to produce the Th1 type
cytokine IL-12 in normal human pregnancy: an intracellular flow cytometric analysis
of peripheral blood mononuclear cells. Clin Exp Immunol 2003;131:490-7.
57. Luppi P, Deloia JA. Monocytes of preeclamptic women spontaneously synthesize pro-
inflammatory cytokines. Clin Immunol 2006;118:268-75.
58. Paternoster DM, Fantinato S, Stella A, Nanhorngue KN. Milani M, Plebani M,
Nicolini U, Girolami A. C-reactive protein in hypertensive disorders in pregnancy.
Clin Appl Thromb Hemost 2006;12:330-7.
59. Koçyigit Y, Atamer Y, Atamer A, Tuzcu A, Akkus Z. Changes in serum levels of
leptin, cytokines and lipoprotein in pre-eclamptic and normotensive pregnant women.
Gynecol Endocrinol 2004;19:267-73.
60. Conrad KP, Miles TM, Benyo DF. Circulating levels of immunoreactive cytokines in
Introduction and aim of the thesis
31
1 women with preeclampsia. Am J Reprod Immunol 1998;40:102-11.
61. Jonsson Y, Rubèr M, Matthiesen L, Berg G, Nieminen K, Sharma S, Ernerudh J,
Ekerfelt C. Cytokine mapping of sera from women with preeclampsia and normal
pregnancies. J Reprod Immunol 2006;70:83-91.
62. Daniel Y, Kupferminc MJ, Baram A, Jaffa AJ, Fait G, Wolman I, Lessing JB. Plasma
interleukin-12 is elevated in patients with preeclampsia. Am J Reprod Immunol
1998;39:376-80.
63. Adams KM, Mandel LS, Guthrie KA, Atkinson MW. Interleukin-18 in the plasma of
women with preeclampsia. Am J Obstet Gynecol 2003;188:1234-7.
64. Sakai M, Shiozaki A, Sasaki Y, Yoneda S, Saito S. The ratio of interleukin (IL)-18 to
IL-12 secreted by peripheral blood mononuclear cells is increased in normal pregnant
subjects and decreased in pre-eclamptic patients. J Reprod Immunol 2004;61:133-43.
65. Kauma S, Takacs P, Scordalakes C, Walsh S, Green K, Peng T. Increased endothelial
monocyte chemoattractant protein-1 and interleukin-8 in preeclampsia. Obstet
Gynecol 2002;100:706-14.
66. Sargent IL, Borzychowski AM, Redman CW. NK cells and human pregnancy - an
inflammatory view. Trends Immunol 2006;27:399-404.
67. Houwert-de Jong MH, Claas FH, Gmelig-Meyling FH, Kalsbeek GL, Valentijn RM,
te Velde ER, Schuurman HJ. Humoral immunity in normal and complicated
pregnancy. Eur J Obstet Gynecol Reprod Biol 1985;19:205-14.
68. Massobrio M, Benedetto C, Bertini E, Tetta C, Camussi G. Immune complexes in
preeclampsia and normal pregnancy. Am J Obstet Gynecol 1985;152:578-83.
69. O'Riordan MN, Higgins JR. Haemostasis in normal and abnormal pregnancy. Best
Pract Res Clin Obstet Gynaecol 2003;17:385-96.
70. Holthe MR, Staff AC, Berge LN, Lyberg T. Different levels of platelet activation in
preeclamptic, normotensive pregnant, and nonpregnant women. Am J Obstet Gynecol
2004;190:1128-34.
71. Konijnenberg A, Stokkers EW, van der Post JA, Schaap MC, Boer K, Bleker OP,
Sturk A, Extensive platelet activation in preeclampsia compared with normal
pregnancy: enhanced expression of cell adhesion molecules. Am J Obstet Gynecol
1997;176:461-9.
72. Yoneyama Y, Suzuki S, Sawa R, Kiyokawa Y, Power GG, Araki T. Plasma adenosine
levels and P-selectin expression on platelets in preeclampsia. Obstet Gynecol
2001;97:366-70.
73. Hayashi M, Inoue T, Hoshimoto K, Negishi H, Ohkura T, Inaba N. Characterization
of five marker levels of the hemostatic system and endothelial status in normotensive
pregnancy and pre-eclampsia. Eur J Haematol 2002;69:297-302.
Chapter 2
Microparticles and exosomes: impact on
normal and complicated pregnancy
B. Toth, C.A.R. Lok, A.N. Böing, M. Diamant, J.A.M. van der Post,
K. Friese, R. Nieuwland
Am. J. Reprod. Immunol. 2007;5:389-402
Chapter 2
34
ABSTRACT
Eukaryotic cells release vesicles into their environment by membrane shedding (ectosomes
or microparticles) and secretion (exosomes). Microparticles and exosomes occur commonly
in vitro and in vivo. The occurrence, composition and function(s) of these vesicles change
during disease (progression). During the last decade, the scientific and clinical interest has
increased tremendously. Evidence is accumulating that microparticles and exosomes may
be of pathophysiological relevance in autoimmune, cardiovascular and thromboembolic
diseases, as well as in inflammatory and infectious disorders. In this review we will briefly
summarize the discovery, biology, structure and function of microparticles and exosomes,
and discuss their (patho-) physiological role during normal and complicated pregnancy.
Cell-derived vesicles and human pregnancy
35
2
I�TRODUCTIO�
Microparticles
Already in the 1940’s, human blood and plasma were shown to contain a subcellular
clotting-promoting factor1. More than 25 years later it was demonstrated that this fraction
consists of small platelet-derived particles2. Their clinical relevance became apparent in
1979, when a case report was presented of a young woman with an unexplained congenital
bleeding disorder. She suffered from a disease, later termed Scott syndrome, characterized
by reduced prothrombin consumption due to impaired release of microparticles (MP) and
phospholipid scrambling3,4.
MP are released from cells by “shedding” and, according to most investigators,
range in size between 0.1-1 µm. In contrast to MP, exosomes are secreted from intracellular
multi-vesicular bodies (MVB) and range in size from 30–90 nm (Figure 1). Figure 1. Microparticles and exosomes
Figure 1. This figure shows the formation of an endosome by invagination. By inward
blebbing of the endosomal membrane, intraluminal vesicles are formed. Endosomes
containing intraluminal vesicles are called multivesicular bodies (MVB). Cells release the
contents of their MVB when the membrane of the MVB fuses with the plasma membrane. In
contrast to exosomes, MP are formed by major structural rearrangements of the
cytoskeleton and are ‘budded’ off from the outer cell membrane.
Chapter 2
36
MP are widely distributed and commonly occur in cell cultures in vitro and in body fluids
in vivo. For instance, human blood contains MP as well as exosomes originating from
various types of cells5. Many studies on MP showed that their numbers, cellular origin,
composition and function(s) are disease (state) dependent, but whether or not these changes
are related to disease development or are a consequence of the disease process itself is still
debated. Proteomes of MP, isolated from human platelets, endothelial cells, malignant cells,
lymphocytes and plasma, have been published6-9. These studies identified a myriad of
proteins, including structural proteins, metabolic enzymes, integrins and membrane fusion
proteins.
Exosomes
Exosomes were described in the early 1980's as 5’-nucleotidase activity-containing
vesicles.10 Subsequently, exosomes were shown to be involved in the removal of the
transferrin receptor from maturing reticulocytes. This surface receptor internalizes by
“inward” blebbing. These blebs (endosomes) pinch off very small (30-90 nm)
“intraluminal” vesicles. Endosomes containing “intraluminal vesicles” are called MVB.
Finally, once 'intraluminal' vesicles become secreted, i.e. after membrane fusion of MVB
and the surrounding plasma membrane, they are called exosomes11-13.
Similar to MP, exosomes are also widely distributed and commonly occur in cell
cultures in vitro and in body fluids in vivo5. Exosomes are smaller than (most) MP and their
proteomes differ14. Exosomes contain cytosolic proteins or proteins from the endocytic
compartment or plasma membrane, whereas proteins of nuclear, mitochondrial,
endoplasmic-reticulum or Golgi-apparatus origin are absent15. About 80% of exosomal
proteins are conserved among species, and characteristic (but not distinctive) protein
families include tetraspannins, heat shock proteins and MHC class I and II molecules15.
Also proteomes of exosomes from various human body fluids have been determined16-17.
It should be mentioned, that isolation procedures of MP and exosomes often differ
between investigators18. To exclude contamination of small cells (e.g. platelets), loss of
vesicles and functional changes, isolation procedures of MP and exosomes need to be taken
into account when data from different research groups are compared. For instance, the in
vitro methods to isolate syncytiotrophoblast-derived MP (STBM) strongly affect their
effects on T lymphocytes19. Also the use of different CD markers for identification,18,20-22
age23 and food consumption24,25 may affect circulating numbers of MP and, possibly, also
exosomes. Figure 2 illustrates the increasing scientific and clinical interest in MP and
exosomes. This increase may be explained by the long and ever increasing list of
biologically relevant functions that have been attributed to these vesicles, and their
association with disease (progression).
Cell-derived vesicles and human pregnancy
37
2
Figure 2. Scientific interest in microparticles and exosomes (1965–2005)
Figure 2. This overview shows the growing scientific interest in extracellular vesicles.(a)
Scientific publications on microparticles from platelets, erythrocytes, leukocytes,
endothelial cells, tumor cells, and other cells.(b) Exosomes. This figure was produced from
PubMed, using as searchstring in All indexed fields [microparticle\*] OR [vesicle\*] OR
[bleb\*]OR [particle\*] AAD All indexed fields [erythrocyte\*] OR [platelet\*]
OR[thrombocyte\*] OR [granulocyte\*] OR [monocyte\*] OR [endothelial\*].For tumor-
derived vesicles, a different search string was used: Title[particle\*] OR [vesicle\*] OR
[bleb\*] OR [microparticle\*] OR [microvesicle\*]OR [shed\*] AAD Title [tumour\*] OR
[tumor\*] OR [cancer\*]. For exosomes, the search string All fields [Exosome\*] was used.
This figure was prepared by R. J. Berckmans, PhD (AMC, the Aetherlands).
MP are best known for their coagulant properties, especially platelet-derived MP
(PMP) which expose (per surface area, compared to platelets) high numbers of binding sites
for (activated) coagulation factors, thereby enabling formation of tenase- and
prothrombinase complexes. According to most investigators, PMP are by far the most
common MP occurring in human blood. MP of various cellular origin, including PMP, may
expose tissue factor (TF), the initiator of coagulation in vivo,26-29 and this TF may be
transferred to other cells30-31. Alternatively, by binding to cells, MP also trigger expression
and production of TF. At least in vitro, PMP facilitate inactivation of coagulation factors
Va and VIIIa by activated protein C. Thus, (P)MP may also possess anti-coagulant
properties32. MP support coagulation in vitro as well as in vivo, and increased numbers of
MP from various cell types have been reported to occur in diseases associated with a
procoagulant state (summarized in Table 1).
Chapter 2
38
Table 1. Cellular origin of circulating microparticles in prothrombotic diseases
Disease Cellular origin of MP Reference(s) Anti-Phospholipid Syndrome Monocytes 104 Endothelial cells 105 Atherosclerosis Leukocytes 106 Coronary Artery Disease Platelets 107 Endothelial cells 108 Monocytes 109 Cancer Platelets 110 Diabetes Mellitus Platelets 111 Granulocytes 112 Monocytes 113 Heparine-induced Platelets 114 thrombocytopenia Hypertension Platelets 115 Monocytes 116 Idiopathic Thrombocytopenia Platelets 117 Paroxysmal nocturnal Platelets 118 hemoglobinuria Sepsis Platelets, Granulocytes 28 Leukocytes 119 Systemic Lupus Erythematosus Platelet 120 Thrombotic Thrombocytopenic Endothelium 121 purpura Uraemia Platelets 122 Vasculitis Endothelial cells 22 Neutrophils, Platelets 123 Sickle cell Disease Erythrocytes 124 Endothelial cells, Monocytes 125
Functions of microparticles and exosomes
The list of MP functions is growing rapidly and include not only coagulation but also
inflammation33, leukocyte adhesion and aggregation34, angiogenesis35, vasoconstriction36,
immune modulation37-39, and endothelial dysfunction36,40. Since most functions were
established only in vitro by using isolated vesicle preparations in model systems, we (still)
do not know to which extent MP also exhibit such functions in vivo. With regard to
coagulation, however, there is direct evidence that MP promote coagulation and thrombus
formation in vivo26, 41.
Cell-derived vesicles and human pregnancy
39
2
Initially, exosomes were considered to be “dustbins” used by cells to remove
redundant molecules, e.g. the transferrin receptors. Recent findings that caspase 3, heat-
shock proteins and cytostatic drugs may accumulate in exosomes (and MP), are in line with
this function42-46. Exosomes may also contribute to a change in haemostatic balance
towards a procoagulant state. In vitro-prepared exosomes from mast cells support thrombin
generation and induce endothelial expression of plasminogen activator inhibitor-147. In
general, cell-derived vesicles may transmit infectious agents or receptors that facilitate the
uptake of infectious agents into (target) cells. Exosomes facilitate spreading of prion
proteins,48 and MP may transfer various receptors that facilitate cellular uptake of human
immunodeficiency virus-149,50. Gould and coworkers proposed the ‘Trojan exosome’
hypothesis, in which they postulated that retroviruses may use exosomes as vehicles for
extracellular traffic and infection.
The most important function of cell-derived vesicles, however, seems to be
intercellular communication. By exposing cell-type specific adhesion receptors or ligands,
vesicles can bind to particular cells and deliver their “message” (e.g. bioactive lipids,
cytokines and growth factors)51. It has become firmly established that exosomes modulate
the immune response15. On the one hand they can facilitate antigen presentation, and on the
other hand suppress the immune response e.g. by exposing FasL52,53. Exosomes from
antigen-presenting (dendritic) cells, “dexosomes”, expose MHC class I and II molecules15.
Dexosomes have been tested in clinical trials as adjuvant anti-cancer therapy, they suppress
graft-versus-host disease in various animal models and protect against Toxoplasma gondii
infection54-57. Although the functions of MP and exosomes are many, their true (patho)
physiological functions in vivo are still unknown.
MICROPARTICLES A�D EXOSOMES I� �ORMAL PREG�A�CY
The success of human pregnancy depends on various physiologic processes. First,
pregnancy is an immunological phenomenon as the semiallogeneic fetus is not rejected and
second, the maternal haemostatic balance shifts towards a procoagulatory state. Therefore,
immunologic disorders and coagulation abnormalities can lead to adverse pregnancy
outcomes58. Paternal genes are expressed preferentially in the syncytiotrophoblasts (ST)
and immune tolerance towards the fetus requires specific suppression of the maternal
immune system59. How fetal trophoblast cells escape the maternal immune response is
unknown, but clonal deletion of immune cells recognizing paternal antigens in the placenta
is thought to play a role59-64. T lymphocytes that recognize fetal antigens decrease during
pregnancy and remain low postpartum to protect the fetus against the maternal immune
system. Placental FasL triggers local depletion of activated maternal (Fas-exposing) T
Chapter 2
40
lymphocytes that recognize placental paternal antigens,65-68 and FasL-exposing trophoblasts
induce Fas-dependent apoptosis of activated T lymphocytes66,68-69.
Exosomes, often supposed to originate at least in part from the placenta, have been
implicated in the establishment of an immune privilege for the developing fetus39,60,70-73.
Figure 3. A flow-chart showing the different populations of circulating vesicles from
placenta (STBM, exosomes) and from other cells (endothelial cells, platelets, leukocytes,
erythrocytes) and the processes thought to be affected by these vesicles related to normal or
complicated pregnancies.
Compared to non-pregnant women, increased levels of exosomes occur in pregnant
women. Incubation of T lymphocytes (Jurkat cells) with such exosomes resulted in down-
regulation of the expression of both CD3-ξ and Janus kinase 3 (JAK 3), as well as in
caspase 3 activation. These responses correlated to exposed FasL of the exosomal
fractions39,71,73. CD3-ξ affects the clonal selection of T lymphocytes, which leads to
Figure 3. Cell-derived vesicles in pregnancy
PlacentaEndothelial cell
Blood cells
CoagulationEndothelial dysfunction
ImmunomodulationInflammation
Normal& Complicatedpregnancy
STBMExosomes
MicroparticlesExosomes
Circulatingmicroparticles
Cell-derived vesicles and human pregnancy
41
2
decreased T lymphocyte-mediated responses and an increased rate of antibody production
protective in human pregnancy (elevated Th2/Th1 immune response). Expression and
activation of JAK3 is a key regulatory link between CD3-ξ expression and apoptosis, thus
contributing to establishment of immune privilege at the feto-maternal interface73.
Although exosomes from human first trimester trophoblast cells do not expose
(membrane-associated) FasL, they contain a biologically active (37 kDa) form of
“encapsulated” (intravesicular) FasL that triggers (Fas-mediated) T-cell apoptosis following
disruption of exosomes (Figure 3, 4)60,70.
Figure 4. Syncytiotrophoblast-derived microparticles
Figure 4. According to the studies of Fränsmyr and Abrahams60 as well as Mincheva-
Ailsson72, FasL (1)- and MIC-loaded (2) microvesicles are synthesized in the RER and
Golgi-apparatus of syncytiotrophoblasts, transported to cytoplasmic granules and stored or
secreted via exocytosis. AC= nucleus; CG= cytoplasmic granules
Mincheva-Nilsson et al., investigated the effect of soluble MHC class I chain-related
proteins A and B (MIC) on the expression of natural killer cell receptors (NKG2D) in
peripheral blood mononuclear cells (PBMC)72. They showed that MIC expression in
placenta was restricted to apical and basal cell membranes of ST and to “cytoplasmic
vacuoles as MIC-loaded microvesicles/exosomes” of these cells72. Since soluble MIC
molecules were present at elevated levels in maternal blood throughout normal pregnancy
and were released by placental explants in vitro, MIC-containing exosomes may be released
from placental villi into the maternal blood. As the human placenta also expresses several
Chapter 2
42
matrix metalloproteases, however, it can not be ruled out that soluble MIC is a cleavage
product in the circulation of pregnant women (Figure 4)70,72. Evidently, by transporting
bio-molecules that modulate the immune response, like FasL or MIC, placental-derived
vesicles may be considered as a “new physiological mechanism of silencing the maternal
immune system”, thereby promoting “fetal allograft immune escape”. As many adverse
pregnancy outcomes can result from the failure to adequately suppress T lymphocyte
activation pathways, defining the mechanism through which circulating placenta-derived
vesicles modulate activation components, such as CD3-ξ, JAK3 and MIC/NKG2D, may
possibly provide new therapeutic targets.
MP A�D EXOSOMES I� COMPLICATED PREG�A�CY
Early pregnancy loss
Between 25-50% of reproductive-aged women experience one or more miscarriages, often
due to fetal chromosomal abnormalities, especially with increasing maternal age58,74. The
WHO classification defines the occurrence of three or more consecutive spontaneous
miscarriages regardless of previous live births as recurrent fetal abortion (RSA)75. RSA
affects about 1-3% of women during child-bearing years76. Known risk factors are genetic
abnormalities, uterine pathologies, endocrine dysfunctions, autoimmune diseases, acquired
and inherited thrombophilic disorders, and environmental factors77. In nearly 50% of
affected women, the cause of RSA remains unknown78.
Trophoblast invasion into the uterine spiral arteries and development and
maintenance of adequate utero-placental circulation are prerequisites for successful
pregnancy79. This invasion may be promoted by (trophoblast-released) soluble FasL-
induced apoptosis of smooth muscle cells in the spiral arteries, thus contributing to utero-
placental circulation80.
During normal pregnancy, the haemostatic balance shifts towards a procoagulatory
state with an increase in clotting factors and fibrinogen as well as a decrease in
anticoagulant factors and fibrinolytic activity58, 81. In RSA, fibrin deposits are present in the
intervillous space of the placenta, raising the question whether RSA may be secondary to an
exaggerated haemostatic response during pregnancy79,82,83. This “hypercoagulability” may
involve other procoagulant factors, including MP and exosomes47,84. In 2001, Laude et al.,
used a prothrombinase assay to study the coagulation-promoting capacity of circulating MP
in 74 non-pregnant women with idiopathic RSA and 50 non-pregnant controls. RSA
patients were divided into two groups: 49 women with more than 3 RSA and less than 10
weeks gestational age, and 25 women with more than 1 late pregnancy loss (gestational age
>10 weeks)85. Isolated MP fractions from RSA women (55%) showed an increased
Cell-derived vesicles and human pregnancy
43
2
coagulation-promoting capacity, 29 (59%) in the early and 12 (48%) in the late pregnancy
loss group.
Carp et al., evaluated the numbers of CD51+/CD31+-positive MP, i.e. MP
presumably of endothelial cell origin, in non-pregnant women with RSA (n=96; ≥3 RSA)
versus non-pregnant women without a history of miscarriage (n=90)86. They reported
increased numbers of endothelial MP in 12 patients (12.5%) and in 2 controls (2%;
p<0.008). Furthermore, injection of artificially prepared procoagulant phospholipid
vesicles, i.e. vesicles containing phosphatidylserine, into pregnant mice induced thrombosis
in the placental bed and lead to reduced birth weight87. Taken together, the presence of
circulating (procoagulant) MP in women with RSA seems to be an acquired thrombophilia,
becoming clinically manifest during pregnancy79,83,85,86. The mechanisms underlying the
presence and contribution of these MP to the pathophysiology of miscarriage, however, are
unclear and additional studies are essential to specify their precise role in the development
of RSA.
Premature labour
Preterm labour is a major obstetric problem occurring in 5-7% of pregnant women. The
premature fetus can develop neurological, gastrointestinal, infectious and other disorders.
One of the most important causes for preterm labour is (sub clinical) infection. Recently, a
role for exosomes in immune suppression during premature labour has been suggested.
Levels of exosomes in sera from pregnant women were shown to be almost two-fold higher
in those delivering at term compared to women delivering preterm. Concurrently, exosomes
of women delivering at term contained higher levels of FasL and HLA-DR and elicited
greater suppression of CD3-ξ and JAK339. Although the underlying pathophysiology
remains unknown, these data implicate that exosomes may be involved in suppressing T
lymphocyte activation during pregnancy, thereby contributing to an immune privilege for
the developing fetus, necessary to achieve a term pregnancy.
Preeclampsia
Preeclampsia is a heterogenic multisystem disorder characterized by hypertension and
proteinuria and develops in the second half of pregnancy. The incidence is 2-5%, and
preeclampsia is a major cause of maternal and fetal morbidity and mortality. Although the
exact etiology is unknown, a general accepted hypothesis is the following two stage model.
Insufficient trophoblast invasion into spiral arteries of the uterus early in pregnancy results
in abnormal placentation with subsequent placental hypoperfusion. In the second stage,
placental factors are released into the maternal circulation, leading to a systemic
inflammatory response and endothelial dysfunction88.
Chapter 2
44
MP may modulate or reflect several of the key-processes in preeclampsia,
including inflammation, coagulation, platelet activation and endothelial dysfunction. The
first scientific papers reporting on the occurrence of MP in preeclampsia, focused on total
numbers of MP in preeclampsia compared to normotensive pregnant and non-pregnant
women. A summary of these articles can be found in Table 2. Obviously, circulating MP
originate from various types of cells and their composition depends on the status of the
parental cells. Data from different studies on circulating MP in preeclampsia are
inconsistent. Several studies reported a decrease in circulating numbers of PMP and an
increase in endothelial cell-derived MP (EMP). Decreased numbers of PMP may be related
to decreased platelet numbers in the maternal circulation, and/or (increased) attachment of
MP to the endothelium or other cells in the maternal circulation. Despite the overall
decrease of PMP, however, subpopulations of PMP exposing a well-established platelet
activation marker (P-selectin) were found to be increased (15.4%) compared to
normotensive pregnant and non-pregnant controls (10.9% and 8.0%, respectively)89. The
observed increase of EMP in preeclampsia may reflect endothelial-cell activation,90 and
increases in (numbers of) leukocyte-derived MP may reflect inflammation91, 92.
Complement activation may be part of the systemic inflammatory response in
preeclampsia. MP activate complement via the classical pathway in vitro. Isolated MP from
preeclamptic patients, however, exposed no increased levels of bound C1q, C3 and C4.
Interestingly, increased numbers of MP were present exposing C-reactive protein (CRP), a
well known complement activator molecule, suggesting that circulating MP may be
involved in complement activation93.
Circulating MP are known to affect endothelial function. Incubation of myometrial
arteries with MP from preeclamptic patients impaired bradykinin-mediated relaxation40, 94.
MP from preeclamptic women also induced vascular hyporeactivity to serotonin in human
omental arteries and aortas from pregnant and non-pregnant mice, and these effects were
associated with increased nitric oxide production91.
MP may contribute to preeclampsia by enhancing coagulation activation that
already occurs during normal pregnancy. Since the capacity of MP from preeclamptic
patients to promote coagulation (thrombin generation assay) was not increased, it seems
unlikely that circulating MP are directly involved in coagulation activation95. In addition,
MP from preeclamptic patients also failed to affect RNA expression of inflammation-
related genes and genes encoding adhesion receptors in endothelial cells96. Thus, MP seem
to modulate some but not all (patho)physiological processes, at least in vitro, that may play
a role in (the development of) preeclampsia.
Table 2. �
umbers of circulating microparticles in normal and com
plicated pregnancy
Table 2. Overview of studies mea
suring circu
lating numbers of MP in norm
al and complica
ted pregnancy; * significantly different
from pregnant co
ntrols; Eq P
S: eq
uivalents of phosphatidylserine; control: not pregnant; P
R: pregnant; P
E: preeclampsia; IU
GR:
intra-uterine gro
wth retardation; PIH
: pregnancy-induced hyp
ertension; Ref: references, A
D: not detectable.
Cellular origin
Marker
Control
PR
PE
IUGR
PIH
Units
Ref
Total
Pla
tele
ts
End
othe
lial
cel
ls
Annexin V
CD
41
CD
51
122 39 7
429
193 13
260
*37.
5 9
182 90
12
M
P/µ
L
126
End
othe
lial
cel
ls
End
othe
lial
cel
ls
CD
62e
CD
31
71
2 61
19
*193
0 *1
0497
822
6768
Cou
nts/µL
12
7
End
othe
lial
cel
ls
Pla
tele
ts
CD
31+/C
D41
- CD
31+/C
D42
+
8,
4 7,
9 *1
4,72
3 10
,751
Cou
nts/µL
90
Pla
tele
ts
CD
61
49
33
39
109 /L
128
Pla
tele
ts
CD
61
6.
6%
*3.7
%
% o
f pl
atel
ets
129
Total
Pla
tele
ts
Lym
phoc
ytes
Annexin V
CD
31
CD
11a
7.
5 4.
2 2.
9
*11.
68
*5.8
3 *5
.85
Nm
ol/L
Eq
PS
91
Total
Pla
tele
ts
T c
ells
T c
ells
Gra
nulo
cyte
s B c
ells
Mon
ocyt
es
Ery
thro
cyte
s End
othe
lial
cel
ls
Annexin V
CD
61
CD
4 CD
8 CD
66
CD
20
D14
CD
234
CD
62e
2357
20
14
13
12 7 3
ND
15
0 11
1960
16
18
ND
N
D 8 10
ND
12
2 N
D
2256
18
18
*29
*15
*79 5
ND
23
4 23
106 /L
92
Total
Pla
tele
ts
Annexin V
CD
61
6.7
6.6
5.1
4.9
*2.6
*2
.2
109 /L
89
Chapter 2
46
Since mice infused with in vitro prepared (artificial) phosphatidyl-
serine/phosphatidylcholine vesicles developed symptoms characteristic of preeclampsia, a
role for MP in the pathophysiological development of preeclampsia seems likely97.
Despite the fact that STBM constitute only a small fraction of the total number of
circulating MP in the maternal blood, still significantly elevated numbers of STBM have
been reported in preeclamptic women compared to normal pregnancy98. In contrast, STBM
were not increased in late onset preeclampsia or IUGR99. Perfusion of subcutaneous fat
arteries with in vitro prepared STBM altered the relaxation response to acetylcholine,100 but
in vivo concentrations of STBM did not have such an effect. STBM inhibited endothelial
cell proliferation,101 activate neutrophils and influence proliferation and activation of T
lymphocytes19, 102. Similar to the before mentioned MP from preeclamptic patients, STBM
hardly affected endothelial gene expression: the expression of 28 genes changed 2-fold or
more out of 10,000 genes examined by microarray. The observed changes were related to
inhibition of endothelial cell proliferation103. Taken together, the exact contribution of
STBM to the etiology of preeclampsia needs further investigation.
The role of exosomes in preeclampsia has not been investigated yet. As
immunologic factors certainly contribute to the development of preeclampsia and
immunologic maladaptation may be one of the underlying phenomena in preeclampsia, this
would be very interesting.
CO�CLUSIO�S
Cell-derived vesicles like MP and exosomes have been investigated in many different
diseases. So far, their pathophysiologic relevance in cardiovascular, thromboembolic as
well as inflammatory and immunologic disorders has been proven mainly in vitro. To
which extent MP and exosomes contribute, affect and/or reflect disease development,
however, is to be determined. Due to lack of standardized protocols to isolate MP and
exosomes from human body fluids such as blood, additional studies are required to
precisely determine the role of these different types of vesicles in normal and complicated
pregnancy.
In normal pregnancy, placenta-derived exosomes expressing or containing FasL
(and possibly MIC) may promote a state of immune privilege for the semiallogeneic fetus
by silencing the maternal immune response. As complicated pregnancies can result from an
inadequate suppression of maternal T lymphocyte activation, this mechanism may
constitute a new therapeutic target. Circulating MP with increased procoagulant potential in
women with RSA may be a chronic phenomenon, comparable to acquired thrombophilia,
possibly becoming clinically manifested during pregnancy. Whether these MP are
Cell-derived vesicles and human pregnancy
47
2
secondary to RSA or already existent before pregnancy, however, is still unknown. Recent
data indicate that women with premature labour have decreased numbers of circulating
placenta-derived exosomes, possibly indicating inappropriate down-regulation of the
maternal immune system. Although data are lacking on the presence of exosomes in
preeclampsia, there is growing evidence that MP are somehow associated with the
pathophysiology underlying disease acquisition and progression. Nevertheless, there is no
clear correlation between circulating numbers of MP and the disease state in different
women suffering from preeclampsia.
Taken together, ongoing research is essential to further elucidate the impact of
circulating MP and exosomes in normal and complicated pregnancy.
REFERE�CES
1. Chargaff E, West R. The biological significance of the thromboplastic protein of
blood. J Biol Chem 1946;166:189-97.
2. Wolf P. The nature and significance of platelet products in human placenta. Br J
Haematol 1967;13:269-88.
3. Sims PJ, Wiedmer T, Esmon CT, Weiss HJ, Shattil SJ. Assembly of the platelet
prothrombinase complex is linked to vesiculation of the platelet plasma membrane.
Studies in Scott syndrome: an isolated defect in platelet procoagulant activity. J Biol
Chem 1989;264:17049-57.
4. Weiss HJ, Vicic WJ, Lages BA, Rogers J. Isolated deficiency of platelet procoagulant
activity. Am J Med 1979;67:206-13.
5. Caby MP, Lankar D, Vincendeau-Scherrer C, Raposo G, Bonnerot C. Exosomal-like
vesicles are present in human blood plasma. Int Immunol 2005;17:879-87.
6. Garcia BA, Smalley DM, Cho H, Shabanowitz J, Ley K, Hunt DF. The platelet
microparticle proteome. J Proteome Res 2005;4:1516-21.
7. Jin M, Drwal G, Bourgeois T, Saltz J, Wu HM. Distinct proteome features of plasma
microparticles. Proteomics 2005;5:1940-52.
8. Miguet L, Pacaud K, Felden C, Hugel B, Martinez MC, Freyssinet JM, Herbrecht R,
Potier N, van DA, Mauvieux L. Proteomic analysis of malignant lymphocyte
membrane microparticles using double ionization coverage optimization. Proteomics
2006;6:153-71.
9. Wubbolts R, Leckie RS, Veenhuizen PT, Schwarzmann G, Mobius W,
Hoernschemeyer J, Slot JW, Geuze HJ, Stoorvogel W. Proteomic and biochemical
analyses of human B cell-derived exosomes. Potential implications for their function
and multivesicular body formation. J Biol Chem 2003;278:10963-72.
Chapter 2
48
10. Trams EG, Lauter CJ, Salem N, Jr., Heine U. Exfoliation of membrane ecto-enzymes
in the form of micro-vesicles. Biochim Biophys Acta 1981;645:63-70.
11. Harding C, Heuser J, Stahl P. Receptor-mediated endocytosis of transferrin and
recycling of the transferrin receptor in rat reticulocytes. J Cell Biol 1983;97:329-39.
12. Johnstone RM. Revisiting the road to the discovery of exosomes. Blood Cells Mol Dis
2005;34:214-19.
13. Pan BT, teng K, Wu C, Adam M, Johnstone RM. Electron microscopic evidence for
externalization of the transferrin receptor in vesicular form in sheep reticulocytes. J
Cell Biol 1985;101:942-48.
14. Thery C, Boussac M, Veron P, Ricciardi-Castagnoli P, Raposo G, Garin J, Amigorena
S: Proteomic analysis of dendritic cell-derived exosomes. a secreted subcellular
compartment distinct from apoptotic vesicles. J Immunol 2001;166:7309-18.
15. Thery C, Zitvogel L, Amigorena S. Exosomes: composition, biogenesis and function.
Nat Rev Immunol 2002;2:569-79.
16. Bard MP, Hegmans JP, Hemmes A, Luider TM, Willemsen R, Severijnen LA, van
Meerbeeck JP, Burgers SA, Hoogsteden HC, Lambrecht BN. Proteomic analysis of
exosomes isolated from human malignant pleural effusions. Am J Respir Cell Mol
Biol 2004;31:114-21.
17. Pisitkun T, Shen RF, Knepper MA. Identification and proteomic profiling of exosomes
in human urine. Proc Natl Acad Sci U S A 2004;101:13368-73.
18. Jy W, Horstman LL, Jimenez JJ, Ahn YS, Biro E, Nieuwland R, Sturk A, Dignat-
George F, Sabatier F, Camoin-Jau L, Sampol J, Hugel B, Zobairi F, Freyssinet JM,
Nomura S, Shet AS, Key NS, Hebbel RP. Measuring circulating cell-derived
microparticles. J Thromb Haemost 2004;2:1842-3.
19. Gupta AK, Rusterholz C, Holzgreve W, Hahn S. Syncytiotrophoblast micro-particles
do not induce apoptosis in peripheral T lymphocytes, but differ in their activity
depending on the mode of preparation. J Reprod Immunol 2005;68:15-26.
20. Abid Hussein MN, Meesters EW, Osmanovic N, Romijn FP, Nieuwland R, Sturk A.
Antigenic characterization of endothelial cell-derived microparticles and their
detection ex vivo. J Thromb Haemost 2003;1:2434-43.
21. Arteaga RB, Chirinos JA, Soriano AO, Jy W, Horstman L, Jimenez JJ, Mendez A,
Ferreira A, de ME, Ahn YS. Endothelial microparticles and platelet and leukocyte
activation in patients with the metabolic syndrome. Am J Cardiol 2006;98:70-4.
22. Brogan PA, Shah V, Brachet C, Harnden A, Mant D, Klein N, Dillon MJ. Endothelial
and platelet microparticles in vasculitis of the young. Arthritis Rheum 2004;50:927-36.
23. Van der Zee PM, Biro E, Ko Y, de Winter RJ, Hack CE, Sturk A, Nieuwland R. P-
selectin- and CD63-exposing platelet microparticles reflect platelet activation in
peripheral arterial disease and myocardial infarction. Clin Chem 2006;52:657-64.
Cell-derived vesicles and human pregnancy
49
2
24. Ferreira AC, Peter AA, Mendez AJ, Jimenez JJ, Mauro LM, Chirinos JA, Ghany R,
Virani S, Garcia S, Horstman LL, Purow J, Jy W, Ahn YS, de ME. Postprandial
hypertriglyceridemia increases circulating levels of endothelial cell microparticles.
Circulation 2004;110:3599-603.
25. Tushuizen ME, Nieuwland R, Scheffer PG, Sturk A, Heine RJ, Diamant M. Two
consecutive high-fat meals affect endothelial-dependent vasodilation, oxidative stress
and cellular microparticles in healthy men. J Thromb Haemost 2006;4:1003-10.
26. Biro E, Sturk-Maquelin KN, Vogel GM, Meuleman DG, Smit MJ, Hack CE, Sturk A,
Nieuwland R. Human cell-derived microparticles promote thrombus formation in vivo
in a tissue factor-dependent manner. J Thromb Haemost 2003;1:2561-8.
27. Nieuwland R, Berckmans RJ, Rotteveel-Eijkman RC, Maquelin KN, Roozendaal KJ,
Jansen PG, ten HK, Eijsman L, Hack CE, Sturk A. Cell-derived microparticles
generated in patients during cardiopulmonary bypass are highly procoagulant.
Circulation 1997;96:3534-41.
28. Nieuwland R, Berckmans RJ, McGregor S, Boing AN, Romijn FP, Westendorp RG,
Hack CE, Sturk A. Cellular origin and procoagulant properties of microparticles in
meningococcal sepsis. Blood 2000;95:930-5.
29. Satta N, Toti F, Feugeas O, Bohbot A, chary-Prigent J, Eschwege V, Hedman H,
Freyssinet JM. Monocyte vesiculation is a possible mechanism for dissemination of
membrane-associated procoagulant activities and adhesion molecules after stimulation
by lipopolysaccharide. J Immunol 1994;153:3245-55.
30. Del Conde I, Shrimpton CN, Thiagarajan P, Lopez JA. Tissue-factor-bearing
microvesicles arise from lipid rafts and fuse with activated platelets to initiate
coagulation. Blood 2005;106:1604-11.
31. Falati S, Liu Q, Gross P, Merrill-Skoloff G, Chou J, Vandendries E, Celi A, Croce K,
Furie BC, Furie B. Accumulation of tissue factor into developing thrombi in vivo is
dependent upon microparticle P-selectin glycoprotein ligand 1 and platelet P-selectin.
J Exp Med 2003;197:1585-98.
32. Tans G, Rosing J, Thomassen MC, Heeb MJ, Zwaal RF, Griffin JH. Comparison of
anticoagulant and procoagulant activities of stimulated platelets and platelet-derived
microparticles. Blood 1991;77:2641-8.
33. Berckmans RJ, Nieuwland R, Kraan MC, Schaap MC, Pots D, Smeets TJ, Sturk A,
Tak PP. Synovial microparticles from arthritic patients modulate chemokine and
cytokine release by synoviocytes. Arthritis Res Ther 2005;7:R536-44.
34. Forlow SB, McEver RP, Nollert MU. Leukocyte-leukocyte interactions mediated by
platelet microparticles under flow. Blood 2000;95:1317-23.
35. Kim HK, Song KS, Chung JH, Lee KR, Lee SN. Platelet microparticles induce
angiogenesis in vitro. Br J Haematol 2004;124:376-84.
Chapter 2
50
36. Boulanger CM, Scoazec A, Ebrahimian T, Henry P, Mathieu E, Tedgui A, Mallat Z.
Circulating microparticles from patients with myocardial infarction cause endothelial
dysfunction. Circulation 2001;104:2649-52.
37. Albanese J, Meterissian S, Kontogiannea M, Dubreuil C, Hand A, Sorba S, Dainiak N.
Biologically active Fas antigen and its cognate ligand are expressed on plasma
membrane-derived extracellular vesicles. Blood 1998;91:3862-74.
38. Peche H, Heslan M, Usal C, Amigorena S, Cuturi MC. Presentation of donor major
histocompatibility complex antigens by bone marrow dendritic cell-derived exosomes
modulates allograft rejection. Transplantation 2003;76:1503-10.
39. Taylor DD, Akyol S, Gercel-Taylor C. Pregnancy-associated exosomes and their
modulation of T cell signaling. J Immunol 2006;176:1534-42.
40. Vanwijk MJ, Svedas E, Boer K, Nieuwland R, Vanbavel E, Kublickiene KR. Isolated
microparticles, but not whole plasma, from women with preeclampsia impair
endothelium-dependent relaxation in isolated myometrial arteries from healthy
pregnant women. Am J Obstet Gynecol 2002;187:1686-93.
41. McGill M, Fugman DA, Vittorio N, Darrow C. Platelet membrane vesicles reduced
microvascular bleeding times in thrombocytopenic rabbits. J Lab Clin Med
1987;109:127-33.
42. Abid Hussein MN, Nieuwland R, Hau CM, Evers LM, Meesters EW, Sturk A. Cell-
derived microparticles contain caspase 3 in vitro and in vivo. J Thromb Haemost
2005;3:888-96.
43. Clayton A, Turkes A, Navabi H, Mason MD, Tabi Z. Induction of heat shock proteins
in B-cell exosomes. J Cell Sci 2005;118:3631-8.
44. De Gassart A., Geminard C, Fevrier B, Raposo G, Vidal M. Lipid raft-associated
protein sorting in exosomes. Blood 2003;102:4336-44.
45. Safaei R, Larson BJ, Cheng TC, Gibson MA, Otani S, Naerdemann W, Howell SB.
Abnormal lysosomal trafficking and enhanced exosomal export of cisplatin in drug-
resistant human ovarian carcinoma cells. Mol Cancer Ther 2005;4:1595-1604.
46. Shedden K, Xie XT, Chandaroy P, Chang YT, Rosania GR. Expulsion of small
molecules in vesicles shed by cancer cells: association with gene expression and
chemosensitivity profiles. Cancer Res 2003;63:4331-7.
47. Al-Nedawi K, Szemraj J, Cierniewski CS. Mast cell-derived exosomes activate
endothelial cells to secrete plasminogen activator inhibitor type 1. Arterioscler Thromb
Vasc Biol 2005;25:1744-9.
48. Fevrier B, Vilette D, Archer F, Loew D, Faigle W, Vidal M, Laude H, Raposo G. Cells
release prions in association with exosomes. Proc Natl Acad Sci U S A
2004;101:9683-8.
49. Mack M, Kleinschmidt A, Bruhl H, Klier C, Nelson PJ, Cihak J, Plachy J,
Cell-derived vesicles and human pregnancy
51
2
Stangassinger M, Erfle V, Schlondorff D. Transfer of the chemokine receptor CCR5
between cells by membrane-derived microparticles: a mechanism for cellular human
immunodeficiency virus 1 infection. Nat Med 2000;6:769-75.
50. Rozmyslowicz T, Majka M, Kijowski J, Murphy SL, Conover DO, Poncz M,
Ratajczak J, Gaulton GN, Ratajczak MZ. Platelet- and megakaryocyte-derived
microparticles transfer CXCR4 receptor to CXCR4-null cells and make them
susceptible to infection by X4-HIV. AIDS 2003;17:33-42.
51. Barry OP, Pratico D, Lawson JA, FitzGerald GA. Transcellular activation of platelets
and endothelial cells by bioactive lipids in platelet microparticles. J Clin Invest
1997;99:2118-27.
