The EMBO Journal vol.13 no.23 pp.5712-5720, 1994

Translational control by cytoplasmic polyadenylationof c-mos mRNA is necessary for oocyte maturationin the mouse

Fatima Gebauer, Wenhao Xul,Geoffrey M.Cooper1 and Joel D.Richter2Worcester Foundation for Experimental Biology, 222 Maple Avenue,Shrewsbury MA 01545 and lDana Farber Cancer Institute, Division ofMolecular Genetics, Harvard Medical School, Department ofPathology, 44 Binney Street, Room B452, Boston MA 02115, USA

2Corresponding author

Communicated by G.Thomas

The c-mos proto-oncogene product is a key element inthe cascade of events leading to meiotic maturation ofvertebrate oocytes. We have investigated the role ofcytoplasmic polyadenylation in the translational con-trol of mouse c-mos mRNA and its contribution tomeiosis. Using an RNase protection assay we show thatoptimal cytoplasmic polyadenylation of c-mos mRNArequires three cis elements in the 3' UTR: the polyaden-ylation hexanucleotide AAUAAA and two U-rich cyto-plasmic polyadenylation elements (CPEs) located 4 and51 nucleotides upstream of the hexanucleotide. Whenfused to CAT coding sequences, the wild-type 3' UTRof c-mos mRNA, but not a 3' UTR containing mutationsin both CPEs, confers translational recruitment duringmaturation. This recruitment coincides with maximumpolyadenylation. To assess whether c-mos mRNA polya-denylation is necessary for maturation of mouseoocytes, we have ablated endogenous c-mos mRNA byinjecting an antisense oligonucleotide, which results ina failure to progress to meiosis II after emission of thefirst polar body. Such antisense oligonucleotide-injectedoocytes could be efficiently rescued by co-injection ofa c-mos mRNA carrying a wild-type 3' UTR. However,co-injection of a c-mos mRNA lacking functional CPEssubstantially lowered the rescue activity. These resultsdemonstrate that translational control of c-mos mRNAby cytoplasmic polyadenylation is necessary for normaldevelopment.Key words: c-mos/cytoplasmic polyadenylation/mouse/oocyte maturation

IntroductionThe c-mos proto-oncogene, the cellular counterpart of thetransforming gene found in Moloney murine sarcomavirus, encodes a serine-threonine protein kinase that isexpressed almost exclusively in vertebrate germ cells(Propst and Vande Woude, 1985; Goldman et al., 1987;Mutter and Wolgemuth, 1987). Studies in the past haveestablished that the product of this proto-oncogene, Mos,is a major regulator of meiotic maturation. In this process,vertebrate oocytes, which are normally arrested at thediplotene stage of the first meiotic prophase, resume

meiosis in response to hormonal stimuli and arrest againat metaphase of the second meiotic division. Meiosis iscompleted only after fertilization.

In Xenopus, Mos has been shown to be involved in theinitiation of meiotic maturation, because injection ofantisense oligonucleotides to its mRNA prevents proges-terone-induced germinal vesicle breakdown (GVBD), oneof the initial events of maturation (Sagata et al., 1988).In addition, oocytes incubated in the presence of cyclo-heximide that are injected with Mos complete meiosis I,indicating that this is the only protein that must besynthesized de novo to complete the first meiotic division(Yew et al., 1992). Mos is also required for progressionfrom meiosis I to meiosis II (Kanki and Donoghue, 1991)and has been identified as a component of the cytostaticfactor (CSF), the activity that arrests oocytes at metaphaseII (Sagata et al., 1989a).Mos is also necessary for normal meiosis in the mouse,

although in this case oocytes injected with antisense c-mosoligonucleotides are able to initiate meiosis and undergoGVBD (O'Keefe et al., 1989; Paules et al., 1989). How-ever, such injected oocytes fail to progress from meiosisI to meiosis II. Instead, they reform a nucleus containingdecondensed chromatin following completion of meiosisI and frequently cleave to two cells (O' Keefe et al., 1989).Similarly, oocytes of mice in which c-mos has beeninactivated by homologous recombination complete mei-osis I normally, but then reform nuclei and undergoparthenogenetic activation (Colledge et al., 1994; Hashim-oto et al., 1994).The ultimate effect of Mos in the meiotic cell cycle

seems to be the stabilization/activation ofMPF (maturationpromoting factor), a complex of the kinase p34cdc2 andcyclin B (Sagata et al., 1989b; Daar et al., 1991; Kankiand Donoghue, 1991; O'Keefe et al., 1991; Yew et al.,1992). In mouse oocytes, Mos is required for the stabiliza-tion of cyclin B and the maintenance of MPF activityduring progression from meiosis I to meiosis II (O'Keefeet al., 1991). Studies in Xenopus indicate that additionalproteins of unknown identity must also be synthesized toinitiate meiosis II (Yew et al., 1992) and that Cdk2, inaddition to Mos, is required for metaphase II arrest(Gabrielli et al., 1993). It appears likely that the activityof Mos is mediated through MAP kinase activation,because Mos can phosphorylate and activate MAP kinasekinase (MEK) (Nebreda and Hunt, 1993; Posada et al.,1993; Shibuya and Ruderman, 1993) and activated MAPkinase is sufficient to induce metaphase arrest (Haccardet al., 1993).

While a great deal of effort has been directed towardthe elucidation of Mos function, little is known about themechanisms underlying the activation of c-mos mRNAexpression. c-mos mRNA is present in fully grown oocytes,is polyadenylated during maturation and is degraded with

52 Oxford University Press5712

c-mosmu mRNA polyadenylation

the bulk of maternal mRNAs that occurs at the two-cellstage in the mouse and at gastrulation in Xenopus (Mutteret al., 1988; Goldman et al., 1988; Sagata et al., 1988;Paris and Richter, 1990; Sheets et al., 1994). This raisesthe possibility that the translation of c-mos mRNA maybe regulated by cytoplasmic polyadenylation, a mechanismknown to control the translation of several mRNAs duringoocyte maturation and early embryogenesis in Xenopus(McGrew et al., 1989; McGrew and Richter, 1990; Parisand Richter, 1990; Simon et al., 1992; Sheets et al., 1994).Two cis-acting elements in the 3' UTRs of XenopusmRNAs are required for cytoplasmic polyadenylation: thehexanucleotide AAUAAA and a U-rich sequence termedthe cytoplasmic polyadenylation element (CPE), which isnormally situated 10-30 nucleotides upstream of thehexanucleotide. Xenopus c-mos mRNA, for example, ispolyadenylated by a CPE-dependent mechanism (Parisand Richter, 1990; Fox et al., 1992) and its translationhas been shown to be polyadenylation-dependent (Sheetset al., 1994), although CPE mutants have not been directlytested for translation. CPE and hexanucleotide sequencesare also required in the mouse for cytoplasmic polyadenyl-ation of tissue-type plasminogen activator (tPA) mRNA(Vassalli et al., 1989; Huarte et al., 1992; Salles et al.,1992).

