Tm

EDa

b

c

a

ARRAA

KEmmHAA

1

lvmgAoaInmftwsnv

i

0d

Leukemia Research 35 (2011) 208–213

Contents lists available at ScienceDirect

Leukemia Research

journa l homepage: www.e lsev ier .com/ locate / leukres

he role of microRNA-196a and microRNA-196b as ERG regulators in acuteyeloid leukemia and acute T-lymphoblastic leukemia

bru Coskuna, Eva Kristin von der Heidea, Cornelia Schleea, Andrea Kühnla, Nicola Gökbugetb,ieter Hoelzerb, Wolf-Karsten Hofmannc, Eckhard Thiela, Claudia D. Baldusa,∗

Department of Hematology and Oncology, Charité University Hospital Berlin, Campus Benjamin Franklin, Hindenburgdamm 30, Berlin, GermanyDepartment of Hematology and Oncology, University of Frankfurt am Main, Frankfurt/Main, GermanyDepartment of Hematology and Oncology, University Hospital Mannheim, Mannheim, Germany

r t i c l e i n f o

rticle history:eceived 9 March 2010eceived in revised form 7 May 2010ccepted 8 May 2010vailable online 8 June 2010

a b s t r a c t

Overexpression of the ETS transcription factor ERG is an adverse prognostic factor in adult patients withacute myeloid leukemia (AML) and T-cell acute lymphoblastic leukemia (T-ALL). We investigated theregulation of ERG by microRNAs and explored their role in hematopoiesis and leukemia. Transfection ofprecursor molecules of miR-196a and miR-196b induced ERG downregulation and luciferase assays con-firmed binding of miR-196a and miR-196b to the ERG 3′UTR. During in vitro differentiation of CD34+ cells,

eywords:RGiR-196aiR-196bematopoietic differentiation

miR-196b expression decreased with time, indicating a role for miR-196b in early hematopoiesis. In AML,patients with NPM1-mutations had higher levels of miR-196a and miR-196b compared to NPM1-wildtype.In T-ALL patients, miR-196a and miR-196b expression was associated with an immature immunophe-notype, and expression of CD34 and CD33. In conclusion, our results identify miR-196a and miR-196b asERG regulators and implicate a potential role for these miRNAs in acute leukemia.

cute myeloid leukemiacute T-lymphoblastic leukemia

. Introduction

Acute myeloid leukemia (AML) and T-cell acute lymphoblasticeukemia (T-ALL) are heterogeneous groups of leukemias, reflectingarious underlying genetic abnormalities [1,2]. Specific chromoso-al aberrations, such as numerical aberrations, translocations, and

ene mutations have shown to be important prognostic factors inML [3–6] and in acute lymphoblastic leukemia (ALL) [7–9]. More-ver, aberrant expression of single genes, for example, BAALC, MN1,nd CXCR4, were also found to be of prognostic relevance [10–12].n particular, deregulation of transcription factors, which promoteormal differentiation of hematopoiesis, is critical for the develop-ent of leukemias. For instance, the oncogenic ETS transcription

actor ERG (v-ets erythroblastosis virus E26 oncogene homolog)hat plays an important physiological role in hematopoiesis [13]as of independent adverse prognostic significance, as high expres-

ion of ERG identified adult patients with T-ALL and cytogenetically

ormal AML (CN-AML) with a high risk of relapse and inferior sur-ival [14,15].

The underlying biology of the oncogenic properties of ERG andts expression regulation remain unknown. To date, few stud-

∗ Corresponding author. Tel.: +49 30 8445 2337; fax: +49 30 8445 4468.E-mail address: claudia.baldus@charite.de (C.D. Baldus).