52. Abusamra AJ, Zhong Z, Zheng X, Li M, Ichim TE, Chin JL, Min WP. Tumor
exosomes expressing Fas ligand mediate CD8+ T-cell apoptosis. Blood Cells Mol Dis
2005;35:169-73.
53. Kim SH, Bianco N, Menon R, Lechman ER, Shufesky WJ, Morelli AE, Robbins PD.
Exosomes derived from genetically modified DC expressing FasL are anti-
inflammatory and immunosuppressive. Mol Ther 2006;13:289-300.
54. Aline F, Bout D, Amigorena S, Roingeard P, mier-Poisson I. Toxoplasma gondii
antigen-pulsed-dendritic cell-derived exosomes induce a protective immune response
against T. gondii infection. Infect Immun 2004;72:4127-37.
55. Chaput N, Flament C, Viaud S, Taieb J, Roux S, Spatz A, Andre F, LePecq JB,
Boussac M, Garin J, Amigorena S, Thery C, Zitvogel L. Dendritic cell derived-
exosomes: biology and clinical implementations. J Leukoc Biol 2006;80:471-8.
56. Peche H, Renaudin K, Beriou G, Merieau E, Amigorena S, Cuturi MC. Induction of
tolerance by exosomes and short-term immunosuppression in a fully MHC-
mismatched rat cardiac allograft model. Am J Transplant 2006;6:1541-50.
57. Taieb J, Chaput N, Zitvogel L. Dendritic cell-derived exosomes as cell-free peptide-
based vaccines. Crit Rev Immunol 2005;25:215-23.
58. Rai R, Regan L. Recurrent miscarriage. Lancet 2006;368:601-11.
59. Tafuri A, Alferink J, Moller P, Hammerling GJ, Arnold B. T cell awareness of
paternal alloantigens during pregnancy. Science 1995;270:630-3.
60. Abrahams VM, Straszewski-Chavez SL, Guller S, Mor G. First trimester trophoblast
cells secrete Fas ligand which induces immune cell apoptosis. Mol Hum Reprod
2004;10:55-63.
61. Holmes CH, Simpson KL, Wainwright SD, Tate CG, Houlihan JM, Sawyer IH,
Rogers IP, Spring FA, Anstee DJ, Tanner MJ. Preferential expression of the
complement regulatory protein decay accelerating factor at the fetomaternal interface
during human pregnancy. J Immunol 1990;144:3099-105.
62. Hsi BL, Hunt JS, Atkinson JP. Differential expression of complement regulatory
Chapter 2
52
proteins on subpopulations of human trophoblast cells. J Reprod Immunol
1991;19:209-23.
63. Loke YW, King A. Immunology of implantation. Baillieres Best Pract Res Clin Obstet
Gynaecol 2000;14:827-37.
64. Munn DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C,
Mellor AL. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science
1998;281:1191-3.
65. Hammer A, Dohr G. Expression of Fas-ligand in first trimester and term human
placental villi. J Reprod Immunol 2000;46:83-90.
66. Jiang SP, Vacchio MS. Multiple mechanisms of peripheral T cell tolerance to the fetal
"allograft". J Immunol 1998;160:3086-90.
67. Kauma SW, Huff TF, Hayes N, Nilkaeo A. Placental Fas ligand expression is a
mechanism for maternal immune tolerance to the fetus. J Clin Endocrinol Metab
1999;84:2188-94.
68. Mor G, Gutierrez LS, Eliza M, Kahyaoglu F, Arici A. Fas-fas ligand system-induced
apoptosis in human placenta and gestational trophoblastic disease. Am J Reprod
Immunol 1998;40:89-94.
69. Griffith TS, Ferguson TA. The role of FasL-induced apoptosis in immune privilege.
Immunol Today 1997;18:240-4.
70. Frangsmyr L, Baranov V, Nagaeva O, Stendahl U, Kjellberg L, Mincheva-Nilsson L.
Cytoplasmic microvesicular form of Fas ligand in human early placenta: switching the
tissue immune privilege hypothesis from cellular to vesicular level. Mol Hum Reprod
2005;11:35-41.
71. Gercel-Taylor C, O'Connor SM, Lam GK, Taylor DD: Shed membrane fragment
modulation of CD3-zeta during pregnancy: link with induction of apoptosis. J Reprod
Immunol 2002;56:29-44.
72. Mincheva-Nilsson L, Nagaeva O, Chen T, Stendahl U, Antsiferova J, Mogren I,
Hernestal J, Baranov V: Placenta-derived soluble MHC class I chain-related molecules
down-regulate NKG2D receptor on peripheral blood mononuclear cells during human
pregnancy: a possible novel immune escape mechanism for fetal survival. J Immunol
2006;176:3585-92.
73. Sabapatha A, Gercel-Taylor C, Taylor DD. Specific isolation of placenta-derived
exosomes from the circulation of pregnant women and their immunoregulatory
consequences. Am J Reprod Immunol 2006;56:345-55.
74. Regan L, Rai R. Epidemiology and the medical causes of miscarriage. Baillieres Best
Pract Res Clin Obstet Gynaecol 2000;14:839-54.
75. Stephenson MD. Management of recurrent early pregnancy loss. J Reprod Med
2006;51:303-10.
Cell-derived vesicles and human pregnancy
53
2
76. Carrington B, Sacks G, Regan L. Recurrent miscarriage: pathophysiology and
outcome. Curr Opin Obstet Gynecol 2005;17:591-7.
77. Li TC, Makris M, Tomsu M, Tuckerman E, Laird S. Recurrent miscarriage: aetiology,
management and prognosis. Hum Reprod Update 2002;8:463-81.
78. Chung PH, Yeko TR. Recurrent miscarriage: causes and management. Hosp Pract
(Minneap) 1996;31:157-64.
79. Greer IA. Thrombophilia: implications for pregnancy outcome. Thromb Res
2003;109:73-81.
80. Harris LK, Keogh RJ, Wareing M, Baker PN, Cartwright JE, Aplin JD, Whitley GS.
Invasive trophoblasts stimulate vascular smooth muscle cell apoptosis by a fas ligand-
dependent mechanism. Am J Pathol 2006;169:1863-74.
81. Pechet L, Alexander B: Increased clotting factors in pregnacy. N Engl J Med
1961;265:1093-7.
82. Dolitzky M, Inbal A, Segal Y, Weiss A, Brenner B, Carp H. A randomized study of
thromboprophylaxis in women with unexplained consecutive recurrent miscarriages.
Fertil Steril 2006;86:362-6.
83. Rai R, Tuddenham E, Backos M, Jivraj S, El'Gaddal S, Choy S, Cork B, Regan L.
Thromboelastography, whole-blood haemostasis and recurrent miscarriage. Hum
Reprod 2003;18:2540-3.
84. Vanwijk MJ, Vanbavel E, Sturk A, Nieuwland R. Microparticles in cardiovascular
diseases. Cardiovasc Res 2003;59:277-87.
85. Laude I, Rongieres-Bertrand C, Boyer-Neumann C, Wolf M, Mairovitz V, Hugel B,
Freyssinet JM, Frydman R, Meyer D, Eschwege V. Circulating procoagulant
microparticles in women with unexplained pregnancy loss: a new insight. Thromb
Haemost 2001;85:18-21.
86. Carp H, Dardik R, Lubetsky A, Salomon O, Eskaraev R, Rosenthal E, Inbal A.
Prevalence of circulating procoagulant microparticles in women with recurrent
miscarriage: a case-controlled study. Hum Reprod 2004;19:191-5.
87. Sugimura M, Kobayashi T, Shu F, Kanayama N, Terao T. Annexin V inhibits
phosphatidylserine-induced intrauterine growth restriction in mice. Placenta
1999;20:555-60.
88. Sargent IL, Borzychowski AM, Redman CW. Immunoregulation in normal pregnancy
and pre-eclampsia: an overview. Reprod Biomed Online 2006;13:680-6.
89. Lok CA, Nieuwland R, Sturk A, Hau CM, Boer K, Vanbavel E, Vanderpost JA.
Microparticle-associated P-selectin reflects platelet activation in preeclampsia.
Platelets 2007;18:68-72.
90. Gonzalez-Quintero VH, Jimenez JJ, Jy W, Mauro LM, Hortman L, O'Sullivan MJ,
Ahn YS. Elevated plasma endothelial microparticles in preeclampsia. Am J Obstet
Chapter 2
54
Gynecol 2003;189:589-93.
91. Meziani F, Tesse A, David E, Martinez MC, Wangesteen R, Schneider F,
Andriantsitohaina R. Shed membrane particles from preeclamptic women generate
vascular wall inflammation and blunt vascular contractility. Am J Pathol
2006;169:1473-83.
92. Vanwijk MJ, Nieuwland R, Boer K, van der Post JA, Vanbavel E, Sturk A.
Microparticle subpopulations are increased in preeclampsia: possible involvement in
vascular dysfunction? Am J Obstet Gynecol 2002;187:450-6.
93. Biro E, Lok CA, Hack CE, van der Post JA, Schaap MC, Sturk A, Nieuwland R. Cell-
Derived Microparticles and Complement Activation in Preeclampsia Versus Normal
Pregnancy. Placenta 2007;28:928-35.
94. Tesse A, Meziani F, David E, Carusio N, Kremer H, Schneider F, Andriantsitohaina R.
Microparticles from preeclamptic women induce vascular hyporeactivity in vessels
from pregnant mice through an overproduction of Nitric Oxide. Am J Physiol Heart
Circ Physiol 2007;293:H520-5.
95. Vanwijk MJ, Boer K, Berckmans RJ, Meijers JC, van der Post JA, Sturk A, Vanbavel
E, Nieuwland R. Enhanced coagulation activation in preeclampsia: the role of APC
resistance, microparticles and other plasma constituents. Thromb Haemost
2002;88:415-20.
96. Lok CA, Boing AN, Reitsma PH, van der Post JA, van BE, Boer K, Sturk A,
Nieuwland R. Expression of inflammation-related genes in endothelial cells is not
directly affected by microparticles from preeclamptic patients. J Lab Clin Med
2006;147:310-20.
97. Omatsu K, Kobayashi T, Murakami Y, Suzuki M, Ohashi R, Sugimura M, Kanayama
N. Phosphatidylserine/phosphatidylcholine microvesicles can induce preeclampsia-like
changes in pregnant mice. Semin Thromb Hemost 2005;31:314-20.
98. Knight M, Redman CW, Linton EA, Sargent IL. Shedding of syncytiotrophoblast
microvilli into the maternal circulation in pre-eclamptic pregnancies. Br J Obstet
Gynaecol 1998;105:632-40.
99. Goswami D, Tannetta DS, Magee LA, Fuchisawa A, Redman CW, Sargent IL, von
DP. Excess syncytiotrophoblast microparticle shedding is a feature of early-onset pre-
eclampsia, but not normotensive intrauterine growth restriction. Placenta 2006;27:56-
61.
100. Cockell AP, Learmont JG, Smarason AK, Redman CW, Sargent IL, Poston L. Human
placental syncytiotrophoblast microvillous membranes impair maternal vascular
endothelial function. Br J Obstet Gynaecol 1997;104:235-40.
101. Smarason AK, Sargent IL, Starkey PM, Redman CW. The effect of placental
syncytiotrophoblast microvillous membranes from normal and pre-eclamptic women
Cell-derived vesicles and human pregnancy
55
2
on the growth of endothelial cells in vitro. Br J Obstet Gynaecol 1993;100:943-9.
102. Gupta AK, Hasler P, Holzgreve W, Gebhardt S, Hahn S: Induction of neutrophil
extracellular DNA lattices by placental microparticles and IL-8 and their presence in
preeclampsia. Hum Immunol 2005;66:1146-54.
103. Hoegh AM, Tannetta D, Sargent I, Borup R, Nielsen FC, Redman C, Sorensen S,
Hviid TV. Effect of syncytiotrophoblast microvillous membrane treatment on gene
expression in human umbilical vein endothelial cells. BJOG 2006;113:1270-9.
104. Nagahama M, Nomura S, Kanazawa S, Ozaki Y, Kagawa H, Fukuhara S. Significance
of anti-oxidized LDL antibody and monocyte-derived microparticles in anti-
phospholipid antibody syndrome. Autoimmunity 2003;36:125-31.
105. Dignat-George F, Camoin-Jau L, Sabatier F, Arnoux D, Anfosso F, Bardin N, Veit V,
Combes V, Gentile S, Moal V, Sanmarco M, Sampol J. Endothelial microparticles: a
potential contribution to the thrombotic complications of the antiphospholipid
syndrome. Thromb Haemost 2004;91:667-73.
106. Chironi G, Simon A, Hugel B, Del PM, Gariepy J, Freyssinet JM, Tedgui A.
Circulating leukocyte-derived microparticles predict subclinical atherosclerosis burden
in asymptomatic subjects. Arterioscler Thromb Vasc Biol 2006;26:2775-80.
107. Mallat Z, Benamer H, Hugel B, Benessiano J, Steg PG, Freyssinet JM, Tedgui A.
Elevated levels of shed membrane microparticles with procoagulant potential in the
peripheral circulating blood of patients with acute coronary syndromes. Circulation
2000;101:841-3.
108. Bernal-Mizrachi L, Jy W, Jimenez JJ, Pastor J, Mauro LM, Horstman LL, de ME, Ahn
YS. High levels of circulating endothelial microparticles in patients with acute
coronary syndromes. Am Heart J 2003;145:962-70.
109. Matsumoto N, Nomura S, Kamihata H, Kimura Y, Iwasaka T. Increased level of
oxidized LDL-dependent monocyte-derived microparticles in acute coronary
syndrome. Thromb Haemost 2004;91:146-54.
110. Kim HK, Song KS, Park YS, Kang YH, Lee YJ, Lee KR, Kim HK, Ryu KW, Bae JM,
Kim S. Elevated levels of circulating platelet microparticles, VEGF, IL-6 and
RANTES in patients with gastric cancer: possible role of a metastasis predictor. Eur J
Cancer 2003;39:184-91.
111. Nomura S, Suzuki M, Katsura K, Xie GL, Miyazaki Y, Miyake T, Kido H, Kagawa H,
Fukuhara S. Platelet-derived microparticles may influence the development of
atherosclerosis in diabetes mellitus. Atherosclerosis 1995;116:235-40.
112. Diamant M, Nieuwland R, Pablo RF, Sturk A, Smit JW, Radder JK. Elevated numbers
of tissue-factor exposing microparticles correlate with components of the metabolic
syndrome in uncomplicated type 2 diabetes mellitus. Circulation 2002;106:2442-7.
113. Omoto S, Nomura S, Shouzu A, Nishikawa M, Fukuhara S, Iwasaka T. Detection of
Chapter 2
56
monocyte-derived microparticles in patients with Type II diabetes mellitus.
Diabetologia 2002;45:550-5.
114. Warkentin TE, Hayward CP, Boshkov LK, Santos AV, Sheppard JA, Bode AP, Kelton
JG. Sera from patients with heparin-induced thrombocytopenia generate platelet-
derived microparticles with procoagulant activity: an explanation for the thrombotic
complications of heparin-induced thrombocytopenia. Blood 1994;84:3691-9.
115. Preston RA, Jy W, Jimenez JJ, Mauro LM, Horstman LL, Valle M, Aime G, Ahn YS.
Effects of severe hypertension on endothelial and platelet microparticles. Hypertension
2003;41:211-7.
116. Nomura S, Kanazawa S, Fukuhara S. Effects of efonidipine on platelet and monocyte
activation markers in hypertensive patients with and without type 2 diabetes mellitus. J
Hum Hypertens 2002;16:539-47.
117. Jy W, Horstman LL, Arce M, Ahn YS. Clinical significance of platelet microparticles
in autoimmune thrombocytopenias. J Lab Clin Med 1992;119:334-45.
118. Wiedmer T, Hall SE, Ortel TL, Kane WH, Rosse WF, Sims PJ. Complement-induced
vesiculation and exposure of membrane prothrombinase sites in platelets of
paroxysmal nocturnal hemoglobinuria. Blood 1993;82:1192-6.
119. Fujimi S, Ogura H, Tanaka H, Koh T, Hosotsubo H, Nakamori Y, Kuwagata Y,
Shimazu T, Sugimoto H. Activated polymorphonuclear leukocytes enhance production
of leukocyte microparticles with increased adhesion molecules in patients with sepsis.
J Trauma 2002;52:443-8.
120. Pereira J, Alfaro G, Goycoolea M, Quiroga T, Ocqueteau M, Massardo L, Perez C,
Saez C, Panes O, Matus V, Mezzano D. Circulating platelet-derived microparticles in
systemic lupus erythematosus. Association with increased thrombin generation and
procoagulant state. Thromb Haemost 2006;95:94-9.
121. Jimenez JJ, Jy W, Mauro LM, Horstman LL, Ahn YS. Elevated endothelial
microparticles in thrombotic thrombocytopenic purpura: findings from brain and renal
microvascular cell culture and patients with active disease. Br J Haematol
2001;112:81-90.
122. Nomura S, Shouzu A, Nishikawa M, Kokawa T, Yasunaga K. Significance of platelet-
derived microparticles in uremia. Nephron 1993;63:485.
123. Daniel L, Fakhouri F, Joly D, Mouthon L, Nusbaum P, Grunfeld JP, Schifferli J,
Guillevin L, Lesavre P, Halbwachs-Mecarelli L. Increase of circulating neutrophil and
platelet microparticles during acute vasculitis and hemodialysis. Kidney Int
2006;69:1416-23.
124. Westerman MP, Unger L, Kucuk O, Quinn P, Lis LJ. Phase changes in membrane
lipids in sickle red cell shed-vesicles and sickle red cells. Am J Hematol 1998;58:177-
82.
Cell-derived vesicles and human pregnancy
57
2
125. Shet AS, Aras O, Gupta K, Hass MJ, Rausch DJ, Saba N, Koopmeiners L, Key NS,
Hebbel RP. Sickle blood contains tissue factor-positive microparticles derived from
endothelial cells and monocytes. Blood 2003;102:2678-83.
126. Bretelle F, Sabatier F, Desprez D, Camoin L, Grunebaum L, Combes V, D'Ercole C,
Dignat-George F. Circulating microparticles: a marker of procoagulant state in normal
pregnancy and pregnancy complicated by preeclampsia or intrauterine growth
restriction. Thromb Haemost 2003;89:486-92.
127. Gonzalez-Quintero VH, Smarkusky LP, Jimenez JJ, Mauro LM, Jy W, Hortsman LL,
O'Sullivan MJ, Ahn YS. Elevated plasma endothelial microparticles: preeclampsia
versus gestational hypertension. Am J Obstet Gynecol 2004;191:1418-24.
128. Harlow FH, Brown MA, Brighton TA, Smith SL, Trickett AE, Kwan YL, Davis GK.
Platelet activation in the hypertensive disorders of pregnancy. Am J Obstet Gynecol
2002;187:688-95.
129. Holthe MR, Lyberg T, Staff AC, Berge LN. Leukocyte-platelet interaction in
pregnancies complicated with preeclampsia. Platelets 2005;16:91-7.
59
PART II
Microparticle numbers and
characteristics in pregnancy and
preeclampsia
Chapter 3
Changes in microparticle numbers and
cellular origin during pregnancy and
preeclampsia
C.A.R. Lok, J.A.M.van der Post, I.L. Sargent, C.M. Hau, A. Sturk,
K. Boer, R. Nieuwland
Hypertension in Pregnancy (in press)
Chapter 3
62
ABSTRACT
Introduction. Microparticles (MP) are pro-coagulant vesicles derived from various cells.
Evidence is accumulating that MP are of pathophysiological relevance in autoimmune,
cardiovascular, thromboembolic diseases and inflammatory disorders. Therefore, their role
in the development of preeclampsia was investigated and MP from preeclamptic patients
influenced endothelial-dependent vasodilatation. Knowledge about changes in circulating
MP numbers during pregnancy and preeclampsia is lacking. We determined this
longitudinally and investigated whether these numbers related to the severity of
preeclampsia.
Methods. Samples were obtained from pregnant women and preeclamptic patients during
pregnancy and postpartum. MP were isolated and studied by flow cytometry.
Results. During pregnancy, MP were decreased at 12 weeks gestation and then returned to
postpartum values. In preeclampsia, MP numbers were reduced at 28 and 36 weeks (both
p=0.04). Monocyte-derived MP were elevated in preeclampsia at 28 (p=0.007), 32 (p=0.02)
and 36 weeks (p=0.01), as were erythrocyte-derived MP at 28 weeks (p=0.04). Placenta-
derived MP increased during pregnancy and preeclampsia. In pregnancy a correlation was
present between placenta-derived MP and systolic blood pressure (r=0.33, p=0.015). No
other correlations were found.
Conclusions. During pregnancy, numbers of MP initially decrease and subsequently
normalize. Placenta-derived MP increase, possibly because of placental growth. In
preeclampsia, reduced numbers of PMP are due to decreased platelet counts. Increased
numbers of monocyte-derived MP reflect monocyte activation, which may be an expression
of the systemic inflammation in preeclampsia. Lack of correlation between numbers of MP
and severity of preeclampsia suggests that MP numbers alone do not explain the reported
vascular effects of MP.
Microparticles in pregnancy and preeclampsia
63
3
I�TRODUCTIO�
MP are small, procoagulant membrane vesicles, which are budded from the cell surface and
released into the circulation during apoptosis or activation of blood cells or endothelial
cells. Microparticles (MP) play a definite role in both inflammation and coagulation1,2.
Since normotensive pregnancy and, even more, preeclampsia are both characterized by
activation of coagulation pathways and an altered inflammatory state3, changes in
circulating MP numbers or their cellular origin and function may underlie the activation of
these processes.
Previously, we showed that the majority of MP originates from platelets4. This
subpopulation is often decreased in preeclampsia, depending on the patient selection5.
Despite their decrease in preeclampsia, a subpopulation of PMP exposing P-selectin, i.e.
MP originating from activated platelets, was increased compared to pregnant and non-
pregnant controls6. Furthermore, numbers of T-cell- and granulocyte-derived MP were
significantly elevated in preeclampsia compared to controls4. These elevations could be a
part of the exaggerated inflammatory response of preeclampsia. The contribution of MP to
the development of preeclampsia, however, is still not completely understood. Whereas MP
from women with preeclampsia impaired endothelium-dependent vasodilatation in isolated
myometrial arteries7, the RNA expression of inflammation-related genes in endothelial cells
was unaffected8. Impairment of endothelial dilatation was also found when small arteries
were incubated with placenta-derived MP9. Although placenta-derived MP constitute only a
small fraction of the total number of circulating MP in the maternal blood, elevated
numbers of placenta-derived MP have been reported in preeclamptic women compared to
normotensive pregnant controls10.
In non-pregnant hypertensive patients significant correlations were reported
between blood pressure and both endothelium-derived MP and PMP11. Currently, data on
changes in MP numbers or subpopulations during the time course of uncomplicated
pregnancies are not available. Moreover, it is unclear how changes in circulating MP are
associated with the severity of preeclampsia.
At present, MP numbers and cellular origin in preeclampsia have always been
investigated in cross-sectional studies in the second half of pregnancy. In the present study,
we analyzed MP in a longitudinal design. Thus, we investigated circulating MP numbers
throughout normotensive pregnancy, and evaluated whether MP or subsets thereof are
related to disease severity in preeclampsia and/or to numbers of circulating blood cells.
Chapter 3
64
MATERIALS A�D METHODS
Patients
The study was approved by the medical ethical committee of the Academic Medical Center
and written consent was obtained from all study patients prior to blood collection. Blood
samples were collected from randomly chosen healthy normotensive pregnant patients not
using any medication (n=8) between 12-14, 19-21, 23-26, 27-29, 30-34, 34-38 weeks
gestation and at 6 weeks postpartum. Preeclamptic patients (n=11) were included upon
admission to the hospital and multiple blood samples were obtained weekly until delivery
and 6 weeks postpartum. Preeclampsia was defined as: (I) diastolic blood pressure of 110
mmHg or more on any occasion or 90 mmHg or more measured on two separate occasions
at least four hours apart and (II) proteinuria of at least 0.3 gram / 24 hours (III) developing
after 20 weeks gestational age. Data concerning age, parity, medical history, blood pressure
at 12 weeks gestational age, Body Mass Index (BMI) and laboratory results (level of
hemoglobin, liver enzymes and platelets) were collected from the patient files. The delivery
method, birth weight and gestational age at delivery were recorded postpartum.
Collection of blood samples
Two blood samples were taken from the antecubital vein without tourniquet through a 20-
gauge needle with a vacutainer system. The first sample was collected into a 4.5 mL tube
containing 0.105 M buffered sodium citrate (Becton Dickinson, San Jose, CA). Within 30
minutes after collection, cells were removed by centrifugation for 20 minutes at 1560 g and
20 °C. Plasma samples were then divided in 250 µL aliquots, immediately snap frozen in
liquid nitrogen to preserve MP structure and then stored at -80 °C until further analysis.
The second sample was collected in a 4.5 mL tube containing ethylenediaminetetraacetic
acid (EDTA; Becton Dickinson; San Jose, CA) and used to determine numbers of
erythrocytes, platelets and leukocytes.
Reagents and assays
Fluorescein isothiocyanate (FITC)-labeled IgG1 and phycoerythrin (PE)-labeled IgG1
and monoclonal antibodies directed against Tsuppressor-cells (anti-CD8-PE), monocytes (anti-
CD14-PE) and B-cells (anti-CD20-FITC) were obtained from Becton Dickinson (San Jose,
CA). To detect Thelper-cells and granulocytes, anti-CD4-FITC and anti-CD66e-FITC were
purchased from the Central Laboratory Bloodtransfusion (Amsterdam, The Netherlands).
Anti-CD61-FITC (anti-GP-IIIa) was obtained from Pharmingen (San Jose, CA) and
CD62e-PE (anti-E-selectin) from Ancell (Bayport, MN). Antibodies directed against P-
selectin (anti-CD62p-PE) and anti-CD63-PE were purchased from Immuno Quality
Products (Groningen, The Netherlands) and anti-glycophorin A-FITC was obtained from
Microparticles in pregnancy and preeclampsia
65
3
DakoCytomation (Carpionteria, CA). Allophycocyanin (APC)-conjugated annexin V was
purchased from Caltag (Burlingame, CA). ED822, an antibody to an unknown antigen
expressed on the apical surface of the syncytiotrophoblast used to detect trophoblastic
cells12, was a kind gift from dr. S. F. Sooranna from the Department of Maternal Fetal
Medicine, Imperial College School of Medicine (London, UK). This antibody was shown to
be more specific than other suggested antibodies used to detect trophoblast cells with flow
cytometry10. The alternative antibody, NDOG2, seemed to be less specific in an earlier
study by our group4. The second antibody for the indirect labelling with ED822,
GAM(Fab)2-FITC was obtained from Dako (Glostrup; Denmark). The following final
dilutions of antibodies were used: IgG1-FITC (1:10), IgG1-PE (1:10), anti-CD4-FITC
(1:2.5), anti-CD8-PE (1:5), anti-CD14-PE (1:20), anti-CD20-FITC (1:10), anti-CD61-FITC
(1:30), anti-CD62p-PE (1:15), CD62e-PE (1:30), anti-CD63 (1:5), anti-CD66e-FITC
(1:10), anti-glycophorin A-FITC (1:5), annexin V-APC (1:40), ED822 (1:2.5) GAM(Fab)2-
FITC (1:20).
Whole blood erythrocyte, platelet and leukocyte counts were determined with a
Cell-Dyn 4000 (Abbott Diagnostics Division; Abbott Laboratories; Hoofddorp, The
Netherlands) at the department of Clinical Chemistry (Academic Medical Center;
Amsterdam, The Netherlands).
Isolation of microparticles
A sample of 250 µL frozen plasma was thawed on ice and centrifuged for 30 minutes at
18890 g and 20 ºC to pellet the MP. With this centrifugation condition it is possible to
pellet the MP without simultaneous pelleting exosomes13. After centrifugation, 225 µL of
the supernatant was removed. The MP pellet and remaining supernatant were resuspended
in 225 µL phosphate-buffered saline (PBS) with citrate (154 mmol/L NaCl, 1.4 mmol/L
phosphate, 10.9 mmol/L trisodium citrate, pH 7.4). After centrifugation for 30 minutes at
18890 g and 20 ºC, 225 µL of the supernatant was removed again. The MP pellet was then
resuspended in 75 µL PBS-citrate.
Flow cytometry
Five µL of the MP suspension was diluted in 35 µL CaCl2 (2.5 mmol/L)-containing PBS.
Then 5 µL APC-labeled annexin V was added to all tubes plus 5 µL of the cell-specific
monoclonal antibody or isotype-matched control antibodies. The samples were then
incubated in the dark for 15 minutes at room temperature. After incubation, 900 µL of
calcium-containing PBS was added to all tubes (except to the annexin V control, to which
900 µL PBS-citrate was added). Samples were analyzed for one minute in a fluorescence
automated cell sorter (FACS Calibur) with CellQuest software (Becton Dickinson; San
Jose, CA). Both forward scatter (FSC) and sideward scatter (SSC) were set at a logarithmic
Chapter 3
66
gain. MP were identified on basis of their size and density (FSC and SSC respectively) and
on their capacity to bind annexin V. Annexin V measurements were corrected for
autofluorescence. Labeling with cell-specific monoclonal antibodies was corrected for
identical concentrations of isotype-matched control antibodies. The number of MP per liter
plasma was calculated using the following formula: Number/L = N x (100/5) x (955/flow) x
(106/250), in which N is the number of events that stained positive for both annexin V and a
cell-specific antibody, 100 (µL) is the (total) volume of the MP suspension after isolation,
from which 5 (µL) is used for labeling, 955 (µL) is the total volume of the labeled MP
suspension after dilution, flow is the volume (µL) analyzed per minute by the
flowcytometer, multiplied by 106 (from µL to L) and finally, 250 (µL) was the original
volume of the plasma aliquot from which MP were isolated.
Flow cytometric analysis of placenta-derived MP was performed using an indirect
staining procedure. MP (5 µL aliquots) were incubated for 15 minutes at room temperature
in a final volume of 55 µL of PBS containing 2.5 mmol/L CaCl2 (PBS/Ca, pH 7.4) and
unlabeled ED822. After incubation, MP were washed with 200 µL of PBS/Ca.
Subsequently, GAM(Fab)2-FITC (5 µL) was added for 15 minutes at room temperature,
and labeling was terminated by addition of 300 µL buffer. Numbers were estimated using a
comparable formula as mentioned before.
Statistical analysis
Data were analyzed with Statistical Package of the Social Science software for Windows,
release 11.5 (SPSS Benelux BV, Gorinchem, The Netherlands). Differences between
demographic data were analyzed with Mann-Whitney U tests. Dichotomous variables were
compared with a Chi-square test. For groups <5, a Fisher’s exact test was used. A mixed
model (ANOVA for repeated measurements with corrections for missing values) was used
to analyze MP numbers as a function of gestational age (repeated measurements).
Differences between the normotensive pregnant patients and the preeclamptic patients for
the different sampling periods were analyzed with Mann-Whitney U tests (cross-sectional
measurements). If more than one sample was available of one preeclamptic patient for a
certain period, the mean was calculated and used for the analysis. Correlations were
analyzed with a Pearsons bivariate two-sided test. Differences were considered significant
if p <0.05.
Microparticles in pregnancy and preeclampsia
67
3
RESULTS
Patient characteristics
Patient characteristics are summarized in Table 1. The median age in the normotensive
pregnant women was 30.8 years compared to 26.5 years in the preeclamptic patients. As
expected, both systolic and diastolic blood pressures were elevated in the preeclampsia
compared normotensive pregnancy. Although, this difference in blood pressure was already
present at a gestational age of 12 weeks, none of these patients were hypertensive before 20
weeks gestation. The majority of the preeclamptic patients was nulliparous.
Table 1. Patient characteristics
�ormotensive
pregnancy
(n=8)
Preeclampsia
(n=11) P
Age (years) 30.8 (25.5-34.5) 26.5 (20.8-33.0) 0.03
Blood pressure 12 wks*
Systolic (mmHg)
Diastolic (mmHg)
95 (70-110)
58 (50-70)
120 (110-155)
75 (65-90)
0.0001
0.001
Highest blood pressure
Systolic (mmHg)
Diastolic (mmHg)
108 (100-120)
68 (55-75)
160 (140-210)
115 (90-130)
0.0001
0.0001
Parity
Nulliparous
Multiparous
2
6
10
1
0.006
Proteinuria (g/24 h) - 9.3 (0.7-16.3) -
Platelets (109/L) 252 (107-408) 206 (42-568) 0.03
BMI (kg/m2) 23.8 (18.2-31.9) 21.6 (20.0-40.8) NS
Delivery
GA (weeks)
Cesarean section
Vaginal birth
39.3 (37.4-42.0)
1
7
34.3 (26.1-36.6)
8
3
0.0001
0.03
Birth weight (gram) 3450 (2940-3870) 1355 (470-2310) 0.0001
Table 1. Data are presented as median (range). P: probability value for differences
between the preeclamptic group and the normotensive pregnant group. AS: non-significant.
BMI: body mass index. GA: gestational age. * In the preeclamptic patients, the blood
pressure at 12 weeks was retrospectively found in the files of the prenatal care.
Chapter 3
68
Four women in the normotensive group and two preeclamptic patients had a first trimester
pregnancy loss before the present pregnancy. One woman in the normotensive group was
pregnant after assisted reproductive treatment. Two normotensive pregnant women and one
preeclamptic patient smoked during the present pregnancy. Most study subjects were
Caucasian (ten preeclamptic patients and four controls). Six preeclamptic patients had
abnormal liver function tests or decreased platelet counts, but they did not fulfill the criteria
for HELLP (hemolysis, elevated liver enzymes, low platelets) syndrome. Although none of
the preeclamptic patients had an eclamptic episode, five patients needed preventive
treatment with magnesium sulphate. None of the women suffered from thromboembolic
complications. Blood pressure and laboratory values returned to normal after delivery. Like
mentioned in the method section data was extracted from the medical files concerning BMI,
birth weight, gestational age at delivery and the method of delivery. These data showed that
the BMI was comparable between groups and birth weight and gestational age at delivery
were significantly lower in the preeclamptic women compared to the normotensive
pregnant women. Furthermore, most preeclamptic patients delivered by cesarean section.
�ormotensive pregnancy
Total numbers of circulating MP were
longitudinally determined throughout
pregnancy in the plasma from normotensive
pregnant women. Figure 1 shows that the
number of MP was decreased at 12 weeks
gestation (median number of MP 2.9
*109/L, p=0.04) compared to postpartum.
Then the MP number gradually normalized
to the postpartum values during pregnancy
(p=0.02) with a maximum number at a
gestational age of 28 weeks (7.3*109/L).
The majority of MP (97%-99%) originated
from platelets (PMP, Table 2). Numbers of
PMP correlated with platelet counts
(r=0.32, p=0.02) and the PMP/platelet ratio
remained constant (0.02-0.03) during the
course of pregnancy. A minor fraction
(0.6%-2.7%) of the MP originated from
erythrocytes. No correlation was present
between the numbers of erythrocyte-
derived MP and erythrocytes.
Figure 1. The number of annexin V-positive
MP in normotensive pregnancies is plotted
against the gestational age. Data are
presented as median with the interquartile
range (25%-75%). In normotensive women,
blood collection started at 12 weeks. *:
p=0.04 compared to postpartum values.
Figure 1. The number of microparticles during normotensive pregnancy
Table 2. C
ellular origin of circulating microparticles in normotensive pregnant wom
en
Gestational age
12
20
24
28
32
36
pp
Tot
al M
P (10
9 /L)
2.9
(1.8
-7.2
)
5.8
(3.4
-10.
0)
5.1
(2.1
-13.
3)
7.3
(2.2
-10.
5)
5.7
(2.7
-11.
7)
5.5
(2.0
-17.
9)
7.3
(1.5
-9.9
)
% P
late
let-de
rive
d M
P
97.0
(95.
2-98
.1)
97.9
(94.
6-99
.5)
99.0
(97.
1-99
.6 )
97.9
(96.
2-98
.8)
97.2
(95.
1-99
.5)
98.1
(88.
3-99
.8)
98.1
(83.
6-98
.9)
% E
ryth
rocy
te-d
eriv
ed M
P
2.7
(0.7
-4.0
)
1.0
(0.4
-4.6
)
0.6
(0.3
-1.9
)
1.6
(0.2
-2.5
)
1.3
(0.4
-3.4
)
1.4
(0-6
.4)
1.9
(1.2
-15.
3)
% T
help
er-c
ell-de
rive
d M
P
0.2
(0-1
.8)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
% M
onoc
yte-
derive
d M
P
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
% B
-cel
l-de
rive
d M
P
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
< 0
.1
(ND
)
% E
ndot
helial
-cel
l-de
rive
d M
P
1.0
(0-1
.6)
0.8
(0-1
.7)
0.4
(0-1
.8)
0.9
(0-2
.4)
0.8
(0-3
.0)
0.9
(0-5
.3)
0.7
(0-2
.7)
% P
lace
nta-
derive
d M
P
2.3
(0.6
-5.6
)
1.6
(0.8
-3.4
)
1.9
(0.7
-5.4
)
1.5
(0.6
-5.7
)
1.8
(1.0
-4.0
)
3.0
(1.9
-7.0
)
1.1
(0.6
-1.7
)
Table 2. The total number of annexin V-positive M
P is presented as med
ian (ra
nge; m
in-m
ax). The subpopulations are exp
ressed
as
med
ian percentage of the total number of MP. Percentages w
ere ca
lculated for every patien
t indep
enden
tly. Therefore, the sum of the
med
ian percentages of all subgroups approach
es 100% and is not exactly 100%; pp: postpartum, AD: not detectable. The percentage
of Tsu
ppressor-cell-derived
MP and G
ranulocyte-derived
MP are <
0.1% for all gestational ages
.
Chapter 3
70
Numbers of circulating leukocyte-derived
MP, staining for CD4, CD8, CD14,
CD20 or CD66e, were negligible and
did not correlate with the number of
leukocytes. Finally, 0.4%-1.0% of MP
stained for E-selectin, which implies an
endothelial cell source.
During normotensive preg-
nancy, the percentage of placenta-
derived MP ranged between 1.5 and
3%. A significant increase of the
absolute number of placenta-derived
MP was found during pregnancy
(p=0.005), with the highest level at 36
weeks gestational age (Figure 2).
Postpartum the percentage decreased to
1.1%. A modest correlation between the
total number of placenta-derived MP and
systolic blood pressure was present
(r=0.33, p=0.015). In five male
volunteers and five healthy non-pregnant
women (mean age 36 years and not using
any medication including oral
contraceptives), no relevant staining for
ED822 to detect placenta-derived MP
was found.
Preeclampsia
The number of MP was weekly determined in plasma from preeclamptic patients after
admission to the hospital. The total number of MP did not change during preeclampsia in
the period between 28 and 36 weeks gestation (Figure 3), but total numbers of MP were
reduced in preeclamptic patients compared to normotensive controls of the same gestational
age. At 28 and 36 weeks gestational age, these differences were statistically significant
(both p=0.04). Six weeks postpartum, MP numbers had increased again to normal levels
(p=0.001) compared to numbers during preeclampsia, but these (postpartum) numbers were
similar to those of normotensive pregnant women. Similar to normotensive pregnancy, the
majority of MP originated from platelets (93-98%, Table 3). Again, numbers of PMP
Figure 2. The number of MP originating from
the placenta in normotensive pregnancies is
plotted against the gestational age. The X-axis
represents the gestational age in weeks and
the Y-axis the number of placenta-derived
MP. Data are presented as median with the
interquartile range (25%-75%). A significant
increase of the absolute number of placenta-
derived MP was found during pregnancy
(p=0.005), with the highest level at 36 weeks
gestational age.
Figure 2. Placenta-derived microparticles
during normotensive pregnancy
Microparticles in pregnancy and preeclampsia
71
3
correlated with platelet counts (r=0.73,
p=0.0001). The ratio between PMP and
platelets was constant throughout
pregnancy and comparable to normotensive
pregnancy. Compared to normotensive
pregnant women, absolute PMP numbers
were significantly decreased at 28 weeks in
preeclamptic patients (p=0.03). The
fraction of erythrocyte-derived MP varied
between 1.1% and 5.3%. The absolute
number of erythrocyte-derived MP was
increased at 28 weeks (p=0.04), 32 weeks
(p=0.05) and 36 weeks (p=0.06) compared
to normotensive pregnancy, but the fraction
of such MP (Table 3) was only
significantly elevated at 28 weeks (p=0.04).
Leukocyte-derived MP, staining
for CD4, CD8, CD14 and CD20 had
negligible (<0.1%) numbers in normo-
tensive pregnancy. In contrast, Thelper-cell-
derived MP were detectable (but not
significantly elevated) in preeclamptic
patients at 28 and 32 weeks gestational age
(Table 3). Tsuppressor-cell-derived MP were
present only at 28 weeks (p=0.02).
Monocyte-derived MP were significantly
elevated in preeclampsia at 28 weeks
(p=0.007), 32 weeks (p=0.04) and 36 weeks
(p=0.03) but not postpartum. In
preeclampsia, significantly more B-cell-
derived MP (exposing CD20) were present at 36 weeks (p=0.008) compared to
normotensive pregnancies. Finally, granulocyte-derived MP were not detectable. The
fraction of endothelium-derived MP ranged between 0.5% and 1.2% of the total MP
number. Numbers of endothelium-derived MP were not elevated in preeclampsia.
During normotensive pregnancy, the percentage of placenta-derived MP was
higher (2.2-5.6%) than postpartum (0.9%). The total number of placenta-derived MP did
not change significantly during preeclampsia if measured as function of gestational age
(Figure 4).
Figure 3. The number of annexin V-
positive MP in preeclampsia is plotted
against the gestational age. Blood
collection started at admission to the
hospital mostly around 28 weeks gestation.
Each preeclamptic patient has a separate
marker because not all patients are
represented in all gestational age groups.
The median for each gestational age is
presented as a short interrupted line.
Compared to normotensive controls of the
same gestational age, there were
significant differences at both 28 and 36
weeks gestational age (p=0.04 for both).
Figure 3. The number of microparticles in
preeclampsia
Table 3. C
ellular origin of circulating microparticles in preeclamptic patients
Gestational age
12
20
24
28
32
36
pp
Tot
al M
P (10
9 /L)
- -
- 2.
3* (↓)
(1.1
-4.5
)
3.3
(1.9
-6.6
)
2.3*
(↓)
(1.2
-5.6
)
7.2
(2.6
-24.
8)
% P
late
let-de
rive
d M
P
- -
- 95
.2 (↓)
(90.
0-98
.8)
95.0
*(↓)
(92.
4-98
.4)
93.2
(82.
4-98
.9)
98.0
(87.
1-99
.2)
% E
ryth
rocy
te-d
eriv
ed M
P
- -
- 5.
3* ( ↑
)
( 1.
5-12
.3)
2.9
(↑)
(0.6
-5.8
)
4.8
(↑)
(0.7
-12.