In this report we describe the role of cytoplasmicpolyadenylation in the expression of mouse c-mos mRNAand its contribution to meiosis. We show that efficientpolyadenylation of c-mos mRNA requires three cis ele-ments: the hexanucleotide and two CPEs located 4 and51 nucleotides upstream of the hexanucleotide. A c-mos3' UTR containing wild-type elements, but not one withmutated CPEs, can drive translation of a reporter sequenceat a time when new synthesis of Mos is required forprogression from meiosis I to meiosis II. Finally, we showthat cytoplasmic polyadenylation of c-mos mRNA isessential for normal mouse oocyte maturation.

ResultsMaturation-dependent polyadenylation of injectedc-mos mRNAEndogenous mouse c-mos mRNA receives a poly(A) of-100 residues during oocyte maturation (Goldman et al.,1988). To assess whether injected c-mos mRNA could bepolyadenylated as well, we used an RNase protectionassay. A cDNA containing the c-mos coding sequenceplus the 3' UTR was cloned upstream of poly(dA) in avector that allowed transcription from both strands of theinsert (Figure IA). Following DNA linearization, capped,non-adenylated RNA was synthesized in vitro with T3RNA polymerase and injected into the cytoplasm of GVstage mouse oocytes in the presence of isobutylmethylxan-thine (IBMX), which prevents spontaneous maturation.After injection, the oocytes were incubated in the absenceof IBMX for 16 h to allow for maturation, which wasdenoted by the emission of the first polar body. RNA wasextracted and annealed to a radiolabeled antisense RNAthat contained a poly(U) tail, obtained by in vitro transcrip-tion from the T7 promoter. The RNA hybrids were treatedwith RNase A, which digests single-stranded RNA, andthe protected fragments were resolved by denaturingpolyacrylamide gel electrophoresis. Figure lB shows the

RNase protection of c-mos mRNA at 0 (lane 2) and 16 h(lane 3) after injection. As controls, we included in theassay the non-adenylated RNA used for injection (lane 1)and the probe alone (lane 4). The integrity of the undigestedprobe (lane 5) was also examined. A fragment of slowermobility compared with the 0 h lane is detected at 16 h.This slower mobility was due to the protection of thepoly(U) tail of the probe, indicating polyadenylation ofthe injected RNA. The length of the poly(A) tail detectedwas dependent upon the length of the poly(U) in theprobe, which in this case was 37 bases. In other experi-ments, injected eggs incubated in the presence of IBMXfor 16 h did not mature and the injected RNA was notadenylated (data not shown), indicating that polyadenyl-ation is concomitant with maturation. The RNase protec-tion assay was sensitive enough to detect the injectedRNA (- 10 pg/egg), but could not detect endogenous c-mosmRNA (about 0.1 pg/egg) (data not shown). These resultsdemonstrate that injected mouse c-mos mRNA behaveslike the endogenous mRNA in that it is polyadenylatedduring oocyte maturation.

Cis elements in the 3' UTR required for efficientpolyadenylation of c-mos mRNAFor most of the mRNAs that have been examined so far,the cis sequences required for cytoplasmic polyadenylationare located in the 3' UTR. To determine whether thec-mos mRNA 3' UTR alone could be polyadenylatedduring maturation, the DNA encoding this region wassubcloned into a vector similar to that shown in Figure1A and used for in vitro transcription. Non-adenylatedc-mos 3' UTR RNA was injected into GV stage oocytesthat were subsequently allowed to mature. RNA was thenextracted from matured eggs at 16 h and the polyadenyla-tion status of the injected RNA measured by RNaseprotection. In this case, about 50% of the injected RNAacquired a poly(A) tail (Figure 2A, RNA WT). Thus, thec-mos mRNA 3' UTR contains all the signals requiredfor cytoplasmic polyadenylation during oocyte maturation.A search for sequence features in the 3' UTR that could

influence polyadenylation revealed three likely elements:a hexanucleotide AAUAAA close to the 3' terminus andtwo U-rich sequences (AUAU5A and U3AU7A3) located4 and 51 nucleotides upstream of the hexanucleotiderespectively (cf. Figure 2B). To determine if thesesequences were necessary for c-mos mRNA cytoplasmicpolyadenylation, a series of mutants were obtained. Theyconsisted either of a complete deletion of the sequence(CPE2), a point mutation (HN) or a substitution byan unrelated sequence of similar length (CPE1). Non-adenylated RNAs were synthesized, injected into GVstage oocytes and analyzed for polyadenylation aftermaturation. The results (Figure 2A) show that mutationsin either of the CPEs reduced the number of RNAmolecules that acquired a poly(A) tail (compare lane 3,RNAs WT, Cl and C2). That is, while about 50% of theinjected wild-type RNA was polyadenylated, less than20% of the Cl or C2 mutant RNAs acquired a poly(A)tail. An RNA containing mutations in both CPEs, however,was not polyadenylated and began to be degraded (Figure2A, RNA Cl +2). This was also true for the RNA withoutthe hexanucleotide (Figure 2A, RNA HN). Therefore,optimal polyadenylation of mouse c-mos mRNA requires

5713

F.Gebauer et al.