145-2126/$ – see front matter © 2010 Elsevier Ltd. All rights reserved.oi:10.1016/j.leukres.2010.05.007

© 2010 Elsevier Ltd. All rights reserved.

ies have been performed unraveling the regulation of ERG inhematopoiesis [13,16]. Characterization of the expression patternof ERG isoforms in leukemia revealed marked differences in theexpression of the two main isoforms ERG2 and ERG3 in T-ALL andAML. The ERG2 promoter was found to be regulated by methyla-tion, whereas no CpG islands were detected in the promoter regionof ERG3 [17]. Thus, in addition to the epigenetic regulation, theregulation of ERG may also be directed by other mechanisms.

microRNAs (miRNAs) are endogenous ∼22 nt non-codingmolecules that play an important regulatory role in critical cellularprocesses such as cell cycle, apoptosis, and differentiation [18,19].Recent discoveries implicate miRNAs in normal hematopoiesis andin the pathogenesis of leukemia. miR-221 and miR-222 were foundto have a role in erythropoiesis, whereas miR-223 was involved ingranulopoietic regulation and miR-150 in megakaryocytic differen-tiation [20–22]. Moreover, deregulation of miRNA expression wasshown to be involved in the initiation and progression of leukemia,as they can act as oncogenes and tumor suppressors [23]. In CN-AML, miR-181a and miR-181b were part of a miRNA expressionsignature associated with outcome and their expression levels were

inversely associated with the risk of an event [24,25]. Additionally,in ALL of various subtypes, miRNA expression profiles revealed highexpression of miR-128b, miR-204, miR-218, miR-331, and miR-181b-1 compared to healthy controls, indicating a potential rolefor these miRNAs in leukemogenesis [26].

a Rese

hepa1wdp

2

2

htrcEomm

2

waF

egSwMr

ttco

2

moCtnt

2

Ga(afr

P(tse

2

ontcl

E. Coskun et al. / Leukemi

Since miRNAs have emerged as major regulators inematopoiesis by fine-tuning transcription factors [27], wexamined the regulation of ERG by miRNAs. Among the miRNAsredicted to regulate ERG, we identified miR-196a and miR-196bs regulators of ERG. In order to explore the potential role of miR-96a and miR-196b in normal hematopoiesis and acute leukemia,e further examined the expression of miR-196a and miR-196buring hematopoietic differentiation, as well as in AML and T-ALLatient samples.

. Materials and methods

.1. Computational analysis

Four different databases (Targetscan http://www.targetscan.org, PicTarttp://pictar.bio.nyu.edu, mirBase http://microrna.sanger.ac.uk, Human microRNAargets http://www.microrna.org) were used to predict potential miRNAs thategulate ERG. The databases predicted miRNAs that target ERG by comparing theomplementarity between the seed region at 5′ end of miRNA and the 3′UTR of theRG mRNA sequences. The following conserved miRNAs, common in at least twof the four databases, were chosen for further analyses: miR-9, miR-27a, miR-30b,iR-137, miR-142-3p, miR-145, miR-196a, miR-196b, miR-219, miR-361, andiR-544.

.2. Cells and patient samples

KG1a and MOLT-4 cell lines, obtained from DSMZ (Braunschweig, Germany),ere cultured in RPMI 1640 with 10% fetal calf serum (FCS) and 1% antibiotics and

ntimycotics. The 293T cell line was maintained in DMEM supplemented with 10%CS and 1% antibiotics and antimycotics.

Human bone marrow (BM) samples used for hematopoietic differentiationxperiments were obtained from healthy donors after informed consent. Densityradient centrifugation (Ficoll-Hypaque; Amersham Pharmacia Biotech, Uppsala,weden) was performed to isolate mononuclear cells from BM samples. CD34+ cellsere immunomagnetically enriched from BM using MACS CD34 isolation kit (MACS,iltenyi Biotec GmbH, Bergisch Gladbach, Germany) following the manufacturer’s

ecommendations.Pretreatment BM samples of adult patients with newly diagnosed AML (admit-

ed to our institution between the years 2006–2009, n = 46) and T-ALL (enrolled onhe German Acute Lymphoblastic Leukemia Multicenter Study Group 07/03 proto-ol, n = 104) were analyzed. As control unselected total BM (n = 4) specimens werebtained from healthy donors after informed consent.

.3. Transfection

KG1a and MOLT-4 cells were transfected with Pre-miRTM miRNA precursorolecules (Applied Biosystems/Ambion, Darmstadt, Germany) and scrambled RNA

ligomer controls (Pre-miR negative control), using the Nucleofector systems (Lonzaologne AG, Cologne, Germany) according to the manufacturer’s recommenda-ions. The final concentration of Pre-miR molecules and the corresponding Pre-miRegative control was 100 nM each. Cells were harvested 24 h (hrs) and 48 h afterransfection.