6 )
1.1
(0.3
-12.
6 )
% T
help
er-c
ell-de
rive
d M
P
- -
- 0.
6
(0-5
.3)
0.4
(0-4
.3)
< 0
.1
(ND
)
< 0
.1
(ND
)
% M
onoc
yte-
derive
d M
P
- -
- 2.
1* (↑)
(0.9
-3.5
)
1.3*
(↑)
(0-3
.7)
1.5*
(↑)
(0.2
-3.6
)
< 0
.1
(ND
)
% B
-cel
l-de
rive
d M
P
- -
- < 0
.1
(ND
)
< 0
.1
(ND
)
0.3*
(↑)
(0-0
.8)
< 0
.1
(ND
)
% E
ndot
helial
-cel
l-de
rive
d M
P
- -
- 0.
6
(0-0
.8)
0.8
(0-3
.0)
1.2
(0.4
-4.9
)
0.5
(0-1
.1)
% P
lace
nta-
derive
d M
P
- -
- 2.
2
(1.3
-3.3
)
3.9
(1.3
-10.
0)
5.6
(1.8
-10.
3)
0.9
(0.1
-6.2
)
Table 3. MP numbers are presented as med
ian (range (m
in-m
ax)). T
he subpopulations are exp
ressed
as med
ian percentage of the
total number of MP. Percentages w
ere ca
lculated for every patien
t indep
enden
tly. Therefore, the sum of the med
ian percentages of all
subgroups appro
ach
es 100% and is not exactly 100%. pp: postpartum, AD: not detectable. Differences in the fraction of MP between
preeclamptic patien
ts and the norm
otensive w
omen
with a probability va
lue of <0.05 w
ere co
nsidered
statistically significant (*),↑:
elevated or ↓: decreased (total number or fraction of MP) co
mpared to norm
otensive pregnant women
. Granulocyte-derived
MP
were < 0.1% for all gestational ages. The percentage of Tsu
ppressor-cell-derived
MP w
as only >
0.1% at 28 w
eeks (0.3%, ra
nge 0-0.8%)
but this w
as not significantly different co
mpared to norm
otensive pregnant women
.
Microparticles in pregnancy and preeclampsia
73
3
The highest median value was measured
at 36 weeks gestational age. Although
the percentages of placenta-derived MP
were higher than in normal pregnancy at
28, 32 and 36 weeks gestation, the
differences did not reach statistical
significance (resp. p=0.864, p=0.056,
p=0.196). However, it should be noted
that some preeclamptic patients showed
a high number of this subset of MP.
These patients did not distinguish
themselves clinically from the other
patients. The hypothesis that placenta-
derived MP are not continuously shed
into the circulation but episodically,
possibly after placental incidents like
ischemia, has been proposed before10. If
this is true, we possibly sampled some
patients during such moments. To
illustrate the presence or absence of
placenta-derived MP, examples of
representative dot plots are shown in
Figure 5. Samples of a healthy non-
pregnant woman and a male volunteer
are shown for comparison with the
samples of normotensive pregnant
women and preeclamptic patients
(Figure 5A and B). During
normotensive pregnancy, some placenta-
derived MP are detectable (5C), and
these MP disappear postpartum (5D).
Some preeclamptic patients showed a
high count of this subset of MP (5E), and after delivery the placenta-derived MP were not
detectable in the maternal circulation anymore (5F).
No correlations were found between MP (or subgroups) with systolic or diastolic
blood pressure, birth weight and proteinuria as markers of the severity of the preeclampsia
(data not shown).
Figure 4. The number of MP originating
from the placenta in pregnancies
complicated by preeclampsia is plotted
against the gestational age. The X-axis
represents the gestational age in weeks and
the Y-axis the number of placenta-derived
MP. Each preeclamptic patient has a
separate marker because not all patients are
represented in all gestational age groups.
The median for each gestational age is
presented as a short interrupted line.
Figure 4. Placenta-derived microparticles in
preeclampsia
Chapter 3
74
Figure 5. Placenta-derived microparticles in pregnancy and preeclampsia
Figure 5. Representative dot plots of a non-pregnant woman (A), a male control (B), a
normotensive pregnant woman during pregnancy (C) and postpartum (D), and a
preeclamptic patient during pregnancy (E) and postpartum (F). All dots are annexin V-
binding MP, the MP binding ED822, i.e. MP of placental origin, occur on the right site of
the fluorescent threshold (vertical line).
DISCUSSIO�
The present study shows that the number of circulating MP in the maternal venous
circulation in normotensive pregnancy is decreased at 12 weeks gestational age compared
to postpartum, and gradually increases towards the postpartum values during pregnancy.
Compared to the normotensive pregnancy, decreased numbers of circulating MP in
pregnancies complicated by preeclampsia were found, which is in line with earlier
reports14,15.
The majority of MP (>95%) originated from platelets and a positive correlation
between PMP numbers and platelet counts was present. This correlation, however, could
Microparticles in pregnancy and preeclampsia
75
3
only partially explain the variation in numbers of PMP. Another possible explanation may
be that at least some PMP originate directly from megakaryocytes16. The PMP/platelet ratio
was comparable at all time points between normotensive pregnancy and preeclampsia.
Thus, PMP may reflect the turnover of platelets in plasma. As a consequence, the decreased
platelet counts in preeclampsia may explain the decreased number of circulating (P)MP. If
true, than the increase of MP after delivery reflects normalization and sometimes elevation
of the platelet count in the maternal blood of preeclamptic patients.
Blood cells, endothelial- and trophoblast cells are presumed to release MP upon
activation and apoptosis. However, cell lysis and fragmentation can also be involved. The
latter explains the elevated percentages of erythrocyte-derived MP in preeclampsia, because
hemolysis frequently accompanies the syndrome.
Elevated numbers of leukocyte-derived MP may reflect activation of leukocytes,
which is one of the features of preeclampsia. Especially monocytes and neutrophils become
activated, possibly during placental passage17. Circulating monocytes of preeclamptic
patients express significantly higher levels of CD11b and CD1418 and produce elevated
levels of inflammatory cytokines (IL-1β, IL-6 and IL-8)19. Although the total number of
MP was decreased in preeclampsia, absolute numbers as well as percentages of monocyte-
derived MP were elevated compared to normotensive pregnant women, which probably
reflects activation of monocytes in preeclampsia as a consequence of the systemic
inflammatory response3.
A change in numbers of leukocyte-derived MP may be involved in the
development of endothelial dysfunction in preeclampsia, since leukocyte-derived MP
produced in vitro from a T-cell line, impair acetylcholine-induced relaxation of mouse
aortic rings20. A similar decrease in relaxation was seen in rat aortic rings incubated with
the total population of circulating MP from patients with myocardial infarction21.
Furthermore, impairment of bradykinin-mediated relaxation in isolated myometrial arteries
was demonstrated for the total population of circulating MP from preeclamptic patients7.
Thus, one of the leukocyte-derived MP subpopulations may be responsible for these
described effects. Although the fraction of leukocytes-derived MP is small, we cannot
exclude that the total number of such subpopulations are higher in vivo, because such MP
are likely to adhere to the endothelium of maternal blood vessels22.
Preeclampsia is thought to be a disorder of the maternal endothelium. Endothelial
cell activation may contribute both to the inflammatory response and to vasoconstriction.
Theoretically, endothelial cell activation should be detectable by elevated levels of
endothelial-derived MP. These circulating endothelium-derived MP affect the endothelium
and possibly aggravate pre-existing endothelial dysfunction23. However, we did not find a
difference in the number of endothelial–derived MP between normotensive women and
preeclamptic patients, which is in line with our previous work4 but contradictory to other
Chapter 3
76
authors24.
Placenta-derived MP increased significantly during normotensive pregnancy. This
is not surprising because of the increase in placental volume. This rise in placenta-derived
MP was also found when measured by ELISA with NDOG2 as capture antibody10,25. In our
study, the number of placenta-derived MP was not significantly elevated in preeclampsia
compared to normotensive pregnancy. This is in contrast to other authors9,25, who reported
elevated numbers of placenta-derived MP in preeclamptic women compared to normal
pregnant women. Placenta-derived MP were not found to be increased in late onset
preeclampsia or IUGR26. The difference in results between investigators may be due to
variation in patient characteristics, study design and antibodies used to detect placenta-
derived MP. Previously, we tested ED822 for the detection of placenta-derived MP. ED822
bound to artificially-prepared placenta-derived MP, but failed to detect these MP in diluted
samples and was therefore unlikely to detect placenta-derived MP in maternal peripheral
blood4. In that study, our isolation protocol contained a washing step that was omitted from
the current (isolation) protocol. Using this new procedure, the yield of MP (sub)
populations improved significantly, which is likely to explain the improved and specific
detection of placenta-derived MP in our present study. ED822 has been described in detail
and compared to other antibodies used to detect placenta-derived MP or STBM by Knight
et al10.
In conclusion, MP numbers change during normotensive pregnancy and are
decreased in preeclampsia. In preeclampsia, circulating MP may reflect activation,
apoptosis or hemolysis from parental cells, whereas decreased numbers of circulating PMP
and increased numbers of erythrocyte MP and monocyte-derived MP may reflect decreased
platelet counts, hemolysis and activation of monocytes, respectively.
REFERE�CES
1. Berckmans RJ, Nieuwland R, Kraan MC, Schaap MC, Pots D, Smeets TJ, Sturk A,
Tak PP. Synovial microparticles from arthritic patients modulate chemokine and
cytokine release by synoviocytes. Arthritis Res Ther 2005;7:R536-44.
2. Nieuwland R, Sturk, A. Platelet-derived Microparticles. In: Platelets; chapter 16,
Michelson AD: Academic Press, 2002:255-62.
3. Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science
2005;308:1592-4.
4. VanWijk MJ, Nieuwland R, Boer K, van der Post JA, van Bavel E, Sturk A.
Microparticle subpopulations are increased in preeclampsia: possible involvement in
vascular dysfunction? Am J Obstet Gynecol 2002;187:450-6.
Microparticles in pregnancy and preeclampsia
77
3
5. Toth B, Lok CA, Böing A, Diamant M, van der Post JA, Friese K, Nieuwland R.
Microparticles and exosomes: impact on normal and complicated pregnancy. Am J
Reprod Immunol 2007;58:389-402.
6. Lok CA, Nieuwland R, Sturk A, Hau CM, Boer K, Vanbavel E, Vanderpost JA.
Microparticle-associated P-selectin reflects platelet activation in preeclampsia.
Platelets 2007;18:68-72.
7. VanWijk MJ, Svedas E, Boer K, Nieuwland R, VanBavel E, Kublickiene KR. Isolated
microparticles, but not whole plasma, from women with preeclampsia impair
endothelium-dependent relaxation in isolated myometrial arteries from healthy
pregnant women. Am J Obstet Gynecol 2002;187:1686-93.
8. Lok CA, Boing AN, Reitsma PH, van der Post JA, van BE, Boer K, Sturk A,
Nieuwland R. Expression of inflammation-related genes in endothelial cells is not
directly affected by microparticles from preeclamptic patients. J Lab Clin Med
2006;147:310-20.
9. Cockell AP, Learmont JG, Smárason AK, Redman CW, Sargent IL, Poston L. Human
placental syncytiotrophoblast microvillous membranes impair maternal vascular
endothelial function. Br J Obstet Gynaecol 1997;104:235-40.
10. Knight M, Redman CW, Linton EA, Sargent IL. Shedding of syncytiotrophoblast
microvilli into the maternal circulation in pre-eclamptic pregnancies. Br J Obstet
Gynaecol 1998;105:632-40.
11. Preston RA, Jy W, Jimenez JJ, Mauro LM, Horstman LL, Valle M, Aime G, Ahn YS.
Effects of severe hypertension on endothelial and platelet microparticles. Hypertension
2003;41:211-7.
12. Contractor SF, SR Sooranna. Monoclonal antibodies to cytotrophoblast and
syncytiotrophoblast of human placenta. J Dev Physiol 1986;8:277–82.
13. Biro E, Nieuwland R, Sturk A. Measuring circulating cell-derived microparticles. J
Thromb Haemost 2004;2:1843–4.
14. Holthe MR, Lyberg T, Staff AC, Berge LN. Leukocyte-platelet interaction in
pregnancies complicated with preeclampsia. Platelets 2005;16:91-7.
15. Bretelle F, Sabatier F, Desprez D, Camoin L, Grunebaum L, Combes V, D' Ercole C,
Dignat-George F. Circulating microparticles: a marker of procoagulant state in normal
pregnancy and pregnancy complicated by preeclampsia or intrauterine growth
restriction. Thromb Haemost 2003;89:486-92
16. Flaumenhaft R. Formation and fate of platelet microparticles. Blood Cells Mol Dis
2006;36:182-7.
17. Mellembakken JR, Aukrust P, Olafsen MK, Ueland T, Hestdal K, Videm V.
Activation of leukocytes during the uteroplacental passage in preeclampsia.
Hypertension 2002;39:155-60.
Chapter 3
78
18. Holthe MR, Staff AC, Berge LN, Lyberg T. Leukocyte adhesion molecules and
reactive oxygen species in preeclampsia. Obstet Gynecol 2004;103:913-22.
19. Luppi P, Deloia JA. Monocytes of preeclamptic women spontaneously synthesize pro-
inflammatory cytokines. Clin Immunol 2006;118:268-75.
20. Martin S, Tesse A, Hugel B, Martinez MC, Morel O, Freyssinet JM, Andriantsitohaina
R. Shed membrane particles from T lymphocytes impair endothelial function and
regulate endothelial protein expression. Circulation 2004;109:1653-9.
21. Boulanger CM, Scoazec A, Ebrahimian T, Henry P, Mathieu E, Tedgui A, Mallat Z.
Circulating microparticles from patients with myocardial infarction cause endothelial
dysfunction. Circulation 2001;104:2649-52.
22. Furie B, Furie BC. Role of platelet P-selectin and microparticle PSGL-1 in thrombus
formation. Trends Mol Med 2004;10:171-8.
23. Brodsky SV, Zhang F, Nasjletti A, Goligorsky MS. Endothelium-derived
microparticles impair endothelial function in vitro. Am J Physiol Heart Circ Physiol
2004;286:H1910-5.
24. Gonzalez-Quintero VH, Smarkusky LP, Jimenez JJ, Mauro LM, Jy W, Hortsman LL,
O’Sullivan MJ, Ahn YS. Elevated plasma endothelial microparticles: preeclampsia
versus gestational hypertension. Am J Obstet Gynecol 2004;191:1418-24.
25. Germain SJ, Sacks GP, Sooranna SR, Sargent IL, Redman CW. Systemic
inflammatory priming in normal pregnancy and preeclampsia: the role of circulating
syncytiotrophoblast microparticles. J Immunol 2007;178:5949-56.
26. Goswami D, Tannetta DS, Magee LA, Fuchisawa A, Redman CW, Sargent IL, von
Dadelszen P. Excess syncytiotrophoblast microparticle shedding is a feature of early-
onset pre-eclampsia, but not normotensive intrauterine growth restriction. Placenta
2006;27:56-61.
Chapter 4
Microparticle-associated P-selectin reflects
platelet activation in preeclampsia
C.A.R. Lok, R. Nieuwland, A. Sturk, C.M. Hau, K. Boer,
E. van Bavel, J.A.M. van der Post
Platelets 2007;18:68-72
Chapter 4
80
ABSTRACT
Introduction. Platelet activation in preeclampsia is reflected by elevated levels of platelets
exposing P-selectin. In plasma, a non-cell bound (soluble) form of P-selectin is present.
Elevated levels of this soluble form of P-selectin have been reported in preeclampsia.
Plasma P-selectin can be divided in two fractions: microparticle (MP) associated P-selectin
and non-MP associated P-selectin. In the present cross-sectional study, we investigated to
which extent plasma P-selectin is microparticle (MP) exposed and whether the fraction of
P-selectin-exposing MP is elevated in preeclamptic patients.
Methods. Preeclamptic patients (n=10) were matched with normotensive pregnant women
(n=10) and non-pregnant controls (n=10). Plasma P-selectin was measured by ELISA. MP
were isolated, double labeled with anti-CD61 (GPIIIa) and anti-CD62p (P-selectin) and
subsequently analyzed with flow cytometry.
Results. Plasma P-selectin concentration was elevated in preeclamptic patients compared to
non-pregnant controls (p=0.007), but not compared to normotensive pregnant women
(p=0.210). Plasma P-selectin is partially MP associated (3-5%). In pregnancy, the fraction
of P-selectin exposing platelet-derived (P)MP (10.9%) was increased compared to non-
pregnant controls (8%; p=0.04). This fraction further increased in preeclamptic patients
(15.4%), and significantly differed from normotensive pregnant women (p=0.02).
Conclusions. A minor fraction of plasma P-selectin is associated with PMP. The fraction of
PMP exposing P-selectin, is increased in preeclamptic patients and to a lesser extent in
normotensive pregnancy. Because MP associated P-selectin exclusively originates from
platelets, this fraction indicates platelet activation. Platelet activation is prominent in
preeclampsia and at least a part of the plasma P-selectin originates from platelets.
Microparticle-associated P-selectin in preeclampsia
81
4
I�TRODUCTIO�
Platelet activation is evident in preeclamptic patients as indicated among others by an
elevated number of platelets exposing P-selectin molecules on their surface1-3 and by
elevated levels of β-thromboglobulin in plasma4. P-selectin becomes exposed on activated
platelets due to fusion of α-granule membranes with the platelet membrane. P-selectin
promotes platelet-leukocyte interactions, leukocyte rolling on the endothelium, platelet
aggregation and monocyte activation leading to the production of tissue factor (TF)5.
Furthermore, P-selectin is directly involved in local fibrin generation and thrombus
formation6. Therefore, P-selectin might be causally involved in endothelial dysfunction
which is a predominant factor in the development of preeclampsia. Interactions between the
endothelium and circulating activated cells are likely to contribute to vascular dysfunction.
In plasma, a soluble (non-cell bound) form of P-selectin is present. Elevated levels of
plasma P-selectin have been reported in preeclamptic patients (Table 1)7-11. This plasma P-
selectin can theoretically be divided into two fractions: MP-associated P-selectin and non-
MP-associated P-selectin. MP are small (less than 1 µm) procoagulant membrane vesicles
released from blood cells or endothelial cells on activation or during apoptosis.
Table 1. Overview of P-selectin in normotensive pregnancy and preeclampsia
Author Patients (n)
(PE/PR/NP)
Measurement
Method
Result
PE1
Result
PR2
Halim,1996 10/10/ND sP-selectin ELISA ↑ ND
Konijnenberg, 1997 10/10/ND P-selectin FACS ↑ ND
Heyl, 1999 22/20/20 sP-selectin ELISA = =
Bosio, 2001 20/26/ND sP-selectin ELISA ↑ ND
Chaiworapongsa, 2002 100/55/20 sP-selectin ELISA ↑ ↑
Yoneyama, 2001 18/18/ND P-selectin FACS ↑ ND
Aksoy, 2002 28/15/20 sP-selectin ELISA ↑ ↑
Holthe, 2004 20/20/12 P-selectin FACS ↑ =
Holthe, 2004 20/20/12 sP-selectin ELISA ↑ =
Table 1. sP-selectin: soluble P-selectin in plasma (both MP associated and non-MP
associated). P-selectin: platelet membrane bound P-selectin, PE: Preeclampsia, PR:
Aormotensive pregnancy, AP: Aon-pregnant, AD: not determined, ↑: elevated, =: no
difference, 1: compared to normotensive controls, 2: compared to non-pregnant controls.
In human blood, cell-derived MP predominantly originate from platelets. Platelet-derived
MP (PMP) are indisputable related to coagulation. They promote thrombin generation in
Chapter 4
82
vitro12 and initiate thrombus formation in vivo13. Absence or reduction of MP formation
leads to hemorrhage, like in Scott syndrome14 and Castaman’s defect15. The exact role of
MP in the coagulation cascade is unknown. Although elevated levels of PMP have been
reported in patients with hypertension and acute coronary disease16, they are not increased
in preeclamptic patients18. Yet, there is evidence that MP are responsible for the impairment
of endothelial function in preeclampsia19. MP associated P-selectin could contribute to the
damaging action of MP in preeclampsia. It is unknown to which extent plasma P-selectin is
associated with PMP in preeclamptic patients and controls.
Therefore, we investigated (A) the fraction of MP associated P-selectin in plasma
in preeclamptic patients, healthy normotensive pregnant women and non-pregnant controls,
(B) the numbers of P-selectin-exposing PMP in these patients and (C) the relation between
MP from preeclamptic patients and coagulation, reflected by the levels of the prothrombin
fragment F1+2.
MATERIALS A�D METHODS
Patients
The study was approved by the medical ethical committee of the Academic Medical Center.
After obtaining written informed consent, blood samples were obtained from preeclamptic
patients (n=10), normotensive pregnant women (n=10) and non-pregnant controls (n=10).
The women were matched for age (± five years) and parity. The preeclamptic patients and
normotensive pregnant women were also matched for gestational age (± two weeks).
Inclusion criteria for preeclampsia were based on the definition of the International Society
for the Studies of Hypertension in Pregnancy (ISSHP)20: (1) diastolic blood pressure of 110
mm Hg or more on any occasion or 90 mm Hg or more on two separate occasions at least
four hours apart, (2) proteinuria of at least 0.3 gram protein / 24 hours and (3) symptoms
developing after 20 weeks gestational age in a previously and subsequently normotensive
women.
Blood from preeclamptic patients was sampled on the first day of admission to the
Department of Obstetrics. Patients with diabetes, preexistent hypertension, vascular disease
or other co-morbidity were excluded. Patients using medication other than antihypertensive
treatment, and patients with only gestational hypertension or intra-uterine growth
retardation were also excluded. The control groups consisted of healthy women not using
any medication including oral contraceptives.
Microparticle-associated P-selectin in preeclampsia
83
4
Collection of blood samples
Two blood samples were taken from the antecubital vein without tourniquet through a 20-
gauge needle with a vacutainer system. The first sample was collected into a 4.5 mL tube
containing 0.105 M buffered sodium citrate (Becton Dickinson; San Jose, CA). Within 30
minutes after collection, cells were removed by centrifugation for 20 minutes at 1560 g and
20 °C. Plasma samples were then divided in 250 µL aliquots, immediately snap frozen in
liquid nitrogen to preserve MP structure and then stored at –80 °C until further analysis.
The second sample was collected in a 4.5 mL tube containing ethylenediaminetetraacetic
acid (EDTA; Becton Dickinson; San Jose, CA) for determination of the total number of
platelets.
Reagents and assays
Fluorescein isothiocyanate (FITC)-labeled IgG1 and phycoerythrin (PE)-labeled IgG1 were
obtained from Becton Dickinson (San Jose, CA), anti-CD61-FITC from Pharmingen (San
Jose, CA) and anti-CD62p-PE from Immuno Quality Products (Groningen, The
Netherlands). Finally, allophycocyanin (APC)-conjugated annexin V was purchased from
Caltag (Burlingame, CA). The following final dilutions of antibodies were used: IgG1-FITC
(1:10), IgG1-PE (1:10), anti-CD61-FITC (1:30), anti-CD62p-PE (1:10) and annexin V-APC
(1:40). Plasma concentrations of P-selectin and the prothrombin fragments F1+2 were
determined using enzyme-linked immunosorbent assays (ELISA). Assays were performed
as described by the manufacturers (Parameter human sP-Selectin Immunoassay by R&D
Systems; Minneapolis, USA and Enzygnost F1+2 by Dade-Behring Diagnostics GmbH;
Marburg, Germany). The minimal detectable concentration of sP-selectin was <0.5 ng/mL.
The intra-assay variation coefficient was 4.9-5.6% and inter-assay variation 7.9-9.9%. The
minimal detectable concentration of F1+2 was 0.04 nmol/L with an intra assay variation of
5-7.5% and an inter-assay variation of 6-13%. Platelet counts were determined with a Cell-
Dyn 4000 (Abbott Diagnostics Division; Abbott Laboratories; Hoofddorp, The
Netherlands) at the department of Clinical Chemistry (Academic Medical Center;
Amsterdam, The Netherlands).
Isolation of microparticles
A sample of 250 µL frozen plasma was thawed on ice and centrifuged for 30 minutes at
18890 g and 20 ºC to pellet the MP. After centrifugation, 225 µL of the supernatant was
removed. The MP pellet and remaining supernatant was resuspended in 225 µL phosphate-
buffered saline with citrate (154 mmol/L NaCl, 1.4 mmol/L phosphate, 10.9 mmol/L
trisodium citrate, pH 7.4). After centrifugation for 30 minutes at 18890 g and 20 ºC, 225 µL
of the supernatant was removed again. The MP pellet was then resuspended in 75 µL PBS-
citrate.
Chapter 4
84
Flow cytometry
Monoclonal antibodies directed against glycoprotein (GP) IIIa (CD61) and P-selectin
(CD62p) were used. Five µL of the MP suspension was diluted in 35 µL CaCl2 (2.5
mmol/L)-containing PBS. Then 5 µL APC-labeled annexin V was added to all tubes plus 5
µL of the cell-specific monoclonal antibody or isotype-matched control antibodies. The
samples were then incubated in the dark for 15 minutes at room temperature. After
incubation, 900 µL of calcium-containing PBS was added to all tubes (except to the
annexin V control, to which 900 µL citrate-containing PBS was added). Samples were
analyzed for one minute in a fluorescence automated cell sorter (FACS Calibur) with
CellQuest software (Becton Dickinson; San Jose, CA). Both forward scatter (FSC) and
sideward scatter (SSC) were set at logarithmic gain. MP were identified on basis of their
size and density and on their capacity to bind annexin V. Annexin V measurements were
corrected for auto fluorescence. Labeling with cell-specific monoclonal antibodies was
corrected for identical concentrations of isotype-matched control antibodies. The number of
MP per liter plasma was calculated using the following formula: Number/L = N x (100/5) x
(955/57) x (106/250), in which A is the number of events that stained positive for both
annexin V and a cell-specific antibody, 100 (µL) is the (total) volume of the MP suspension
after isolation, from which 5 (µL) is used for labeling, 955 (µL) is the total volume of the
labeled MP suspension after dilution, from which approximately 57 (µL) is analyzed per
minute by the flowcytometer, multiplied by 106 (from µL to L) and finally, 250 (µL) was
the original volume of the plasma aliquot from which MP were isolated.
Statistical analysis
Data were analyzed with Statistical Package of the Social Science software for Windows,
release 11.5 (SPSS Benelux BV; Gorinchem, The Netherlands). The demographic
characteristics of patients are presented as medians with the minimal and maximal value.
Data were analyzed with a Mann-Whitney U Tests. The data of the flow cytometric
analysis and ELISA were analyzed with non-parametric tests because the relatively small
size of the groups and the variation in MP numbers. Differences among three groups were
compared with Kruskall Wallis tests and differences between two groups with Mann-
Whitney U test. A probability value of <0.05 was considered statistically significant.
Correlations were calculated with a two-sided bivariate Pearson correlation test.
Microparticle-associated P-selectin in preeclampsia
85
4
RESULTS
Patient characteristics
Patient characteristics are summarized in Table 2. As expected, birth weight and
gestational age at delivery were significantly lower in the preeclamptic women and both
systolic and diastolic blood pressures were significantly higher compared to normotensive
pregnant women and the non-pregnant controls.
Table 2. Patient characteristics
Table 2. Data are presented as median (range). BMI: Body Mass Index, SGOT: serum
glutamate oxaloacetate transaminase, LDH: lactate dehydrogenase. P: Statistical
difference between the preeclamptic patients with the normotensive pregnant women. P*:
Statistical difference between the preeclamptic patients and non-pregnant controls.
Preeclampsia
(n = 10)
Normotensive
pregnancy
(n = 10)
Non-pregnant
controls
(n = 10)
P P*
Age (years) 30.6 (20.8-35.0) 31.5 (21.4-39.2) 30.0 (20.0-36.0) NS NS
Gestational age
At study (wks)
At delivery (wks)
29.4 (24.8-32.1)
33.9 (26.1-36.1)
29.6 (24.9-32.7)
39.0 (36.1-42.1)
-
-
NS
0.001
-
-
Blood pressure
Systolic (mmHg)
Diastolic (mmHg)
163 (140-220)
115 (95-120)
110 (100-120)
65 (60-75)
108 (95-133)
69 (65-85)
0.0001
0.0001
0.0001
0.0001
BMI (kg/m2) 25.8 (20.0-51.9) 22.2 (19.7-31.9) - NS -
Proteinuria (g/L) 3.9 (0.37-6.97) - - - -
SGOT (U/L) 33.5 (19-310) - - - -
LDH (U/L) 259 (149-912) - - - -
Parity
Primiparous
Multiparous
7
3
7
3
7
3
-
-
-
-
Birth weight (gr) 1160 (470-2090) 3515 (2490-3870) - 0.001 -
Chapter 4
86
Most patients (9/10) developed an early onset preeclampsia (<32 weeks gestation) and one
patient developed preeclampsia after 32 weeks and one day. All blood samples were
collected between 9:00 and 11:00 a.m. One of the preeclamptic women developed HELLP
(hemolyse, elevated liver enzymes, low platelets ) syndrome. Analyses were also performed
without the HELLP patient. One preeclamptic patient was excluded from the MP analysis
because MP were hardly detectable due to loss of the MP pellet during the isolation
procedure. One normotensive pregnant woman was excluded from the F1+2 analysis,
because the concentration of F1+2 was above the upper detection limit of the ELISA (>10
nmol/L).
Levels of P-selectin fractions in plasma
The concentration of P-selectin in cell-free plasma of nine non-pregnant controls fell within
the normal range stated by the manufacturer (18-40 ng/mL), as did seven normotensive
pregnant women and four preeclamptic patients (Figure 1).
The median concentration of plasma P-selectin in the preeclamptic group was 51.0 ng/mL
which differed significantly from the non-pregnant controls (22.8 ng/mL, p=0.007), but not
from the normotensive pregnant women (35.5 ng/mL, p=0.1). Three to five percent of the
plasma P-selectin could be removed by high-speed centrifugation, indicating that this
fraction is MP associated (Table 3). This percentage did not differ significantly among
groups.
Figure 1. Plasma P-selectin concentration in preeclampsia, normotensive pregnancy
and non-pregnant controls Figure 1. The concentration of
plasma P-selectin (ng/mL) for
each individual is presented. The
short continuous lines indicate
the median of each separate
group. The two dotted lines
represent the reference range as
provided by the manufacturer
(18-40 ng/mL). The median
concentrations of the pregnant
and non-pregnant control groups
fall in this range. The
concentration in the preeclamptic
group is elevated.
Microparticle-associated P-selectin in preeclampsia
87
4
Table 3. Plasma fractions of P-selectin (ng/mL)
Preeclampsia
(n =10)
Normotensive
pregnancy
(n = 10)
Non-pregnant
controls
(n = 10)
P
P*
Plasma
51.0 (25.2-73.8) 35.5 (24.8-55.0) 22.8 (18.6-56.8) NS 0.007
Supernatant
(Non-MP
associated)
46.4 (23.9-67.0) 31.8 (23.2-52.6) 22.2 (17.8-53.4) NS 0.002
MP
associated 3.3 % 3.9 % 5.3 % NS NS
Table 3. Data are presented as medians (min-max). P: Statistical difference between
preeclampsia and normotensive pregnancy. P*: Statistical difference between preeclampsia
and non-pregnant controls. The microparticle (MP) associated fraction of P-selectin is
presented as percentage of the plasma concentration of P-selectin. It is calculated for each
separate sample by subtracting the level of P-selectin in the (MP-free) supernatant from the
total P-selectin concentration in plasma. The p-value for the difference between
normotensive pregnancy and non-pregnant controls is for plasma and supernatant
respectively 0.03 and 0.02.
Platelets and MP
Whole blood platelet counts (Table 4) were significantly lower in the preeclamptic group
compared to normotensive pregnant women and non-pregnant controls. Only one patient
developed HELLP syndrome, but after excluding this patient, the number of platelets was
still significantly lower in the preeclamptic group. The majority of MP (85-98%) stained for
CD61, indicating that they originated from platelets. The numbers of MP and PMP were
comparable between the control groups, but reduced in preeclamptic patients. The ratio
between PMP counts and platelet numbers was consistent (0.02) in the three groups
studied; suggesting a direct association between the number of circulating platelets and the
number of PMP is present. Therefore, the lower number of PMP in the preeclamptic
patients most likely reflects the lower number of circulating platelets. The fraction of PMP
exposing P-selectin was increased in preeclamptic patients compared to normotensive
pregnant women (15.4% versus 10.9%; p=0.02) and compared to non-pregnant controls
(8.0%; p=0.001). These differences remained after excluding the HELLP patient. The use
of antihypertensive medication may affect the function of platelets and possibly the number
Chapter 4
88
of PMP. The median number of PMP was comparable between patients using medication
and patients not using antihypertensive medication.
Table 4. �umbers of circulating platelets and (platelet-derived) microparticles
Preeclampsia
(n = 9)
Normotensive
pregnancy
(n = 10)
Non-pregnant
controls
(n = 10)
P
P*
Platelets (*109/L) 149
(37-239)
238
(165-396)
304
(155-413)
0.003 0.02
MP (*109/L) 2.6
(1.3-7.8)
5.1
(1.5-12.8)
6.7
(2.2-16.6)
0.03 0.04
PMP (*109/L) 2.2
(0.8-7.3)
4.9
(1.4-14.9)
6.6
(1.9-15.6)
0.03 0.03
P-selectin-exposing
PMP (%)
15.4
(11.0-19.5)
10.9
(7.0-17.4)
8.0
(4.9-13.1)
0.02 0.001
Table 4. Data are presented as median (range). P: P-value of difference in medians
between preeclampsia and normotensive pregnant patients. P*: P-value of the difference in
medians between preeclampsia and non-pregnant controls. The p-value of the difference in
medians between normotensive pregnancy and non-pregnant controls was only significant
for the percentage of P-selectin exposing PMP (p=0.02). MP: microparticles. PMP:
Platelet-derived microparticles.
The percentage of P-selectin-exposing PMP in patients using medication was elevated to a
lesser extent (median 13.5%) than patients not using any medication (median 16.8%),
however, this difference was not significant. In Figure 2 the percentages of PMP exposing
P-selectin, for all individuals and the median for each group, is presented. Only in the
preeclamptic group a correlation was present between platelet numbers and P-selectin
exposing PMP while an association with total numbers of PMP was absent. No differences
were found in the mean fluorescence intensity of the P-selectin-exposing subpopulations of
PMP among groups, suggesting that the quantity of P-selectin exposed per MP was
comparable (data not shown).
Level of prothrombin fragment F1+2
Concentrations of the prothrombin fragment F1+2 of the non-pregnant controls were within
the reference range (0.4 to 1.1 nmol/L) except for one person (Figure 3). Both the
preeclamptic patients and the normotensive pregnant women had F1+2 levels higher than 1.1
nmol/L. The (median) concentration in the normotensive pregnant women was slightly
Microparticle-associated P-selectin in preeclampsia
89
4
elevated (1.63 nmol/L, p=0.001) compared to non-pregnant controls. Further elevation was
found in the preeclamptic group (1.92 nmol/L, p=0.0001). No correlation was present
between F1+2 and the percentage of P-selectin-exposing PMP in the separate groups.
Furthermore, no correlations were found between F1+2, plasma P-selectin and MP numbers.
Figure 2. Percentages of P-selectin-
exposing PMP for each individual are
shown for the different groups. The short
horizontal lines show the median of each
group. The percentages in the
preeclamptic group are increased
(15.4%) compared to the pregnant
(10.9%) and non-pregnant controls
(8.0%).
Figure 3. Concentrations of F1+2
(nmol/L) for each individual are shown
for the different groups. The short
horizontal lines show the median of each
group. The two dotted lines represent the
reference range according to the
manufacturer (0.4 to 1.1 nmol/L). Only
the median concentration of the non-
pregnant group falls in this range (0.77
nmol/L). The concentrations in both the
preeclamptic and the normotensive
control group are elevated (respectively
1.92 nmol/L and 1.63 nmol/L).
Figure 3. F1+2 concentrations in plasma in preeclampsia, normotensive pregnancy
and non-pregnant controls
Figure 2. P-selectin-exposing platelet-derived microparticles in preeclampsia,
normotensive pregnancy and non-pregnant controls
Chapter 4
90
DISCUSSIO�
In the present study we demonstrate that a minor fraction of plasma P-selectin is associated
with MP. Although plasma P-selectin concentration was elevated in preeclamptic patients
compared to normotensive pregnant women, this elevation was statistically not significant.
This may be due to the relatively small number of women included.
P-selectin is present both in Weibel-Palade bodies of endothelial cells and in the
α-granules and dense bodies of platelets. Upon activation, P-selectin becomes exposed on
both cell types. This implies that P-selectin in plasma can originate from endothelial cells
and / or platelets. However, strong correlations between plasma P-selectin concentration
and platelet count21 as well as β-tromboglobulin levels5, and a lack of correlation with
endothelial activation markers22, suggest that plasma P-selectin most likely originates from
platelets. Increased levels of P-selectin in plasma from patients with platelet consumption
disorders, including preeclampsia, provide further evidence for the platelet origin of plasma
P-selectin23.
Our flow cytometry data show that all P-selectin-exposing MP double stain for
CD62p and CD61 (GPIIIa). Because it was recently demonstrated that MP originating from
human endothelial cells do not expose GPIIIa24, P-selectin-exposing MP in plasma samples
originate from platelets and therefore directly reflect platelet activation. To which extent the
non-MP associated fraction of the plasma P-selectin concentration originates from the
endothelium, however, remains to be determined.
In the present study, the overall numbers of PMP were decreased in the
preeclamptic group, probably due to the concurrent decrease in platelet numbers. Although
the number of PMP was lowest in the preeclamptic group, the fraction of PMP exposing P-
selectin was significantly elevated. Thus, subpopulations of PMP in vivo may reflect
platelet activation better than overall PMP numbers. These findings emphasize that the
composition and function of MP vary, depending on different (patho) physiological
circumstances.
Because the fraction of P-selectin-exposing PMP in preeclamptic patients did not
correlate with the prothrombin fragment F1+2, activation of the coagulation system and
platelets are not necessarily linked. This confirms that preeclampsia is a disease with a
heterogeneous pathophysiology, with platelet activation being more prominent in some
patients and coagulation activation in others.
Interactions between dysfunctional or damaged endothelium, platelets and MP are
likely to contribute to the development of preeclampsia. Recently, Vandendries et al.,
proposed a model, in which platelets adhere to damaged endothelium, become activated
and recruit tissue factor-bearing MP from the blood, leading to coagulation activation and
thrombus formation6. In their model, P-selectin plays a key role since it not only regulates
Microparticle-associated P-selectin in preeclampsia
91
4
the initial interactions between leukocytes and the endothelium but also the interactions
between activated platelets and leukocytes. It is tempting to speculate that P-selectin-
exposing PMP adhere to the (damaged) endothelium in preeclamptic patients, thereby
contributing to the recruitment of leukocytes or their MP, leading to enhanced inflammation
and coagulation.
ACK�OWLEDGEME�TS We thank YungYung Ko for her technical assistance with the ELISA assays.
REFERE�CES
1. Holthe MR, Staff AC, Berge LN, Lyberg T. Different levels of platelet activation in
preeclamptic, normotensive pregnant, and nonpregnant women. Am J Obstet Gynecol
2004;190:1128-34.
2. Konijnenberg A, Stokkers EW, van der Post JA, Schaap MC, Boer K, Bleker OP,
Sturk A. Extensive platelet activation in preeclampsia compared with normal
pregnancy: enhanced expression of cell adhesion molecules. Am J Obstet Gynecol
1997;176:461-9.
3. Yoneyama Y, Suzuki S, Sawa R, Kiyokawa Y, Power GG, Araki T. Plasma adenosine
levels and P-selectin expression on platelets in preeclampsia. Obstet Gynecol
2001;97:366-70.
4. Hayashi M, Inoue T, Hoshimoto K, Negishi H, Ohkura T, Inaba N. Characterization
of five marker levels of the hemostatic system and endothelial status in normotensive
pregnancy and pre-eclampsia. Eur J Haematol 2002;69:297-302.
5. Blann AD, Nadar SK, Lip GY. The adhesion molecule P-selectin and cardiovascular
disease. Eur Heart J 2003;24:2166-79.
6. Vandendries ER, Furie BC, Furie B. Role of P-selectin and PSGL-1 in coagulation
and thrombosis. Thromb Haemost 2004;92:459-66.
7. Aksoy H, Kumtepe Y, Akcay F, Yildirim AK. Correlation of P-selectin and
lipoprotein(a), and other lipid parameters in preeclampsia. Clin Exp Med 2002;2:39-
43.
8. Bosio PM, Cannon S, McKenna PJ, O'Herlihy C, Conroy R, Brady H. Plasma P-
selectin is elevated in the first trimester in women who subsequently develop pre-
eclampsia. BJOG 2001;108:709-15.
9. Halim A, Kanayama N, el Maradny E, Nakashima A, Bhuiyan AB, Khatun S, Terao
Chapter 4
92
T. Plasma P selectin (GMP-140) and glycocalicin are elevated in preeclampsia and
eclampsia: their significances. Am J Obstet Gynecol 1996;174:272-7.
10. Heyl W, Handt S, Reister F, Gehlen J, Mittermayer C, Rath W. The role of soluble
adhesion molecules in evaluating endothelial cell activation in preeclampsia. Am J
Obstet Gynecol 1999;180:68-72.
11. Chaiworapongsa T, Romero R, Yoshimatsu J, Espinoza J, Kim YM, Park K, Kalache
K, Edwin S, Bujold E, Gomez R. Soluble adhesion molecule profile in normal
pregnancy and pre-eclampsia. J Matern Fetal Neonatal Med 2002;12:19-27.
12. VanWijk MJ, Boer K, Berckmans RJ, Meijers JC, van der Post JA, Sturk A, VanBavel
E, Nieuwland. Enhanced coagulation activation in preeclampsia: the role of APC
resistance, microparticles and other plasma constituents. Thromb Haemost
2002;88:415-20.
13. Biro E, Sturk-Maquelin KN, Vogel GM, Meuleman DG, Smit MJ, Hack CE, Sturk A,
Nieuwland R. Human cell-derived microparticles promote thrombus formation in vivo
in a tissue factor-dependent manner. J Thromb Haemost 2003;1:2561-68.
14. Sims PJ, Wiedmer T, Esmon CT, Weiss HJ, Shattil SJ. Assembly of the platelet
prothrombinase complex is linked to vesiculation of the platelet plasma membrane.
Studies in Scott syndrome: an isolated defect in platelet procoagulant activity. J Biol
Chem 1989;264:17049-57.
15. Castaman G, Yu-Feng L, Battistin E, Rodeghiero F. Characterization of a novel
bleeding disorder with isolated prolonged bleeding time and deficiency of platelet
microvesicle generation. Br J Haematol 1997;96:458-63.
16. Tate DA, Bode AP, Nichols TC, Dehmer GJ. Platelet activation detected by platelet-
derived microparticles in coronary sinus blood from patients with unstable coronary
syndromes. Circulation 1992;86:3193A.