A

L~~~~3 1T3

1 2

c-oLTJAAAAAA

Linearize withrestriction enzyme 2

Synthesize sense RNAwith T3 poiymerase

5, -

Linearize withrestriction enzyme 1

Synthesize antIsense RNAwith T7 polymerase

3' - UUUUUU

injectextract RNA

iAAAAAA anneal

or

B-UuuuuuU -uuuu uu

~,RNase A

t 0, 1M 0 1 6

.AAAAAA- UuuuuuU

0

A

..* 1.."..ILane 2 7

Fig. 1. Analysis of c-mos mRNA polyadenylation by RNase protection. (A) Schematic diagram of the RNase protection procedure used to detect thepolyadenylation of injected c-mos mRNA. (B) GV stage oocytes were injected with in vitro synthesized c-mos mRNA (-10 pi of a 1 pg/pI solution)and were cultured for 0 or 16 h. RNA was then extracted from 30 and 46 oocytes respectively and used in an RNase protection assay as describedin part A (lanes 2 and 3). Lane 1 (marker, M) refers to 200 pg of non-injected mRNA that was included in the RNase protection assay as a control(the size of the protected fragment is 112 nt); lane 4 shows a negative control where the antisense RNA probe was digested with RNase; lane 5shows the integrity of the probe (199 nt). tpi (h) refers to time post-injection, in hours.

three cis elements in the 3' UTR, two CPEs and thehexanucleotide.We also determined whether sequences outside of the

c-mos CPEs could affect polyadenylation, as they havebeen shown to do in Xenopus (McGrew and Richter, 1990;Simon et al., 1992; Stebbins-Boaz and Richter, 1994).The deletion of 31 nucleotides upstream of the CPE1(Figure 2A, RNA A) only slightly lowered polyadenyl-ation. However, substitution of the sequence between theCPEs (Figure 2A, RNA S) produced a more dramaticinhibition of polyadenylation. Thus, additional sequences

in the c-mos RNA 3' UTR can affect CPE function. Asummary of these results is presented in Figure 2B.

Time course of c-mos mRNA 3' UTRpolyadenylationDuring mouse oocyte maturation, GVBD usually occursby 2 h and polar body extrusion by 10-12 h. To determinewhether c-mos mRNA polyadenylation correlates witheither of these events, oocytes injected with a wild-typec-mos mRNA 3' UTR were collected at several timesduring maturation and the poyadenylation status of the

5714

A

1.I

9

j

9 9

, *

I ts

Bc-mos

Nomenc0ature

WT UUUAUUUW AA_--A 1AUAUUU UUA AA -

C1

C2 _-

C1 +2

A

S 13

Fig. 2. Analysis of cis elements that control cytoplasmic polyadenylation. (A) Polyadenylation profile of wild-type and mutant c-mos mRNA 3'UTRs. GV stage oocytes were injected with the 3' UTR RNAs at the following concentrations: WT, 0.25 pg/pl; Cl, 1.4 pg/pl; C2, 0.27 pg/pl;Cl+2, 0.63 pg/pl; HN, 0.28 pg/pl; A, 3.5 pg/pl; S, 3.5 pg/pl. After 16 h, the RNA was analyzed for polyadenylation as described in Figure 1. For allpanels, lane I (marker) shows 50 pg of non-injected RNA that was included in the RNase protection assay as a control; lane 2 shows the RNAextracted from oocytes at 0 h after injection (10 oocytes in all cases); lane 3 shows the RNA extracted from oocytes at 16 h after injection (numberof oocytes per RNA is as follows: WT, 49; Cl, 20; C2, 47; Cl +2, 54; HN, 47; A, 37; S, 25); lane 4 shows the digested probe alone; lane 5 showsthe integrity of the probe used in the assay. (B) Schematic representation of the putative regulatory elements in the 3' UTR of c-mos mRNA and the3' UTR mutants. Nucleotides are numbered according to the initiation codon. Termination codon is at nucleotide 1030. The sequence of the possibleCPEs and the polyadenylation hexanucleotide are shown. For details on the 3' UTR mutant sequences see Materials and methods. White and blackboxes represent wild-type or mutated sequences respectively. The discontinuous line also represents a mutated sequence. RNase protection assays

were performed on samples from oocytes injected with RNA from each construct. The percentage of polyadenylation, which was measured in a

phosphorimager, was calculated as the amount of RNA that received a poly(A) tail of any length at 16 h compared with the total RNA recovered at

that time. This percentage should only be taken as a rough estimate of polyadenylation, because shortened molecules due to partial protection, earlyRNA synthesis termination and/or degradation were included in the calculation.

extracted RNA was analyzed by RNase protection(Figure 3). Although no polyadenylation was detected by2 h (lane 6), it was clearly evident by 4 h (lane 7). TheRNA continued to be polyadenylated up to 8 h (lane 8) anddeclined somewhat by 16 h (lane 9). In other experiments,however, the polyadenylation profile of the RNA at 16 hwas not significantly different from that observed at 8 h.Thus, the c-mos mRNA 3' UTR is polyadenylated afterGVBD but before completion of meiosis I.

The 3' UTR of c-mos mRNA confers translationalregulation to a reporter mRNA in a CPE-dependentfashionAlthough the polyadenylation of an mRNA usually leadsto its translational activation, this is not always the

case. During spermiogenesis in the mouse, for example,translational activation of a number of mRNAs correlateswith their deadenylation (Kleene, 1989). To determinewhether CPE-dependent polyadenylation of the c-mos

mRNA 3' UTR can regulate translation during oocytematuration, the wild-type c-mos 3' UTR, as well as onethat lacked functional CPEs (see Figure 2A, WT andC I + 2), was cloned downstream of the coding sequencefor chloramphenicol acetyltransferase (CAT). RNAderived from CAT-WT and CAT-Cl+2 constructs, inaddition to CAT without any c-mos 3' UTR, was injectedinto GV stage oocytes that were allowed to mature.Oocytes were taken at 16 h after injection and proteinextracts prepared for CAT assays. Figure 4A shows that,while CAT-WT RNA was translated efficiently, very

5715

c-mosIu mRNA polyadenylation

S

-*- p

...\

!P .1

ro w 16 - p

WI.U

1 2 3 : 5

:^._.-..:

,..

..

_. JL*... w

._....D

Polyad

50

17

14

0

0

30

-

n

EGebauer et al.

A(7-, ** l

L aj.