17. Mallat Z, Benamer H, Hugel B, Benessiano J, Steg PG, Freyssinet JM, Tedgui A.
Elevated levels of shed membrane microparticles with procoagulant potential in the
peripheral circulating blood of patients with acute coronary syndromes. Circulation
1999;101:841-3.
18. VanWijk MJ, Nieuwland R, Boer K, van der Post JA, van Bavel E, Sturk A.
Microparticle subpopulations are increased in preeclampsia: possible involvement in
vascular dysfunction? Am J Obstet Gynecol 2002;187:450-6.
19. VanWijk MJ, Svedas E, Boer K, Nieuwland R, VanBavel E, Kublickiene KR. Isolated
microparticles, but not whole plasma, from women with preeclampsia impair
endothelium-dependent relaxation in isolated myometrial arteries from healthy
pregnant women. Am J Obstet Gynecol 2002;187:1686-93.
20. Perry IJ, Beevers DG. The definition of pre-eclampsia. BJOG 1994;101:587-91.
21. Semenov AV, Romanov YA, Loktionova SA, Tikhomirov OY, Khachikian MV,
Microparticle-associated P-selectin in preeclampsia
93
4
Vasil'ev SA, Mazurov AV. Production of soluble P-selectin by platelets and
endothelial cells. Biochemistry 1999;64:1326-35.
22. Semenov AV, Kogan-Ponomarev MI, Ruda MI, Komarov AL, Panchenko EP,
Chazova IE, Mazurov AV. Soluble P-selectin - a marker of platelet activation and
vessel wall injury: increase of soluble P-selectin in plasma of patients with myocardial
infarction, massive atherosclerosis and primary pulmonary hypertension. Ter Arkh
2000;72:15-20.
23. Chong BH, Murray B, Berndt MC, Dunlop LC, Brighton T, Chesterman CN. Plasma
P-selectin is increased in thrombotic consumptive platelet disorders. Blood
1994;83:1535-41.
24. Abid Hussein MN, Meesters EW, Osmanovic N, Romijn FP, Nieuwland R, Sturk A.
Antigenic characterization of endothelial cell-derived microparticles and their
detection ex vivo. J Thromb Haemost 2003;1:2434-43.
Chapter 5
Circulating platelet- and placenta-derived
microparticles expose Flt-1 in
preeclampsia
C.A.R. Lok, A.N. Böing, I.L. Sargent, S.R. Sooranna, J.A.M. van der Post,
R. Nieuwland, A. Sturk
provisionally accepted
Chapter 5
96
ABSTRACT
Introduction. The soluble (non-cell bound) vascular endothelial growth factor (VEGF)
receptor fms-like tyrosine kinase 1 (Flt-1) is secreted by trophoblast cells and elevated
concentrations occur in preeclampsia. By binding VEGF, Flt-1 deprives the endothelium of
this important mediator of angiogenesis and regulator of vascular tone and blood pressure.
Microparticles (MP) from preeclamptic patients affect vascular behavior and may also
expose Flt-1. Whether Flt-1 is associated with such MP is unknown. We determined
whether non-cell bound Flt-1 is associated with MP from preeclamptic patients and whether
levels of Flt-1-exposing MP are increased in preeclampsia. Furthermore, we established the
cellular origin of Flt-1-exposing MP and investigated whether full-length or truncated Flt-1
is associated with MP.
Methods. Samples were obtained from preeclamptic patients, normotensive pregnant and
non-pregnant women (each n=20). Concentrations of VEGF and non-cell bound Flt-1 were
measured by ELISA. MP were isolated and characterized by flow cytometry. Western blot
determined which form of Flt-1 is associated with MP.
Results. Non-cell bound Flt-1 was elevated in preeclampsia compared to pregnant and non-
pregnant women. A fraction of this Flt-1 (5%) was associated with MP in preeclampsia.
Flt-1-exposing MP were elevated in preeclampsia compared to normotensive pregnancy
(p=0.02), and they were predominantly of platelet and placental origin. Full-length Flt-1,
was identified in isolated MP but not in corresponding (MP-free) plasma samples.
Conclusions. Full-length Flt-1 is exclusively associated with platelet-derived and placenta-
derived MP. It is possible that the presentation of Flt-1 on the membrane of a MP might
alter its function, particularly if it acts in synergism with other vasoactive molecules
expressed alongside it on the MP.
Platelet- and placenta-derived microparticles expose Flt-1
97
5
I�TRODUCTIO�
To accommodate the vascular challenges of pregnancy, many growth factors are produced,
including vascular endothelial growth factor (VEGF). VEGF is produced by several organs
including the placenta, and plays an important role in angiogenesis, regulation of vascular
tone and blood pressure. To exert these functions, VEGF binds to one of its transmembrane
receptors, VEGFR-1 (fms-like tyrosine kinase 1 (Flt-1)) or VEGFR-2 (kinase-insert domain
region (KDR)) which are exposed by endothelial cells and other cells. The biological
activity of VEGF is -at least in part- regulated by binding to a circulating, non-cell bound
(‘soluble’) form of the Flt-1 receptor (sVEGFR-1 or sFlt-1)1. sFlt-1 is an alternatively
spliced product of the Flt-1 gene, which is released by various cell types into the blood and
elevated concentrations have been reported in placental tissue and in maternal serum in
preeclampsia2. Furthermore, this non-cell bound Flt-1 has been reported to be elevated in
plasma already before the onset of preeclampsia3.
Trophoblast cells expose Flt-1 and release non-cell bound Flt-1. These cells also
release small vesicles, so called (placenta-derived) microparticles (MP) from their outer
membrane into the circulation. Concurrently, MP are also released from maternal
leukocytes, endothelial cells and platelets. MP have been suggested to play a role in the
development of preeclampsia because they impair endothelial function in vitro4,5. In
preeclampsia, both non-cell bound Flt-1 as well as the numbers of placenta-derived MP are
increased compared to normal pregnancy2, 6. Since the concentrations of non-cell bound Flt-
1 are usually measured in cell-free plasma which contains MP, it is unclear whether the Flt-
1 that is detected is (partly) associated with and/or exposed on these circulating MP.
The aims of the present study were (I) to determine whether non-cell bound Flt-1
is associated with MP in plasma of patients with preeclampsia, (II) to evaluate whether the
numbers of Flt-1-exposing MP are increased in preeclampsia compared to normal
pregnancy, (III) to establish the cellular origin of Flt-1-exposing MP, and (IV) to determine
which forms of non-cell bound Flt-1 (full-length or truncated Flt-1) are associated with
circulating MP.
MATERIALS A�D METHODS Patients
The study was approved by the medical ethical committee of the Academic Medical Center.
After obtaining written informed consent, blood samples were obtained from preeclamptic
patients (n=20), normotensive pregnant women (n=20) and non-pregnant controls (n=20).
The women were matched for maternal age (± five years) and parity. The preeclamptic
Chapter 5
98
patients and normotensive pregnant women were also matched for gestational age (± two
weeks). Preeclampsia was defined as: (1) diastolic blood pressure of 110 mmHg or more on
any occasion or 90 mmHg or more on two separate occasions at least four hours apart, (2)
proteinuria of ≥0.3 gram protein / 24 hours and (3) symptoms developing after 20 weeks
gestational age and values returning to normal within 3 months after delivery. The control
groups consisted of healthy women not using any medication.
Collection of blood samples
Two blood samples (9 ml) were taken from the antecubital vein without a tourniquet
through a 20-gauge needle using a vacutainer system. The samples were collected into two
4.5 mL tubes containing 0.105 M buffered sodium citrate (Becton Dickinson; San Jose,
CA). Within 30 minutes after collection, cells were removed by centrifugation for 20
minutes at 1560 g and 20 °C. Plasma samples were then divided in 250 µL aliquots,
immediately snap frozen in liquid nitrogen to preserve MP structure and then stored at
-80 °C until further analysis.
ELISA
The concentration of both VEGF165 and (non-cell bound) sFlt-1 in MP-containing plasma
and in MP-free plasma (supernatant obtained after centrifugation of the MP-containing
plasma for 30 min at 18890 g) were determined by ELISA according to the protocol of the
manufacturer (Quantikine, R&D Systems; Abingdon, UK) in 10 patients from each group.
The intra-assay variation of the VEGF assay was 4.5-6.7%, the inter-assay variation
6.2-8.8% and the minimal detectable level 5.0 pg/mL. The intra-assay variation coefficient
of the sFlt-1 assay was 2.6-3.8% and the inter-assay variation 7.0-8.1%. The sensitivity of
the assay was 1.63-14.4 pg/mL.
Cell-specific Antibodies
Fluorescein isothiocyanate (FITC)-labeled IgG1 and phycoerythrin (PE)-labeled IgG1 and
anti-CD8-PE were obtained from Becton Dickinson (San Jose, CA). Allophycocyanin
(APC)-conjugated annexin V was purchased from Caltag (Burlingame, CA). Monoclonal
antibodies directed against endothelial cells (CD62e-FITC) and (s)Flt-1 (Flt-1-PE) were
obtained from R&D (Minneapolis, MN) and CD62e-PE from Ancell (Bayport, MN). Anti-
CD61-FITC (anti-GP-IIIa) and anti-glycophorin A-FITC were obtained from
DakoCytomation (Glostrup, Denmark). Anti-CD4-FITC was purchased from Sanquin
(Amsterdam, The Netherlands). Anti-CD66b was obtained from Immunotech (Beckman
Coulter; Mijdrecht, The Netherlands). ED822, a mouse monoclonal antibody to an
unknown antigen expressed on the apical surface of the syncytiotrophoblast was used to
detect trophoblastic cells7,8. The second antibody for the indirect labelling with ED822,
Platelet- and placenta-derived microparticles expose Flt-1
99
5
GAM(Fab)2-FITC was obtained from Dako (Glostrup, Denmark). The following final
dilutions of antibodies were used: IgG1-FITC (1:10), IgG1-PE (1:10), annexin V-APC
(1:20), anti-CD4-FITC (1:2.5), anti-CD8-PE (1:5), anti-CD61-FITC (1:30) anti-CD62e-PE
(1:20), anti-CD62e-FITC (1:5), anti-CD66b (1:20), anti-Flt-1-PE (1:15), anti-GlycoA-FITC
(1:5), ED822 (1:2.5) and GAM(Fab)2-FITC (1:20).
Isolation of microparticles
A sample of 250 µL frozen plasma was thawed on ice and centrifuged for 30 minutes at
18890 g and 20 ºC to pellet the MP. After centrifugation, 225 µL of the supernatant was
removed. The MP pellet and remaining supernatant was resuspended in 225 µL phosphate-
buffered saline with citrate (154 mmol/L NaCl, 1.4 mmol/L phosphate, 10.9 mmol/L
trisodium citrate, pH 7.4). After centrifugation for 30 minutes at 18890 g and 20 ºC, 225 µL
of the supernatant was removed again. The MP pellet was then resuspended in 75 µL PBS-
citrate.
Flow cytometry
Five µL of the MP suspension was diluted in 35 µL CaCl2 (2.5 mmol/L)-containing PBS.
Then 5 µL APC-labeled annexin V was added to all tubes plus 5 µL of the cell-specific
monoclonal antibody or isotype-matched control antibodies. The samples were then
incubated in the dark for 15 minutes at room temperature. After incubation, 900 µL of
calcium-containing PBS was added to all tubes (except to the annexin V control, to which
900 µL citrate-containing PBS was added). Samples were analyzed for one minute in a
flow cytometer (FACS Calibur) with CellQuest software (Becton Dickinson; San Jose,
CA). Both forward scatter (FSC) and sideward scatter (SSC) were set on logarithmic gain.
MP were identified on the basis of their size and density and on their capacity to bind
annexin V. Annexin V measurements were corrected for autofluorescence. Labeling with
cell-specific monoclonal antibodies was corrected for using identical concentrations of
isotype-matched control antibodies. Double labeling of anti-CD4-FITC, anti-CD8-PE, anti-
CD61-FITC, anti-CD62e-FITC, anti-CD66b and anti-GlycoA-FITC with anti-Flt-1-PE
were performed to investigate the origin of the Flt-1-exposing MP. Calculation of the
number of MP per liter plasma was based upon the particle count per unit time, the flow
rate of the flow cytometer, and the net dilution during sample preparation of the analyzed
MP suspension.
Double labeling of ED822 and Flt-1
Samples with high numbers of Flt-1-exposing MP were selected to investigate whether they
originated from trophoblast cells, using an indirect staining procedure. Samples with low
numbers of Flt-1-exposing MP were not investigated, since the losses due to the two
Chapter 5
100
washing steps, which were necessary to enable indirect staining of MP, result in very low
MP numbers for analysis. MP (5 µL aliquots) were incubated for 15 minutes at room
temperature in a final volume of 50 µL of PBS containing 2.5 mmol/L CaCl2 (PBS/Ca, pH
7.4) and unlabeled ED822, anti-Flt-1-PE and annexin V-APC. After incubation with the
antibody, the MP were washed with 200 µL of PBS/Ca. Then, 5 µL GAM(Fab)2-FITC was
added, and the mixtures were again incubated for 15 minutes at room temperature.
Subsequently, 300 µL of buffer was added and the MP were analyzed by flow cytometry.
Western Blotting
Because the ELISA does not discriminate between full-length Flt-1 and alternatively
spliced Flt-1, the elevated plasma levels of non-cell bound Flt-1 in preeclampsia may be
either “truly soluble” Flt-1 or transmembrane Flt-1 associated with MP. These forms can be
discriminated by Western blot analysis.
For Western blotting, the total MP population was isolated from 750 µL plasma by
centrifugation for 1 hour at 18890 g. Because of the higher volume of this plasma sample,
1 hour of centrifugation was necessary to pellet all MP. Then, 725 µL MP-free plasma
(supernatant) was removed and stored. The remaining 25 µL plasma containing the MP was
resuspended in 725 µL PBS and then centrifuged again for 1 hour at 18890 g and 20 °C.
Then, 740 µL of the supernatant was removed. The MP pellet was dissolved in reducing
sample buffer (final volume 25 µL) and 6 µL MP-free plasma was diluted with 210 µL
PBS. The diluted MP-free plasma was further diluted twofold with reducing sample buffer
(final dilution 72 times, which is the same concentration as the residual plasma in the MP
samples). The samples (10 µL) were transferred to gradient gels (4-15%) and blotted to
PVDF (both from BioRad; Hercules, CA). Membranes were blocked with 5% BSA (Sigma
Aldrich; Zwijndrecht, The Netherlands) for 1 hour. Western blots were labelled with an
antibody recognizing full-length Flt-1 as well as its truncated, non-cell bound form, in
2.5 % BSA (Abcam; Cambridge, UK). For staining, goat anti-rabbit peroxidase-labelled
was used (Dako; Glostrup, Denmark). For detection, a Lumi-light plus conjugate was used
(Roche; Indianapolis, IN). A lysate from IL-1α stimulated human umbilical vein
endothelial cells (HUVEC, 1 hour, 5 ng/mL) was used as positive control.
Statistical analysis
Data were analyzed with the Statistical Package of the Social Science software for
Windows, release 11.5 (SPSS Benelux BV; Gorinchem, The Netherlands). The
demographic characteristics of patients were normally distributed and therefore presented
as means ± SD and compared with ANOVA and Bonferroni post-hoc tests. The data from
the flow cytometric analysis and ELISA were not normally distributed and therefore
presented as medians and ranges and analyzed with Kruskal Wallis Tests for differences
Platelet- and placenta-derived microparticles expose Flt-1
101
5
among the three study groups and Mann-Whitney U Tests for comparisons between the
preeclampsia and normotensive pregnancy group or the non-pregnant controls. If the
concentration of a sample was below the detection limit of the ELISA assay, calculations
were performed with the lowest measurable concentration. A probability value of <0.05
was considered statistically significant. Correlations were calculated with a two-sided
bivariate Pearson correlation test.
RESULTS
Patient characteristics
Patient characteristics are summarized in Table 1. Age and body mass index (BMI) were
comparable between groups. As expected, birth weight and gestational age at delivery were
significantly lower in the preeclamptic women compared to normotensive pregnant women.
Both systolic and diastolic blood pressures were significantly higher in preeclampsia
compared to the control groups. The majority of women were primiparous in both the
preeclamptic and normotensive pregnant groups. In the preeclamptic group, 12 patients
used antihypertensive medication (60%) and 5 patients (25%) suffered from HELLP
(hemolysis, elevated liver enzymes, low platelets) syndrome besides preeclampsia.
Plasma concentrations of VEGF and sFlt-1
The plasma concentrations of VEGF were below the detection limit in all preeclamptic
patients (<7.8 pg/mL; Figure 1A). The concentration of VEGF was 8.1 pg/mL (range 7.8-
44.5 pg/mL) in normotensive pregnant patients and 16.7 pg/mL (range 11.1-24.4 pg/mL) in
non-pregnant women. In contrast to VEGF, the concentration of non-cell bound Flt-1 was
significantly elevated in preeclampsia (Figure 1B; 2288 pg/mL, range 1106-4763 pg/mL)
compared to normotensive pregnant women (227 pg/mL, range 153-369 pg/mL) and non-
pregnant women (31.2 pg/mL, range 31.2-65.0 pg/mL).
When the plasma was centrifuged to remove MP, about 95% of non-cell bound
Flt-1 remained in the MP-free supernatant from preeclamptic patients. Thus, about 5%
(range 0-13%) of non-cell bound Flt-1 was associated with MP in this group.
Chapter 5
102
Table 1. Patient characteristics
Table 1. P: difference between preeclampsia and normotensive pregnant controls. P*:
difference between preeclampsia and non-pregnant controls. BMI: Body Mass Index.
Figure 1. Concentrations of VEGF and non-cell bound Flt-1 in plasma
Figure 1. The concentrations of (A) VEGF and (B) non-cell bound Flt-1 are shown. Each
dot represents one patient. The dotted lines represent the lower detection limit of these
assays.
Preeclampsia
(n = 20)
Normotensive
pregnancy
(n = 20)
Non-pregnant
controls
(n = 20)
P P*
Age (years) 30.0 ± 4.9 29.2 ± 3.6 29.9 ± 3.6 NS NS
Gestational age
At study (wks)
At delivery (wks)
29.4 ± 2.2
31.9 ± 3.1
30.3 ± 3.0
39.1 ± 1.8
-
-
NS
0.0001
-
-
Blood pressure
Systolic (mmHg)
Diastolic (mmHg)
159 ± 15
99 ± 9
114 ± 13
67 ± 9
113 ± 15
70 ± 9
0.0001
0.0001
0.0001
0.0001
BMI (kg/m2) 27.1 ± 6.1 23.7 ± 4.9 21.9 ± 2.1 NS NS
Proteinuria (g/L) 6.1 ± 4.7 - - - -
Parity
Primiparous
Multiparous
18
2
18
2
-
-
-
-
-
-
Birth weight (gr) 1324 ± 566 3351 ± 585 - 0.0001 -
Platelet- and placenta-derived microparticles expose Flt-1
103
5
Circulating MP expose non-cell bound Flt
Total numbers of MP were decreased in preeclampsia compared to both normotensive
pregnant women and non-pregnant controls (Figure 2A). There were no correlations
between the number of MP with either blood pressure, proteinuria or birth weight. The
majority of the MP (94-98%) originated from platelets in all groups (data not shown). The
number of endothelial cell-derived MP did not differ between groups (Figure 2B). Figure 2. Circulating microparticles in preeclampsia
Figure 2. This figure shows box-plots of the number of (A) total MP, (B) endothelial cell-
derived MP, (C) Flt-1-exposing MP and (D) the proportion of Flt-1-exposing MP.
Chapter 5
104
In contrast, the numbers of MP exposing Flt-1 were elevated in preeclamptic patients
compared to normotensive pregnant women (Figure 2C; p=0.02). Moreover, the fraction of
Flt-1-exposing MP (Figure 2D) was elevated in preeclampsia (1.36%, range 0-16%)
compared to normotensive pregnancy (0.23%, range 0-40%; p=0.001) and non-pregnant
controls (median 0.30%, range 0-4%; p=0.0001).
Further characterization of MP-associated (non-cell bound) Flt-1
Figure 3A shows placenta-derived MP exposing Flt-1. In Figure 3B a representative
Western blot of MP fractions and MP-free plasma is presented.
Figure 3. Flt-1 is associated with circulating microparticles
Figure 3. A: Dot plot of a single experiment showing the staining of isolated MP from
preeclamptic plasma labeled with either anti-Flt-1 or its negative control antibody. B:
Western blot showing lysates of MP and corresponding MP-free plasma of 2 normotensive
pregnant and 2 preeclamptic patients. MP lysates contain a 150 kDa band corresponding
full-length Flt-1. HUVEC: A culture supernatant of HUVEC used as a positive control for
the Flt-1 analyses.
Platelet- and placenta-derived microparticles expose Flt-1
105
5
Two different concentrations of HUVEC lysate were used as positive controls, showing a
single 150 kDa (full-length) form of Flt-1. Lysates from isolated MP fractions and the
corresponding MP-free plasma samples of two preeclamptic patients and two pregnant
controls are presented. All MP lysates contained detectable amounts of 150 kDa Flt-1,
suggesting that MP expose the transmembrane form of Flt-1. Since the corresponding (MP-
free) plasma samples did not contain a full-length form, this 150 kDa Flt-1 is exclusively
associated with circulating MP.
Cellular origin of MP exposing non-cell bound Flt-1
A clearly detectable population of circulating Flt-1-exposing MP was present in plasma
samples from 13 women (9 patients with preeclampsia and 4 women with a normotensive
pregnancy). To establish the cellular origin of these circulating Flt-1-exposing MP, double
labeling experiments were performed using a panel of various cell-specific antibodies. MP
originating from erythrocytes, Thelper-cells, Tsuppressor-cells, granulocytes or endothelial cells
did not stain for Flt-1.
Figure 4. The percentage of Flt-exposing platelet- and placenta-derived microparticles
Figure 4. The percentage of Flt-1-exposing PMP is presented in figure A. Each dot
represents one patient. The second graph (B) shows the Flt-1-exposing MP derived from
the placenta. The staining procedure of these placenta-derived MP with Flt-1 differs from
the procedure to stain PMP (see Methods). Therefore, the percentages presented in B
cannot be added to the percentages in A.
Chapter 5
106
The majority of the Flt-1-exposing MP (77-86%) originated from platelets (Figure 4A).
The other Flt-1 exposing MP (approximately 19% in the preeclamptic patients) double
stained with ED822, confirming their placental origin (Figure 4B). A representative
example of placenta-derived MP exposing Flt-1 in the plasma of a patient with
preeclampsia is shown in Figure 5. Although the majority of the Flt-1-exposing MP was
derived from platelets, this was only a minor fraction of all platelet-derived MP (PMP).
Nevertheless, this fraction was elevated in preeclampsia (0.7%, range 0.20-1.60%)
compared to normotensive pregnant controls (0.3%, range 0.1-0.6%; p=0.01) but not to
non-pregnant controls (0.6%, range 0.1-3.4%; p>0.05). There was no correlation between
the number of PMP and the number of Flt-1-exposing MP. In contrast, a strong correlation
was present between the total number of ED822-exposing MP and Flt-1-exposing MP
(r=0.744, p= 0.009).
Figure 5. Placenta-derived microparticles expose Flt-1
Figure 5. A representative example of placenta-derived MP exposing Flt-1 in the plasma of
a patient with preeclampsia is shown.
Platelet- and placenta-derived microparticles expose Flt-1
107
5
DISCUSSIO�
In the present study, we confirmed that the concentration of non-cell bound Flt-1 is elevated
in preeclampsia compared to normotensive pregnancies and non-pregnant controls. A
fraction of non-cell bound Flt-1 is associated with MP. Thus, at least two different forms of
non-cell bound Flt-1 concurrently occur in plasma of preeclamptic patients. First, a major
fraction of (truly) “soluble” Flt-1, and a second, minor fraction of full-length Flt-1 which is
exclusively associated with MP.
Total numbers of MP were decreased in preeclampsia probably reflecting the
decreased platelet count in preeclampsia9. Our present study shows that plasma from
preeclamptic patients contains substantial numbers of platelet-derived and placenta-derived
MP exposing Flt-1. It is tempting to speculate that the increased presence of such MP
contributes to the reported effects of MP on the endothelium. Various in vitro models of
angiogenesis have shown that serum of pregnant women induced endothelial cells to form
tube-like structures whereas serum from preeclamptic patients inhibited this formation1.
Moreover, addition of non-cell bound Flt-1 to normal serum also inhibited this tube
formation. This inhibitory action could be overcome by addition of VEGF and Placental
Growth Factor. In fact, administration of non-cell bound Flt-1 to rats mimics several of the
clinical symptoms of preeclampsia, including hypertension and glomerular endotheliosis1.
In an animal model, MP also induced various features characteristic of preeclampsia. Mice
infused with in vitro prepared (artificial) phosphatidylserine/phosphatidylcholine vesicles,
developed symptoms characteristic of preeclampsia10, and incubation of myometrial
arteries with MP from preeclamptic patients impaired bradykinin-mediated relaxation11,12.
We found that the majority of Flt-1-exposing MP originated from platelets. This is
not surprising, because PMP compose the largest subgroup of MP in both pregnant women
and preeclamptic patients. Moreover, Flt-1 has been shown to be exposed on activated
platelets enabling a feed forward of VEGF on thrombin-activated platelets13. The remaining
Flt-1-exposing MP originated from placenta. Despite the fact that these MP constitute only
a relatively small fraction of the total number of circulating MP in the maternal blood, still
significantly elevated numbers are present in plasma from preeclamptic women compared
to normal pregnancy6,14. Plasma of some patients contained substantial numbers of Flt-1
exposing MP. This variation between patients can be caused by the time of sample
collection. In our measurements, we assume that MP are continuously shed into the
circulation. However, it has been postulated that e.g. placenta-derived MP are episodically
shed into the circulation, possibly after placental incidents like ischemia6. This may also
apply to other subpopulations of MP. It also should be mentioned that MP isolated from
plasma do not reflect the entire in vivo situation, since particular subsets of MP may already
have been removed from the circulation, either by clearance or by adherence to the
Chapter 5
108
(damaged) endothelium or to other cells. Indeed, it has been shown that placenta-derived
MP can be taken up by monocytes8. Thus, the true proportion of Flt-1-exposing MP
originating from the placenta may be higher in vivo.
Perfusion of subcutaneous fat arteries with in vitro prepared placenta-derived MP
impaired the relaxation response, suggesting that such MP are indeed capable of
modulating endothelial “dysfunction”5. Taken together, these data may point to a possible
effect of MP containing Flt-1. This study is the first step to elucidate the role of differences
in particular subsets of MP in preeclampsia. Additional studies in small resistance arteries
are essential to demonstrate the functional consequences of these differences.
Non-glycosylated full-length Flt-1 has a molecular weight of 150 kDa15. The non-
cell bound (and non-MP associated) Flt-1 molecule lacks the transmembrane and
cytoplasmic regions, and has a lower molecular weight. Different molecular weights of the
truly soluble Flt-1 have been reported in the literature, depending on the origin and the
glycosylation status of the molecule. Our finding of full-length Flt-1 with a molecular
weight of 150 kDa in the MP fractions is in line with earlier reports15. To which extent the
biological activity of MP-bound Flt-1 in our study contributes to the pathophysiological
development of preeclampsia, however, remains to be determined.
In conclusion, the concentration of non-cell bound Flt-1 is significantly elevated in
plasma from preeclamptic patients. Different forms of non-cell bound Flt-1 coexist in such
plasma samples, i.e. a minor fraction of a full-length (transmembrane) form (150 kDa) that
is associated with MP, and a major fraction of truncated Flt-1, which is truly “soluble”. The
biological activities of the coexisting forms of (s) Flt-1 in preeclampsia are of great interest
and remain to be established. It is possible that the presentation of Flt-1 on the membrane of
a MP might alter its function, particularly if it acts in synergism with other vasoactive
molecules expressed alongside it on the MP.
ACK�OWLEDGEME�TS
The authors wish to thank Chi Hau and Anita Grootemaat for their technical assistance.
REFERE�CES
1. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S Libermann TA, Morgan
JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP, Karumanchi SA. Excess
placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial
Platelet- and placenta-derived microparticles expose Flt-1
109
5
dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest
2003;111:649-58.
2. McKeeman GC, Ardill JE, Caldwell CM, Hunter AJ, McClure N. Soluble vascular
endothelial growth factor receptor-1 (sFlt-1) is increased throughout gestation in
patients who have preeclampsia develop. Am J Obstet Gynecol 2004;191:1240-6.
3. Chaiworapongsa T, Romero R, Kim YM, Kim GJ, Kim MR, Espinoza J Bujold E,
Gonçalves L, Gomez R, Edwin S, Mazor M. Plasma soluble vascular endothelial
growth factor receptor-1 concentration is elevated prior to the clinical diagnosis of
pre-eclampsia. J Matern Fetal Neonatal Med 2005;17:3-18.
4. Vanwijk MJ, Svedas E, Boer K, Nieuwland R, Vanbavel E, Kublickiene KR. Isolated
microparticles, but not whole plasma, from women with preeclampsia impair
endothelium-dependent relaxation in isolated myometrial arteries from healthy
pregnant women. Am J Obstet Gynecol 2002;187:1686-93.
5. Cockell AP, Learmont JG, Smarason AK, Redman CW, Sargent IL, Poston L. Human
placental syncytiotrophoblast microvillous membranes impair maternal vascular
endothelial function. Br J Obstet Gynaecol 1997;104:235-40.
6. Knight M, Redman CW, Linton EA, Sargent IL. Shedding of syncytiotrophoblast
microvilli into the maternal circulation in pre-eclamptic pregnancies. Br J Obstet
Gynaecol 1998;105:632-40.
7. Contractor SF, SR Sooranna. Monoclonal antibodies to cytotrophoblast and
syncytiotrophoblast of human placenta. J Dev Physiol 1986;8:277–82.
8. Germain SJ, Sacks GP, Sooranna SR, Sargent IL, Redman CW. Systemic
inflammatory priming in normal pregnancy and preeclampsia: the role of circulating
syncytiotrophoblast microparticles. J Immunol 2007;178:5949-56.
9. Lok CA, Nieuwland R, Sturk A, Hau CM, Boer K, Vanbavel E, Vanderpost JA.
Microparticle-associated P-selectin reflects platelet activation in preeclampsia.
Platelets 2007;18:68-72.
10. Omatsu K, Kobayashi T, Murakami Y. Phosphatidylserine/phosphatidylcholine
microvesicles can induce preeclampsia-like changes in pregnant mice. Semin Thromb
Hemost 2005;31:314-20.
11. Tesse A, Meziani F, David E Carusio N, Kremer H, Schneider F, Andriantsitohaina R.
Microparticles from preeclamptic women induce vascular hyporeactivity in vessels
from pregnant mice through an overproduction of Nitric Oxide. Am J Physiol Heart
Circ Physiol 2007;293:H520-5.
12. Vanwijk MJ, Svedas E, Boer K, Nieuwland R, Vanbavel E, Kublickiene KR. Isolated
microparticles, but not whole plasma, from women with preeclampsia impair
endothelium-dependent relaxation in isolated myometrial arteries from healthy
pregnant women. Am J Obstet Gynecol 2002;187:1686-93.
Chapter 5
110
13. Sellheim F, Holmsen H, Vassbotn, FS. Identification of functional VEGF receptors on
human platelets. FEBS letters 2002;512:107-10.
14. Goswami D, Tannetta DS, Magee LA. Excess syncytiotrophoblast microparticle
shedding is a feature of early-onset pre-eclampsia, but not normotensive
15. Banks RE, Forbes MA, Searles J Pappin D, Canas B, Rahman D, Kaufmann S,
Walters CE, Jackson A, Eves P, Linton G, Keen J, Walker JJ, Selby PJ. Evidence for
the existence of a novel pregnancy-associated soluble variant of the vascular
endothelial growth factor receptor, Flt-1. Mol Hum Reprod 1998;4:377-86.
intrauterine growth restriction. Placenta 2006;27:56-61.
111
PART III
Microparticles and inflammation
Chapter 6
Expression of inflammation-related genes
in endothelial cells is not directly affected
by microparticles from preeclamptic
patients
C.A.R. Lok, A.N. Böing, P.H. Reitsma, J.A.M. van der Post, E. van Bavel,
K. Boer, A. Sturk, R. Nieuwland
J. Lab. Clin. Med. 2006;147:310-20
Chapter 6
114
ABSTRACT
Introduction. Inflammation and endothelial dysfunction are prominent in preeclampsia.
Microparticles (MP) may link these processes, as MP induce the production of pro-
inflammatory cytokines by endothelial cells and cause endothelial dysfunction. Aim: To
study changes in expression of inflammation-related genes in human endothelial cells in
response to MP from preeclamptic patients.
Methods. Human umbilical vein endothelial cells (HUVEC) were incubated for various
time intervals in the absence or presence of isolated MP fractions from preeclamptic
patients (n=3), normotensive pregnant women (n=3), non-pregnant controls (n=3) and
interleukin (IL)-1α as a positive control. Total RNA was isolated and used for Multiplex
Ligation-dependent Probe Amplification (MLPA) and real-time PCR.
Results. IL-1α enhanced the expression of IL-1α, IL-2, IL-6, IL-8, nuclear factor of kappa
light chain enhancer in B-cells (NFκB)-1, NFκB-2, NFκB-inhibitor, cyclin dependent
kinase inhibitor and monocyte chemotactic protein-1 and transiently increased tissue factor
expression. RNA expression of inflammation-related genes and genes encoding adhesion
receptors, however, were unaffected by any of the MP fractions tested.
Conclusions. MLPA is a suitable assay to test the inflammatory status of endothelial cells,
since incubation with IL-1α triggered substantial changes in RNA expression in endothelial
cells. Taken together, it seems unlikely that MP from preeclamptic patients induce
endothelial dysfunction by directly affecting the expression of inflammation-related genes
in these cells.
Microparticles and endothelial gene expression
115
6
I�TRODUCTIO�
Inflammation and endothelial dysfunction are both prominent in the development of
preeclampsia1. The activated endothelium plays a pivotal role by the production of
inflammatory mediators such as cell-adhesion receptors, growth factors, cytokines and
mediators that influence the vascular tone. However, the factors that initiate this
inflammatory response are still unknown.
Microparticles (MP), small membrane vesicles released from activated or
apoptotic blood- or endothelial cells, modulate endothelial cell function since MP from
preeclamptic patients impair endothelium-mediated relaxation in isolated myometrial
arteries2. In addition, in vitro generated platelet-derived MP (PMP) trigger the production
of interleukin (IL)-1β, IL-6 and IL-8 in endothelial cells, as reflected by both elevated
mRNA and protein levels3. Leukocyte-derived MP induced the production of the pro-
inflammatory cytokines IL-6 and monocyte chemotactic protein (MCP)-1 by endothelial
cells4,5, and leukocyte MP from synovial fluid of arthritic joints triggered the production of
IL-8 and MCP-1 by fibroblast-like synoviocytes6. Elevated levels of MP from leukocytes
have been reported in preeclampsia7. Whether isolated MP fractions from preeclamptic
patients affect the expression of inflammation-related genes or genes encoding adhesion
receptors in endothelial cells is the focus of this study.
To study possible MP-induced changes in RNA expression of endothelial cells, a
novel method, Multiplex Ligation-dependent Probe Amplification (MLPA)8 was used. In
parallel experiments, the suitability of this method in endothelial cells was investigated by
measuring time-dependent changes in (m)RNA-expression of 40 different inflammation-
related genes induced by the pro-inflammatory cytokine IL-1α. Real-time PCR was used to
determine RNA expression levels of various adhesion receptors produced by endothelial
cells after incubation with MP or IL-1α
MATERIALS A�D METHODS Patients
The study was approved by the medical ethical committee of the Academic Medical Center
and was carried out according to the principles of the Declaration of Helsinki. After
obtaining written informed consent, blood samples were obtained from preeclamptic
patients (n=3), normotensive pregnant women (n=3) and non-pregnant controls (n=3). The
women were matched for maternal age (± five years) and parity. The preeclamptic patients
and normotensive pregnant women were also matched for gestational age (± two weeks).
The non–pregnant controls were healthy women not using any medication, including oral
Chapter 6
116
contraceptives. Preeclampsia was defined according to the definitions of the International
Society for the Studies of Hypertension in Pregnancy (ISSHP): (1) diastolic blood pressure
of 110 mm Hg or more on any occasion or 90 mm Hg or more on two separate occasions at
least four hours apart, (2) proteinuria of 0.3 gram protein in 24 hours developing after 20
weeks gestational age and (3) values returning to normal within 3 months after delivery.
In each group, two patients were primiparous and one patient was multiparous. As
expected, the systolic and diastolic blood pressures were significantly higher in the
preeclamptic group compared with the normotensive pregnant women and the non-pregnant
controls. The birth weight was lower in the preeclamptic group compared with the
normotensive pregnant women. No other differences existed (Table 1).
Collection of blood samples
Samples were taken from the antecubital vein without a tourniquet through a 20-gauge
needle with a vacutainer system. The samples were collected into a 4.5 mL tube containing
0.105 M (3.2%) buffered sodium citrate (Becton Dickinson; San Jose, CA). Within 30
minutes after collection, cells were removed by centrifugation for 20 minutes at 1560 g and
20 °C. Plasma samples were then divided in 250 µL aliquots, immediately snap frozen in
liquid nitrogen to preserve MP structure and then stored at –80 °C until further analysis.
Isolation of microparticles
Plasma (8 aliquots) was thawed on melting ice, pooled in two aliquots of 1 mL and
centrifuged for 60 minutes at 18890 g and 20 ºC to pellet the MP. After centrifugation, 975
µL of the supernatant was removed from each aliquot. The MP pellets (25 µL) were then
resuspended in 500 µL culture medium and 25 µL of the MP-free plasma was also diluted
in 500 µL culture medium.
Endothelial cell isolation
Umbilical cords were collected on the delivery ward at the Academic Medical Center. Only
umbilical cords from healthy pregnant women with uncomplicated singleton pregnancies
were used. Our procedures for endothelial cell isolation have been described before9. As the
addition of serum is essential for the survival of endothelial cells, MP from human serum
were removed by centrifugation. In the third passage, HUVEC were transferred to a 24-well
plate coated with gelatin. After confluence, the cells were maintained for 2-3 days until
steady state was achieved before the experiments were started.
Microparticles and endothelial gene expression
117
6
Table 1. Patient characteristics
Preeclampsia
(n = 3)
�ormotensive
pregnancy
(n = 3)
�on-
pregnant
controls
(n = 3)
P P*
Age (years) 29.1 ± 5.5 29.6 ± 5.0 25.7 ± 4.6 NS NS
Gestational age (wks) 30.2 ± 2.7 31.2 ± 1.2 NS
Blood pressure
Systolic (mmHg)
Diastolic (mmHg)
163 ± 7.6
112 ± 10.4
107 ± 5.8
65 ± 5.0
122 ± 14.9
69 ± 5.3
0.002
0.001
0.008
0.001
Body Mass Index
(kg/m2)
25.0 ± 7.5 25.0 ± 8.2 NS
Birth weight 1460 ± 370 3295 ± 572 0.02
Table 1. Data are presented as mean ± SD. AS: not significant. P: P-value of difference in
means between preeclampsia and normotensive pregnancy.P*: P-value of the difference in
means between preeclampsia and non-pregnant controls.
Incubation and R�A isolation
For the initial experiments with IL-1α to study the time-dependent changes in mRNA
expression in activated HUVEC and the suitability of the MLPA assay, culture medium of
the confluent cells was replaced by culture medium containing IL-1α (5 ng/mL, Sigma-
Alderich Chemie; Zwijndrecht, The Netherlands) or by culture medium without IL-1α
(control). Endothelial cells were incubated at 37 °C with IL-1α or culture medium alone for
0, 30, 60, 90, 120 or 240 minutes. To analyze the possible effect of endothelial cell
subcultures on RNA expression, endothelial cells from two different umbilical cords were
cultured and RNA was isolated from the first and third passage cells. All measurements
were performed in triplicate. Cells were incubated without or with IL-1α for one hour and
four hours. RNA expression was analyzed by MLPA.
For the MP-experiments, endothelial cells were incubated with 500 µL culture
medium with either isolated MP or MP-free plasma. Previously, the cellular origin of
circulating MP in preeclamptic patients was determined and showed that >95% of these MP
are derived from platelets7. IL-1α and culture medium alone were used as positive and
negative controls. After 1 hour and 4 hours incubation, culture medium was removed and
cells were detached by incubation with 500 µL trypsin. Subsequently, the cell suspensions
were mixed with 500 µL culture medium and centrifuged for 10 minutes at 20 °C and
Chapter 6
118
300 g. The supernatant was removed and total RNA was isolated from the endothelial cells
using RNeasy columns (Qiagen; Hilden, Germany), according to the protocol of the
manufacturer. Total RNA was dissolved in 30 µL RNase-free water (Qiagen; Hilden,
Germany) and stored at –20 °C until further analysis.
MLPA
MLPA (kit P009, MRC-Holland; Amsterdam, The Netherlands) was performed with RNA
in a concentration of 40-60 ng RNA/µL. With the MLPA assay 40 different genes can be
determined simultaneously using 40 different probes8. The length of a MLPA probe varies
between 130-500 bp. Each probe consists of a short oligonucleotide that contains a target-
specific sequence at the 3’ end and a longer oligonucleotide that contains a target-specific
sequence at the 5’ phosphorylated end and a stuffer sequence of a variable length to enable
the separation of the different PCR products during electrophoresis. The MLPA assay
consists of six steps, of which the first five are schematically presented in Figure 1: (1)
isolation of RNA, (2) production of single strand cDNA, (3) hybridization and (4) ligation
of different probes, (5) PCR of the ligated probes and finally (6) capillary electrophoresis.
The RNA samples were thawed and 2.5 µL of each RNA sample was used. For the reverse
transcription (RT) reaction (2), a RT-primer mix, RT-buffer and dNTP’s were added to the
200 µL PCR tubes containing the RNA samples. Samples were heated at 80 °C for 1
minute in a high-speed thermal cycler with a heated lid (Biometra Uno II; Göttingen,
Germany) and incubated for 5 minutes at 45 °C. Reverse transcriptase was diluted to 20
U/µL and 1.5 µL was added per sample. After 15 minutes incubation at 37 °C, the samples
were heated at 98 °C for 2 minutes. In the hybridization phase (3), 1.5 µL buffer (1.5 M
KCl, 1 mM EDTA, 300 mM Tris-HCl, pH 8.5) and 1.5 µL probe mix (1-4 fmol of each
short probe oligonucleotide and each long probe oligonucleotide in Tris EDTA) were added
to the samples. The samples were then heated for 1 minute at 95 °C, followed by incubation
for 16 hours at 60 °C to allow complete hybridization. The procedure was continued with
the addition of a ligase enzyme at 54 °C for 15 minutes to enable ligation (4). The samples
were heated for 5 minutes at 98 °C. Then the PCR reaction was started with 5 µl of the
MLPA product (5) with the addition of an enzyme dilution buffer, PCR primers, water and
a polymerase mix. The amplification cycle (95 °C – 60 °C – 72 °C) was repeated 32 times.
ROX-500, a fluorescent marker, was added to the PCR product. Samples were purified with
Sephadex G-50 (Sigma-Alderich Chemie; Zwijndrecht, The Netherlands) in filter plates
(mahvn4550; Millipore; Billerica, USA) and analyzed by capillary electrophoresis (6) on a
capillary sequencer (ABI 3100, Applied Biosystems; Warrington, UK). The intensity and
size of the different probes were calculated with Genescan and Genotyper software
packages (Applied Biosystems; Warrington, UK).
Microparticles and endothelial gene expression
119
6
Figure 1. Schematic overview of the MLPA procedure
Figure 1. The MLPA assay consists of six steps, of which the first five are shown: (1)
isolation of RAA, (2) production of single strand cDAA by a RT reaction, (3) overnight
hybridization of 40 pairs of a short probe oligonucleotide (A) and a long probe
oligonucleotide (B) with the cDAA (4) ligation of different probes by a ligase enzyme and
(5) PCR of the ligated probes 32 cycles. The last step (6), capillary electrophoresis is not
shown in this figure.
In line with the manufacturers’ instruction for the application of the MLPA kit in blood
cells, β-2-microglobulin (B2M) was chosen as a reference (household) gene for this study.
In preliminary experiments (data not shown), it was confirmed that changes in B2M
expression were minimal in both control cells and in response to IL-1α. In each experiment,
the expression of the B2M gene was arbitrarily set at 1.0 (i.e. 100%), to which changes in
gene expression were compared. (Figures 2 and 3).
Chapter 6
120
Real-time LightCycler PCR
Real-time PCRs were performed on a LightCycler System according to the protocol of the
manufacturer (Roche Diagnostics; Mannheim, Germany). RT was carried out at 42 °C for
60 minutes (first strand cDNA synthesis kit, Roche Molecular Biochemicals; Mannheim,
Germany). For each PCR reaction, 2 µL of cDNA and 18 µL reaction mixture were used.
The reaction mixture contained 2.0 µL DNA Master Mix SYBR Green I (Taq DNA
polymerase, SYBR Green I dye, 10 mmol/L MgCl2 and deoxynucleoside triphosphate mix),
0.5 µL (2.5 ng) of both the forward and reverse primer, 2.4 µL 4.0 mmol/L MgCl2 and 12.6
µL aqua dest. Primers for E-selectin, ICAM-1, VCAM-1, GAPDH and TF were obtained
from Biolegio; Nijmegen, The Netherlands, primers are summarized in Table 2. For DNA
amplification, 40 cycles of denaturation (95 °C, 30 s), annealing (10 s; primer-dependent,
see Table 2) and extension (72 °C, 10 s) were performed. Water was used as a negative
control. The melting curve analysis started at 95 °C, was then decreased to 5 °C below the
annealing temperature of each primer and then increased again to 95 °C at the rate of 0.2
°C/s. Quantification analysis was performed as described by Ramakers et al 10. In each
experiment, the expression of GAPDH was set at 1.0 (i.e. 100%), to which changes in E-
selectin, ICAM-1, VCAM-1 and TF expression were compared.
Table 2. Primers used for Real-time LightCycler PCR
Sequence (5' → 3' ) BP Annealing temp
ICAM-1 forward TTCCTCACCGTGTACTGGACT 228 bp 60 °C
reverse TCCATGGTGATCTCTCCTCA
E-selectin forward TGAGCATGGAAGCCTGGTTT 227bp 60 °C
reverse AGCTTCCAGGGTTTTGGAAA
TF forward TGAAGGATGTGAAGCAGACGT 237 bp 58 °C
reverse GGCTTAGGAAAGTGTTGTTCC
VCAM-1 forward GGAATTTCTGGAGGATGCAGA 226 bp 58 °C
reverse TTGCAGCTTTGTGGATGGAT
GAPDH forward GAAGGTGAAGGTCGGAGTC 225 bp 55 °C
reverse GAAGATGGTGATGGGATTTC
Statistics
Data were analyzed with Statistical Package of the Social Science software for Windows,
release 11.5 (SPSS Benelux BV, Gorinchem, The Netherlands). The demographic
characteristics of patients were normally distributed and therefore analyzed with a one-way
Microparticles and endothelial gene expression
121
6
analysis of variance test (ANOVA) for differences between three groups and Bonferroni
post hoc tests. RNA expression of each gene measured with MLPA or real-time PCR was
determined as a function of time and compared with the RNA expression of the endothelial
cells incubated with culture medium alone (control). A mixed model was used to analyze
expression of individual genes as a function of incubation time (repeat measures) and
incubation condition. Data were paired because endothelial cells from the same umbilical
cord were used for incubations with either MP, MP-free plasma or controls. If the p-value
of the interaction between incubation condition and time was <0.05, the difference was
considered significant.
RESULTS
Effect of IL-1αααα on mR�A expression in HUVEC
To validate the use of MLPA in endothelial cells and the effect of the pro-inflammatory
interleukin IL-1α, experiments were performed using HUVEC from 7 umbilical cords.
Incubation with IL-1α for different time intervals up to 24 hours showed maximal
expression of all tested genes within the first 4 hours after addition of IL-1α (data not
shown). Therefore, all further experiments were performed within this time interval.
Figure 2 shows changes in expression of interleukins (panels A and B), oncogenes
and transcription factors/inhibitors (C, D), various intracellular enzymes (E, F), and
chemokines, platelet-derived growth factor-B (PDGF-B), tissue factor (TF),
thrombospondin-1 (THBS-1) and tumor-necrosis factor receptor 1 (TNF-R1) (panel G, H).
Compared to control, especially the expression of genes coding for IL-8 (panel A), NFκB-
1, NFκB-1A and NFκB-2 (panel C) and MCP-1 (panel G) increased. TF expression was
transient and maximal after 1 hour.
Results of duplicate samples of the same umbilical cord prior to incubation were
almost identical, i.e. variation in expression was less than 1% (data not shown). When gene
expression was normalized to the mean expression of a series of relatively stable genes
(B2M, BMI (B lymphoma Mo-MLV insertion region) and PARN (poly-A specific
ribonuclease) plus TNF-R1) rather than B2M alone, similar expression patterns were
observed (data not shown). RNA expression of 37 genes was comparable between the first
and third passages. In the absence of IL-1α and compared to first passage cells, only the
expression of BMI (at one hour) and CDKN-1A (cyclin dependent kinase inhibitor; at one
hour and four hours) were increased.
Chapter 6
122
Table 3. Overview of presence of inflammatory genes in HUVEC
Probes MLPA Literature RefInterleukins IL-1α + + 13, 14 IL-1β + + 13, 15 IL-1RA - + 14, 16 IL-2 + - 13, 14 IL-4(R1) - - 13, 14 IL-4(R2) - - 15, 14 IL-6 + + 13, 14 IL-8 + + 13-15 IL-10 - - 13 IL-12(p35) - - 15 IL-12(p40) + - 13 IL-13 - - 13,14 IL-15(R1) + + 13 IL-15(R2) - + 15 IL-18 - + 17*Transcription factors/oncogenes BMI + MYC + + 18,19 NFκB-1 + + 20** NFκB-1A + + 21 NFκB-2 + - 22Enzymes/Enzyme-Inhibitors CDKN-1A + + 23 GST-P1 + + 24* PARN + PDE-4B + + 25,26 PTP-1B + + 27 PTP-4A + SERP-B9 + + 28 29Other cytokines B2M + + 30*** IFNγ - - 13,14 MIF + + 31 MCP-1 + + 14,32 MCP-2 + MIP-1A - + 33* MIP-1B - - 34 PDGF-B + + 35, 36 TF + + 37, 38 THBS-1 + + 39* TNF-α - + 13 TNF-R1 + + 40 TNF-β -
Microparticles and endothelial gene expression
123
6
Endothelial cells stimulated with IL-1α showed an increased expression of CDKN-1A after
one hour but not after four hours, and expression of MYC was elevated (at one hour). BMI,
CDKN-1A and MYC all play a role in the cell-division-cycle control system, which seems
to be affected by cell passage. Because the expression of all other genes studied was hardly
affected, we decided to perform all our experiments with third passage endothelial cells to
circumvent the complication of combining endothelial cells from various umbilical cords in
order to obtain sufficient cells for the experimental set up.
In Table 3 an overview of the MLPA data of multiple experiments is summarized.
In this table, the frequencies of detectable quantities of RNA for individual genes in either
resting or (IL-1α) activated endothelial cells are indicated. Of the 40 genes studied, 27 were
expressed in HUVEC of which 20 genes had been demonstrated previously. The expression
of BMI, PARN, PTP-4A and MCP-2 has not been described in HUVEC before. BMI is an
oncogene, expressed in lymphomas and other malignancies10,11. PARN deadenylates
mRNA’s, and PTP-4A is a tyrosine phosphatase, important for cell development, growth
and differentiation. Finally, MCP-2 is a monocyte chemotactic protein. Current findings
also implicate that human endothelial cells may produce IL-2 and IL-12, and express the
transcription factor NFκB-2, which is a member of the NFκB/Rel gene family that regulates
acute phase and immune responses. Although others reported the expression of IL-1
receptor antagonist (RA), IL-18, MIP-1A and TNF-α in endothelial cells, we could not
detect their expression. This may be due to the use of different agonists.
Table 3. All probes of the MLPA assay are listed. “+” reflects detection of the RAA of
interest in at least two samples in the MLPA (3rd column) or reported in literature (4th
column), “-“means not detectable in any sample studied (n=84) in the MLPA (3rd column)
and not detected by other authors (4th column), not even at protein level; *protein level,
**activity measurement, *** flow cytometry.
Chapter 6
124
R�A expression after incubation with MP
Endothelial cells were incubated with isolated MP fractions or MP-free plasma from
patients with preeclampsia, normotensive pregnant women or healthy controls. IL-1α was
used as positive control and culture medium as negative control. Figure 3 shows the RNA
expression of individual cytokines after incubation with these MP fractions (A, C, E, G, I)
and MP-free plasma (B, D, F, H, J) and the controls. The incubation period was 1 hour (left
side of each graph) or 4 hours (right side of each graph). The pro-inflammatory interleukins
(IL-1α, IL-6 and IL-8) were not up-regulated after incubation with MP or MP-free plasma
in any of the three groups studied (A, B). Also, genes encoding oncogenes, transcription
factors (C, D), enzymes and enzyme-inhibitors (E, F, G, H) and MCP-1, (macrophage)
migration inhibitory factor (MIF), PDGF-B, TF and THBS-1 (I, J) were unaffected by
incubation with MP or MP-free plasma. In these experiments, the results for both IL-1α and
culture medium alone were comparable to the initial experiments, illustrating that HUVEC
were viable and sensitive to activation.
Figure 2. RAA expression induced by IL-1α (A, C, E, G) and control (B, D, F, H) of
interleukins (A, B), transcription factors and oncogenes (C, D), enzymes or enzyme
inhibitors (E, F) and other cellular factors (G, H). Incubation times were 0 (white), 30, 60,
90, 120 and 240 minutes (black). Statistically significant changes in expression are marked
with *. The Y-axis displays the relative expression of each probe compared to B2M (β-2-
microglobulin).
IL: interleukin, BMI: B lymphoma Mo-MLV (murine leukemia viral oncogene homolog)
insertion region, MYC: early-response (proto-oncogene) gene myc, AFκB: nuclear factor
of kappa light chain gene enhancer in B cells, AFκB-IA: nuclear factor of kappa light chain
gene enhancer in B cells inhibitor alpha (IκB), CDKA-1A: cyclin dependent kinase
inhibitor, GST: glutathione s-transferase, PARA: poly-A specific ribonuclease, PDE:
phosphodiesterase, PTP: protein-tyrosine phosphatase, SERP: serine proteinase inhibitor
B9, MCP: monocyte chemotactic protein, MIF: (macrophage) migration inhibitory factor,
PDGF: platelet derived growth factor, TF: tissue factor, THBS: thrombospondin and TAF-
R: tumor necrosis factor-receptor.
Microparticles and endothelial gene expression
125
6
Figure 2. R�A expression in HUVEC after incubation with IL-1αααα
Chapter 6
126
Figure 3. R�A expression in HUVEC after incubation with microparticles
Microparticles and endothelial gene expression
127
6
Figure 3. This figure shows the RAA expression in endothelial cells after incubation with
either MP (A, C, E, G, I) or MP-free plasma (B, D, F, H, J). The bars represent from the
left to the right: preeclampsia, normotensive pregnancy, non-pregnant controls, IL-1α (positive control) and culture medium alone (negative control). The left side of each graph
shows the results of 1 hour incubation and the right side of each graph shows the results of
4 hours incubation. The Y-axis displays the relative expression of each probe compared to
B2M. Significant changes in expression are marked with *.
Real-time PCR
To validate the sensitivity of MLPA in endothelial cells and to determine RNA expression
of well-known endothelial adhesion molecules not included in the MLPA assay, real-time
PCR was performed. Incubation with IL-1α resulted in a significant increase in expression
of ICAM-1, VCAM-1, E-selectin and TF (Figure 4). Expression of these adhesion
molecules and TF was unaffected by incubation with MP or MP-free plasma from patients
with preeclampsia, normotensive pregnant women or healthy controls.
DISCUSSIO�
In preeclampsia, the number of leukocyte-derived MP is elevated compared to
normotensive pregnant women and non-pregnant controls7. In vitro prepared leukocytic MP
trigger the release of IL-6 and MCP-1 from endothelial cells4,5 and leukocytic MP isolated
from synovial fluid of arthritic patients induce the release of cytokines from synoviocytes6.
Chapter 6
128
Figure 4. R�A expression in HUVEC measured with real-time PCR
Figure 4. Real-time PCR showing RAA expression in endothelial cells of adhesion
molecules and TF. The bars represent from the left to the right: preeclampsia,
normotensive pregnancy, non-pregnant controls, Il-1α (positive control) and culture medium alone (negative control). A: results of 1 hour incubation with MP, B: 4 hours
incubation with MP, C: 1 hour incubation with plasma, D: 4 hours incubation with plasma.
The Y-axis displays the relative expression of each probe compared to GAPDH. Significant
changes in expression are marked with *.
This shows that leukocytic MP promote inflammation. Therefore, we hypothesized that MP
from preeclamptic patients may directly affect expression of inflammation-related genes in
endothelial cells.
Inflammation and endothelial dysfunction are closely associated in preeclampsia,
and isolated MP from preeclamptic patients impair endothelial-dependent vasodilatation in
Microparticles and endothelial gene expression
129
6
isolated resistance arteries2. Dilation of blood vessels results from complex interactions
between the endothelium and the underlying smooth muscle cells. MP may either impair
dilatation by directly affecting endothelial cells, smooth muscle cells or their interaction. In
the present study, the first possibility, i.e. whether MP exert their action directly on
endothelial cells was assessed. It was demonstrated that MP from preeclamptic patients did
not affect the RNA expression of the studied genes in endothelial cells, not even with
higher numbers than in vivo. It cannot be excluded that the expression of other genes in
endothelial cells, i.e. genes not included in the MLPA, may be affected by MP. The second
option, i.e. the direct binding of circulating MP to vascular smooth muscle cells, seems
unlikely, because an intact endothelium prevents binding of MP to these cells. However, in
preeclampsia, the endothelium is damaged leading possibly to exposure of the vascular
smooth muscle cells to circulating MP. Finally, MP may affect the interaction between
endothelial- and vascular smooth muscle cells because MP modulated isolated arteries.
The MLPA assay monitors changes in RNA expression of inflammation-related
genes in human endothelial cells. This study is the first to use the MLPA for analysis of
endothelial RNA expression. IL-1α induced a significant inflammatory response in
endothelial cells. An effect of MP could not be monitored. However, it cannot be excluded
that subtle changes in gene expression induced by MP were not detected. Additional studies
will be necessary to determine if minimal changes in RNA expression in endothelial cells
can be accurately determined with MLPA. Also, it can not be excluded that MP target the
endothelium of small arterioles. However, isolating sufficient RNA from such vessels is
difficult and carries the risk of contamination by RNA from other cell types, e.g. vascular
smooth muscle cells, which complicates the interpretation of the results. We did not
investigate the effect of MP on first passage endothelial cells, because preliminary
experiments showed only minimal differences in gene expression between the first and
third passage endothelial cells. Therefore, it is unlikely that MP would affect RNA
expression of first passage cells differently.
In conclusion, the MLPA assay can be used to monitor changes in inflammation-
related genes in human endothelial cells in vitro, but a direct effect of isolated MP from
preeclamptic patients on the expression of either inflammation-related genes or genes
encoding adhesion receptors in endothelial cells could not be demonstrated.
ACK�OWLEDGEME�TS
We thank Arnold vd Spek, Hella Aberson and Chi Hau for their technical advices and
assistance.
Chapter 6
130
REFERE�CES
1. Redman CW, Sacks GP, Sargent IL. Preeclampsia: an excessive maternal
inflammatory response to pregnancy. Am J Obstet Gynecol 1999;180:499-506.
2. VanWijk MJ, Svedas E, Boer K, Nieuwland R, VanBavel E, Kublickiene KR. Isolated
microparticles, but not whole plasma, from women with preeclampsia impair
endothelium-dependent relaxation in isolated myometrial arteries from healthy
pregnant women. Am J Obstet Gynecol 2002;187:1686-93.
3. Nomura S, Tandon NN, Nakamura T, Cone J, Fukuhara S, Kambayashi J. High-shear-
stress-induced activation of platelets and microparticles enhances expression of cell
adhesion molecules in THP-1 and endothelial cells. Atherosclerosis 2001;158:277-87.
4. Mesri M, Altieri DC. Endothelial cell activation by leukocyte microparticles. J
Immunol 1998;161:4382-7.
5. Mesri M, Altieri DC. Leukocyte microparticles stimulate endothelial cell cytokine
release and tissue factor induction in a JNK1 signaling pathway. J Biol Chem
1999;274:23111-8.
6. Berckmans RJ, Nieuwland R, Kraan MC, Schaap MC, Pots D, Smeets TJM Sturk A,
Tak PP. Synovial microparticles from arthritic patients modulate chemokine and
cytokine release by synoviocytes. Arthritis Res Ther 2005;7:R536-44.
7. VanWijk MJ, Nieuwland R, Boer K, van der Post JA, van Bavel E, Sturk A.
Microparticle subpopulations are increased in preeclampsia: possible involvement in
vascular dysfunction? Am J Obstet Gynecol 2002;187:450-6.
8. Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative
quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe
amplification. Nucleic Acids Res 2002;30:e57.
9. Abid Hussein MN, Meesters EW, Osmanovic N, Romijn FP, Nieuwland R, Sturk A.
Antigenic characterization of endothelial cell-derived microparticles and their
detection ex vivo. J Thromb Haemost 2003;1:2434-43.
10. Ramakers C, Ruijter JM, Lekanne Deprez RH, Moorman AFM. Assumption-free
analysis of quantitative real-time polymerase chain rection (PCR) data. Neuroscience
Letters 2003;339:62-6.
11. Kim JH, Yoon SY, Kim CN, Joo JH, Moon SK, Choe IS, Choe YK, Kim JW. The
Bmi-1 oncoprotein is overexpressed in human colorectal cancer and correlates with
the reduced p16INK4a/p14ARF proteins. Cancer Lett 2004;203:217-24.
12. Shah A, Unger E, Bain MD, Bruce R, Bodkin J, Ginnetti J, Wang WC, Seon B,
Stewart CC, Evans SS. Cytokine and adhesion molecule expression in primary human
endothelial cells stimulated with fever-range hyperthermia. Int J Hyperthermia
2002;18:534-51.
Microparticles and endothelial gene expression
131
6
13. Nilsen EM, Johansen FE, Jahnsen FL, Lundin KE, Scholz T, Brandtzaeg P, Haraldsen
G. Cytokine profiles of cultured microvascular endothelial cells from the human
intestine. Gut 1998;42:635-42.
14. Krishnaswamy G, Smith JK, Mukkamala R, Hall K, Joyner W, Yerra L, Chi DS.
Multifunctional cytokine expression by human coronary endothelium and regulation
by monokines and glucocorticoids. Microvasc Res 1998;55:189-200.
15. Inoue I, Goto S, Mizotani K, Awata T, Mastunaga T, Kawai S, Nakajima T, Hokari S,
Komoda T, Katayama S. Lipophilic HMG-CoA reductase inhibitor has an anti-
inflammatory effect: reduction of MRNA levels for interleukin-1beta, interleukin-6,
cyclooxygenase-2, and p22phox by regulation of peroxisome proliferator-activated
receptor alpha (PPARalpha) in primary endothelial cells. Life Sci 2000;67:863-76.
16. Dewberry R, Holden H, Crossman D, Francis S. Interleukin-1 receptor antagonist
expression in human endothelial cells and atherosclerosis. Arterioscler Thromb Vasc
Biol 2000;20:2394-400.
17. Takeuchi M, Okura T, Mori T, Akita K, Ohta T, Ikeda M, Ikegami H, Kurimoto M.
Intracellular production of interleukin-18 in human epithelial-like cell lines is
enhanced by hyperosmotic stress in vitro. Cell Tissue Res 1999;297:467-73.
18. Chettab K, Zibara K, Belaiba SR, McGregor JL. Acute hyperglycaemia induces
changes in the transcription levels of 4 major genes in human endothelial cells:
macroarrays-based expression analysis. Thromb Haemost 2002;87:141-8.
19. Hsieh HJ, Li NQ, Frangos JA. Pulsatile and steady flow induces c-fos expression in
human endothelial cells. J Cell Physiol 1993;154:143-51.
20. Sonoki K, Iwase M, Iino K, Ichikawa K, Ohdo S, Higuchi S, Yoshinari M, Iida M.
Atherogenic role of lysophosphatidylcholine in low-density lipoprotein modified by
phospholipase A2 and in diabetic patients: protection by nitric oxide donor.
Metabolism 2003;52:308-14.
21. Wagner M, Klein CL, Kleinert H, Euchenhofer C, Forstermann U, Kirkpatrick CJ.
Heavy metal ion induction of adhesion molecules and cytokines in human endothelial
cells: the role of NF-kappaB, I kappaB-alpha and AP-1. Pathobiology 1997;65:241-
52.
22. Franzen B, Duvefelt K, Jonsson C, Engelhardt B, Ottervald J, Wickman M, Yang Y,
Schuppe-Koistinen I. Gene and protein expression profiling of human cerebral
endothelial cells activated with tumor necrosis factor-alpha. Brain Res Mol Brain Res
2003;115:130-46.
23. Kim J, Cheon IS, Won YJ, Na HJ, Kim YM, Choe J. IL-4 inhibits cell cycle
progression of human umbilical vein endothelial cells by affecting p53, p21(Waf1),
cyclin D1, and cyclin E expression. Mol Cells 2003;16:92-6.
Chapter 6
132
24. Bruneel A, Labas V, Mailloux A, Sharma S, Vinh J, Vaubourdolle M, Boudin B.
Proteomic study of human umbilical vein endothelial cells in culture. Proteomics
2003;3:714-23.
25. Favot L, Keravis T, Holl V, Le Bec A, Lugnier C. VEGF-induced HUVEC migration
and proliferation are decreased by PDE2 and PDE4 inhibitors. Thromb Haemost
2003;90:334-43.
26. Koga S, Morris S, Ogawa S, Liao H, Bilezikian JP, Chen G, Thompson WJ, Ashikaga
T, Brett J, Stern DMPinsky DJ. TNF modulates endothelial properties by decreasing
cAMP. Am J Physiol 1995;268:C1104-13.
27. Norris K, Norris F, Kono DH, Vestergaard H, Pedersen O, Theofilopoulos AN, Moller
NP. Expression of protein-tyrosine phosphatases in the major insulin target tissues.
FEBS Lett 1997;415:243-8.
28. Morikawa S, Takabe W, Mataki C, Kanke T, Itoh T, Wada Y, Izumi A, Saito Y,
Hamakubo T, Kodama T. The effect of statins on mRNA levels of genes related to
inflammation, coagulation, and vascular constriction in HUVEC. Human umbilical
vein endothelial cells. J Atheroscler Thromb 2002;9:178-83.
29. Mussoni L, Banfi C, Sironi L, Arpaia M, Tremoli E. Fluvastatin inhibits basal and
stimulated plasminogen activator inhibitor 1, but induces tissue type plasminogen
activator in cultured human endothelial cells. Thromb Haemost 2000;84:59-64.
30. Wedgwood JF, Hatam L, Bonagura VR. Effect of interferon-gamma and tumor
necrosis factor on the expression of class I and class II major histocompatibility
molecules by cultured human umbilical vein endothelial cells. Cell Immunol
1988;111:1-9.
31. Nishihira J, Koyama Y, Mizue Y. Identification of macrophage migration inhibitory
factor (MIF) in human vascular endothelial cells and its induction by
lipopolysaccharide. Cytokine 1998;10:199-205.
32. Lee YW, Hennig B, Toborek M. Redox-regulated mechanisms of IL-4-induced MCP-
1 expression in human vascular endothelial cells. Am J Physiol Heart Circ Physiol
2003;284:H185-H192.
33. Cha JK, Jeong MH, Bae HR, Han JY, Jeong SJ, Jin HJ, Lim YJ, Kim SH, Kim JW.
Activated platelets induce secretion of interleukin-1beta, monocyte chemotactic
protein-1, and macrophage inflammatory protein-1alpha and surface expression of
intercellular adhesion molecule-1 on cultured endothelial cells. J Korean Med Sci
2000;15:273-8.
34. Shukaliak JA, Dorovini-Zis K. Expression of the beta-chemokines RANTES and
MIP-1 beta by human brain microvessel endothelial cells in primary culture. J
Neuropathol Exp Neurol 2000;59:339-52.
Microparticles and endothelial gene expression
133
6
35. Hsieh HJ, Li NQ, Frangos JA. Shear stress increases endothelial platelet-derived
growth factor mRNA levels. Am J Physiol 1991;260:H642-6.
36. Cenni E, Granchi D, Ciapetti G, Savarino L, Corradini A, Di Leo A. Cytokine
expression in vitro by cultured human endothelial cells in contact with polyethylene
terephthalate coated with pyrolytic carbon and collagen. J Biomed Mater Res
2000;15;50:483-9.
37. Grabowski EF, Carter CA, Ingelfinger JR, Tsukurov O, Conroy N, Abbott WM, Orkin
RW. Comparison of tissue factor pathway in human umbilical vein and adult
saphenous vein endothelial cells: implications for newborn hemostasis and for
laboratory models of endothelial cell function. Pediatr Res 1999;46:742-7.
38. Langer F, Morys-Wortmann C, Kusters B, Storck J. Endothelial protease-activated
receptor-2 induces tissue factor expression and von Willebrand factor release. Br J
Haematol 1999;105:542-50.
39. Bonnefoy A, Harsfalvi J, Pfliegler G, Fauvel-Lafeve F, Legrand C. The
subendothelium of the HMEC-1 cell line supports thrombus formation in the absence
of von Willebrand factor and collagen types I, III and VI. Thromb Haemost
2001;85:552-9.
40. Berger AC, Alexander HR, Wu PC, Tang G, Gnant MF, Mixon A, Turner ES, Libutti
SK. Tumour necrosis factor receptor I (p55) is upregulated on endothelial cells by
exposure to the tumour-derived cytokine endothelial monocyte- activating polypeptide
II (EMAP-II). Cytokine 2000;12:992-1000.
Chapter 7
Leukocyte activation and circulating
leukocyte-derived microparticles in
preeclampsia
C.A.R. Lok, J. Jebbink, R. Nieuwland, M.M. Faas, K. Boer,
A. Sturk, J.A.M. van der Post
submitted
Chapter 7
136
ABSTRACT
Introduction. Preeclampsia shows characteristics of an inflammatory disease including
leukocyte activation, reflected by elevated numbers of circulating leukocytes exposing
adhesion molecules and aberrant levels of soluble activation markers. Analyses of
leukocyte-derived microparticles (MP) and mRNA expression of inflammation-related
genes in maternal leukocytes may establish which subgroups of leukocytes are activated
and contribute to the development of preeclampsia.
Methods. Blood samples were obtained from preeclamptic patients, normotensive pregnant
and non-pregnant controls. Concentrations of sL-selectin and elastase were measured by
ELISA. mRNA was isolated from maternal leukocytes and expression of inflammation-
related genes determined by multiplex ligation-dependent probe amplification (MLPA). MP
were isolated by centrifugation and characterized by flow cytometry.
Results. Decreased concentrations of sL-selectin and elevated concentrations of elastase
confirmed leukocyte activation in preeclampsia and to a lesser extent in normotensive
pregnancy. Leukocytes of preeclamptic patients showed up-regulation of NFκB-1A
(nuclear factor of kappa light chain gene enhancer in B cells inhibitor or IκB) and
CDKN-1A (cyclin dependent kinase inhibitor) compared to pregnant controls. IL-1RA and
TNF-R1 were increased compared to non-pregnant controls. Monocyte-derived MP were
elevated in preeclamptic patients compared to normotensive pregnant women. Both the
numbers of Tsuppressor-cell-derived and granulocyte-derived MP were elevated compared to
non-pregnant women.
Discussion. Leukocytes are activated in preeclampsia as reflected by changed levels of
elastase and sL-selectin. A pro-inflammatory gene expression profile is not prominent in
the total population of leukocytes, though differences in mRNA expression can be detected.
Increased levels of particular subsets of leukocyte-derived MP reflect activation of their
parental cells in preeclampsia.
Leukocyte activation and microparticles in preeclampsia
137
7
I�TRODUCTIO�
Preeclampsia is a pregnancy-specific multisystem disorder, occurring in the second half of
pregnancy with an incidence in unselected populations of 2.6%1. It is a major cause of
maternal and fetal morbidity and mortality of which the exact cause remains unclear.
Preeclampsia is considered an exaggerated systemic inflammatory response to pregnancy2,
with activation of many parts of the inflammatory network, including leukocyte activation.
Indeed, signs of activation of granulocytes, monocytes and lymphocytes have been
reported.
Evidence for the activation of granulocytes in preeclampsia is based upon the
elevated expression of adhesion molecules and complement-related markers3-5, the
production of reactive oxygen species3,6 and an increase of soluble markers like elastase
and lactoferrin in the plasma of preeclamptic patients7,8. Furthermore, granulocyte counts
are elevated in preeclamptic patients compared to non-preeclamptic women9,10.
Monocytes from preeclamptic patients express significantly higher levels of cell-
surface activation markers (CD11b , CD11c and CD14) and produce more reactive oxygen
species compared to normotensive pregnant women5.
T lymphocytes are divided in Thelper-cells and Tsuppressor-cells. Thelper-cells are further
subdivided into type 1 and type 2 lymphocytes based on their cytokine production profile.
The balance between these two subtypes is of importance in pregnancy and preeclampsia.
In normotensive pregnancy, suppression of cell-mediated immunity is reflected by a
predominance of type 2 cytokines because production of the pro-inflammatory type 1
cytokines decreases11. In contrast, preeclampsia is characterized by a predominance of
Thelper1-cell immunity resulting in a more pro-inflammatory cytokine profile12,13. Also
cytotoxic T-cells and NK cells seem to demonstrate such a polarity and especially the latter
show a type 1 preference in preeclampsia11,14.
More evidence for activation of leukocytes comes from increased numbers of
circulating leukocyte-derived microparticles (MP) during preeclampsia15. MP are small
membrane vesicles, which are budded from the cell surface and released into the circulation
during apoptosis or activation of blood cells or endothelial cells. Thus, activation of
leukocytes results in the production of leukocyte-derived MP.
The production of cytokines is also indicative of the pro-inflammatory state of
leukocytes. Changes in cytokine production in preeclampsia are comparable to those found
in sepsis16,17. Sepsis can be mimicked by administration of endotoxin to healthy subjects.
Isolated leukocytes from these subjects show increased mRNA expression of Macrophage
Inflammatory Protein (MIP)-1A, MIP-1B, Interleukin (IL)-8, IL-1β, IL-1 Receptor
Antagonist (RA) and Nuclear Factor of Kappa light chain gene enhancer in B Cells
inhibitor (NFκB-1A or IκB)18. Changes in the levels of plasma proteins encoded by most of
Chapter 7
138
the above mentioned genes have been investigated previously in preeclamptic patients. The
results from these studies, however, are contradictory19-26. Therefore, in the present study
we determined the activation state of leukocytes by measuring mRNA expression of
inflammation-related genes using multiplex ligation-dependent probe amplification
(MLPA). In addition, we analyzed circulating numbers of leukocyte-derived MP and
subgroups thereof as additional putative markers of leukocyte activation, as well as
differential leukocyte counts, and plasma sL-selectin- and elastase concentrations as
markers of inflammation and leukocyte activation.
METHODS
Patients
The study was approved by the medical ethical committee of the Academic Medical Center.
After obtaining written informed consent, blood samples were obtained from preeclamptic
patients (n=10), normotensive pregnant women (n=10) and non-pregnant women (n=10).
The women were matched for age (± five years) and parity. The preeclamptic patients and
normotensive pregnant women were also matched for gestational age (± two weeks).
Inclusion criteria for preeclampsia were: (1) diastolic blood pressure of 110 mmHg or more
on any occasion or 90 mmHg or more on two separate occasions at least four hours apart,
(2) proteinuria of ≥ 0.3 gram protein / 24 hours and (3) symptoms developing after 20
weeks of gestation in previously normotensive women. The control groups consisted of
healthy women not using any medication or oral contraceptives.
Collection of blood samples
Three blood samples (13,5 ml) were taken from the antecubital vein without tourniquet
through a 20-gauge needle with a vacutainer system. The first sample was collected into a
4.5 mL tube containing 0.105 M buffered sodium citrate (Becton Dickinson, San Jose, CA).
Within 30 minutes after collection, cells were removed by centrifugation for 20 minutes at
1560 g and 20 °C. Plasma samples were then divided in 250 µL aliquots, immediately snap
frozen in liquid nitrogen to preserve MP structure and then stored at –80 °C until further
analysis. The second sample was collected in a 4.5 mL tube containing 0.054 mL (15%)
ethylenediaminetetraacetic acid (EDTA; Becton Dickinson; San Jose, CA) for
determination of the total number of leukocytes. The third sample was also collected in a
4.5 mL tube containing EDTA and immediately used for RNA isolation.
Leukocyte activation and microparticles in preeclampsia
139
7
ELISA
Plasma concentrations of sL-selectin (sL-selectin, R&D Systems; Abingdon, United
Kingdom) and elastase (Human PMN elastase, Bender Medsystems; Vienna, Austria) were
determined using enzyme-linked immunosorbent assays (ELISA). Assays were performed
as described by the manufacturers. The minimal detectable concentration of elastase was
1.98 ng/mL. The intra-assay variation coefficient was 4.8% and inter-assay variation 5.6%.
The minimal detectable concentration of sL-selectin was <0.3 ng/mL with an intra-assay
variation of 3.7% and an inter-assay variation of 4.2%.
R�A isolation
Total RNA was isolated from peripheral whole blood using RNeasy columns (Qiagen;
Hilden, Germany), according to the protocol of the manufacturer. Total RNA was dissolved
in 30 µL RNase-free water (Qiagen; Hilden, Germany) and stored at –20 °C until further
analysis.
MLPA
Multiplex Ligation-dependent Probe Amplification (MLPA) is an established technique
used for the detection of chromosomal abnormalities but can also be applied to study
inflammation-related gene-expression. MLPA data proved to correlate well with other
established techniques such as quantative RT-PCR and microarray27.
MLPA (kit P009, MRC-Holland; Amsterdam, The Netherlands) was performed
with total RNA in a concentration of 40-60 ng RNA/µL. With this MLPA assay 40
different genes can be determined simultaneously using 40 different probes. The MLPA
procedure has been described by us before28. In short, after isolation of RNA, single
stranded cDNA is produced with a RT reaction in a high-speed thermal cycler with a heated
lid (Biometra Uno II; Goettingen, Germany). After addition of 1.5 µL buffer (1.5 M KCl, 1
mM EDTA, 300 mM Tris-HCl, pH 8.5) and 1.5 µL probe mix (1-4 fmol of each short
probe oligonucleotide and each long probe oligonucleotide in Tris EDTA) hybridization
was allowed for 16 hours. The procedure was continued with the addition of a ligase
enzyme enabling ligation of different probes. Then amplification of the ligated probes was
performed with 32 cycles of a polymerase chain reaction (PCR). The PCR-product was
stained with ROX-500. Samples were purified with Sephadex G-50 (Sigma-Alderich
Chemie; Zwijndrecht, The Netherlands) in filter plates (mahvn4550, Millipore; Billerica,
USA) and analyzed by capillary electrophoresis on a capillary sequencer (ABI 3100,
Applied Biosystems; Warrington, UK). The intensity and size of the different probes were
calculated with Genescan and Genotyper software packages (Applied Biosystems;
Warrington, UK). β-2-microglobulin (B2M) was chosen as a reference (household) gene.
Chapter 7
140
Reagents and assays
Antibodies and dilution
Fluorescein isothiocyanate (FITC)-labeled IgG1 and phycoerythrin (PE)-labeled IgG1 and
monoclonal antibodies directed against Tsuppressor-cells (anti-CD8-PE), monocytes (anti-
CD14-PE) and B-cells (anti-CD20-FITC) were obtained from Becton Dickinson (San Jose,
CA). To detect Thelper-cells and granulocytes, anti-CD4-FITC and anti-CD66e-FITC were
purchased from the Central Laboratory of Blood Transfusion (Amsterdam, The
Netherlands). Anti-CD61-FITC (anti-GP-IIIa) was obtained from Pharmingen (San Jose,
CA). Allophycocyanin (APC)-conjugated annexin V was purchased from Caltag
(Burlingame, CA). The following final dilutions of antibodies were used: IgG1-FITC
(1:10), IgG1-PE (1:10), anti-CD4-FITC (1:2.5), anti-CD8-PE (1:5), anti-CD14-PE (1:20),
anti-CD20-FITC (1:10), anti-CD61-FITC (1:30), anti-CD66e-FITC (1:10) and annexin V-
APC (1:40).
Leukocyte counts
Leukocyte counts were determined with a Cell-Dyn 4000 (Abbott Diagnostics Division,
Abbott Laboratories; Hoofddorp, The Netherlands) at the department of Clinical Chemistry
(Academic Medical Center; Amsterdam, The Netherlands).
Isolation of microparticles
A sample of 250 µL frozen plasma was thawed on ice and centrifuged for 30 minutes at
18890 g and 20 ºC to pellet the MP. After centrifugation, 225 µL of the supernatant was
removed. The MP pellet and remaining supernatant was resuspended in 225 µL phosphate-
buffered saline with citrate (154 mmol/L NaCl, 1.4 mmol/L phosphate, 10.9 mmol/L
trisodium citrate, pH 7.4). After centrifugation for 30 minutes at 18890 g and 20 ºC, 225 µL
of the supernatant was removed again. The MP pellet was then resuspended after addition
of 75 µL PBS-citrate.
Flow cytometry
Five µL of the MP suspension was diluted in 35 µL CaCl2 (2.5 mmol/L)-containing PBS.
Then 5 µL APC-labeled annexin V was added to all tubes plus 5 µL of the cell-specific
monoclonal antibody or isotype-matched control antibody. The samples were then
incubated in the dark for 15 minutes at room temperature. After incubation, 900 µL of
calcium-containing PBS was added to all tubes (except to the annexin V control, to which
900 µL citrate-containing PBS was added). Samples were analyzed for one minute in a
fluorescence automated cell sorter (FACS Calibur) with CellQuest software (Becton
Dickinson; San Jose, CA). Both forward scatter (FSC) and sideward scatter (SSC) were set
Leukocyte activation and microparticles in preeclampsia
141
7
at a logarithmic gain. MP were identified on basis of their size and density and on their
capacity to bind annexin V. Annexin V measurements were corrected for auto-fluorescence.
Labeling with cell-specific monoclonal antibodies was corrected for identical
concentrations of isotype-matched control antibodies. The number of MP per liter plasma
was calculated using the following formula: Number/L = N x (100/5) x (955/57) x
(106/250), in which A is the number of events that stained positive for both annexin V and a
cell-specific antibody, 100 (µL) is the (total) volume of the MP suspension after isolation,
from which 5 (µL) is used for labeling, 955 (µL) is the total volume of the labeled MP
suspension after dilution, from which approximately 57 (µL) is analyzed per minute by the
flow cytometer, multiplied by 106 (from µL to L) and finally, 250 (µL) was the original
volume of the plasma aliquot from which MP were isolated.
Statistical analysis Data were analyzed with Statistical Package of the Social Science software for Windows,
release 11.5 (SPSS Benelux BV; Gorinchem, The Netherlands). The demographic
characteristics of patients are presented as means with standard deviations. The three study
groups are compared with ANOVA and Bonferroni post-hoc tests. These tests were also
used for the MLPA data. Data of the ELISA and flowcytometry were not normally
distributed and therefore analyzed with Kruskall Wallis tests for differences among three
groups and Mann-Whitney U test’s for differences between two groups. The presence
(independent of the extent of expression) of mRNA expression of the different genes was
compared with Chi-square tests. Correlations were analyzed with a Pearsons bivariate two-
sided test. Probability values of <0.05 were considered statistically significant.
RESULTS
Patient characteristics
Patient characteristics are presented in Table 1. Preeclamptic patients were older and had a
higher body mass index (BMI) compared to normotensive women and non-pregnant
controls. As by definition, the systolic blood pressure and diastolic blood pressure were
significantly elevated in preeclamptic patients compared to both control groups. In contrast,
birth weight and gestational age at delivery were significantly decreased in the preeclamptic
women compared to normotensive pregnant women.
Chapter 7
142
Table 1. Patient characteristics
Characteristics Preeclampsia
(n=10)
�ormotensive
pregnancy
(n=10)
�on-pregnant
women
(n=10)
P P*
Age (years) 33.1 ± 3.4 30.5 ± 1.6 30.3 ± 1.6 NS 0.04
BMI 26.5 ± 5.2 21.4 ± 1.1 21.9 ± 2.1 0.006 0.02
Blood pressure
Systolic
Diastolic
164 ± 16
96 ± 8
122 ± 9
73 ± 8
108 ± 14
68 ±10
0.0001
0.0001
0.0001
0.0001
Proteinuria 7.1 ± 5.5 - - - -
Gestational age
At sampling
At delivery
28.9 ± 1.9
31.3 ± 3.4
30.2 ± 3.2
39.1 ± 1.6
-
-
NS
0.0001
-
-
Birth weight 1267 ± 648 3262 ± 607 - 0.0001 -
Table 1. All patients were nulliparous and matched for age (± 5 years). Preeclamptic
patients and normotensive pregnant women were also matched for gestational age (± 2 weeks). Data are presented as mean ± SD. P: statistical difference between preeclamptic
patients and normotensive controls. P*: statistical difference between preeclamptic patients
and non-pregnant controls.