Fig. 3. Time course of c-mos mRNA 3' UTR polyadenylation. GVstage oocytes were injected with c-mos mRNA 3' UTR (WT RNA ofFigure 2, 0.7 pg/pl) and analyzed for polyadenylation at several timesthereafter. Lane 1, integrity of the probe used in the assay (244 nt).The following samples were included in the assay: lane 2, 50 pg ofin vitro synthesized polyadenylated RNA; lane 3, 50 pg of non-adenylated in vitro synthesized RNA used for injection (the size of theprotected fragment is 113 nt); lane 4, digested probe alone; lanes 5-9,RNA from oocytes collected at 0, 2, 4, 8 and 16 h after injection (10,24, 26, 24 and 26 oocytes were collected at each time pointrespectively).

little CAT activity was detected in oocytes injected withCAT-Cl +2 or CAT only. Thus, the 3' UTR of c-mosmRNA confers translational activation to a reporter mRNAonly when it contains functional CPEs. From this weinfer that cytoplasmic polyadenylation of c-mos mRNAregulates its translation during oocyte maturation.To further confirm this observation, we determined

whether the translation profile of injected CAT-WT RNAcorrelated with the polyadenylation profile of c-mos 3'UTR RNA (WT) characterized above (Figure 3). Injectedoocytes were collected at several times and protein extractswere prepared. Figure 4B shows that translation ofCAT-WT, as measured by CAT activity, was first detectedat 8 h post-injection and increased dramatically by 12 h.Therefore, translation shortly follows polyadenylation andcorresponds to the time when Mos is required for meiosisI to meiosis II progression.

Cytoplasmic polyadenylation of c-mos mRNA isnecessary for oocyte maturationUsing injected antisense oligonucleotides, O'Keefe et al.(1989) showed that the ablation of c-mos mRNA inmaturing mouse oocytes caused them to fail to progressfrom meiosis I to meiosis II. This result, together with thosein this study indicating that cytoplasmic polyadenylation ofc-mos mRNA controls its translation, suggests that CPEfunction is a key regulator of early mouse development.To investigate this directly, we ablated the endogenous c-mos mRNA with an antisense oligonucleotide comple-mentary to a 15 base sequence within the coding region(O'Keefe et al., 1989; Figure 5A). While injection of thesense oligonucleotide did not have any effect on matura-tion, about 55% of the oocytes injected with the antisenseoligonucleotide contained both a polar body and a nucleus,indicating failure to progress from meiosis I to meiosis II

Ac 100-0

Cu

E0 5

E

E

0~

CAT-WT CAT-C +2

PB

4

CAT

Injected RNA

B 1GVBD

c0

asEE

Exm

0-

0

4 8 12 16 20

tpi (h)

Fig. 4. Translational control by the 3' UTR of c-mos mRNA, asdetermined by CAT activity. (A) GV stage oocytes were injected withCAT mRNAs containing either the wild-type 3' UTR of c-mos mRNA(CAT-WT), a double CPE mutant 3' UTR (CAT-Cl +2) or no c-mos3' UTR (CAT). In addition, all mRNAs contained 85 nucleotides ofCAT 3' UTR sequences. Protein extracts were made at 16 h afterinjection and the CAT activity was determined. The values in theordinate represent the average of two experiments. The concentrationof the RNAs used for injection was 3.5 fg/pl. Fifteen oocytes weretaken per RNA. (B) Time course of translation of injected CAT-WTRNA. Oocytes were taken several times after injection and processedas described for part A. The values in the ordinate represent theaverage of at least two experiments. GVBD, germinal vesiclebreakdown; PB, polar body extrusion. Fifteen oocytes were taken pertime point.

(Figure SB and C). The remaining 45% matured normally.We next assessed whether injected wild-type or CPE-mutated, full-length c-mos mRNA could rescue this pheno-type. To do this, we mixed the antisense oligonucleotideand the mRNA prior to injection, so that oocyte viabilitywould not be compromised by multiple injections. Forthis reason, the sequence within the injected c-mos mRNAthat would anneal to the oligonucleotide was changed sothat, while encoding the normal protein, it would not basepair with the antisense oligonucleotide and would not bedegraded by endogenous RNase H activity (Figure 5A).Wild-type c-mos mRNA, when injected at 6 or 0.12 pg/oocyte, completely rescued the phenotype induced by theoligonucleotide, such that all of the oocytes progressed tometaphase II (Figure SC). However, when a c-mos mRNAthat did not contain functional CPEs was injected at the

5716

c-mosmu mRNA polyadenylation

a antisense

rantlsense + FMWT_ antisense + FMC1+2

A

c-mos 5. [3UTR

II ~II565 5.-

/ \~amino acid Leu His Set

endogenous mRNA

antisense olIgonucleotide

CUC CAC UCs

GAG GTG AG

Cirt Ser

CAA AGC

GTT TCG

Injected mRNA U CA A injected RNA/egg (pg)

GV

''.,*.. a, s. z

ESa | ::

i:;w1y*' ::!<z:

PB

Prophase I -___--. Metaphase 11meio ;:

A'ucleus + PB

nos antisensephenotype

Fig. 5. CPE function of c-mos mRNA is necessary for normal oocyte maturation. (A) The nucleotide sequence of endogenous c-mos mRNA fromnucleotides 565-579, as well as the encoded amino acid residues, are shown. The nucleotide sequence of the antisense oligonucleotide directedagainst this region is also depicted. The nucleotide sequence of the same region of injected RNAs is shown and the nucleotide differences withrespect to the endogenous mRNA are outlined. This sequence encodes the same amino acids as the endogenous sequence, but cannot form a stablehybrid with the antisense oligonucleotide. (B) Pictures of normal GV stage and metaphase II mouse oocytes compared with the phenotype observedwhen oocytes are injected with the c-mos antisense oligonucleotide. Failure to progress from meiosis I to meiosis II is indicated by reformation of a

nucleus within the body of the egg following polar body extrusion. (C) Effect of injection of c-mos mRNAs containing wild-type (FMWT) or doubleCPE mutant (FMC1+2) 3' UTRs on antisense-treated oocytes. Oocytes were injected with the c-mos antisense oligonucleotide (0.7-1 pg/pl) and 6or 0.12 pg of RNA and scored for the presence of a nucleus and a polar body after 16 h. The numbers on the bars represent the number of oocyteswith this phenotype over the total number of oocytes that extruded a polar body in multiple experiments.

same concentrations, 26-32% of the oocytes still exhibitedabnormal meiosis (Figure 5C). Because the mutated c-

mos mRNA 3' UTR (see Figure 2A) does not supportpolyadenylation (Figure 2B), we conclude that cytoplasmicpolyadenylation of c-mos mRNA is necessary for mouse

oocyte maturation.

DiscussionOocyte maturation and early embryogenesis in manyanimals are characterized by a lack of transcription, anddevelopment during this period is programmed by maternalmRNAs. Regulation of maternal mRNA expression can

take many forms, including changes in stability andlocalization of the mRNA (Brown and Harland, 1990;

Christerson and McKearin, 1994; Lantz and Schedl, 1994),as well as the presence of masking proteins (Richter andSmith, 1984; Standart et al., 1990; Goodwin et al., 1993;Ranjan et al., 1993) or antisense RNAs (Lee et al., 1993;Wightman et al., 1993) that bind to the mRNA and inhibitits recognition by the translational machinery. Anothermajor mechanism of translational control of maternalmRNAs is cytoplasmic polyadenylation (reviews inRichter, 1991; Wickens, 1992; Wormington, 1993). InXenopus, the essential sequences for this process, thehexanucleotide AAUAAA and the CPE, are recognizedby factors that presumably mediate poly(A) tail elongation(McGrew and Richter, 1990; Paris et al., 1991; Fox et al.,1992; Bilger et al., 1994).

In the mouse, tPA mRNA is polyadenylated and trans-

5717

C

70 A

n

0

E.E

0n

m._O

1733

50

30 -

10

B

oAI

0126

EGebauer et al.

lated shortly after GVBD (Huarte et al., 1985, 1987).Moreover, it has been shown that the long poly(A) tailacquired by tPA mRNA during maturation is required forits translation (Vassalli et al., 1989). A CPE with thesequence AU4A2U is essential for cytoplasmic polyadenyl-ation of this mRNA (Salles et al., 1992). Because mousec-mos mRNA also receives a poly(A) tail during matura-tion (Goldman et al., 1988; Mutter et al., 1988), cyto-plasmic polyadenylation could regulate its expression aswell. Our analysis shows that optimal polyadenylation ofmouse c-mos mRNA requires the presence of two func-tional CPEs in the 3' UTR, as well as the hexanucleotideAAUAAA. In addition, the sequence between the CPEsalso influences polyadenylation. Not every modificationof the 3' UTR, however, has a strong effect on poly(A)tail elongation, because a deletion of 31 nucleotidesupstream of the CPEI only slightly loweredpolyadenylation.The sequences of the CPEs of mouse c-mos RNA,

U3AU7A3 and AUAU5A, are different from the one inXenopus c-mos mRNA, which is U4AU (Paris and Richter,1990; Fox et al., 1992). This sequence also differs fromthe only other functional CPE that has been analyzed inthe mouse, which is that for tPA mRNA. Other mousemRNAs contain CPE-like elements (Salles et al., 1992;Paynton and Brachvarova, 1994), but the role of thesesequences in polyadenylation has not been analyzed.Why c-mos mRNA should require two CPEs for optimalpolyadenylation while tPA mRNA needs only one is notclear. One possibility is that the two CPEs of c-mos mRNAmerely represent redundant sequences. Alternatively, theymay be required to modulate the timing of c-mos mRNApolyadenylation. In Xenopus, for example, RNAs withsomewhat variable CPEs acquire different sizes of poly(A)tails at different times during oocyte maturation (Parisand Richter, 1990; Sheets et al., 1994). Further experimentswill determine if this is the case.

The presence of functional CPEs in the 3' UTR ofc-mos mRNA is required for translational activation of areporter sequence during maturation. Translation beginsbetween 4 and 8 h after injection (Figure 4B), coincidentwith maximum polyadenylation of the 3' UTR (Figure 3),and increases dramatically by 12 h of maturation, a timewhen the last event of meiosis I, polar body extrusion,occurs. This result suggests that de novo synthesized Mosprotein accumulates at the end of meiosis I. Antisenseexperiments (O'Keefe et al., 1989, 1991; this study), aswell as studies in which c-mos has been inactivatedby homologous recombination (Colledge et al., 1994;Hashimoto et al., 1994), indicate that this protein functionsthereafter, being required for progression to metaphase II.

The expression of an mRNA may be regulated by morethan one mechanism, each contributing differently to itstranslation. To analyse the contribution of cytoplasmicpolyadenylation to c-mos mRNA expression in vivo, weablated the endogenous mRNA and replaced it with eitherthe wild-type mRNA or an mRNA without functionalCPEs, which could or could not be polyadenylated respect-ively. Injection of the antisense oligonucleotide interruptedmeiosis in about 55% of the oocytes, which is a resultsimilar to that obtained by O'Keefe et al. (1989). Thisphenotype is due to the destruction of c-mos mRNA, aspreviously determined by those investigators. While a

physiological amount of the full-length c-mos mRNAcarrying a wild-type 3' UTR (0.12 pg/oocyte) was able torescue 100% of the oocytes, an mRNA without functionalCPEs did not rescue the antisense oligonucleotide-inducedphenotype with nearly the same efficiency (Figure SC).Thus, we demonstrate that CPE function is necessary forc-mos mRNA expression and is a critical determinant fornormal development. We do note, however, that a consist-ent fraction of the oocytes were rescued by the injectionof c-mos mRNA with mutated CPEs (Figure SC). Thiseffect was not due to the injection per se, because injectionof an unrelated RNA did not show rescue activity (datanot shown). It is possible that this rescued fraction arisesfrom a 'leaky' translation of the mutant c-mos mRNA,which would be consistent with the low levels of translationobserved for the CAT mRNA without functional CPEs(Figure 4A). Alternatively, there might be other mechan-isms in addition to polyadenylation that increase c-mosmRNA translation during maturation.

In this manuscript we have reported the cis elementsrequired for optimal polyadenylation of mouse c-mosmRNA and we have determined that this polyadenylationis required for its translation. More importantly, we havedemonstrated that the CPE function is an essential regulatorof oocyte maturation and is necessary for expression ofc-mos mRNA in vivo. Our next goal is to identify thefactors participating in this cytoplasmic polyadenylationprocess.