General markers of leukocyte activation in pregnancy and preeclampsia
Aumbers of circulating leukocytes
As a general marker of inflammation, we determined the total number of leukocytes in
maternal blood. Their number was elevated in normotensive pregnant women (9.4*106/L)
compared to non-pregnant controls (6.0*106/L, p=0.026). This number was even higher in
the preeclamptic patients (12.8*106/L, p=0.004 and p=0.08 compared to non-pregnant
controls and pregnant women, respectively). This is due to an increase in the number of
(neutrophilic) granulocytes, which were significantly elevated in both preeclampsia and
normotensive pregnancy compared to non-pregnant women (both p=0.001). The absolute
numbers of leukocyte subgroups did not differ between normotensive pregnant and
preeclamptic women. The percentages of granulocytes, monocytes and lymphocytes are
shown in Figure 1.
Leukocyte activation and microparticles in preeclampsia
143
7
Figure 1. Leukocyte counts
Figure 1. The percentages of the different leukocyte subpopulations are shown for
preeclamptic patients, normotensive pregnant women and non-pregnant controls.
Figure 2. Concentration of sL-selectin
Figure 2. The concentration of
sL-selectin in preeclamptic
patients, normotensive
pregnant women and non-
pregnant controls is presented.
Every dot represents one
patient. The short interrupted
lines represent the median
value of each group.
Chapter 7
144
Levels of sL-selectin in maternal plasma
A widely accepted marker of leukocyte activation is sL-selectin. The median concentration
of sL-selectin in cell-free citrated plasma of the preeclamptic patients was 449 ng/mL
(range 397-659 ng/mL; Figure 2). This concentration was significantly decreased
compared to both normotensive pregnant women (575 ng/mL, range 480-756 ng/mL),
p=0.015) and the non-pregnant controls (770 ng/mL, range 629-979 ng/mL, p=0.001).
Leukocyte mRAA expression
Of the 40 inflammation-related genes studied by MLPA, 23 genes were expressed in total
circulating leukocytes in >50% of the preeclamptic patients, normotensive pregnant women
and non-pregnant controls (Table 2). The overall expression pattern of these genes,
however, did not differ between groups. In preeclampsia, two genes were up-regulated
compared to normotensive pregnancy (Figure 3): NFκB-1A (p=0.004) and CDKN-1A
(cyclin dependent kinase inhibitor, p=0.02) and three genes showed an elevated expression
compared to non-pregnant controls: NFκB-1A (p=0.001), IL-1RA, (p=0.003), TNF-R1
(p=0.004), whereas the expression of GST-P1 was decreased (p=0.002). The expression of
IL-1RA, TNF-R1 and GST-P1 did not differ between the patients with preeclampsia and
normotensive pregnant controls (p=0.76, p=0.33 and p=0.76 respectively).
Table 2. All probes of the MLPA assay are listed in the second column. Values are relative peak
areas compared to B2M. Some genes are not regularly detected (<50% of the samples). The results of
the preeclamptic patients are presented in the third column, of the normotensive pregnant patients in
the fourth column and of the non-pregnant controls in the fifth column. IL: interleukin, BMI: B
lymphoma Mo-MLV (murine leukemia viral oncogene homolog) insertion region, MYC: early-
response (proto-oncogene) gene myc, AFκB: nuclear factor of kappa light chain gene enhancer in B
cells, AFκB-IA: nuclear factor of kappa light chain gene enhancer in B cells inhibitor alpha (IκB),
CDKA-1A: cyclin dependent kinase inhibitor, GST: glutathione s-transferase, PARA: poly-A specific
ribonuclease, PDE: phosphodiesterase, PTP: protein-tyrosine phosphatase, SERP: serine proteinase
inhibitor B9, B2M: beta-2- microglobulin, IFA: interferon, MIF: (macrophage) migration inhibitory
factor, MCP: monocyte chemotactic protein, MIP: macrophage inflammatory protein, PDGF:
platelet derived growth factor, TF: tissue factor, THBS: thrombospondin, TAF: tumor necrosis factor
and TAF-R: TAF-receptor. * significant difference with pregnant or non-pregnant controls.
Leukocyte activation and microparticles in preeclampsia
145
7
Table 2. Overview of presence of inflammatory genes in leukocytes
Genes Preeclampsia �ormotensive pregnancy
�on-pregnant women
Reference gene B2M 1 1 1 Interleukins IL-1α - - -
IL-1β 0.24 0.27* 0.16 IL-1RA 0.45* 0.40* 0.27 IL-2 - - - IL-4(R1) - - - IL-4(R2) - - - IL-6 - - - IL-8 0.19 0.14 0.21 IL-10 - - - IL-12(p35) - - - IL-12(p40) - - - IL-13 - - - IL-15(R1) 0.03 0.03 0.03 IL-15(R2) - - - IL-18 - - - Transcription BMI 0.06 0.05* 0.08 factors/oncogenes MYC 0.30 0.22* 0.31 NFκB-1 0.29 0.29 0.26 NFκB-1A 0.45* 0.30 0.27 NFκB-2 0.07 0.08 0.08 Enzymes/Enzyme- CDKN-1A 0.09* 0.07 0.09 Inhibitors GST-P1 0.03* 0.03* 0.05 PARN 0.10 0.10* 0.14 PDE-4B 0.31 0.25 0.25 PTP-1B 0.07 0.07 0.08 PTP-4A 0.80 0.78 0.83 SERP-B9 0.24 0.20 0.25 Other cytokines IFNγ - - - MIF 0.18 0.15* 0.20 MCP-1 - - - MCP-2 - - - MIP-1A 0.03 0.02 0.03 MIP-1B 0.09 0.05* 0.09 PDGF-B - - 0.02 TF - - - THBS-1 0.06 0.07 0.08 TNF-α 0.03 0.03 0.04 TNF-R1 0.48* 0.51* 0.36 TNF-β 0.04 0.03 0.04
Chapter 7
146
Nine genes differed in the extent of mRNA expression between normotensive pregnant
women and non-pregnant controls. Three genes were up-regulated: IL-1β (p=0.01), IL-1RA
(p=0.002) and TNF-R1 (tumor necrosis factor-receptor 1, p=0.001), and six genes were
down-regulated: MYC (early-response (proto-oncogene) gene myc, p=0.008), MIP-1B
(p=0.005), PARN (poly-A specific ribonuclease, p=0.005), BMI-1 (B lymphoma Mo-MLV
(murine leukemia viral oncogene homolog) insertion region 1, p=0.003), MIF (macrophage
migration inhibitory factor, p=0.001) and GST-P1 (glutathione s transferase-p1, p=0.003).
Figure 3. mR�A expression of IL-1ß, IL-1RA, T�F-R1, �FĸB-1A, CDK�-1A, and
GST-P1
Figure 3. mRAA expression of IL-1ß, IL-1RA, TAF-R1, AFĸB-1A, CDKA-1A, and GST-P1.
The relative mRAA expression compared to B2M expression of several inflammation-
related genes differentially expressed in either pregnancy, preeclampsia or both compared
to non-pregnant women.
Leukocyte activation and microparticles in preeclampsia
147
7
Markers reflecting activation of leukocyte subsets in pregnancy and preeclampsia
Circulating MP
The activation status of leukocytes and subpopulations thereof was determined by
measuring numbers of circulating leukocyte-derived MP. Total numbers of MP and the
number of platelet-derived MP (PMP) were decreased in preeclampsia compared to
normotensive pregnant women (p=0.008 and p=0.004 respectively) and compared to non-
pregnant controls (p=0.001 and p=0.001 respectively, data not shown). In contrast, the total
numbers of leukocyte-derived MP were comparable between groups (Figure 4A). The level
of granulocyte-derived MP was elevated in normotensive pregnancy (p=0.022) and
preeclampsia (p=0.007) compared to non-pregnant controls and tended to be increased in
preeclampsia compared to pregnant women, but this difference did not reach statistical
significance (p=0.086, Figure 4B). MP from monocytes were elevated in preeclamptic
patients compared to normotensive pregnant women (p=0.049), but not compared to non-
pregnant women (Figure 4C). The number of B-cell-derived MP did not differ between
groups (Figure 4D) nor did the level of Thelper-cell-derived MP (Figure 4E). The number of
Tsuppressor-cell-derived MP was elevated in preeclampsia, but the difference was only
significant compared to non-pregnant women (p=0.019, Figure 4F). There was no
difference in the numbers of Tsuppressor-cell-derived MP between the pregnant and non-
pregnant controls. Both types of T-cell-derived MP correlated with the number of
lymphocytes in the maternal blood in preeclampsia (respectively r=0.678, p=0.045 and
r=0.681, p=0.044). Strikingly, the percentages of leukocyte-derived MP differed
substantially from the distribution of their parental cells. Based on the numbers of
circulating subsets of MP (Figure 5), especially lymphocytes and monocytes seem to be
activated.
Level of elastase in maternal plasma
To confirm activation of granulocytes in preeclamptic patients, we measured the plasma
levels of elastase. The concentration of elastase was significantly elevated in the
preeclamptic patients (median 59 ng/mL, range 29-96 ng/mL) compared to pregnant
women (33 ng/mL, range 26-66 ng/mL, p=0.009) and non-pregnant controls (28 ng/mL,
range 13-40, p=0.001, Figure 6).
Chapter 7
148
Figure 4. �umbers of leukocyte-derived microparticles
Leukocyte activation and microparticles in preeclampsia
149
7
Figure 4. This Figure presents the total number of leukocyte-derived MP (A) and the
subgroups of leukocyte-derived MP: Granulocyte-derived MP (B), Monocyte-derived MP
(C), B-cell-derived MP(D), Thelper-cell-derived MP (E) and Tsuppressor-cell-derived MP (F).
Data are presented as medians with ranges. One outlier was excluded from the
normotensive patients in these data.
DISCUSSIO�
In the present study, we investigated with different techniques the extent of activation of
leukocytes and subgroups thereof in preeclampsia. An elevated number of leukocytes was
present in preeclampsia compared to pregnant women and non-pregnant controls. Plasma
levels of sL-selectin were decreased in pregnancy and even more in preeclampsia, and
expression of several inflammation-related genes were differentially expressed in
preeclamptic patients. Changes in numbers of circulating subsets of leukocyte-derived MP
and an elevated concentration of elastase indicated activation of particular subgroups of
leukocytes in preeclampsia. Leukocyte activation in general was confirmed by altered
concentrations of sL-selectin in preeclampsia and to a lesser extent in normotensive
pregnancy.
Chapter 7
150
Figure 5. Percentages of leukocyte-derived microparticles
Figure 5. The fraction of the different leukocyte-derived MP is shown. In contrast to the
parental cells (Figure 1), granulocyte-derived MP compose the smallest fraction of the
leukocyte-derived MP, followd by monocytes-derived MP. The largest fraction is composed
of lymphocyte-derived MP.
L-selectin is exposed on leukocytes and is proteolytically cleaved and shed from
the cell surface during activation (sL-selectin). Therefore, the concentration of sL-selectin
is increased in acute inflammatory processes29, but may be decreased in chronic
inflammatory processes30. Decreased concentrations of sL-selectin have also been reported
in other vascular diseases, including (un)stable angina and acute myocardial infarction30.
Based on our current results and those of others3,31, preeclampsia seems to be a disease
characterized by a more chronic type of inflammation.
Data describing gene-expression in circulating leukocytes from the maternal blood
to assess the activation status is limited. In the present study, an altered gene profile of
inflammation-related and cell-cycle-related genes was found in normotensive pregnancy
compared to non-pregnant controls. Nevertheless, no specific predominance of type 2 (e.g.
IL-4, IL-5, IL-6 or IL-13) cytokines was present. Also, no down-regulation of type 1 (IL-2,
IL-12, TNF-α) cytokines occurred. These results are in line with previous observations that
lymphocytes and monocytes of preeclamptic women only produce cytokines after
stimulation in vitro11,17. MRNA expression of the pro-inflammatory IL-1β gene in
leukocytes was up-regulated in pregnancy, showing that inflammation is also present in
normotensive pregnancy, and that circulating leukocytes may contribute to this
inflammation. In preeclampsia, mRNA expression of IL-1β was also elevated, but this
increase was not significant compared to non-pregnant women. Moreover, there was also
no difference between preeclamptic patients and normotensive pregnant women.
Leukocyte activation and microparticles in preeclampsia
151
7
Figure 6. Plasma concentrations of elastase
Figure 6. The concentrations of elastase in plasma of preeclamptic patients, normotensive
pregnant women and non-pregnant controls are shown. Every dot represents one patient.
The short interrupted lines represent the median value of each group. The minimal
detectable level of elastase is 1.98 ng/mL.
An elevated plasma level of IL-1β in normal pregnancy but not in preeclampsia has been
reported by others21. Endothelial cells are a target for IL-1β. Its effects are modulated by
IL-1RA, which is produced by monocytes and macrophages. In the present study, IL-1RA
was up-regulated in both pregnancy and preeclampsia compared to non-pregnant controls.
Elevated plasma levels of IL-1RA in preeclampsia have been described before32. Since IL-
1RA is an inhibitor of IL-1ß33, the up-regulation of this gene may be a protective response.
Although we found no differences in expression of TNF-α between the groups,
mRNA for TNF-R1 was up-regulated in pregnancy and preeclampsia. This may suggest
that pregnant and preeclamptic women are both more sensitive to the effects of TNF-α. We
Chapter 7
152
detected up-regulation of the expression of NFκB-1A in leukocytes from preeclamptic
patients. NFκB-1A (or IκB) is an inhibitor of NFκB. NFκB is a transcription factor which
plays an important role in immunomodulation by regulating the expression of a wide
variety of genes. NFκB is present in the cytoplasma bound to NFκB-1A. After degradation
of NFκB-1A, translocation of NFκB to the nucleus occurs, resulting in pro-inflammatory
gene expression. Although up-regulation of NFκB-1A mRNA in pregnancy and
preeclampsia seems to be contradictory with the inflammatory hypothesis, also circulating
leukocytes isolated from septic patients showed a similar decreased expression18.
Furthermore, it remains uncertain to which extent changes in expression levels of the
NFκB-1A gene triggers changes in protein expression, since McCracken et al., reported
down regulation of NFκB-1A protein during pregnancy and preeclampsia34.
CDKN-1A plays a role in the cell cycle. The role of CDKN or its inhibitor in
preeclampsia has not been investigated in humans yet. Pregnant mice, however, which are
heterogeneous deficient for p57Kip2, i.e. a potent inhibitor of several cyclin/cyclin dependent
kinase complexes, display symptoms similar to preeclampsia35. Therefore, the clinical
relevance of our finding remains unclear. Finally, the expression of GST-P1 was decreased
compared to non-pregnant controls. GST plays a role in the removal of reactive oxygen
species. Since elevated concentrations of GST are present in plasma from preeclamptic
patients36, it seems unlikely that GST in plasma from preeclamptic patients originates from
circulating leukocytes.
The total number of MP was decreased in preeclampsia, probably due to a
decreased platelet count37. We also studied the presence of subsets of leukocyte-derived MP
to determine whether particular types of leukocytes become activated during preeclampsia
and contribute to the inflammatory response.
Granulocyte-derived MP were elevated compared to the non-pregnant state. These
MP are also elevated in patients suffering from multi-organ failure or sepsis compared to
healthy controls, and their numbers strongly correlated with plasma levels of elastase38.
Similarly, we confirmed this correlation in our present study. Elastase is a degranulation
product of neutrophils, and elevated concentrations have been reported in preeclampsia7,8.
Elevated levels of monocyte-derived MP were present in preeclampsia compared
to normotensive pregnancy and Tsuppressor-cell-derived MP were elevated compared to the
non-pregnant state, reflecting activation of both monocytes and Tsuppressor-cells. Whether the
different subpopulations of leukocyte-derived MP have a role in the development of
preeclampsia or merely reflect cell activation, however, remains to be elucidated. Effects of
these MP in in vitro studies have been reported previously. T-cell-derived MP impair
relaxation of mouse aortic rings in vitro39, and leukocyte-derived MP induce the production
of the pro-inflammatory cytokines IL-6 and monocyte chemotactic protein (MCP)-1 by
Leukocyte activation and microparticles in preeclampsia
153
7
endothelial cells40,41. On the other hand, we found no direct effect of MP from preeclamptic
patients on RNA expression of inflammation-related genes by endothelial cells in vitro28.
Activation of leukocytes leads to production and exposure of adhesion molecules.
As a consequence, activated cells may quickly bind to other cells within the blood or to the
endothelium. To which extent this also applies to MP from such cells, is unknown.
Therefore, it can not be excluded that circulating cells and MP derived there from do not
necessarily represent the entire in vivo situation.
In conclusion, our findings confirm the occurrence of leukocyte activation in
general and of particular leukocyte subgroups in preeclampsia and to a lesser extent in
normotensive pregnancy. Changes in leukocyte-derived MP coincide with altered levels of
sL-selectin and elastase, but there is no clear pro-inflammatory mRNA expression profile
although in preeclampsia differences in mRNA expression levels of NFkB-1A, CDKN-1A,
IL-1RA, TNF-R1 and GST-were present. To which extent activated leukocytes are rapidly
removed from the blood, thereby triggering leukocyte production within the bone marrow
on the one hand and preventing the remaining cells from showing a full blown pro-
inflammatory phenotype on the other hand, remains open for discussion.
ACK�OWLEDGEME�TS
The authors are grateful to Chi M. Hau and Anita N. Böing for their assistance in the
technical work.
REFERE�CES
1. Morris RK, Cnossen JS, Khan KS, Robson SC, Kleijnen J, Ter Riet G, Mol BW, Van
der Post JAM. Serum screening with Down’s syndrome markers to predict pre-
eclampsia and fetal growth restriction: Systematic review and meta-analysis. (HTA
2008, in press, www.hta.ac.uk/***).
2. Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science
2005;308:1592-4.
3. Sacks GP, Studena K, Sargent K, Redman CW. Normal pregnancy and preeclampsia
both produce inflammatory changes in peripheral blood leukocytes akin to those of
sepsis. Am J Obstet Gynecol 1998;179:80-6.
4. Mellembakken JR, Aukrust P, Olafsen MK, Ueland T, Hestdal K, Videm V.
Activation of leukocytes during the uteroplacental passage in preeclampsia.
Hypertension 2002;39:155-60.
Chapter 7
154
5. Holthe MR, Staff AC, Berge LN, Lyberg T. Leukocyte adhesion molecules and
reactive oxygen species in preeclampsia. Obstet Gynecol 2004;103:913-22.
6. Tsukimori K, Nakano H, Wake N. Difference in neutrophil superoxide generation
during pregnancy between preeclampsia and essential hypertension. Hypertension
2007;49:1436-41.
7. Belo L, Santos-Silva A, Caslake M, Cooney J, Pereira-Leite L, Quintanilha A, Rebelo
I. Neutrophil activation and C-reactive protein concentration in preeclampsia.
Hypertens Pregnancy 2003;22:129-41.
8. Gupta AK, Gebhardt S, Hillermann R, Holzgreve W, Hahn S. Analysis of plasma
elastase levels in early and late onset preeclampsia. Arch Gynecol Obstet
2006;273:239-42.
9. Lurie S, Frenkel E, Tuvbin Y. Comparison of the differential distribution of
leukocytes in preeclampsia versus uncomplicated pregnancy. Gynecol Obstet Invest
1998;45:229–31.
10. Matsuo K, Ushioda N, Harman CR, Kimura T. Increased leukocyte distribution in the
pre-clinical stage of pre-eclampsia. Int J Gynaecol Obstet 2007;96:31-2.
11. Veenstra van Nieuwenhoven AL, Bouman A, Moes H, Heineman MJ, de Leij LF,
Santema J, Faas MM. Cytokine production in natural killer cells and lymphocytes in
pregnant women compared with women in the follicular phase of the ovarian cycle.
Fertil Steril 2002;77:1032-7.
12. Saito S, Shiozaki A, Nakashima A, Sakai M, Sasaki Y. The role of the immune
system in preeclampsia. Mol Aspects Med 2007;28:192-209.
13. Sargent IA, Borzychowski AM, Redman WG. NK cells and human pregnancy – an
inflammatory view. Trends in Immunol 2006;27:399-404.
14. Borzychowski AM, Croy BA, Chan WL, Redman CW, Sargent IL. Changes in
systemic type 1 and type 2 immunity in normal pregnancy and pre-eclampsia may be
mediated by natural killer cells. Eur J Immunol 2005;35:3054-63.
15. Lok CAR, Van der Post JAM, Sargent IL, Hau CM, Sturk A, Boer K, Nieuwland R.
Changes in microparticle numbers and cellular origin during pregnancy and
preeclampsia. Hypertens in Pregnancy (in press).
16. Luppi P, Deloia JA. Monocytes of preeclamptic women spontaneously synthesize
pro-inflammatory cytokines. Clin Immunol 2006;118:268-75.
17. Veenstra van Nieuwenhoven AL, Bouman A, Moes H, Heineman MJ, de Leij LF,
Santema J, Faas MM. Endotoxin-induced cytokine production of monocytes of third-
trimester pregnant women compared with women in the follicular phase of the
menstrual cycle. Am J Obstet Gynecol 2003;188:1073-7.
18. Spek CA, Verbon A, Aberson H, Pribble JP, McElgunn CJ, Turner T, Axtelle T,
Schouten J, Van Der Poll T, Reitsma PH. Treatment with an anti-CD14 monoclonal
Leukocyte activation and microparticles in preeclampsia
155
7
antibody delays and inhibits lipopolysaccharide-induced gene expression in humans
in vivo. J Clin Immunol 2003;23:132-40.
19. Germain SJ, Sacks GP, Sooranna SR, Sargent IL, Redman CW. Systemic
inflammatory priming in normal pregnancy and preeclampsia: the role of circulating
syncytiotrophoblast microparticles. J Immunol 2007;178:5949-56.
20. Koçyigit Y, Atamer Y, Atamer A, Tuzcu A, Akkus Z. Changes in serum levels of
leptin, cytokines and lipoprotein in pre-eclamptic and normotensive pregnant women.
Gynecol Endocrinol 2004;19:267-73.
21. Conrad KP, Miles TM, Benyo DF. Circulating levels of immunoreactive cytokines in
women with preeclampsia. Am J Reprod Immunol 1998;40:102-11.
22. Jonsson Y, Rubèr M, Matthiesen L, Berg G, Nieminen K, Sharma S, Ernerudh J,
Ekerfelt C. Cytokine mapping of sera from women with preeclampsia and normal
pregnancies. J Reprod Immunol 2006;70:83-91.
23. Daniel Y, Kupferminc MJ, Baram A, Jaffa AJ, Fait G, Wolman I, Lessing JB. Plasma
interleukin-12 is elevated in patients with preeclampsia. Am J Reprod Immunol
1998;39:376-80.
24. Adams KM, Mandel LS, Guthrie KA, Atkinson MW. Interleukin-18 in the plasma of
women with preeclampsia. Am J Obstet Gynecol 2003;188:1234-7.
25. Sakai M, Shiozaki A, Sasaki Y, Yoneda S, Saito S. The ratio of interleukin (IL)-18 to
IL-12 secreted by peripheral blood mononuclear cells is increased in normal pregnant
subjects and decreased in pre-eclamptic patients. J Reprod Immunol 2004;61:133-43.
26. Kauma S, Takacs P, Scordalakes C, Walsh S, Green K, Peng T. Increased endothelial
monocyte chemoattractant protein-1 and interleukin-8 in preeclampsia. Obstet
Gynecol 2002;100:706-14.
27. Eldering E, Spek CA, Aberson HL, Grummels A, Derks IA, de Vos AF, McElgunn
CJ, Schouten JP. Expression profiling via novel multiplex assay allows rapid
assessment of gene regulation in defined signalling pathways. Nucleic Acids Res
2003;31:153.
28. Lok CA, Böing AN, Reitsma PH, van der Post JA, van Bavel E, Boer K, Sturk A,
Nieuwland R. Expression of inflammation-related genes in endothelial cells is not
directly affected by microparticles from preeclamptic patients. J Lab Clin Med
2006;147:310-20.
29. Gearing AJ, Newman W. Circulating adhesion molecules in disease. Immunol Today
1993;14:506-12.
30. Haught WH, Mansour M, Rothlein R, Kishimoto TK, Mainolfi EA, Hendricks JB,
Hendricks C, Mehta JL. Alterations in circulating intercellular adhesion molecule-1
and L-selectin: further evidence for chronic inflammation in ischemic heart disease.
Am Heart J 1996;132:1-8.
Chapter 7
156
31. Chaiworapongsa T, Romero R, Yoshimatsu J, Espinoza J, Kim YM, Park K, Kalache
K, Edwin S, Bujold E, Gomez R. Soluble adhesion molecule profile in normal
pregnancy and pre-eclampsia. J Matern Fetal Neonatal Med 2002;12:19-27.
32. Greer IA, Lyall F, Perera T, Boswell F, Macara LM. Increased concentrations of
cytokines interleukin-6 and interleukin-1 receptor antagonist in plasma of women
with preeclampsia: a mechanism for endothelial dysfunction? Obstet Gynecol
1994;84:937-40.
33. Arend WP, Welgus HG, Thompson RC, Eisenberg SP. Biological properties of
recombinant human monocyte-derived interleukin 1 receptor antagonist. J Clin Invest
1990;85:1694-7.
34. McCracken SA, Drury CL, Lee HS, Morris JM. Pregnancy is associated with
suppression of the nuclear factor kappaB/IkappaB activation pathway in peripheral
blood mononuclear cells. J Reprod Immunol 2003;58:27-47.
35. Kanayama N, Takahashi K, Matsuura T, Sugimura M, Kobayashi T, Moniwa N,
Tomita M, Nakayama K. Deficiency in p57Kip2 expression induces preeclampsia-
like symptoms in mice. Mol Hum Reprod 2002;8:1129-35.
36. Kumtepe Y, Börekçi B, Aksoy H, Altinkaynak K, Ingeç M, Ozdiller O. Measurement
of plasma glutathione S-transferase in hepatocellular damage in pre-eclampsia. J Int
Med Res 2002;30:483-7.
37. Lok CA, Nieuwland R, Sturk A, Hau CM, Boer K, Vanbavel E, Vanderpost JA.
Microparticle-associated P-selectin reflects platelet activation in preeclampsia.
Platelets 2007;18, 68-72.
38. Joop K, Berckmans RJ, Nieuwland R, Berkhout J, Romijn FP, Hack CE, Sturk A.
Microparticles from patients with multiple organ dysfunction syndrome and sepsis
support coagulation through multiple mechanisms. Thromb Haemost 2001;85:810-20.
39. Martin S, Tesse A, Hugel B, Martinez MC, Morel O, Freyssinet JM,
Andriantsitohaina R. Shed membrane particles from T lymphocytes impair
endothelial function and regulate endothelial protein expression. Circulation
2004;109:1653-9.
40. Mesri M, Altieri DC. Endothelial cell activation by leukocyte microparticles. J
Immunol 1998;161:4382-7.
41. Mesri M, Altieri DC. Leukocyte microparticles stimulate endothelial cell cytokine
release and tissue factor induction in a JNK1 signaling pathway. J Biol Chem
1999;274:23111-8.
Chapter 8
Cell-derived microparticles and complement
activation in preeclampsia versus normal
pregnancy
É. Biró, C.A.R. Lok, C.E. Hack, J.A.M. van der Post, M.C.L. Schaap,
A. Sturk, R. Nieuwland
Placenta 2007;28:928-35
The first two authors contributed equally to this study
Chapter 8
158
ABSTRACT
Introduction. Inflammation plays a major role in the vascular dysfunction seen in
preeclampsia, and several studies suggest involvement of the complement system. The
objectives of the present study were to investigate whether complement activation on the
surface of microparticles (MP) is increased in plasma of preeclamptic patients versus
healthy pregnant controls.
Methods. MP from plasma of preeclamptic (n=10), healthy pregnant (n=10) and healthy
non-pregnant (n=10) women were analyzed by flow cytometry for bound complement
components (C1q, C4, C3) and complement activator molecules (C-reactive protein (CRP),
serum amyloid P-component (SAP), immunoglobulin (Ig)M, IgG). Fluid phase complement
activation products and activator molecules were also determined.
Results. Levels of MP with bound complement components showed no increase in
complement activation on the MP surface in preeclamptic women, in line with levels of
fluid phase complement activation products. In healthy non-pregnant and pregnant women,
bound CRP was associated with classical pathway activation on the MP surface, and in
healthy pregnant women IgM and IgG molecules also contributed. In preeclamptic women,
MP with bound SAP and those with IgG seemed to contribute to C1q binding without a
clear association to further classical pathway activation. Furthermore, significantly
increased levels of MP with bound CRP were present in preeclamptic compared with
healthy pregnant women (median 178 x106/L versus 47 x106/L, P <0.01), but without
concomitant increases in complement activation.
Conclusions. We found no evidence of increased complement activation on the MP surface
in preeclamptic women. MP with bound CRP were significantly increased, but in contrast
to healthy pregnant and non-pregnant women, this was not associated with increased
classical pathway activation on the surface of the MP.
Microparticles and complement activation in preeclampsia
159
8
I�TRODUCTIO�
Vascular dysfunction plays a central role in preeclampsia. The early phase of the disease is
characterized by suboptimal placentation1,2 and hemodynamic maladaptation to pregnancy3,
while at later stages generalized vascular dysfunction develops4,5 leading to the clinical
syndrome of preeclampsia. The pathogenesis of the disease is not yet fully understood, but
inflammatory processes seem to play a major role6. An important inflammatory mechanism
is complement activation. However, the role of the complement system in preeclampsia is
not clear. Decreased levels of C4 and C3, decreased CH50 values8, and increased plasma
levels of the anaphylatoxins C3a and C5a9-11 have been found in preeclamptic patients, as
well as decreased C1-inhibitor antigen and activity and decreased C4b-binding protein in
plasma12,13. Furthermore, in the placenta of preeclamptic patients, increased deposition of
C1q, C3d and the terminal complement complex were found14,15. Activation products of the
complement system induce chemotaxis and activation of leukocytes, and accordingly,
Haeger et al., found a correlation between levels of C5a in preeclamptic patients and
concentrations of elastase, a marker of neutrophil activation11. These results argue in favour
of a role for the complement system in preeclampsia. In contrast, Massobrio et al., found no
differences in serum C4, C3, or in plasma C3d concentrations when comparing
preeclamptic, healthy pregnant, and healthy non-pregnant women16, and Mellembakken et
al., found only decreased plasma concentrations of C4 in preeclamptic patients versus
healthy pregnant women, but no differences in plasma C3, C4b/c, C3b/c, C9, C4b-binding
protein, or C1-inhibitor17. Thus, a role for the complement system in the development of
preeclampsia is not yet definitely established.
Cell-derived microparticles (MP) are small vesicles released from cells upon
activation or apoptosis. They may play a role in inflammatory processes by activating or
altering the function of various cells types such as endothelial cells, monocytes, or
neutrophil granulocytes, via transfer of bioactive molecules, or ligand-receptor
interactions18-21. In addition, MP may also play a role in complement activation via the
classical pathway, as demonstrated in vitro by Nauta et al., and Gasser et al22,23. They
showed the binding of C1q (the first component of the classical pathway of complement) to
MP, and the deposition of C4 and C3, two components of the complement cascade
downstream of C1q, that are known to bind covalently to complement activating
surfaces24,25.
Recently, in synovial fluid of patients suffering from rheumatoid arthritis (RA), we
showed the presence of high levels of cell-derived MP with bound C1q, C4 and C3. Plasma
of these patients and of healthy individuals contained much lower levels of such MP26. The
results obtained in that study also suggested that in RA synovial fluid immunoglobulin G
(IgG) and IgM molecules were involved in complement activation on the surface of the
Chapter 8
160
MP, while in plasma of both RA patients and healthy individuals, CRP27. All three of these
molecules, as well as serum amyloid P component (SAP) can bind C1q and thereby activate
the classical pathway27-34. MP with activated complement components on their surface are
likely to play a role in the inflammatory processes in the joints of RA patients by
chemotaxis and activation of leukocytes26. Similarly, if present in the circulation of
preeclamptic patients, they might contribute to the generalized vascular dysfunction seen in
this disorder.
In the present study we investigated whether complement activation on the surface
of circulating MP is increased in patients suffering from preeclampsia compared with
healthy pregnant controls. Levels of circulating MP with bound C1q and activated C4
and/or C3 were assessed, as well as levels of MP binding the complement activator
molecules CRP, SAP, IgM and IgG.
METHODS
Patients and healthy controls
Preeclamptic (n=10), healthy pregnant (n=10) and healthy non-pregnant women (n=10)
were included in the study, both pregnant groups having singleton pregnancies.
Preeclampsia was defined according to the International Society for the Study of
Hypertension in Pregnancy: diastolic blood pressure of at least 110 mmHg on any occasion,
or at least 90 mmHg on two separate occasions at least four hours apart, and proteinuria of
at least 300 mg protein/24 hours, both developing after 20 weeks gestational age and
returning to normal values within 3 months after delivery35. The pregnant control group
consisted of healthy normotensive women with uncomplicated pregnancies, not using any
medication. The non-pregnant control group comprised healthy normotensive women, not
using any medication including oral contraceptives. The women in the three groups were
matched for age (± 5 years) and parity. The preeclamptic and healthy pregnant women were
also matched for gestational age (± 2 weeks). The demographic and clinical characteristics
of all study subjects are summarized in Table 1. Two of the women had received
betamethasone 12 mg (the first of two identical doses, administered at an interval of 24h)
the day before blood sampling, to promote fetal lung maturation. The other women either
received no corticosteroids (n=5) or received their first dose after blood sampling for this
study (n=3). The two women that had received corticosteroids did not form outliers when
compared with the rest of the preeclamptic women (data not shown). This study was
approved by the ethical committee of the Academic Medical Center of the University of
Amsterdam and complies with the principles of the Declaration of Helsinki. All patients
and healthy subjects had given their informed consent.
Microparticles and complement activation in preeclampsia
161
8
Table 1. Demographic and clinical characteristics of the healthy non-pregnant,
healthy pregnant and preeclamptic women
Healthy non-pregnant (n = 10)
Healthy pregnant (n = 10)
Preeclamptic (n = 10)
At time of sampling
Age (years) 31.0 (25.5–36.0) 31.5 (25.2–35.3) 30.6 (26.5–33.5)
Gestational age (weeks) – 31.0 (28.1–32.3) 29.4 (27.2–30.9)
Parity
Nulliparous 7 7 7
Multiparous 3 3 3
Blood pressure
Systolic (mmHg) 115.0 (107.5–126.5) 110.0 (107.5–115.0) 160.0 (142.5–175.0)
Diastolic (mmHg) 70.0 (65.0-80.0) 65.0 (60.0–75.0) 112.5 (98.8–120.0)
Body mass index (kg/m2) - 22.3 (20.6–30.9) 25.8 (20.3–40.8)
At delivery
Gestational age (weeks) - 39.5 (37.8–41.0) 33.9 (27.9–34.6)
Birth weight (g) - 3515 (2860–3690) 1160 (945–1818)
Table 1. Data are presented as median and interquartile range, except for parity, where the
numbers of nulliparous and multiparous women are provided.
Sample collection
Venous blood of patients and controls was collected without the use of a tourniquet into 0.1
volume of 105 mmol/L trisodium citrate. Blood cells were removed by centrifugation
(1550g, 20 minutes, room temperature) immediately after sample collection, and the plasma
was aliquotted, snapfrozen in liquid nitrogen and stored at –80°C.
Measurement of fluid phase complement activation products and complement
activator molecules
Plasma samples (250 µL aliquots) were thawed on melting ice and made MP-free by
centrifugation at 18890 g for 60 minutes at 4°C. The upper 200 µL of the microparticle-free
supernatants were collected and analyzed for concentrations of the soluble complement
activation products C4b/c (C4b, inactivated C4b and its further degradation product C4c)
and C3b/c (C3b, inactivated C3b and its further degradation product C3c) as well as SAP,
as described previously, by enzyme-linked immunosorbent assays36,37. CRP, IgM and IgG
concentrations were analyzed on the automated clinical chemistry analyzer Modular
Analytics P800 using Tina-quant reagents (Roche Diagnostics, Basel, Switzerland).
Chapter 8
162
Flow cytometric analysis of microparticles and bound complement components or
complement activator molecules
MP were isolated from plasma as we described previously38. Samples (250 µL aliquots)
were thawed on melting ice, then centrifuged at 18890 g for 30 minutes at room
temperature to pellet the MP. Subsequently, 225 µL of the supernatants were removed, and
225 µL of phosphate-buffered saline (PBS; 154 mmol/L NaCl, 1.4 mmol/L phosphate, pH
7.4) containing 10.5 mmol/L trisodium citrate (PBS/citrate) were added. MP were
resuspended, then again pelleted by centrifugation, after which 225 µL of supernatant were
again removed. To the remaining 25 µL MP pellet 75 µL of PBS/citrate buffer were added,
and the MP were resuspended.
Flow cytometric analysis was performed using an indirect staining procedure39.
MP (5 µL aliquots) were incubated for 30 minutes at room temperature in a final volume of
50 µL of PBS containing 2.5 mmol/L CaCl2 (PBS/Ca, pH 7.4) and unlabeled mouse
monoclonal antibodies against bound complement factors (C1q, C4, C3) or bound
complement activator molecules (CRP, SAP, IgM, IgG), or the respective isotype-matched
control antibodies (clones MOPC-31C (IgG1) and G155-178 (IgG2a) from Becton,
Dickinson and Company (BD) Pharmingen; San Jose, CA, USA). The monoclonal
antibodies against C1q, C4, C3, CRP and SAP (clones C1q-2, C4-4, C3-15, 5G4, and SAP-
14, respectively) were described previously37,40-42. Antibodies against the heavy chains of
IgM and IgG molecules (clones MH15-1 and MH16-1, respectively) were obtained from
Sanquin, Amsterdam, the Netherlands. After incubation with the antibodies, the
microparticles were washed with 200 µL of PBS/Ca. Then, rabbit anti-mouse F(ab’)2-
phycoerythrin (F(ab’)2-PE; Dako, Glostrup, Denmark; 5 µL) was added, and the mixtures
were again incubated for 30 minutes at room temperature.
Subsequently, 400 µL of buffer were added and the MP analyzed on a FACS
Calibur flow cytometer with CELLQuest 3.1 software (BD Immunocytometry Systems;
San Jose, CA, USA). Acquisition was performed for 1 minute per sample, during which the
flow cytometer analyzed approximately 60 µL of the suspension. Forward scatter and side
scatter were set at logarithmic gain. To identify marker positive events, thresholds were set
based on microparticle samples incubated with similar concentrations of isotype-matched
control antibodies. Calculation of the number of microparticles per liter plasma was based
upon the particle count per unit time, the flow rate of the flow cytometer, and the net
dilution during sample preparation of the analyzed microparticle suspension.
Statistical analysis
Data were analyzed with GraphPad PRISM 3.02 (GraphPad Software, Inc., San Diego, CA,
USA). Differences between groups were analyzed with the Friedman test, followed by
Dunn’s post test. Correlations were determined using Spearman’s correlation test.
Microparticles and complement activation in preeclampsia
163
8
Differences and correlations were considered significant at P <0.05. Data are presented as
median and interquartile range.
RESULTS
Healthy pregnant versus non-pregnant women
Levels of the fluid phase complement activation products C4b/c and C3b/c in MP-free
plasma of healthy pregnant women indicated a tendency towards increased complement
activation when compared with healthy non-pregnant controls (Table 2) but the differences
did not reach statistical significance (P >0.05). Analyzing levels of the complement
activator molecules in MP-free plasma (Table 2), we found no differences in
concentrations of CRP, SAP, IgM or IgG between healthy pregnant and non-pregnant
women (P >0.05 for all).
Table 2. Concentrations of fluid phase complement activation products and
complement activator molecules in plasma of healthy non-pregnant, healthy pregnant
and preeclamptic women
Healthy non-pregnant (n = 10) Pa
Healthy pregnant (n = 10) Pb
Preeclamptic
(n = 10) Pc
C4b/c (nmol/L) 4.1 (3.3–10.7) N.S.
9.4 (5.6–22.3) N.S. 10.3 (8.5–14.1) *
C3b/c (nmol/L) 14.8 (10.7–20.0) N.S.
19.5 (14.7–31.9) N.S. 20.6 (17.9–27.2) N.S.
CRP (mg/L) 1.3 (0.4–2.5) N.S.
4.8 (2.9–12.8) * 14.5 (6.6–61.2) ***
SAP (mg/L) 47.2 (38.8–67.4) N.S.
57.5 (57.1–70.4) N.S. 66.1 (52.0–81.4) *
IgM (g/L) 0.9 (0.6–1.6) N.S.
1.1 (0.6–1.7) N.S. 0.6 (0.5–1.8) N.S.
IgG (g/L) 9.8 (9.4–11.9) N.S.
7.8 (6.6–10.1) N.S. 6.3 (4.5–7.4) **
Table 2. Data are presented as median and interquartile range. Differences were analyzed
with the Friedman test, followed by Dunn’s post test. Two-tailed significance levels are
provided (P), which were considered significant at P <0.05. *P <0.05; **P <0.01; ***P
<0.001. CRP: C-reactive protein, IgG: immunoglobulin G, IgM: immunoglobulin M, A.S.:
not significant, and SAP: serum amyloid P component. aDifferences between healthy
pregnant and healthy non-pregnant women. bDifferences between preeclamptic and healthy
pregnant women. cDifferences between preeclamptic and non-pregnant women.
Chapter 8
164
The total concentration of MP did not differ between healthy pregnant and non-
pregnant women (median and interquartile range 1207 (876–2057) x106/L versus 1126
(910–2455) x106/L, respectively, P >0.05). The concentrations of MP with the complement
activator molecules CRP, SAP, IgM, and/or IgG bound to their surface are shown in Figure
1. No differences were found between healthy pregnant and non-pregnant women regarding
these (P >0.05 for all). MP with C1q, C4 and/or C3 on their surface (Figure 2) were present
at relatively low levels in plasma of both healthy pregnant and non-pregnant women, with
no detectable differences regarding MP with bound C1q or C4 (P >0.05 for both), and
somewhat lower levels of MP with bound C3 in plasma of healthy pregnant versus healthy
non-pregnant women (P < 0.05).
Table 3. Correlations between the concentrations of microparticles binding the
various complement activator molecules or complement components in plasma of
healthy non-pregnant, healthy pregnant and preeclamptic women
Healthy non-
pregnant
(n = 10)
Healthy
pregnant
(n = 10)
Preeclamptic
(n = 10)
r P r P r P
CRP pos. MP vs. C1q pos.
MP
0.832
8 0.005 0.939
4 0.000 0.5394 0.114
SAP pos. MP vs. C1q pos.
MP
0.454
5 0.191 0.563
6 0.096 0.7576 0.015
IgM pos. MP vs. C1q pos.
MP
0.381
8 0.279 0.818
2 0.006 -0.0424 0.918
IgG pos. MP vs. C1q pos.
MP
0.503
0 0.144 0.656
5 0.044 0.8303 0.005
C1q pos. MP vs. C4 pos.