Materials and methodsPlasmidsPlasmid SP65A (Munroe and Jacobson, 1990) was digested with SacIand HindIII, releasing a poly(dA) fragment of 73 residues that wassubcloned into the Sacl and HindlIl sites of Bluescript SK- (Stratagene).The resulting vector was called BSK-A. The 3' UTR of c-mos cDNAwas obtained by PCR from the pMSI plasmid (Oskarsson et al., 1980)with oligonucleotides Scmos-BamHI and Rcmos-XbaI (oligonucleotidesequences are detailed below), digested with BamHI and XbaI restrictionendonucleases and cloned into BSK-A digested at the same sites anddephosphorylated. This recombinant contained a portion of polylinkerbetween the c-mos insert and the poly(dA) that was substituted by aBbsI restriction site. To do this, the full-length plasmid was amplifiedby PCR using oligonucleotides Rcmos-BbsI and BbsI-A16, digested withBbsI and ligated. This plasmid was called WT and contained the wild-type 3' UTR of c-mos cDNA immediately followed by the BbsI site andthen a poly(dA) tail of 82 residues.cDNAs encoding the c-mos 3' UTR with mutations in the CPE and

hexanucleotide were obtained by PCR using WT plasmid as the template.The Cl mutant was obtained by amplification of the full-length WTplasmid with RCPEl-NcoI and SCPE1-NcoI oligonucleotides, digestionwith NcoI endonuclease and ligation. The insert for the C2 mutant wasobtained by PCR from the WT plasmid using the T3 promoter primer(New England Biolabs) and RCPE2-BbsI oligonucleotide. This fragmentwas digested with Sacl and BbsI and cloned into a WT vector that hadbeen treated with SacI and BbsI and gel-purified to remove the WTinsert. The HN mutant was obtained in a similar way as the C2 mutant,but using oligonucleotide RHN-BbsI instead of RCPE2-BbsI for theamplification reaction. The Cl +2 mutant was obtained by amplificationof the full-length C2 plasmid with the same oligonucleotides as for theCl mutant. The insert of the A mutant was obtained by amplification ofthe WT plasmid with oligonucleotides AbefCPEl-BamHI and Rcmos-BbsI. The amplified fragment was digested with BamHI and BbsI andligated to a WT vector that had been treated with the same restrictionenzymes and gel-purified to remove the WT insert. The S mutantwas obtained by amplification of the full-length WT plasmid witholigonucleotides SR-NcoI and SS-NcoI, digestion of the amplifiedplasmid with NcoI and ligation.A fragment containing the full-length coding sequence and the 3'

UTR of c-mos cDNA was obtained by PCR from the pMSI plasmid

5718

c-mosfu mRNA polyadenylation

with oligonucleotides 5'mos-BamHI and 3'mos-BsaI. A BsaI site at the3' terminus was introduced in this case because the full-length c-mossequence contained an internal BbsI site. This fragment was digestedwith BamHI and BsaI before ligating it to a WT vector that had beentreated with BamHI and BbsI and gel-purified to remove the WT insert.A recombinant plasmid containing a substitution in the c-mos codingregion corresponding to nucleotides 565-579 (from the initiation codon)was obtained by amplification of the full-length c-mos-containing plasmidwith oligonucleotides SMmos and AMmos and subsequent self-ligationof the amplified plasmid. This recombinant was called FMWT (full-length c-mos with a wild-type 3' UTR). The insert of a mutated FMlacking functional CPE sequences (FMCI +2) was obtained by PCRfrom the C1 +2 plasmid using oligonucleotides Scmos-BamHI andRCPE2-BsaI, digested with BamHI and BsaI and cloned in the vectorFM that had been treated with BamHI and BsaI and gel-purified.The c-mos sequences in all recombinants were cloned upstream of a

poly(dA) tail. The stability of the poly(dA) tail in bacteria was variablein that it decreased with the size of the c-mos insert in the differentplasmids, being 37 residues for recombinants with large inserts (FM)and 82 residues for recombinants with small inserts (WT, C1, Cl +2,HN, S, A).The sequence of the oligonucleotides and their position with respect

to the initiation codon of c-mos cDNA were as follows: Scmos-BamHI(1041-1062), CGGGATCCAGCCGATTGTAGAGATAAGCTFT; Rcmos-XbaI (1147-1134), GCTCTAGAGTAACTTTATTTCC; Rcmos-BbsI(1143-1124), i--T-I'TGTCTFCTTTATTTCCTAAAAATATG; BbsI-A16, GGGAAGACAAAAAAAAAAAAAAAA; RCPE1 -NcoI (1071-1057), CATGCCATGGCAGAGACAAAAGCTT; SCPEl-Ncol (1086-1100), CATGCCATGGGAAGTAAGGATGGTG; RCPE2-BbsI (1143-1111), TITiT-TT-l'GTCTTCTFTTATTTCCGCCCTAGTGGTATG; RHN-BbsI (1143-1125), TTT'ITrll'l'l1GTCT7CTTTCTFCCCTAAAAATATG;5'mos-BamHI (1-18), CGGGATCCATGCCTTCGCCTCTAAGC; Rcmos-BsaI (1143-1125), T'l-ll'l GAGACCTTTATTTCCTAAAAATAT;SMmos (580-595), CCAGTCGATTITGCACTTGGACC; AMmos(564-549), CTATGCAAAAAAAGCAGGCCGTTA; RCPE2-BsaI(1143-1111), TITY-IT- GAGACCTflATTlTCCGCCCTAGTGGTATG;AbefCPEI-BamHI (1072-1094), CGGGATCCTTTATFTFFrTTlAAA-GAAGTAAGG; SS-NcoI (1126-1145), CATGCCATGGACCAGCCTC-AAGAACACCCATATTTTTAGGAAATAAAGAAG; SR-NcoI (1085-1064), CATGCCATGGGAATGGAGTCTCTATTTAAAAAAATAAA-CAGAGACA.

Recombinant CAT plasmids were obtained by digestion of the P4Cplasmid (a gift from Leon Browder, University of Calgary, Alberta,Canada) with AvaI and KpnI and insertion of a fragment containing thewild-type version of c-mos 3' UTR cDNA obtained by digestion of theWT plasmid with AvaI and KpnI (CAT-WT) or a 3' UTR with mutatedCPEs obtained by digestion of the C 1+2 plasmid in the same sites(CAT-C l + 2).The sequence of all recombinants was determined by the dideoxy

method (Sanger et al., 1977) and analyzed using the GCG software(Genetics Computer Group, 1991).

RNAsRNAs for injection were synthesized from the T3 promoter of thevarious recombinants using the T3 Message Machine Kit (Ambion),following the recommendations of the vendor. Unincorporated cap wasseparated from the RNA by gel filtration through a Sephadex G-25column (Pharmacia) and the RNA was treated with phenol-chloroformbefore precipitation with ethanol. The recovered RNA was washed twicewith 70% ethanol, dried and resuspended in deionized/sterile water. Atrace-labeled parallel reaction was performed to assess the integrity andquantity of RNA that was synthesized in each case. The quantity ofRNA was determined by cutting the RNA band from a gel and measuringits radioactivity in a Cerenkov counter. WT RNA contained wild-typeCPE and hexanucleotide sequences (see Figure 2A). Cl RNA containeda substitution of the complete CPE1 sequence by a NcoI site (CCATGG).C2 RNA contained a deletion of the CPE2. HN RNA contained ahexanucleotide sequence of AAGAAA. C l + 2 RNA contained a substitu-tion of the CPEI by the sequence CATGGCATGCCATGG and a deletionof the CPE2. The S mutant contained a substitution of the sequencebetween the CPEI and the CPE2 by the following NcoI site-containingsequence, TAGAGACTCCATTCCCATGGACCAGCCTCAAGAACACCC.The A mutant contained a deletion of the 31 nucleotides upstream ofthe CPE1.

Radiolabeled antisense RNA was synthesized with T7 RNA poly-merase using [x-32P]CTP as the radiolabeled nucleotide and was gel-purified.

RNA was extracted from injected oocytes as described by Chomczyn-ski and Sacchi (1987) with some modifications. Briefly, oocytes werehomogenized in 200 gI of solution D (4 M guanidine thiocyanate,25 mM sodium citrate, 0.5% sarcosyl, 0.1 M mercaptoethanol, pH 7)by vortexing. Five micrograms of yeast RNA were added, together with20 gl of 2 M sodium acetate and 200 ,i of phenol-chloroform (1:1),and the mix incubated on ice for 15 min. The aqueous phase wasrecovered and precipitated twice with isopropanol. The recovered RNAwas washed with 70% ethanol and used for the RNase protection assay.

Oocyte collection, culture and microinjectionOocytes were collected, cultured and microinjected essentially as previ-ously described (O'Keefe et al., 1989). Fully grown primary oocyteswere isolated under a dissecting microscope from ovaries of 21-28 dayold mice (B6SJL from The Jackson Laboratory or BDF1 from CharlesRiver Breeding Laboratories) that had been primed for 46-48 h with 5units of pregnant mare serum gonadotropin (PMSG). Oocytes weredenuded of granulosa cells adhering to the zona pellucida and collectedin Dulbecco's phosphate buffered saline (DPBS) containing 5% fetalbovine serum (FBS) and 150 tM isobutylmethylxanthine (IBMX) toprevent meiotic maturation during their isolation. IBMX is a phosphodies-terase inhibitor that maintains the oocyte levels of cAMP, known todiminish during maturation. Oocytes were transferred to and transientlycultured prior to injection in modified Ham's F-10 medium (Serta et al.,1995) containing 5% FBS and 150 tM IBMX.

Microinjection was done under an inverted phase contrast microscopeusing an IM-200 microinjector (Narishige, Tokyo). About 10 pl of thevarious RNAs and/or antisense oligonucleotides were injected into thecytoplasm. Injected oocytes were washed three times in DPBS to removeIBMX and cultured in modified Ham's F-10 medium containing 5%FBS for 16 h (unless otherwise noted) to allow for maturation. Theoocytes were scored for germinal vesicle breakdown, polar body extrusionand reformation of a nucleus before being snap-frozen in liquid nitrogenfor RNase protection and CAT assays.

RNase protection assayRNA extracted from oocytes was mixed with the radiolabeled antisenseRNA probe in 20 ,ul of hybridization buffer (80% formamide, 0.4 MNaCl, 40 mM PIPES, pH 6.4, 5 mM EDTA). The RNA was denaturedby incubation at 85°C for 5 min and transferred to 45°C for overnightannealing. The samples were then digested for I h at 30°C with 10 ,ug/mlRNase A in a buffer containing 10 mM Tris-HCI, pH 7.5, 5 mM EDTAand 300 mM NaCl. Samples were subsequently adjusted to 0.6% SDSand digested with 0.17 mg/ml proteinase K for 30 min. at 37°C. Sampleswere treated with phenol-chloroform and precipitated. The protectedproducts were resolved by polyacrylamide-urea gel electrophoresisand visualized by autoradiography. The gels were also exposed in aphosphorimager for quantification.

CAT assayProtein extracts for CAT assays were obtained by repeated freezing andthawing of the oocytes in 0.2 M Tris-HCI, pH 8. CAT assays wereperformed as described in Jones et al. (1983). CAT activity wasdetermined as the fraction of chloramphenicol that was acetylated andwas quantified in a phosphorimager. A region of the gel with no signalwas used as a background, which was substracted from all values.

AcknowledgementsWe thank Dr Dan Torry for preliminary infections, Dr Qiu Ping Cao forproviding the modified protocol for extraction of RNA from mouseoocytes and Dr Juan Valcarcel for critically reviewing the manuscript.This work was supported by grants from the National Institutes of Health(GM46779 and CA40189) and The March of Dimes Birth DefectsFoundation to J.D.R. and by a grant from the National Institutes ofHealth (HD26594) to G.M.C. F.G. was supported by post-doctoralfellowships from NATO and the Ministerio de Educacion y Ciencia(Spain).

ReferencesBilger,A., Fox,C., Wahle,E. and Wickens,M. (1994) Genes Dev., 8,

1106-1116.Brown,B.D. and Harland,R.M. (1990) Genes Dev., 4, 1925-1935.Chomczynsky,P. and Sacchi,N. (1987) Anal. Biochem., 162, 156-159.Christerson,L.B. and McKearin,D.M. (1994) Genes Dev., 8, 614-628.

5719

EGebauer et al.

Colledge,W.H., Carlton,M.B.L., Udy,G.B. and Evans,M.J. (1994) Nature,370, 65-68.

Daar,I., Paules,R. and Vande Woude,G.F. (1991) J. Cell Biol., 114,329-335.