MP
0.781
8 0.011 0.733
3 0.020 0.5273 0.123
C1q pos. MP vs. C3 pos.
MP
0.757
6 0.015 0.614
0 0.067 0.5289 0.123
Table 3. Correlation analysis was performed using Spearman’s correlation test (r:
correlation coefficient, P: two-tailed significance level, considered significant at P <0.05).
CRP: C-reactive protein, IgG: immunoglobulin G, IgM: immunoglobulin M: and SAP:
serum amyloid P component.
As shown in Table 3, in plasma of healthy pregnant women, the concentration of MP with
CRP, IgM or IgG on their surface correlated with those binding C1q (CRP: r=0.9394, P
<0.001; IgM: r=0.8182, P <0.01; IgG: r=0.6565, P <0.05), while in plasma of healthy non-
pregnant women, only the concentrations of MP with CRP on their surface correlated with
those binding C1q (r=0.8328, P <0.01). Furthermore, in healthy pregnant women, the con-
Microparticles and complement activation in preeclampsia
165
8
Figure 1. Concentrations of microparticles with bound complement activator molecules in
plasma of healthy non-pregnant, healthy pregnant, and preeclamptic women
Figure 1. Concentrations of MP
with bound complement activator
molecules CRP (A), SAP (B), IgM
(C) or IgG (D) in plasma of healthy
non-pregnant, healthy pregnant,
and preeclamptic women. Data are
presented as median and quartiles.
(The box extends from the 25th
percentile to the 75th percentile,
with a line at the median, and the
whiskers show the minimum and
maximum values.) Differences were
analyzed with the Friedman test,
followed by Dunn’s post test. Two-
tailed significance levels are
provided (P), which were
considered significant at P <0.05.
**P <0.01. CRP: C-reactive
protein, IgG: immunoglobulin G,
IgM: immunoglobulin M, A.S.: not
significant, and SAP: serum
amyloid P component.
Chapter 8
166
centrations of MP binding C1q correlated with those binding C4 (r=0.7333, P <0.05), and
in healthy non-pregnant women, they correlated with those binding C4 (r=0.7818, P <0.05)
as well as those binding C3 (r=0.7576, P <0.05). These results suggest that in healthy
pregnant and non-pregnant women MP had induced classical pathway activation via bound
CRP, and that in healthy pregnant women MP-bound IgM or IgG was also involved.
Figure 2. Concentrations of microparticles with bound complement components
Figure 2. Concentrations
of MP with bound
complement components
C1q (A), C4 (B) or C3 (C)
in plasma of healthy non-
pregnant, healthy pregnant,
and preeclamptic women.
Data are presented as
median and quartiles. (The
box extends from the 25th
percentile to the 75th
percentile, with a line at the
median, and the whiskers
show the minimum
and maximum values.)
Differences were analyzed
with the Friedman test,
followed by Dunn’s post
test. Two-tailed sig-
nificance levels are
provided (P), which were
considered significant at P
<0.05. *P <0.05. A.S.: not
significant.
Microparticles and complement activation in preeclampsia
167
8
Preeclamptic versus healthy pregnant women
Levels of the fluid phase complement activation products C4b/c and C3b/c in MP-free
plasma of preeclamptic patients did not differ from those in plasma of healthy pregnant
controls (P >0.05, Table 2). Likewise, there were no differences between preeclamptic and
healthy pregnant women regarding plasma levels of SAP, IgM and IgG (P >0.05 for all,
Table 2). However, we found significantly increased concentrations of CRP in
preeclamptic patients compared with healthy pregnant controls (P <0.05). The total
concentration of MP in plasma did not differ between preeclamptic and healthy pregnant
women (1232 (818–1653) x106/L versus 1207 (876–2057) x106/L, respectively, P >0.05).
As shown in Figure 1, in preeclamptic patients, MP with bound CRP were present at
significantly higher concentrations when compared with healthy pregnant women (178 (72–
718) x106/L versus 47 (15–75) x106/L, P < 0.01), while the MP with SAP, IgM, and/or IgG
on their surface were present at similar concentrations in the two groups (P >0.05). In
Figure 3 representative histogram plots of microparticles with bound CRP are provided. In
spite of the increased levels of MP with CRP bound to their surface, MP with C1q, C4
and/or C3 on their surface were not increased in preeclamptic women compared with
Figure 3. Representative histogram plots of microparticles with bound CRP in plasma
Figure 3. Representative histogram plots of MP with bound CRP in plasma of a healthy
non-pregnant (A), a healthy pregnant (B), and a preeclamptic woman (C). Fluorescence
intensity (x-axis) vs. MP count (y-axis) is shown. Binding of the isotype-matched control
antibody is depicted with the filled histogram, and binding of the specific antibody with the
open histogram. CRP: C-reactive protein.
healthy pregnant controls (P >0.05, Figure 2), and levels of MP binding CRP did not
correlate with those binding C1q (P >0.05, Table 3) in preeclamptic women. In this patient
group, the concentration of MP binding SAP and those binding IgG correlated with those
binding C1q (SAP: r=0.7576, P <0.05, IgG: r=0.8303, P <0.01, Table 3). As discussed
before, in plasma of healthy pregnant women, the concentration of MP binding CRP, IgM
Chapter 8
168
as well as IgG correlated with those binding C1q (Table 3). In preeclamptic women a
correlation between MP binding C1q and those binding C3 or C4 was absent, again in
contrast to healthy pregnant women.
DISCUSSIO�
The results of this study indicate that there are no differences in complement activation on
the MP surface when comparing healthy non-pregnant, healthy pregnant, and preeclamptic
women, apart from a slightly higher concentration of MP with bound C3 on their surface in
healthy non-pregnant women when compared to healthy pregnant women. This is consistent
with the levels of the fluid phase complement activation products C4b/c and C3b/c in
plasma, which are also similar in the three groups. Furthermore, our results suggest that in
healthy non-pregnant and pregnant women, bound CRP molecules are involved in the
classical pathway activation on the surface of MP, and that in healthy pregnant women IgM
and especially IgG molecules also contribute. Interestingly, in plasma of preeclamptic
women we found significantly higher levels of MP with bound CRP on their surface,
compared with both healthy pregnant and non-pregnant women, but this was not associated
with increased activation of the classical pathway of complement in preeclamptic women.
CRP binds to phosphorylcholine (the polar head group of phosphatidylcholine and
sphingomyelin) in the outer leaflet of membranes in the presence of sufficient amounts of
lysophosphatidylcholine43 or to oxidized phosphatidylcholine44. Ligand-complexed CRP
can bind C1q and activate the classical pathway of complement27,31,42. In a previous study26,
we found that in RA patients and healthy individuals levels of circulating MP with CRP on
their surface correlated with levels of circulating MP with C1q. These in turn correlated
with MP with bound C4 on their surface, suggesting classical pathway activation by CRP
bound to the MP. The same phenomenon could be observed in the present study in plasma
of healthy non-pregnant as well as healthy pregnant women. In plasma of preeclamptic
women, however, such a relationship was absent. CRP is known to exert direct opsonic
effects by binding to FcγRI and FcγRII on monocytes and neutrophils45. Possibly, in
women with preeclampsia the balance between complement activation and direct
opsonization by CRP is shifted towards the latter, or perhaps another mechanism is
responsible for inhibition of complement activation in plasma of preeclamptic women.
Interestingly, in a previous study we found that isolated MP from preeclamptic patients but
not healthy pregnant women can cause endothelial dysfunction in isolated myometrial
arteries from healthy pregnant women, but that this effect is abolished by the presence of
plasma from the patients47. Explaining this phenomenon and our present results showing
Microparticles and complement activation in preeclampsia
169
8
the absence of complement activation in the presence of relatively high concentrations of
MP binding CRP will require further investigations.
It should be mentioned, that in contrast to healthy non-pregnant women, where
only CRP seems to be involved in the low-level complement activation on the MP surface
by binding and activating C1q, in healthy pregnant women IgM and IgG molecules also
seem to participate. IgM molecules can bind to oxidized phospholipids and
lysophospholipids32,48 while the binding specificities of IgG molecules have not yet been
elucidated. In preeclamptic women SAP (which binds to phosphatidylethanolamine37,49,50)
and IgG seem to contribute, though in this study group MP binding C1q did not correlate
with those binding C4 or C3, suggesting the classical pathway is either (partly) inhibited at
the level of C1q, or that other pathways might also be involved. In spite of the questions
that still remain open, these results do illustrate the altered inflammatory state of
preeclamptic and even healthy pregnant women, when compared to healthy non-pregnant
controls, as described previously7.
There are data indicating that early-onset and late-onset preeclampsia might be
qualitatively different diseases51. In line with this, in a study examining the extent of
shedding of syncytiotrophoblast MP into the maternal circulation, Goswami et al., found a
difference between early-onset (before 34 weeks of gestation) and late-onset (later than 34
weeks of gestation) preeclampsia, with increased levels in the former group and no
difference in the latter, compared with matched healthy pregnant women52. In this regard it
should be mentioned that our study group consisted entirely of early-onset preeclamptic
women, and we observed no association between gestational age and the measured
parameters within this group (data not shown). However, such a relationship cannot be
excluded based on the present data. A study on preeclamptic women encompassing a wider
range of gestational ages at disease onset, including women with later-onset preeclampsia
than our study group, might reveal differences associated with gestational age at disease
onset.
In conclusion, we did not find increased levels of MP with bound C1q, C4 or C3 in
preeclamptic women, in accordance with similar levels of fluid phase complement
activation products in these women. Plasma of preeclamptic women did contain
significantly increased levels of microparticles binding CRP, but in contrast to healthy
pregnant and non-pregnant women, this was not associated with classical pathway
activation on the surface of the MP in these patients.
ACK�OWLEDGEME�TS
The authors are grateful to L.M. Pronk for her technical assistance.
Chapter 8
170
REFERE�CES
1. Pijnenborg R, Anthony J, Davey DA, Rees A, Tiltman A, Vercruysse L, van Assche
A. Placental bed spiral arteries in the hypertensive disorders of pregnancy. Br J Obstet
Gynaecol 1991;98:648-55.
2. Meekins JW, Pijnenborg R, Hanssens M, McFadyen IR, van Asshe A. A study of
placental bed spiral arteries and trophoblast invasion in normal and severe pre-
eclamptic pregnancies. Br J Obstet Gynaecol 1994;101:669-74.
3. Easterling TR, Benedetti TJ, Schmucker BC, Millard SP. Maternal hemodynamics in
normal and preeclamptic pregnancies: a longitudinal study. Obstet Gynecol
1990;76:1061-9.
4. Roberts JM. Endothelial dysfunction in preeclampsia. Semin Reprod Endocrinol
1998;16:5-15.
5. Taylor RN, de Groot CJ, Cho YK, Lim KH. Circulating factors as markers and
mediators of endothelial cell dysfunction in preeclampsia. Semin Reprod Endocrinol
1998;16:17-31.
6. Taylor RN. Review: immunobiology of preeclampsia. Am J Reprod Immunol
1997;37:79-86.
7. Redman CW, Sacks GP, Sargent IL. Preeclampsia: an excessive maternal
inflammatory response to pregnancy. Am J Obstet Gynecol 1999;180:499-506.
8. Houwert-de Jong MH, Claas FH, Gmelig-Meyling FH, Kalsbeek GL, Valentijn RM,
te Velde ER, Schuurman HJ. Humoral immunity in normal and complicated
pregnancy. Eur J Obstet Gynecol Reprod Biol 1985;19:205-14.
9. Haeger M, Bengtson A, Karlsson K, Heideman M. Complement activation and
anaphylatoxin (C3a and C5a) formation in preeclampsia and by amniotic fluid. Obstet
Gynecol 1989;73:551-6.
10. Haeger M, Unander M, Bengtsson A. Complement activation in relation to
development of preeclampsia. Obstet Gynecol 1991;78:46-9.
11. Haeger M, Unander M, Norder-Hansson B, Tylman M, Bengtsson A. Complement,
neutrophil, and macrophage activation in women with severe preeclampsia and the
syndrome of hemolysis, elevated liver enzymes, and low platelet count. Obstet
Gynecol 1992;79:19-26.
12. Halbmayer WM, Hopmeier P, Mannhalter C, Heuss F, Leodolter S, Rubi K, Fischer
M. C1-esterase inhibitor in uncomplicated pregnancy and mild and moderate
preeclampsia. Thromb Haemost 1991;65:134-8.
13. Schjetlein R, Haugen G, Sandset PM, Wisloff F. Reduced C4b-binding protein in
preeclampsia. Thromb Res 1997;85:153-8.
Microparticles and complement activation in preeclampsia
171
8
14. Sinha D, Wells M, Faulk WP. Immunological studies of human placentae:
complement components in pre-eclamptic chorionic villi. Clin Exp Immunol
1984;56:175-84.
15. Tedesco F, Radillo O, Candussi G, Nazzaro A, Mollnes TE, Pecorari D.
Immunohistochemical detection of terminal complement complex and S protein in
normal and pre-eclamptic placentae. Clin Exp Immunol 1990;80:236-40.
16. Massobrio M, Benedetto C, Bertini E, Tetta C, Camussi G. Immune complexes in
preeclampsia and normal pregnancy. Am J Obstet Gynecol 1985;152:578-83.
17. Mellembakken JR, Hogasen K, Mollnes TE, Hack CE, Abyholm T, Videm V.
Increased systemic activation of neutrophils but not complement in preeclampsia.
Obstet Gynecol 2001;97:371-4.
18. Jy W, Mao WW, Horstman L, Tao J, Ahn YS. Platelet microparticles bind, activate
and aggregate neutrophils in vitro. Blood Cells Mol Dis 1995;21:217-31.
19. Barry OP, Pratico D, Lawson JA, FitzGerald GA. Transcellular activation of platelets
and endothelial cells by bioactive lipids in platelet microparticles. J Clin Invest
1997;99:2118-27.
20. Forlow SB, McEver RP, Nollert MU. Leukocyte-leukocyte interactions mediated by
platelet microparticles under flow. Blood 2000;95:1317-23.
21. Mause SF, von Hundelshausen P, Zernecke A, Koenen RR, Weber C. Platelet
microparticles: a transcellular delivery system for RANTES promoting monocyte
recruitment on endothelium. Arterioscler Thromb Vasc Biol 2005;25:1512-8.
22. Nauta AJ, Trouw LA, Daha MR, Tijsma O, Nieuwland R, Schwaeble WJ, Gingras
AR, Mantovani A, Hack EC, Roos A. Direct binding of C1q to apoptotic cells and cell
blebs induces complement activation. Eur J Immunol 2002;32:1726-36.
23. Gasser O, Schifferli JA. Microparticles released by human neutrophils adhere to
erythrocytes in the presence of complement. Exp Cell Res 2005;307:381-7.
24. Campbell RD, Dodds AW, Porter RR. The binding of human complement component
C4 to antibody-antigen aggregates. Biochem J 1980;189:67-80.
25. Law SK, Lichtenberg NA, Levine RP. Evidence for an ester linkage between the
labile binding site of C3b and receptive surfaces. J Immunol 1979;123:1388-94.
26. Biró É, Nieuwland R, Tak PP, Pronk LM, Schaap MC, Sturk A, Hack CE. Activated
complement components and complement activator molecules on the surface of cell-
derived microparticles in patients with rheumatoid arthritis and healthy individuals.
Ann Rheum Dis 2007;66:1085-92.
27. Kaplan MH, Volanakis JE. Interaction of C-reactive protein complexes with the
complement system. I. Consumption of human complement associated with the
reaction of C-reactive protein with pneumococcal C-polysaccharide and with the
choline phosphatides, lecithin and sphingomyelin. J Immunol 1974;112:2135-47.
Chapter 8
172
28. Füst G, Medgyesi GA, Rajnavölgyi E, Csecsi-Nagy M, Czikora K, Gergely J. Possible
mechanisms of the first step of the classical complement activation pathway: binding
and activation of C1. Immunology 1978;35:873-84.
29. Bruggemann M, Williams GT, Bindon CI, Clark MR, Walker MR, Jefferis R,
Waldmann H, Neuberger MS. Comparison of the effector functions of human
immunoglobulins using a matched set of chimeric antibodies. J Exp Med
1987;166:1351-61.
30. Ying SC, Gewurz AT, Jiang H, Gewurz H. Human serum amyloid P component
oligomers bind and activate the classical complement pathway via residues 14-26 and
76-92 of the A chain collagen-like region of C1q. J Immunol 1993;150:169-76.
31. Agrawal A, Shrive AK, Greenhough TJ, Volanakis JE. Topology and structure of the
C1q-binding site on C-reactive protein. J Immunol 2001;166:3998-4004.
32. Kim SJ, Gershov D, Ma X, Brot N, Elkon KB. I-PLA(2) activation during apoptosis
promotes the exposure of membrane lysophosphatidylcholine leading to binding by
natural immunoglobulin M antibodies and complement activation. J Exp Med
2002;196:655-65.
33. Ciurana CL, Zwart B, van Mierlo G, Hack CE. Complement activation by necrotic
cells in normal plasma environment compares to that by late apoptotic cells and
involves predominantly IgM. Eur J Immunol 2004;34:2609-19.
34. Zwart B, Ciurana C, Rensink I, Manoe R, Hack CE, Aarden LA. Complement
activation by apoptotic cells occurs predominantly via IgM and is limited to late
apoptotic (secondary necrotic) cells. Autoimmunity 2004;37:95-102.
35. Davey DA, MacGillivray I. The classification and definition of the hypertensive
disorders of pregnancy. Am J Obstet Gynecol 1988;158:892-8.
36. Wolbink GJ, Bollen J, Baars JW, ten Berge RJ, Swaak AJ, Paardekooper J, Hack CE.
Application of a monoclonal antibody against a neoepitope on activated C4 in an
ELISA for the quantification of complement activation via the classical pathway. J
Immunol Methods 1993;163:67-76.
37. Familian A, Zwart B, Huisman HG, Rensink I, Roem D, Hordijk PL, Aarden LA,
Hack CE. Chromatin-independent binding of serum amyloid P component to
apoptotic cells. J Immunol 2001;167:647-54.
38. Berckmans RJ, Nieuwland R, Böing AN, Romijn FP, Hack CE, Sturk A. Cell-derived
microparticles circulate in healthy humans and support low grade thrombin
generation. Thromb Haemost 2001;85:639-46.
39. Biró É, Nieuwland R, Sturk A. Measuring circulating cell-derived microparticles. J
Thromb Haemost 2004;2:1843-4.
40. Hack CE, Paardekooper J, Smeenk RJ, Abbink J, Eerenberg AJ, Nuijens JH.
Disruption of the internal thioester bond in the third component of complement (C3)
Microparticles and complement activation in preeclampsia
173
8
results in the exposure of neodeterminants also present on activation products of C3.
An analysis with monoclonal antibodies. J Immunol 1988;141:1602-9.
41. Hoekzema R, Martens M, Brouwer MC, Hack CE. The distortive mechanism for the
activation of complement component C1 supported by studies with a monoclonal
antibody against the "arms" of C1q. Mol Immunol 1988;25:485-94.
42. Wolbink GJ, Brouwer MC, Buysmann S, Ten Berge IJ, Hack CE. CRP-mediated
activation of complement in vivo: assessment by measuring circulating complement-
C-reactive protein complexes. J Immunol 1996;157:473-9.
43. Volanakis JE, Wirtz KW. Interaction of C-reactive protein with artificial
phosphatidylcholine bilayers. Nature 1979;281:155-7.
44. Chang MK, Binder CJ, Torzewski M, Witztum JL. C-reactive protein binds to both
oxidized LDL and apoptotic cells through recognition of a common ligand:
Phosphorylcholine of oxidized phospholipids. Proc Natl Acad Sci U S A
2002;99:13043-8.
45. Crowell RE, Du Clos TW, Montoya G, Heaphy E, Mold C. C-reactive protein
receptors on the human monocytic cell line U-937. Evidence for additional binding to
Fc gamma RI. J Immunol 1991;147:3445-51.
46. Bharadwaj D, Stein MP, Volzer M, Mold C, Du Clos TW. The major receptor for C-
reactive protein on leukocytes is fcgamma receptor II. J Exp Med 1999;190:585-90.
47. VanWijk MJ, Svedas E, Boer K, Nieuwland R, VanBavel E, Kublickiene KR. Isolated
microparticles, but not whole plasma, from women with preeclampsia impair
endothelium-dependent relaxation in isolated myometrial arteries from healthy
pregnant women. Am J Obstet Gynecol 2002;187:1686-93.
48. Shaw PX, Horkko S, Chang MK, Curtiss LK, Palinski W, Silverman GJ, Witztum JL.
Natural antibodies with the T15 idiotype may act in atherosclerosis, apoptotic
clearance, and protective immunity. J Clin Invest 2000;105:1731-40.
49. Schwalbe RA, Dahlback B, Coe JE, Nelsestuen GL. Pentraxin family of proteins
interact specifically with phosphorylcholine and/or phosphorylethanolamine.
Biochemistry 1992;31:4907-15.
50. Emsley J, White HE, O'Hara BP, Oliva G, Srinivasan N, Tickle IJ, Blundell TL, Pepys
MB, Wood SP. Structure of pentameric human serum amyloid P component. Nature
1994;367:338-45.
51. von Dadelszen P, Magee LA, Roberts JM. Subclassification of preeclampsia.
Hypertens Pregnancy 2003;22:143-8.
52. Goswami D, Tannetta DS, Magee LA, Fuchisawa A, Redman CW, Sargent IL, von
Dadelszen P. Excess syncytiotrophoblast microparticle shedding is a feature of early-
onset pre-eclampsia, but not normotensive intrauterine growth restriction. Placenta
2006;27:56-61.
175
PART IV
General discussion, future perspectives
and summary
Chapter 9
General discussion and
future perspectives
Chapter 9
178
GE�ERAL DISCUSSIO� A�D FUTURE PERSPECTIVES
9.1 Aim of the thesis
9.2 Concentration and origin of microparticles in pregnancy and preeclampsia
9.3 Effects of microparticles in pregnancy and preeclampsia
9.3.1 Endothelial dysfunction
9.3.2 Inflammation
9.3.3 Other effects
9.4 Future perspectives
General discussion
179
9
9.1 AIM OF THE THESIS
Preeclampsia is a pregnancy-specific syndrome defined by hypertension and proteinuria.
The exact etiology of preeclampsia is still unclear, although endothelial dysfunction, an
exaggerated inflammatory response and coagulation are involved. Since these processes are
all affected by cell-derived microparticles (MP), we hypothesized that MP contribute to the
development or aggravation of preeclampsia. MP are vesicles released from the cell surface
by blebbing of the plasma membrane. Their composition depends on their cellular origin
but may differ from the parental cell. The release and formation of MP are also affected by
the activation or apoptosis status of the releasing cell.
9.2 CO�CE�TRATIO� A�D ORIGI� OF MICRPARTICLES I� PREG�A�CY
A�D PREECLAMPSIA
Differences in MP measurements
At present, there is no consensus in the literature with regard to the concentration of MP or
subpopulations thereof in preeclampsia (Chapter 2). These differences are due to
variations in patient selection, methodological differences and intra-individual variations.
First, preeclampsia is a heterogeneous disease and clinical symptoms may vary
from asymptomatic women to critically ill patients. Since our hospital is a tertiary referral
center and admits ill patients with often an early onset of preeclampsia, patients included in
our studies are more likely to suffer from thrombocytopenia and hemolysis, i.e. processes
which clearly affect the MP concentration. An influence of disease severity has been
demonstrated for placenta-derived MP1. Taken together, differences in patient selection
may complicate comparison of data between investigators.
Secondly, laboratories use different isolation- and detection protocols, other
definitions of MP, and different cluster of differentiation (CD) markers for MP
identification. These variables explain differences in MP numbers between our present data
and those reported in studies from others2-7. An improvement in our isolation protocol
accounts for the lower concentrations of MP obtained in our earlier studies8.
Thirdly, variations in MP numbers may depend on age9 and food consumption10,11.
Also many pre-analytical variables, such as the time between collection and handling of the
blood, markedly affect the measured concentrations of MP. Furthermore, we and others
assume that MP are continuously shed into the circulation. However, this is not necessarily
true for all cell types, since placenta-derived MP were shown to be episodically released
into the circulation, e.g. after placental incidents like ischemia12. Whether or not this also
applies to the release of other subpopulations of MP, is unknown.
Chapter 9
180
Finally, in pregnancy, the circulating blood volume is increased considerably.
Therefore, a decreased concentration of MP may be anticipated. This is not confirmed by
our results, possibly due to a concurrent activation of platelets and leukocytes. In contrast,
in preeclampsia haemoconcentration occurs due to fluid leakage to the extravascular space.
Furthermore, platelets and leukocytes are activated and also lysis of erythrocytes
contributes to altered concentrations of MP and subpopulations thereof. The overall
decreased MP concentration in preeclampsia is most likely explained by a decreased
platelet count which is often found in preeclampsia.
Total concentrations versus subpopulations
With regard to pregnancy and preeclampsia, most studies on the occurrence of MP thus far
particularly focused on the total concentration of circulating MP compared to control
populations 6,7,13. It should be mentioned that by determination of the concentration of MP
in cell-free plasma samples, only those MP will be obtained that are present within the
maternal plasma. In other words, MP isolated from plasma samples do not reflect the real in
vivo situation, since particular subpopulations of MP may already have been removed from
the circulation by clearance or by adherence to the (damaged) endothelium or to other
circulating cells14. Despite the fact that such subpopulations are important with regard to
the development or aggravation of preeclampsia, they are not easily accessible for clinical
research.
Despite these limitations, our present data suggest that especially subpopulations
or characteristics of circulating MP may be of equal relevance as the total concentration of
MP. In our studies, the majority of circulating MP originated from platelets in preeclampsia
as well as in normotensive pregnancies (Chapter 3). Minor fractions of circulating MP
originated from erythrocytes, leukocytes, endothelial cells and trophoblast cells. In
preeclamptic patients, increased numbers of erythrocyte-derived MP and leukocyte-derived
MP were present compared to normotensive controls of the same gestational age.
Although the biological or (patho-)physiological role of changes in circulating
concentrations of MP subpopulations is unclear, they most likely reflect changes of their
parental cells. For instance, elevated numbers of circulating P-selectin-exposing PMP in
preeclampsia (Chapter 4) reflect platelet activation, which is supported by the current
literature15-18. Elevated concentrations of circulating erythrocyte-derived MP in
preeclampsia reflect haemolysis or haemoconcentration, and increased numbers of
circulating leukocyte-derived MP indicate cellular activation (see next paragraph). Elevated
numbers of circulating endothelial cell-derived MP have been proposed to reflect
endothelial activation or dysfunction4,19,20. Since we found comparable numbers of
endothelial-derived MP in plasma samples of preeclamptic patients and controls, we
assume that endothelial activation is similar in our preeclamptic patients and controls. The
General discussion
181
9
elevated number of placenta-derived MP in the third trimester in pregnancy reflects most
likely an increased placenta volume with more trophoblast cells shedding MP. The
gestational age-dependent increase in the circulating number of placenta-derived MP is in
accordance with Germain et al14. Alternatively, hypoxia and subsequent apoptosis may
affect the release of such MP in preeclampsia21.
9.3 EFFECTS OF MICROPARTICLES I� PREG�A�CY A�D PREECLAMPSIA
MP may modulate endothelial dysfunction, inflammation, haemostasis and angiogenesis
(Figure 1), which will be discussed in the following paragraphs. It should be mentioned
that most of these effects were established in vitro using isolated fractions of MP. Whether
or not MP also exert such functions in vivo, however, is only partially known.
Figure 1. Possible functions of microparticles in preeclampsia
Figure 1. A schematic representation of the possible functions of MP and exosomes in
preeclampsia described in literature and in this thesis.
Chapter 9
182
9.3.1 Endothelial dysfunction
Previously, we and others showed that isolated fractions of MP from plasma of
preeclamptic patients impaired endothelial-dependent dilatation in isolated resistance
arteries22,23. On the other hand, MP from preeclamptic patients were reported to induce
vascular hyporeactivity of human omental arteries and aortas from mice2. The difference
with the study of Van Wijk22 may be attributed to differences in experimental conditions.
Several lines of evidence suggest that subpopulations of MP may (differentially)
affect endothelial function. Meziani et al., showed that incubation with PMP resulted in the
release of vasodilative NO metabolites, whereas incubation with leukocyte-derived MP
stimulated not only NO release but also production of vasoconstrictive COX-2 metabolites.
Also placenta-derived MP and T-cell-derived MP affect endothelial relaxation response in
vitro23,24. Thus, the overall effect of MP isolated from plasma samples on the endothelium
is likely to be a subtle balance between the various pro- and antagonistic effects of the
many subpopulations of MP being present in such samples.
9.3.2 Inflammation
Inflammation may underlie the before mentioned vascular effects of MP2,25. Therefore, we
investigated whether MP from preeclamptic patients induced changes in RNA expression of
inflammation-related genes in human umbilical endothelial cells (Chapter 6). Gene
expression, however, was found to be unaffected. It cannot be excluded from these
experiments that incubation of other types of endothelial cells with MP or by using
endothelial cells cultured under flow conditions would have resulted in a different outcome.
Moreover, we also cannot exclude that MP most effective in modulating endothelial gene
expression or function were already removed from the circulation and therefore absent in
our plasma samples. Our data are confirmed by Donker et al., who showed that incubation
of either human umbilical endothelial cells or human glomerular microvascular endothelial
cells with MP-containing plasma of preeclamptic patients failed to trigger cytokine release
or changes in gene expression26. Interestingly, plasma from preeclamptic patients triggered
cytokine production in monocyte cultures27. Thus, MP, which are present in plasma, may
exert an indirect effect on the endothelium via monocyte activation (Figure 2). This is
supported by the finding that T-cell-derived MP trigger cytokine production in
monocytes28. Again, the exerted effects of MP on the endothelium seem to differ between
subpopulations, since incubation of human umbilical endothelial cells with placenta-
derived MP hardly affected gene expression29.
The inflammatory response is a complex system of many interacting processes.
Not only endothelial activation plays a central role, but also leukocyte adhesion and
activation, immune modulation, platelet-activation and haemostasis. In the next paragraphs,
General discussion
183
9
the presence and contribution of MP subpopulations in preeclampsia to inflammation,
based on this thesis, will be briefly discussed.
Figure 2. Microparticles with different characteristics circulate in preeclampsia
Figure 2. MP originate from blood cells, endothelial cells and trophoblast cells.
Depending on their origin, they expose different molecules. As a result,, they exert different
effects on the endothelium. Flt-1 exposed on placenta-derived MP or PMP may bind
circulating VEGF. Hypothetically, the effect of MP on the endothelium may be exerted
indirectly via the activation of monocytes. Possibly this effect is mediated through the
adhesion receptor P-selectin. The overall balance between circulating or attached
(subpopulations of) MP determines their final biological action.
We found elevated concentrations of monocyte-derived MP in plasma samples of
preeclamptic patients compared to controls (Chapters 3 and 7). Since the numbers of
monocytes were not increased (Chapter 7), this increase may reflect activation of
monocytes in preeclampsia, which is in line with the current literature15. Monocyte-derived
MP may affect other cells, e.g. synovial MP trigger cytokine production by fibroblast-like
synoviocytes. A major fraction of synovial MP originates from monocytes, although also
Chapter 9
184
MP from granulocytes and T-cells are present. Monocyte-derived MP also trigger the
expression and production of tissue factor and von Willebrand factor by endothelial cells in
vitro31. It seems unlikely, however, that monocyte-derived MP substantially contribute to
inflammation in preeclampsia, since we found no changes in expression of inflammation-
related genes in endothelial cells after incubation with MP (Chapter 6). Since monocytes
as well as monocyte-derived MP constitute relatively minor fractions of the total population
of leukocytes and circulating MP, respectively, their effects may be masked by other more
prominent (sub)populations of cells and MP.
Compared to non-pregnant women, elevated concentrations of granulocyte-derived
MP are present in preeclamptic patients and in pregnant women (Chapter 7)8. This may be
due to elevated numbers of granulocytes32-34. Although granulocytes compose about 75% of
the leukocytes in pregnancy, the percentage of granulocyte-derived MP was only 17-25 %
(Chapter 7), suggesting that subpopulations show different rates of MP release and/or
removal from the circulation.
In our longitudinal study (Chapter 3), relatively small numbers of granulocyte-
derived MP (<0.1%) were detected. In Chapter 7, however, the median fraction of
granulocyte MP (of the total number of MP) was 2.7% in preeclampsia (versus 0.6% in
pregnancy and 0.2% in non-pregnant controls. Whereas the experimental conditions of
these studies were comparable, patients included in the longitudinal study suffered from
more severe preeclampsia than those included in the cross sectional study (Chapters 3 and
7, respectively). We hypothesize that the severity of preeclampsia may affect the interaction
between (activated) leukocytes, their MP and the endothelium. Since adhesion of
granulocytes to endothelial cells from preeclamptic pregnancies is increased compared to
granulocyte adhesion to endothelial cells from control pregnancies, there is some evidence
to support this hypothesis35. Possibly, also the binding of granulocyte-derived MP to
endothelial cells may be disease state dependent.
Also Tsuppressor-cell-derived MP were increased in preeclampsia compared to non-
pregnant controls, suggesting activation of Tsuppressor-cells. An elevated level of T-cell-
derived MP is in line with the study of Van Wijk et al8. T-cell-derived MP trigger
expression and production of interleukin (IL)-1ß and IL-1 receptor antagonist (RA) by
monocytes in vitro28. Although it is unknown whether T-cell derived MP bind to monocytes
in vivo, we found increased expression of both IL-1ß and IL-1RA in leukocytes from
pregnant and preeclamptic patients (Chapter 7). Also placenta-derived MP are capable of
binding to monocytes, and trigger the expression and production of pro-inflammatory
cytokines14. Thus, it may be worthwhile to study the occurrence of complexes of monocytes
and MP of various cellular origins ex vivo.
In Chapter 8, we showed that isolated fractions of MP from preeclamptic patients
showed no increased signs of complement activation compared to controls. Only the
General discussion
185
9
concentration of MP exposing C-reactive protein (CRP) was elevated. CRP is a
complement activator molecule, which binds to phosphatidylcholine exposed on the MP
surface. Surface-exposed CRP activates the complement system. Furthermore, CRP triggers
the expression and production of cytokines and tissue factor by monocytes36,37. Thus, the
biological role of MP-exposed CRP in preeclampsia remains to be determined, but such MP
are likely to contribute to the pro-inflammatory phenotype of preeclampsia.
9.3.3 Other effects
Platelets rapidly adhere to damaged endothelium, become activated and form a platelet
plug. Activated platelets capture tissue factor (TF)-exposing MP from the blood, thereby
initiating coagulation38. In the interaction between cells and between cells and MP, P-
selectin plays an essential role. Since we found P-selectin to be exposed on circulating PMP
(Chapter 4), such MP may have an increased ability to adhere to cells or other MP.
We showed that plasma from preeclamptic patients contains substantial numbers
of platelet-derived and placenta-derived MP exposing Flt-1 (Chapter 5). Although
composing only a minor fraction of the total concentration of non-cell bound Flt-1 in
plasma, the biological activity of MP-exposed Flt-1 may differ from truly soluble (non-
membrane associated) Flt-1. A pro-angiogenic effect of PMP was observed in vitro39,40. In
contrast, endothelial-derived MP impaired angiogenesis41. Again, the overall effect of MP
is likely to be a balance between the pro- and anti angiogenic effects of the various
subpopulations of MP. One may speculate that Flt-1 exposed by MP may be transferred to
“target” cells in a same mechanism as previously described for tissue factor42. If so,
transferred Flt-1 may function as a transmembrane receptor for VEGF, thereby enabling
angiogenesis.
9.4 FUTURE PERSPECTIVES
Until now, most research focused on the question: “What are the effects of MP?”.
However, the question “Why do cells release MP?” may be equally interesting (Figure 3).
The release of MP is an important and conserved cellular feature. One may hypothesize that
cells unable to release MP are more stressed and likely to die, because their ability to
remove dangerous intracellular substances such as caspases is impaired. In this theory, the
ability of cells to release sufficient MP may be affected by two major causes. First, since
MP shedding is an active process which requires energy, energy depletion may impair their
release. Second, there may also be a genetic cause, e.g. gene polymorphisms, affecting the
ability of cells to release MP. Thus, analysis of genes already known to be involved in MP
release may provide new insights. In our studies, we persistently found decreased numbers
Chapter 9
186
of PMP (and platelets) in preeclampsia compared to normotensive women (Chapter 3, 4, 5
and 7), which seems to be in line with the before mentioned hypothesis. Since others
reported elevated concentrations of (P)MP43 and endothelial-derived MP19 in other vascular
diseases, however, a more thorough analysis seems essential.
Figure 3. The reason and effect of microparticles release
Figure 3. The release of MP by cells may be at least as important as the biological effects
of MP. The inability of cells to release MP induces apoptosis. Whereas release of MP may
be beneficial to the releasing cell, uncontrolled release may constitute a potential
“environmental hazard”.
MP may have both biologically or clinically positive (‘good’) and negative (‘bad’)
effects (Figure 4). First, MP are involved in intercellular communication. Proteins, mRNA,
receptors and organelles can be transferred from MP to target cells44. Second, MP may
contribute to cellular survival, because inhibition of MP release triggers apoptosis45. In this
model, MP are cellular dustbins, which protect the cells against intracellular accumulation
of harmful enzymes or other substances. Third, the release of E-selectin from the
endothelial cell surface by shedding E-selectin-exposing MP may prevent leukocyte
attachment to the endothelium. Whereas release of MP may be beneficial to the releasing
cell, uncontrolled release may constitute a potential “environmental hazard”. For example,
MP are generally considered to be procoagulant and contribute to haemostasis. Their
uncontrolled release, however, may lead to hypercoagulation with vascular disease as a
consequence. These positive and/or negative effects of MP are at least partially dependent
on the status of the parental cell. MP from apoptotic T-cells impair relaxation, whereas MP
from activated T-cells expose sonic hedgehog (SHH) proteins and increase NO release, thus
promoting vasodilation46. MP exposing SHH proteins can even reverse endothelial
General discussion
187
9
dysfunction and in the future it will become clear whether there is a therapeutic role for
SHH-exposing MP.
Figure 4. The balance between beneficial and harmful effects of microparticles
Figure 4. MP affect the delicate balance of various clinically relevant processes.
Imbalance contributes to disease development.
The role of exosomes in preeclampsia has not been thoroughly investigated yet.
Evidence is accumulating that exosomes modulate the immune response47. They facilitate
antigen presentation, but are also capable of suppressing the immune response by exposing
FasL48,49. Exosomes may be involved in suppressing T lymphocyte activation during
pregnancy, thereby contributing to an immune privilege for the developing fetus, which is
necessary to achieve a term pregnancy50. Immunologic maladaptation may be one of the
underlying phenomena in preeclampsia. Therefore, additional studies on exosomes may
give new clues in the search for the etiology of preeclampsia.
In conclusion, despite many remaining questions, the role of various types of cell-
derived vesicles in disease development, including preeclampsia, is slowly becoming
apparent. The possibilities of research on such vesicles and their putative clinical relevance
are exiting and promising.
Chapter 9
188
REFERE�CES
1. Goswami D, Tannetta DS, Magee LA, Fuchisawa A, Redman CW, Sargent IL, von
DP. Excess syncytiotrophoblast microparticle shedding is a feature of early-onset pre-
eclampsia, but not normotensive intrauterine growth restriction. Placenta 2006;27:56-
61.
2. Meziani F, Tesse A, David E, Martinez MC, Wangesteen R, Schneider F,
Andriantsitohaina R. Shed membrane particles from preeclamptic women generate
vascular wall inflammation and blunt vascular contractility. Am J Pathol
2006;169:1473-83.
3. Gonzalez-Quintero VH, Smarkusky LP, Jimenez JJ, Mauro LM, Jy W, Hortsman LL,
O'Sullivan MJ, Ahn YS. Elevated plasma endothelial microparticles: preeclampsia
versus gestational hypertension. Am J Obstet Gynecol 2004;191:1418-24.
4. Gonzalez-Quintero VH, Jimenez JJ, Jy W, Mauro LM, Hortman L, O'Sullivan MJ,
Ahn YS. Elevated plasma endothelial microparticles in preeclampsia. Am J Obstet
Gynecol 2003;189:589-93.
5. Bretelle F, Sabatier F, Desprez D, Camoin L, Grunebaum L, Combes V, D'Ercole C,
Dignat-George F. Circulating microparticles: a marker of procoagulant state in normal
pregnancy and pregnancy complicated by preeclampsia or intrauterine growth
restriction. Thromb Haemost 2003;89:486-92.
6. Harlow FH, Brown MA, Brighton TA, Smith SL, Trickett AE, Kwan YL, Davis GK.
Platelet activation in the hypertensive disorders of pregnancy. Am J Obstet Gynecol
2002;187:688-95.
7. Holthe MR, Lyberg T, Staff AC, Berge LN. Leukocyte-platelet interaction in
pregnancies complicated with preeclampsia. Platelets 2005;16:91-7.
8. VanWijk MJ, Nieuwland R, Boer K, van der Post JA, van Bavel E, Sturk A.
Microparticle subpopulations are increased in preeclampsia: possible involvement in
vascular dysfunction? Am J Obstet Gynecol 2002;187:450-6
9. Van der Zee PM, Biro E, Ko Y, de Winter RJ, Hack CE, Sturk A, Nieuwland R. P-
selectin- and CD63-exposing platelet microparticles reflect platelet activation in
peripheral arterial disease and myocardial infarction. Clin Chem 2006;52:657-64.
10. Ferreira AC, Peter AA, Mendez AJ, Jimenez JJ, Mauro LM, Chirinos JA, Ghany R,
Virani S, Garcia S, Horstman LL, Purow J, Jy W, Ahn YS, de ME. Postprandial
hypertriglyceridemia increases circulating levels of endothelial cell microparticles.
Circulation 2004;110:3599-3603.
11. Tushuizen ME, Nieuwland R, Scheffer PG, Sturk A, Heine RJ, Diamant M. Two
consecutive high-fat meals affect endothelial-dependent vasodilation, oxidative stress
and cellular microparticles in healthy men. J Thromb Haemost 2006;4:1003-10.
General discussion
189
9
12. Knight M, Redman CW, Linton EA, Sargent IL. Shedding of syncytiotrophoblast
microvilli into the maternal circulation in pre-eclamptic pregnancies. Br J Obstet
Gynaecol 1998;105:632-40.
13. Desprez D, Zobairi F, Aucouturier JS, Leymarie F, Freyssinet JM, Grunebaum L, de
Raucourt E. Evolution of circulating procoagulant microparticles during normal
pregnancy. Blood Coagul Fibrinolysis 2008;19:179-81.
14. Germain SJ, Sacks GP, Sooranna SR, Sargent IL, Redman CW. Systemic
inflammatory priming in normal pregnancy and preeclampsia: the role of circulating
syncytiotrophoblast microparticles. J Immunol 2007;178:5949-56.