Fox,C., Sheets,M., Wahle,E. and Wickens,M. (1992) EMBO J., 11,5021-5032.

Gabrielli,B., Roy,L. and Maller,J. (1993) Science, 259, 1766-1769.Genetics Computer Group (1991) Program Manualfor the GCG package

Version 7. 575 Science Drive, Madison, WI 53711Goldman,D.S., Kiessling,A.A., Millette,C.F. and Cooper,G.M. (1987)

Proc. Natl Acad. Sci. USA, 84, 4509-4513.Goldman,D.S., Kiessling,A. and Cooper,G. (1988) Oncogene, 3, 159-

162.Goodwin,E., Okkema,P., Evans,T. and Kimble,J. (1993) Cell, 75, 329-

339.Haccard,O., Sarcevic,B., Lewellyn,A., Hartley,R., Roy,L., Izumi,T.,

Erikson,E. and Maller,J. (1993) Science, 262, 1262-1265.Hashimoto,N., Watanabe,N., Furuta,Y., Tamemoto,H., Sagata,N.,

Yokoyama,M., Okazaki,K., Nagayoshi,M., Takeda,N., Ikawa,Y. andAizawa,S. (1994), Nature, 370, 68-71.

Huarte,J., Belin,D. and Vassalli,J. (1985) Cell, 43, 551-558.Huarte,J., Belin,D., VassalliA., Strickland,S. and Vassalli,J. (1987) Genes

Dev., 1, 1201-1211.Huarte,J., Stutz,A., O'Connell,M., Gubler,P., Belin,D., Darrow,A.,

Strickland,S. and Vassalli,J. (1992) Cell, 69, 1021-1030.Jones,N.C., Richter,J.D., Weeks,D.L. and Smith,L.D. (1983) Mol. Cell.

Biol., 3, 2131-2142.Kanki,J.P. and Donoghue,D.J. (1991) Proc. Natl Acad. Sci. USA, 88,

5794-5798.Kleene,K. (1989) Development, 106, 367-373.Lantz,V. and Schedl,P. (1994) Mol. Cell. Biol., 14, 2235-2242.Lee,R., Feinbaum,R. and Ambros,V. (1993) Cell, 75, 843-854.McGrew,L. and Richter,J. (1990) EMBO J., 9, 3743-3751.McGrew,L., Dworkin-Rastl,E., Dworkin,M. and Richter,J. (1989) Genes

DevR, 3, 803-805.Munroe,D. and Jacobson,A. (1990) Mol. Cell. Biol., 10, 3441-3455.Mutter,G.L. and Wolgemuth,D.J. (1987) Proc. Natl Acad. Sci. USA, 84,

7869-7872.Mutter,G.L., Grills,G.S. and Wolgemuth,D.J. (1988) EMBO J., 7, 683-

689.Nebreda,A.R. and Hunt,T. (1993) EMBO J., 12, 1979-1986.O'Keefe,S., Wolfes,H., Kiessling,A. and Cooper,G. (1989) Proc. Natl

Acad. Sci. USA, 86, 7038-7042.O'Keefe,S., Kiessling,A. and Cooper,G. (1991) Proc. Natl Acad. Sci.

USA, 88, 7869-7872.Oskarsson,M., Blair,D.G., Maizel,J.V. and Vande Woude,G.F. (1980)

Science, 207, 1222-1224.Paris,J. and Richter,J. (1990) Mol. Cell. Biol., 10, 5634-5645.Paris,J., Swenson,K., Piwnica-Worms,H. and Richter,J. (1991) Genes

Dev., 5, 1697-1708.Paules,R., Buccione,R., Moschel,R. and Vande Woude,G.F. (1989) Proc.

Natl Acad. Sci. USA, 86, 5395-5399.Paynton,B.V. and Bachvarova,R. (1994) Mol. Repro. Dev., 37, 172-180.Posada,J., Yew,N., Ahn,N., Vande Woude,G.F. and Cooper,J. (1993)

Mol. Cell. Biol., 13, 2546-2553.Propst,F. and Vande Woude,G.F. (1985) Nature, 315, 516-517.Ranjan,M., Tafuri,S.R. and Wolffe,A.P. (1993) Genes Dev., 7, 1725-1736.Richter,J. (1991) BioEssays, 13, 179-183.Richter,J.D. and Smith,L.D. (1984) Nature, 309, 378-380.Sagata,N., Oskarsson,M., Copeland,T., Brumbaugh,J. and Vande

Woude,G.F. (1988) Nature, 335, 519-525.Sagata,N., Watanabe,N., Vande Woude,G.F. and Ikawa,Y. (1 989a) Nature,

342, 512-518.Sagata,N., Daar,I., Oskarsson,M., Showalter,S. and Vande Woude,G.F.

(1989b) Science, 245, 643-645.Salles,F, Darrow,A., O'Connell,M. and Strickland,S. (1992) Genes Dev.,

6, 1202-1212.Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl Acad. Sci.

USA, 74, 5463-5467.Serta,R.T., Seibel,M.M. and Kiessling,A.A. (1995) Hum. Reprod., in

press.Sheets,M., Fox,C., Hunt,T., Vande Woude,G.F. and Wickens,M. (1994)

Genes Dev., 8, 926-938.Shibuya,E. and Ruderman,J. (1993) Mol. Biol. Cell, 4, 781-790.Simon,R., TassanT. and Richter,J. (1992) Genes Dev., 6, 2580-2591.Standart,N., Dale,M., Stewart,E. and Hunt,T. (1990) Genes Dev., 4,

2157-2168.

Stebbins-Boaz,B. and Richter,J.D. (1994) Mol. Cell. Biol., 14, 5870-5880.

Vassalli,J., Huarte,J., Belin,D., Gubler,P., Vassalli,A., O'Connell,M.,Parton,L., Rickles,R. and Strickland,S. (1989) Genes Dev., 3, 2163-2171.

Wickens,M. (1992) Semin. Dev. Biol., 3, 399-412.Wightman,B., Ha,I. and Ruvkun,G. (1993) Cell, 75, 855-862.Wormington,M. (1993) Curr Opin. Cell Biol., 5, 950-954.Yew,N., Mellini,M. and Vande Woude,G.F. (1992) Nature, 355, 649-652.

Received on June 24, 1994; revised on September 12, 1994

5720