15. Holthe MR, Staff AC, Berge LN, Lyberg T. Different levels of platelet activation in
preeclamptic, normotensive pregnant, and nonpregnant women. Am J Obstet Gynecol
2004;190:1128-34.
16. Konijnenberg A, Stokkers EW, van der Post JA, Schaap MC, Boer K, Bleker OP,
Sturk A. Extensive platelet activation in preeclampsia compared with normal
pregnancy: enhanced expression of cell adhesion molecules. Am J Obstet Gynecol.
1997;176:461-9.
17. Yoneyama Y, Suzuki S, Sawa R, Kiyokawa Y, Power GG, Araki T. Plasma adenosine
levels and P-selectin expression on platelets in preeclampsia. Obstet Gynecol
2001;97:366-70.
18. Hayashi M, Inoue T, Hoshimoto K, Negishi H, Ohkura T, Inaba N. Characterization
of five marker levels of the hemostatic system and endothelial status in normotensive
pregnancy and pre-eclampsia. Eur J Haematol 2002;69:297-302.
19. Bernal-Mizrachi L, Jy W, Jimenez JJ, Pastor J, Mauro LM, Horstman LL, de ME,
Ahn YS. High levels of circulating endothelial microparticles in patients with acute
coronary syndromes. Am Heart J 2003;145:962-70.
20. Brodsky SV, Zhang F, Nasjletti A, Goligorsky MS. Endothelium-derived
microparticles impair endothelial function in vitro. Am J Physiol Heart Circ Physiol
2004;286:H1910-5.
21. Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science
2005:308;1592-4.
22. VanWijk MJ, Svedas E, Boer K, Nieuwland R, Vanbavel E, Kublickiene KR. Isolated
microparticles, but not whole plasma, from women with preeclampsia impair
endothelium-dependent relaxation in isolated myometrial arteries from healthy
pregnant women. Am J Obstet Gynecol 2002;187:1686-93.
23. Martin S, Tesse A, Hugel B, Martinez MC, Morel O, Freyssinet JM,
Andriantsitohaina R. Shed membrane particles from T lymphocytes impair endothelial
function and regulate endothelial protein expression. Circulation 2004;109:1653-9.
Chapter 9
190
24. Cockell AP, Learmont JG, Smarason AK, Redman CW, Sargent IL, Poston L. Human
placental syncytiotrophoblast microvillous membranes impair maternal vascular
endothelial function. Br J Obstet Gynaecol 1997;104:235-40.
25. Tesse A, Meziani F, David E, Carusio N, Kremer H, Schneider F, Andriantsitohaina
R. Microparticles from preeclamptic women induce vascular hyporeactivity in vessels
from pregnant mice through an overproduction of Nitric Oxide. Am J Physiol Heart
Circ Physiol 2007;293:H520-5.
26. Donker RB, Asgeirsdóttir SA, Gerbens F, van Pampus MG, Kallenberg CG, te
Meerman GJ, Aarnoudse JG, Molema G. Plasma factors in severe early-onset
preeclampsia do not substantially alter endothelial gene expression in vitro. J Soc
Gynecol Investig 2005;12:98-106.
27. Faas MM, Donker RB, van Pampus MG, Huls AM, Salomons J, de Vos P, Aarnoudse
JG. Plasma of pregnant and preeclamptic women activates monocytes in vitro. Am J
Obstet Gynecol. 2008 (in press)
28. Scanu A, Molnarfi N, Brandt KJ, Gruaz L, Dayer JM, Burger D. Stimulated T cells
generate microparticles, which mimic cellular contact activation of human monocytes:
differential regulation of pro- and anti-inflammatory cytokine production by high-
density lipoproteins. J Leukoc Biol. 2008;83.
29. Hoegh AM, Tannetta D, Sargent I, Borup R, Nielsen FC, Redman C, Sorensen S,
Hviid TV. Effect of syncytiotrophoblast microvillous membrane treatment on gene
expression in human umbilical vein endothelial cells. BJOG 2006;113:1270-79.
30. Berckmans RJ, Nieuwland R, Kraan MC, Schaap MC, Pots D, Smeets TJ, Sturk A,
Tak PP. Synovial microparticles from arthritic patients modulate chemokine and
cytokine release by synoviocytes. Arthritis Res Ther 2005;7:R536-44.
31. Essayagh S, Xuereb JM, Terrisse AD, Tellier-Cirioni L, Pipy B, Sié P. Microparticles
from apoptotic monocytes induce transient platelet recruitment and tissue factor
expression by cultured human vascular endothelial cells via a redox-sensitive
mechanism. Thromb Haemost 2007;98:831-7.
32. Lurie S, Frenkel E, Tuvbin Y. Comparison of the differential distribution of
leukocytes in preeclampsia versus uncomplicated pregnancy. Gynecol Obstet Invest
1998;45:229–31.
33. Matsuo K, Ushioda N, Harman CR, Kimura T. Increased leukocyte distribution in the
pre-clinical stage of pre-eclampsia. Int J Gynaecol Obstet 2007;96:31-2.
34. Von Dadelszen P, Watson RW, Noorwali F, Marshall JC, Parodo J, Farine D, Lye SJ,
Ritchie JW, Rotstein OD. Maternal neutrophil apoptosis in normal pregnancy,
preeclampsia, and normotensive intrauterine growth restriction. Am J Obstet Gynecol.
1999;181:408-14.
General discussion
191
9
35. Wang Y, Adair CD, Coe L, Weeks JW, Lewis DF, Alexander JS. Activation of
endothelial cells in preeclampsia: increased neutrophil-endothelial adhesion correlates
with up-regulation of adhesion molecule P-selectin in human umbilical vein
endothelial cells isolated from preeclampsia. J Soc Gynecol Investig 1998;5:237-43.
36. Ballou, SP, Lozanski, G. Induction of inflammatory cytokine release from cultured
human monocytes by C-reactive protein. Cytokine 1992;4:361-8.
37. Cermak, J, Key, NS, Bach, RR, Balla J, Jacobs HS, Vercellotti GM. C-reactive protein
induces human peripheral blood monocytes to synthesize tissue factor. Blood
1993;82:513-20.
38. Vandendries ER, Furie BC, Furie B. Role of P-selectin and PSGL-1 in coagulation
and thrombosis. Thromb Haemost 2004;92:459-66.
39. Brill A, Dashevsky O, Rivo J, Gozal Y, Varon D. Platelet-derived microparticles
induce angiogenesis and stimulate post-ischemic revascularization. Cardiovasc Res.
2005;67:30-8
40. Kim HK, Song KS, Chung JH, Lee KR, Lee SN. Platelet microparticles induce
angiogenesis in vitro. Br J Haematol. 2004;124:376-84.
41. Mezentsev A, Merks RM, O'Riordan E, Chen J, Mendelev N, Goligorsky MS,
Brodsky SV. Endothelial microparticles affect angiogenesis in vitro: role of oxidative
stress. Am J Physiol Heart Circ Physiol. 2005;289:H1106-14.
42. Del Conde I, Shrimpton CN, Thiagarajan P, Lopez JA. Tissue-factor-bearing
microvesicles arise from lipid rafts and fuse with activated platelets to initiate
coagulation. Blood 2005;106:1604-11.
43. Mallat Z, Benamer H, Hugel B, Benessiano J, Steg PG, Freyssinet JM, Tedgui A.
Elevated levels of shed membrane microparticles with procoagulant potential in the
peripheral circulating blood of patients with acute coronary syndromes. Circulation
2000;101:841-3.
44. Ratajczak J, Wysoczynski M, Hayek F, Janowska-Wieczorek A, Ratajczak MZ.
Membrane-derived microvesicles: important and underappreciated mediators of cell-
to-cell communication. Leukemia 2006;20:1487-95.
45. Abid Hussein MN, Böing AN, Sturk A, Hau CM, Nieuwland R. Inhibition of
microparticle release triggers endothelial cell apoptosis and detachment. Thromb
Haemost 2007;98:1096-107.
46. Agouni A, Mostefai HA, Porro C, Carusio N, Favre J, Richard V, Henrion D,
Martínez MC, Andriantsitohaina R. Sonic hedgehog carried by microparticles corrects
endothelial injury through nitric oxide release. FASEB J 2007;21:2735-41.
47. Thery C, Zitvogel L, Amigorena S. Exosomes: composition, biogenesis and function.
Nat Rev Immunol 2002;2:569-79.
Chapter 9
192
48. Abusamra AJ, Zhong Z, Zheng X, Li M, Ichim TE, Chin JL, Min WP. Tumor
exosomes expressing Fas ligand mediate CD8+ T-cell apoptosis. Blood Cells Mol Dis
2005;35:169-173.
49. Kim SH, Bianco N, Menon R, Lechman ER, Shufesky WJ, Morelli AE, Robbins PD.
Exosomes derived from genetically modified DC expressing FasL are anti-
inflammatory and immunosuppressive. Mol Ther 2006;13:289-300.
50. Taylor DD, Akyol S, Gercel-Taylor C. Pregnancy-associated exosomes and their
modulation of T cell signaling. J Immunol 2006;176:1534-42.
Chapter 10
Summary
Summary
195
10
Chapter 1. Preeclampsia is a pregnancy specific syndrome defined by hypertension and
proteinuria. It is a major cause of maternal and fetal morbidity and mortality. Abnormal
placentation early in pregnancy underlies the development of a systemic inflammatory
response in the second half of pregnancy. The exact etiology of preeclampsia is still
unclear, although the placenta plays a central role. In addition, also endothelial dysfunction,
exaggerated inflammation and altered haemostasis are involved. Microparticles (MP), small
cell-derived vesicles that are released from cells upon activation or apoptosis, have been
suggested to affect the before mentioned processes. In this thesis, changes in MP
concentration in normotensive pregnancy and their role in the development or aggravation
of preeclampsia were investigated.
Chapter 2. MP are released from cells by budding of the plasma membrane and range in
size between 0.1-1.0 µm. MP in blood are predominantly of platelet origin. MP
concentrations are changed in many autoimmune, cardiovascular and thromboembolic
diseases, as well as in inflammatory and infectious disorders. Exosomes are even smaller
vesicles, 20-90 nm, which are released into the blood when endosomes containing
intraluminal vesicles fuse with the plasma membrane. Exosomes modulate the immune
response, but are also involved in haemostasis and intercellular communication. MP and
exosomes may play a role in recurrent miscarriage, premature delivery and preeclampsia,
although our knowledge of their precise contribution to the pathophysiology of these
diseases is still incomplete.
Chapter 3. Knowledge about changes in circulating MP concentrations during
normotensive pregnancy and preeclampsia was lacking. Therefore, numbers and cellular
origin of circulating MP were determined longitudinally during the course of normotensive
pregnancy and preeclampsia. Furthermore, their relation to the severity of preeclampsia was
investigated. During normotensive pregnancy, numbers of MP initially decreased and
subsequently normalized. In preeclampsia, the number of circulating MP and platelet-
derived MP (PMP) were found to be reduced, whereas monocyte-derived MP and
erythrocyte-derived MP were elevated. There were no correlations between the
concentration of MP and the severity of preeclampsia, suggesting that their numbers are not
necessarily associated with their vascular effects.
Chapter 4. Platelet activation in preeclampsia is reflected by elevated levels of platelets
exposing P-selectin and in plasma a non-cell bound (“soluble”) form of this P-selectin is
present. Elevated levels of plasma P-selectin have been reported in preeclampsia. This non-
cell bound P-selectin may be MP associated. We investigated to which extent plasma P-
selectin is MP associated and whether the fraction of P-selectin-exposing MP is elevated in
Chapter 10
196
preeclamptic patients. We showed that a minor fraction of plasma P-selectin was indeed
associated with PMP. This fraction was increased in preeclampsia compared to
normotensive pregnant and non-pregnant women. Because MP-associated P-selectin was
exclusively associated with PMP, this fraction reflects platelet activation in preeclampsia.
Chapter 5. The soluble VEGF receptor, Flt-1 is secreted by trophoblast cells and elevated
concentrations occur in preeclampsia. By binding VEGF, Flt-1 deprives the endothelium of
this mediator of angiogenesis and regulator of vascular tone and thus blood pressure. MP
from preeclamptic patients affect vascular behavior and may also expose Flt-1. We
determined whether non-cell bound Flt-1 is associated with MP from preeclamptic patients
and whether levels of Flt-1-exposing MP are increased in preeclampsia. Furthermore, we
established the cellular origin of Flt-1-exposing MP and investigated whether full-length or
truncated Flt-1 is associated with MP. Non-cell bound Flt-1 and the number of MP
exposing Flt-1 were shown to be elevated in preeclampsia compared to controls. Flt-1-
exposing MP originated predominantly from platelets and trophoblast cells. Full-length Flt-
1 (150 kda) was associated with MP and absent in MP-free plasma samples. The biological
activities of these coexisting forms of Flt-1 remain to be established. The presence of Flt-1
on the membrane of a MP might alter its function, particularly if it acts in synergism with
other vasoactive molecules expressed alongside it on the MP.
Chapter 6. Inflammation and endothelial dysfunction are prominent features of
preeclampsia. The activated endothelium plays a pivotal role by the production of
inflammatory mediators. The factors initiating this inflammatory response, however, are
still unknown. MP may underlie this response in preeclampsia because they are known to
induce the expression and production of pro-inflammatory cytokines by e.g. endothelial
cells and induce endothelial dysfunction. We investigated the RNA expression of
inflammation-related genes in cultured endothelial cells after incubation with MP from
preeclamptic patients, normotensive pregnant women and non-pregnant women. The RNA
expression of such genes was unaffected by any of these MP fractions. Thus, it seems
unlikely that circulating MP isolated from plasma from preeclamptic patients cause
endothelial dysfunction directly by affecting the expression of inflammation-related genes.
Chapter 7. Preeclampsia shows characteristics of an inflammatory disease including
leukocyte activation, reflected by elevated numbers of circulating leukocytes exposing
adhesion molecules, and aberrant levels of soluble activation markers. Analyses of
leukocyte-derived MP and mRNA expression of inflammation-related genes in maternal
leukocytes may establish which subgroups of leukocytes are activated and contribute to the
development of preeclampsia. We confirmed the occurrence of activation of leukocytes and
Summary
197
10
of particular leukocyte subgroups in preeclampsia, and to a lesser extent in normotensive
pregnancy. Although an overall pro-inflammatory gene expression profile could not be
detected within the total population of leukocytes, differences in mRNA of some genes
were observed. The increased levels of circulating MP from monocytes, granulocytes and
Tsuppressor-cells reflected activation of their parental cells in preeclampsia.
Chapter 8. An important inflammatory mechanism is complement activation. The role of
the complement system in preeclampsia is unclear because both elevated and comparable
levels of complement factors and complement activation molecules have been reported in
preeclamptic patients compared to normotensive controls. We investigated whether
complement activation on the surface of circulating MP is increased in plasma of
preeclamptic patients versus pregnant controls. Although numbers of CRP-exposing MP
were significantly increased in preeclampsia, this increase was not associated with elevated
complement activation.
Samenvatting
Samenvatting
201
10
Hoofdstuk 1. Preëclampsie is een syndroom dat uitsluitend voorkomt tijdens de
zwangerschap en wordt gekenmerkt door een hoge bloeddruk en eiwitverlies in de urine.
Het is een belangrijke oorzaak van maternale en foetale morbiditeit en mortaliteit. Een
gestoorde ontwikkeling van de placenta vroeg in de zwangerschap lijkt ten grondslag te
liggen aan de klinische symptomen die zichtbaar worden tijdens de tweede helft van de
zwangerschap. De exacte etiologie van preëclampsie is nog onduidelijk, maar het niet goed
functioneren van maternale endotheelcellen, een overmatige ontstekingsrespons en een
veranderende hemostase zijn van belang bij de pathofysiologie van dit syndroom.
Micropartikels zijn kleine blaasjes, welke variëren in grootte tussen 0.1-1.0 µm en met
name worden afgesnoerd door geactiveerde cellen en door cellen die geprogrammeerde
celdood ondergaan. Omdat micropartikels de bovengenoemde processen, die betrokken zijn
bij de pathofysiologie van preëclampsie, kunnen beïnvloeden, onderzochten wij in dit
proefschrift de veranderingen van concentraties en eigenschappen van micropartikels in
ongecompliceerde zwangerschappen en in preëclampsie.
Hoofdstuk 2. In dit hoofdstuk wordt een overzicht gegeven van de huidige kennis over
micropartikels in gezonde en gecompliceerde zwangerschappen. Micropartikels worden
afgesnoerd van het oppervlak van circulerende cellen in het bloed en van endotheelcellen.
Micropartikels in het bloed zijn met name afkomstig van bloedplaatjes. Het is bekend dat
de concentratie van micropartikels afwijkend is bij verschillende auto-immuunziekten,
cardiovasculaire aandoeningen en tromboembolische processen, evenals in inflammatoire
ziekten en tijdens sepsis. Exosomen zijn nog kleinere blaasjes, variërend in grootte tussen
20-90 nm. Exosomen komen in het bloed als de membranen van intracellulaire ”multi-
vesicular bodies” fuseren met de plasma membraan waardoor er intraluminale blaasjes vrij
komen. Exosomen beïnvloeden niet alleen de immuunrespons, maar zijn ook betrokken bij
hemostase en intercellulaire communicatie. Micropartikels en exosomen spelen mogelijk
een rol bij herhaalde miskramen, partus prematurus en preëclampsie. Echter, de kennis over
de exacte bijdragen van micropartikels en exosomen aan deze ziekten is beperkt.
Hoofdstuk 3. Het is onbekend hoe de concentratie of de herkomst van circulerende
micropartikels is veranderd bij preëclampsie in vergelijking met ongecompliceerde
zwangerschappen. Daarom zijn de aantallen en de cellulaire herkomst van circulerende
micropartikels longitudinaal gemeten in bloedmonsters van zowel normotensieve zwangere
vrouwen als van preëclamptische patiënten. Tevens is onderzocht of er een verband bestaat
tussen aantallen micropartikels en de ernst van preëclampsie. In het begin van een
normotensieve zwangerschap is de concentratie micropartikels afgenomen, daarna vindt er
een geleidelijke stijging plaats. Bij preëclampsie worden verlaagde aantallen micropartikels
en van plaatjes afkomstige micropartikels gevonden, terwijl micropartikels afkomstig van
Chapter 10
202
monocyten en erythrocyten juist zijn verhoogd. Er zijn geen correlaties gevonden tussen de
micropartikels concentraties en de ernst van preëclampsie, hetgeen suggereert dat de
concentratie micropartikels niet noodzakelijkerwijs is geassocieerd met de ernst van
klinische verschijnselen.
Hoofdstuk 4. Activatie van bloedplaatjes bij preëclampsie kan worden afgemeten aan
verhoogde aantallen bloedplaatjes die P-selectine exposeren. In plasma is een circulerende
niet cel-gebonden vorm van P-selectine aanwezig. Verhoogde concentraties van deze vorm
van P-selectine zijn aangetoond in preëclampsie. Wij hebben onderzocht in hoeverre dit
circulerende P-selectin geassocieerd is met micropartikels en of het aantal micropartikels
dat P-selectine exposeert, is toegenomen tijdens preëclampsie. Wij hebben aangetoond dat
een klein deel (3-5%) van het plasma P-selectine inderdaad gebonden is aan micropartikels
die afkomstig zijn van bloedplaatjes. In preëclampsie bleek dit micropartikel-gebonden P-
selectine te zijn toegenomen ten opzichte van normotensive zwangere en niet-zwangere
vrouwen. Omdat het aan micropartikel-gebonden P-selectine uitsluitend aantoonbaar was
op micropartikels afkomstig van plaatjes is dit dus een maat voor de mate van activatie van
bloedplaatjes tijdens preëclampsie.
Hoofdstuk 5. De circulerende VEGF (vascular endothelial growth factor) receptor, Flt-1,
wordt geproduceerd door trofoblast cellen en het is bekend dat verhoogde concentraties zijn
gevonden in plasma van vrouwen met preëclampsie. Door VEGF te binden, voorkomt sFlt-
1 dat het endotheel in contact komt met deze belangrijke angiogenese-inducerende factor en
regulator van de bloeddruk. Omdat bekend is dat micropartikels van preëclamptische
patiënten de functionaliteit van bloedvaten kunnen beïnvloeden, hebben wij onderzocht of
micropartikels Flt-1 exposeren. Wij hebben gemeten of het niet cel-gebonden Flt-1
geassocieerd is met circulerende micropartikels van preëclamptische patiënten, en of het
aantal Flt-1-exposerende micropartikels is toegenomen in preëclampsie. Bovendien hebben
we de herkomst van Flt-1-exposerende micropartikels vastgesteld en onderzocht of het
intacte (“full-length”) Flt-1 of een verkorte vorm van Flt-1 op micropartikels aanwezig is.
De concentratie van circulerend Flt-1 en van Flt-1-exposerende micropartikels was
verhoogd in preëclampsie ten opzichte van de controle groepen. Flt-1-exposerende
micropartikels waren voornamelijk afkomstig van bloedplaatjes en trofoblast cellen. Het
intacte Flt-1 (150 kDa) kon worden aangetoond op de micropartikels en niet in
micropartikel-vrij plasma. De biologische activiteit van deze naast elkaar bestaande vormen
van Flt-1 moet nog worden vastgesteld. De aanwezigheid van Flt-1 op de membraan van
micropartikels zou het effect van micropartikels op endotheelcellen kunnen beïnvloeden.
Samenvatting
203
10
Chapter 6. Onsteking en het niet goed functioneren van het endotheel zijn belangrijke
processen in het ontstaan van preëclampsie. Het geactiveerde endotheel speelt een
belangrijke rol door eiwitten te produceren die betrokken zijn bij de ontstekingsrespons. De
factoren die deze ontstekingsrespons kunnen initiëren zijn slechts ten dele bekend.
Micropartikels zouden ook betrokken kunnen zijn bij deze respons, omdat micropartikels
de aanmaak van ontstekingsmediatoren door endotheelcellen kunnen bevorderen en tevens
“endotheeldisfunctie” kunnen induceren. Wij onderzochten de RNA expressie van genen
die coderen voor ontstekingsmediatoren in gekweekte endotheelcellen na incubatie met
micropartikels van preëclamptische patiënten, normotensieve zwangeren en niet-zwangere
vrouwen. De RNA expressie van deze genen werd echter niet beïnvloed door de
toegevoegde micropartikels. Het lijkt dus onwaarschijnlijk dat circulerende micropartikels,
geïsoleerd uit plasma van preëclamptische patiënten, endotheeldisfunctie veroorzaken door
rechtstreeks de expressie van genen die coderen voor ontstekingsmediatoren, te stimuleren.
Hoofdstuk 7. Preëclampsie heeft kenmerken van een ontstekingsrespons, welke onder
andere wordt gekenmerkt door activatie van leukocyten. Dit blijkt bijvoorbeeld uit de
verhoogde aantallen circulerende leukocyten met adhesiemoleculen op het celoppervlak, en
uit de veranderde concentraties activatiemerkers die door leukocyten worden aangemaakt in
vergelijking met de normale zwangerschap. Naast de analyse van micropartikels, afkomstig
van leukocyten, kan de mRNA expressie van genen die coderen voor
ontstekingsbevorderende mediatoren in maternale leukocyten een aanwijzing zijn welke
subgroepen van leukocyten bijdragen aan het ontstaan van preëclampsie. Wij hebben
bevestigd dat leukocyten en diverse subgroepen geactiveerd zijn in preëclampsie en in
mindere mate in normotensieve zwangerschappen. Alhoewel in de totale leukocyten
populatie geen eenduidig ontstekingsbevorderend genexpressie profiel kon worden
vastgesteld, bleken wel verschillen aantoonbaar in de expressie van een beperkt aantal
genen. De verhoogde concentratie circulerende micropartikels afkomstig van monocyten,
granulocyten en Tsuppressor-cellen weerspiegelen de activatie van deze celtypen in
preëclampsie.
Hoofdstuk 8. Complementactivatie is een belangrijk onderdeel van de ontstekingsrespons.
De rol van dit systeem in preëclampsie is onduidelijk, omdat zowel verhoogde als
onveranderende concentraties van complementfactoren en activatoren zijn aangetoond in
preëclamptische patiënten ten opzichte van normotensieve controles. Wij hebben
onderzocht of merkers van complementactivatie in verhoogde mate aanwezig zijn op het
oppervlak van circulerende micropartikels bij preëclamptische patiënten versus zwangere
controles. Alhoewel de aantallen van CRP (C-reactive protein)-exposerende micropartikels
Chapter 10
204
significant waren verhoogd in preëclampsie, bleek deze toename niet geassocieerd te zijn
met complementactivatie.
Hoofdstuk 9. Het is duidelijk geworden dat naast de totale concentratie ook bepaalde
eigenschappen van circulerende micropartikels belangrijk zijn. Het biologische effect van
veranderingen hierin is echter niet bekend. Waarschijnlijk weerspiegelen micropartikels
veranderingen in cellulaire processen die gemeten kunnen worden in het bloed van
patiënten met preëclampsie, zoals hemolyse, bloedplaatjesactivatie en deling van
trofoblastcellen door placentaire groei. De concentratie micropartikels wordt mede bepaald
door de heterogeniciteit van preëclampsie, door de manier van isoleren en analyseren van
micropartikels en door de leeftijd en het dieet van de moeder. Mogelijk worden
micropartikels niet continu in het bloed afgescheiden, waardoor het moment van afname
een rol kan spelen bij de gemeten concentratie micropartikels. Ondanks dat micropartikels
een rol lijken te spelen bij endotheeldisfunctie, inflammatie, hemostase en angiogenese,
heeft het analyseren van micropartikels vooralsnog geen klinische toepassing. In de
toekomst moet worden onderzocht waarom cellen micropartikels afsnoeren en niet alleen
wat het effect is van de afgesnoerde micropartikels. Verder is de rol van exosomen in
preëclampsie nog niet onderzocht.
Bibliography
205
10
Co-authors
Bibliography
Dankwoord
Curriculum vitae
Co-authors
207
CO-AUTHORS
ACADEMIC MEDICAL CE�TER, AMSTERDAM, THE �ETHERLA�DS
Department of Obstetrics and Gynaecology
Dr. K. Boer
Drs. M. Buimer
Drs. J. Jebbink
Prof. dr. J.A.M. van der Post
Department of Clinical Chemistry
Drs. É. Biró
A.N. Böing
C.M. Hau
Dr. R. Nieuwland
M.C.L. Schaap
Prof. dr. A. Sturk
Department of Medical Physics
Prof. dr. E. van Bavel
U�IVERSITY MEDICAL CE�TER, FREE U�IVERSITY, AMSTERDAM, THE
�ETHERLA�DS
Department of Endocrinology
Dr. M. Diamant
Department of Immunology (pathophysiology of aspecific inflammation)
Prof. dr. C.E. Hack (Crucell Holland B.V., Leiden)
208
U�IVERSITY MEDICAL CE�TER GRO�I�GE�, GRO�I�GE�, THE
�ETHERLA�DS
Department of Pathology and Medical Biology
Dr. M.M. Faas
U�IVERSITY MEDICAL CE�TER LEIDE�, LEIDE�, THE �ETHERLA�DS
Department of Hematology (experimental molecular medicine)
Prof. dr. P.H. Reitsma
IMPERIAL COLLEGE SCHOOL OF MEDICI�E, CHELSEA A�D
WESTMI�STER HOSPITAL, LO�DO�, U�ITED KI�GDOM
Department of Maternal Fetal Medicine
Dr. S.R. Sooranna
LUDWIG-MAXIMILIA�S U�IVERSITY, MU�ICH, GERMA�Y
Department of Obstetrics and Gynaecology
Dr. K. Friese
Dr. B. Toth
U�IVERSITY OF OXFORD, THE WOME�'S CE�TRE, JOH� RADCLIFFE
HOSPITAL, OXFORD, U�ITED KI�GDOM
�uffield Department of Obstetrics and Gynaecology
Prof. dr. I.L. Sargent
Bibliography
209
BIBLIOGRAPHY
Full Articles (not published in this thesis)
• Lok CAR, Dijkema MWJ. Psychologische oorlogsvoering. Nieuwsbrief van de
Nederlandse Vereniging voor Medische Polemologie. Januari 1997.
• Brouwer CN, Lok CAR, Wolffers I, Sebagalls S. Psychosocial and economic aspects
of HIV/AIDS and counselling of caretakers of HIV-infected children in Uganda.
AIDS Care 2000;12:535-40.
• Papatsonis DN, Lok CAR, Bos JM, van Geijn HP, Dekker GA. Calcium channel
blockers in obstetrics: the management of preterm labor and hypertension in
pregnancy. Eur J Obstet Gyn Reprod Biol 2001;97:122-140.
• Lok CAR. Bleeding in early pregnancy. In: Evidence-based obstetrics, Chapter 6.
Eds: D.K.James et al. Saunders, London, 2003.
• Lok CAR, Houwen van der C, Kate-Booij ten MJ, Eijkeren van MA, Ansink AC.
Pregnancy after EMACO for gestational trophoblastic disease; a report from the
Netherlands. Br J Obstet Gynaecol 2003;110:560-6.
• Lok CAR, Böing A, van Bavel E. Kleine deeltjes met grote gevolgen. Wat is de rol
van micropartikels bij het veroorzaken van endotheelschade in preeclampsie? Analyse
2003;9:266-270.
• Lok CAR, Kate-Booij ten MJ, Ansink AC. Multichemotherapie voor hoog-risico
trofoblast tumoren; een follow-up studie. Ned Tijdschr Obstet Gyn 2004;117(5).
• Houwen, vd C, Rietbroek RC, ten Kate-Booij MJ, Lok CAR, Lammes FB, Ansink,
AC. Feasibility of central coordinated EMA/CO for gestational trophoblastic disease
in The Netherlands. Br J Obstet Gynaecol 2004;111:143-7.
• Lok CAR, Zürcher AF, Velden vd J. A case of a hydatidiform mole in a 56-year-old
woman. Int J Gynecol cancer 2005;14:1-5.
210
• Lok CAR, Reekers JA, Westermann AM, Van der Velden J. Embolization for
hemorrhage of liver metastases from choriocarcinoma. Gynecol Oncol 2005;98:506-9.
• Lok CAR, Ansink AC, Grootfaam D, van der Velden J, Verheijen RH, ten Kate-Booij
MJ. Treatment and prognosis of post term choriocarcinoma in The Netherlands.
Gynecol Oncol 2006;103:698-702.
• Papatsonis DNM, Bos JM, van Geijn HP, Lok CAR, Dekker GA. Nifedipine
pharmacokinetics and plasma levels in the management of preterm labor. Am J Ther
2007;14:346-50.
• Van Oppenraaij RHF, Goddijn M, Lok CAR, Exalto N. De jonge zwangerschap:
revisie van de Nederlandse benamingen voor klinische en echoscopische bevindingen.
Ned Tijdschr v Gen 2008;152:20-4.
• Ten Kate-Booij MJ, Lok CAR, Verheijen RH, Massuger LFAG, van Trommel NE.
Behandeling van persisterende trofoblastziekten anno 2007. Ned Tijdschr v Gen 2008
(in press).
Dankwoord
211
DA�KWOORD
Ik had al lang geleden bedacht dat mijn dankwoord uit het woord “Bedankt” zou bestaan. Kort en krachtig. Ik zou dan wel veel mensen te kort doen. Want promoveren kun je niet alleen! Daarom wil ik de volgende mensen heel hartelijk bedanken: Allereerst wil ik alle gezonde zwangere vrouwen en preëclamptische patiënten bedanken die zonder eigenbelang hun bloed hebben afgestaan in het kader van de wetenschap. Sommigen zelfs tot 7 keer aan toe! Zonder deze patiënten was het onderzoek onmogelijk geweest. Mijn promotoren Joris van der Post & Guus Sturk. Beste Joris, altijd druk en rennen. Toch wist je vaak tijd voor me vrij te maken. Als wetenschapper maar zeker ook als clinicus heb ik veel van je geleerd. Ik vind het erg leuk dat je inmiddels professor bent geworden en daarom mijn promotor kunt zijn. Beste Guus, ik ben jaloers op jouw scherpe geest. Na een blik op wat uitslagen, stelde jij de vragen waar ik natuurlijk weer geen antwoord op had. Het was altijd goed om bij je binnen te lopen voor onderzoeksvragen, maar je had ook tijd voor persoonlijke zaken, zoals een kraambezoek. Mijn co-promotoren Rienk �ieuwland & Kees Boer. Rienk, het is heel simpel, zonder jou had dit boekje er niet gelegen. Heel veel dank voor al die uren praten over resultaten, bedenken van experimenten en schrijven van artikelen. Ik vond het altijd erg gezellig bij je op de kamer met kopjes thee en kletsen over kinderen en vogels. Ik prijs me gelukkig dat jij mijn co-promotor was. Kees, jouw enthousiasme is volgens mij oneindig. Als agnio ben ik bij jou met onderzoek begonnen. Ik vind het leuk dat we dit wetenschappelijke project nu ook met elkaar afsluiten. Jouw creativiteit heeft ook iets heel moois van dit boekje gemaakt. Ed van Bavel. Beste Ed, jij bent steeds betrokken geweest bij het onderzoek al lag het meer op het terrein van de klinische chemie dan de medische fysica. Je was altijd weer in voor een nieuw idee en kwam ook enthousiast weer naar iedere vergadering. Ik hoop dat er een opvolger komt voor mij die weer meer functioneel onderzoek met jou gaat doen want er zijn nog een hoop leuke ideeën.
212
Mijn kamergenoten Liesbeth van Leeuwen & Petra Biewenga. Lieve Liesbeth, wat hebben we het gezellig gehad. Veel gelachen, soms ook wat tranen. Ik kon me geen betere kamergenoot wensen. Dat zulke tegenpolen het zo goed kunnen hebben op twee vierkante meter. Ik ben blij dat jij mijn paranimf wilt zijn. Lieve Petra. Jij kwam iets later op onze kamer en dat maakte het compleet. Moet soms wel moeilijk zijn geweest om zo in het midden te zitten tussen twee uitersten. Dank voor alle gezelligheid. Medewerkers van het LEKC: Anita, Chi, Yung, Dennis, Marianne, Rene, Frans, Mohammed, Éva, Marc & Maarten. Beste Anita, je hebt me veel geleerd over allemaal lastige technieken. We hebben veel gekletst over leuke dingen en over experimenten. Ik mocht je altijd weer lastig vallen met vragen via de mail. Ik vind het fantastisch dat jij ook gaat promoveren. Maar eerst nog even bevallen. Wel leuk dat ik jouw vragen daarover eens kon beantwoorden. Beste Chi, zonder jouw supersnelle pipetteren, zat ik nu nog buizen te facsen. Jij hebt enorm veel werk verzet en iedere keer met een lach en zonder mopperen. Heb ik nu mijn bolletje verdiend? Alle anderen van het lab, bedankt voor de ontzettend leuke en leerzame tijd die ik bij jullie op F1 heb gehad. Ik wist niet dat laboranten zo gezellig konden zijn! Mijn opleiders Otto Bleker, Maas-Jan Heineman & Mark-Hans Emanuel. Otto, jij hebt het mogelijk gemaakt dat ik in deze constructie als opleidingsassistent kon promoveren. Ook al wist je niet altijd waar het onderzoek over ging, als ik met uitslagen binnen liep, was je altijd enthousiast. Maas-Jan, ik vertrok net naar de periferie toen jij de plaats van Otto innam. Tijdens het schrijven van sommige hoofdstukken kwam ik er achter dat mijn onderzoek raakvlakken heeft met jouw onderzoek in Groningen. Daarom is het leuk dat je in mijn promotiecommissie zit. Mark-Hans, ik hoop dat ik een stukje van jouw enthousiasme en onderzoekergeest kan overnemen. Ik ben blij dat ik het laatste deel van mijn opleiding in het Spaarne kan doen en ik vind het leuk dat je deel hebt uitgemaakt van mijn promotiecommissie en je daarom door wat artikelen hebt heen geworsteld die niet helemaal op jouw terrein lagen. Mede-onderzoekers: Stef, Pieternel, Jan-Willem, Madelon, Henrike, Wouter, andere Wouter, Sebastiaan, Saskia, Etelka, Karlijn, Jiska, Wessel, Janne-Meije, Henrike, Madelon, Judith, Moira, Marianne, Marjolein en “last but not least” Maarten. Bedankt voor de gezelligheid en het binnenlopen bij elkaar. De
Dankwoord
213
maandagmiddaglunch was een heerlijke onderbreking van de dag en een goed moment om alle nieuwtjes te horen. Wouter, nu hebben we samen 3 boekjes. Maarten, we zaten deels in dezelfde richting met ons onderzoek, wat tot veel leuke discussies heeft geleid. Of kwam je toch alleen maar voor de dropjes naar H4-240? We promoveren nu ook nog vlak na elkaar. Succes volgende week! Jiska en Karlijn heel veel dank voor de hulp met het verzamelen van patiënten materiaal. De arts-assistenten & stafleden uit het AMC en Spaarne Ziekenhuis. Bedankt voor jullie interesse en bijdrage aan mijn opleiding en onderzoek. Ook hartelijk dank aan de arts-assistenten die bloed hebben afgestaan als gezonde controles. De verloskundigen & verpleegkundigen die mij attendeerden op mogelijke patiënten voor mijn onderzoek en die vele navelstrengen hebben verzameld voor mij (inclusief Henna). Hartelijk dank daarvoor. Secretaresses & poli-assistenten. Hartelijk dank voor alle logistieke onder-steuning. Mijn beste maatje Manje Dijkema. Lieve Manje, al in het eerste jaar van de studie hebben we elkaar ontmoet en we hebben daarna veel samen beleefd. Je was zo’n goede ceremoniemeester op mijn bruiloft dat je nu mijn paranimf “moet” zijn. Ik geniet ervan om met jou muziek te maken en te luisteren naar je prachtige verhalen. Maar ik geniet vooral van je omdat jij jij bent. Ik ben dankbaar dat ik zo’n goede vriend mag hebben. Goede vrienden zijn onbetaalbaar. Corine & Harry, Eveline, Ciska & Albert, Judy & Mike, �ashwan & Poupak, Susan & Eric, Tjalling & Vlada. Bedankt voor jullie interesse en voor alle gezelligheid. Ik hoop op nog vele leuke momenten met elkaar! Mijn ouders. Lieve pap & mam, zonder jullie was het een stuk moeilijker geweest om dit boekje te maken. Dat de inhoud van dit boekje er zo mooi uitziet heb ik helemaal aan jou te danken, pap. Er zijn heel wat uurtjes in gaan zitten, terwijl mam op Myrthe & Dafne paste. Maar ik ben er wel heel erg trots op! En ik denk jij eigenlijk ook wel. Maar ook bedankt voor jullie steun en interesse tijdens mijn hele studie en opleiding. Ik had eigenlijk het Sinterklaasgedicht over micropartikels als bijlage willen toevoegen, maar ik houd het toch maar voor mezelf.
214
Mijn (schoon)familie. Bedankt voor jullie interesse, het veelvuldig oppassen op mijn dochters en het zorgen voor ontspannende (soms muzikale) momenten tussen opleiding en promotie door. Mijn lieve en zorgzame Maarten, ik zou jou en de meiden eigenlijk als eerste moeten noemen want jullie zijn het allerbelangrijkste in mijn leven. Als ik ergens steun voor al mijn activiteiten kan vinden, is het wel bij jou. Nooit een onvertogen woord als ik weer eens laat thuis kom, weg moet of uren achter de computer zit. Samen chronisch vermoeid zijn door de nachtvoedingen en veel te lang opblijven om films te kijken nadat jij lekker gekookt hebt. Ik hoop nog veel samen met jou te mogen reizen en leuke dingen te doen, maar ik hoop vooral samen met jou en onze dochters oud te mogen worden. Mijn prachtige dochters, Myrthe & Dafne, jullie hebben onbewust een groot deel van het schrijven van dit proefschrift meegemaakt. Want met Sesamstraat aan de ene kant van het scherm en mijn Word document aan de andere kant, was iedereen tevreden. Een 20-inch breedbeeld computerscherm is onmisbaar voor iedere promoverende ouder met jonge kinderen.
Christianne
Curriculum Vitae
215
CURRICULUM VITAE
De auteur van dit proefschrift werd op 5 oktober 1973 in de (Haarlemmermeer)polder als
tweede dochter van Hans & Maaike Lok op de wereld gezet, met verloskundige begeleiding
van haar tante. Zij bracht haar jeugd door in Hoofddorp en bezocht de Jan van Nassau
school, waar zij in een klas zat met slechts vier andere meisjes. Inmiddels heeft zij bij twee
van hen de bevalling begeleid. De lagere schoolperiode werd afgerond op de Montessori
school in Hoofddorp. In 1992 behaalde zij haar VWO diploma aan het Atheneum “Adriaen
Pauw” in Heemstede.
Hierna studeerde zij Geneeskunde aan de Vrije Universiteit in Amsterdam. Tijdens
haar studie deed zij wetenschappelijk onderzoek bij Prof. dr. H.P. van Geijn en Dr. G.A.
Dekker op de afdeling Verloskunde van het Universitair Medisch Centrum van de Vrije
Universiteit (UMC-VU). Dit onderzoek betrof onder andere de farmacokinetiek van
nifedipine tijdens de behandeling van premature weeënactiviteit. Hierna heeft zij in
Oeganda meegewerkt aan onderzoek naar de verticale transmissie van HIV bij kinderen.
Extra co-schappen werden gevolgd op de afdelingen Neurochirurgie, Radiologie en
Cosmetische Chirurgie van het UMC-VU en de afdeling Internal Medicine van het Yeovil
District Hospital in Engeland.
Naast haar studie werkte zij als verzorgende in de thuiszorg en in een bejaardentehuis,
en als biometriste op de afdeling Verloskunde van het UMC-VU. In 1999 rondde zij haar
artsexamen cum laude af. Na het artsexamen werkte zij als arts-assistent niet in opleiding
op de afdelingen Verloskunde & Gynaecologie van het Kennemer Gasthuis in Haarlem, het
Academisch Medisch Centrum (AMC) in Amsterdam en het Medisch Centrum Alkmaar. In
het AMC begon zij onder leiding van Dr. A.C. Ansink met onderzoek naar verschillende
facetten van hoog-risico Trofoblast Ziekten.
In 2001 begon zij met de opleiding Verloskunde & Gynaecologie in het AMC met als
opleider Prof. dr. O.P. Bleker. Tussen januari 2003 en december 2004 werd de opleiding
tijdelijk onderbroken om basaal wetenschappelijk onderzoek te kunnen uitvoeren. Dit
onderzoek was een samenwerking tussen de afdelingen Verloskunde, Klinische Chemie en
Medische Fysica van het AMC. Dit proefschrift is het resultaat van deze samenwerking. In
april 2006 werd het AMC verlaten om in het Spaarne Ziekenhuis in Hoofddorp het laatste
deel van de specialistenopleiding te beginnen met Dr. M.H. Emanuel als opleider. In januari
2009 hoopt zij daar de opleiding af te ronden. Zij is getrouwd met Maarten Jansen en zij
hebben twee prachtige dochters: Myrthe (twee jaar oud) en Dafne (half jaar oud).