.4. Real time RT-PCR for ERG mRNA and miRNA expression analyses

Total RNA was extracted using Trizol® Reagent (Invitrogen GmbH, Karlsruhe,ermany). For cDNA synthesis, 500 ng of total RNA was reverse transcribed infinal volume of 20 �l using oligo-dT primers and AMV reverse transcriptase

Roche Diagnostics GmbH, Mannheim, Germany). Comparative RT-PCR assays ofregion common to all ERG isoforms (pan-ERG), ERG2 and ERG3 isoforms were per-

ormed using Glucose Phosphate Isomerase (GPI) as housekeeping gene as previouslyeported [17].

The relative levels of miRNAs were determined by stem-loop real time RT-CR using gene-specific primers according to the TaqMan MicroRNA Assay protocolApplied Biosystems/Ambion, Darmstadt, Germany). Briefly, for reverse transcrip-ion, 10 ng of total RNA was used in each reaction and mixed with the specifictem-loop primers. All PCRs were run in duplicates and RNU6B small nuclear RNAndogenous control was used for normalization.

.5. Reporter vector and DNA constructs

The miR-196a and miR-196b binding sites of ERG 3′UTR were designed asligonucleotides, either as wildtype (wt) or as mutant by inserting randomucleotides into the miR-196 “seed sequences”, and were subsequently cloned intohe psiCHECKTM 2 Vector (Promega GmbH, Mannheim, Germany). The oligonu-leotide sequences were designed to carry the XhoI and NotI sites facilitatingigation into the vector. The sense oligonucleotide sequences were as follows:

arch 35 (2011) 208–213 209

psicheck-ERG-wt, 5′ tttaaggaaaactacctgtataaaa 3′; psicheck-ERG-mut, 5′ tttaag-gaaaactggtaacctgtataaaa 3′ .

2.6. Luciferase reporter gene assay

293T cells were seeded at 2.5 × 105 cells per well of a 12-well plate and weregrown for 48 h. After 48 h the cells were washed with PBS and replaced with newmedium. A total of 400 ng of the plasmids psicheck-ERG-wt and psickeck-ERG-mut,respectively, were cotransfected with 50 pmol final concentrations of either Pre-miR-196a or Pre-miR-196b molecules and their corresponding Pre-miR negativecontrols, using Lipofectamin 2000 (Invitrogen GmbH, Karlsruhe, Germany). After24 h, the cell extract was obtained and firefly and Renilla luciferase activities weremeasured with the Dual-Luciferase reporter system (Promega GmbH, Mannheim,Germany) according to manufacturer’s instructions. Renilla luciferase activity wasnormalized to firefly luciferase activity.

2.7. CD34+ cell differentiation

Immunomagnetically purified CD34+ BM cells from healthy donors were cul-tured in Iscove’s modified Dulbecco’s culture medium supplemented with 20% FCS,1% antibiotic and antimycotic. The cytokines SCF (50 ng/ml) and IL-3 (20 ng/ml)(MACS, Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) were added to keepthe cells in the maintenance culture. To induce lineage-specific differentiation, EPO(3 U/ml) (R&D Systems GmbH, Wiesbaden-Nordenstadt, Germany) was added forerythropoietic differentiation and G-CSF (50 ng/ml) and GM-CSF (20 ng/ml) (MACS,Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) for granulopoietic differenti-ation. The cells were semi-depleted at predefined time points (days 3, 6, 9, 13, 16,and 20). At these time points medium and cytokines were replaced and harvestedcells were processed for RNA isolation. The maturation of CD34+ cells was confirmedwith flow cytometry using antibodies against the cell surface markers GlycophorinA (GlyA) (Beckman Coulter GmbH, Krefeld, Germany) for erythroid differentiationand CD15 (BD Biosciences, Heidelberg, Germany) for granulopoietic differentiation.

3. Results

3.1. miR-196a and miR-196b regulate ERG mRNA expression

By using the miRNA prediction softwares, 11 potential miR-NAs binding to ERG 3′UTR were chosen for further analyses. AllmiRNAs were tested by transfecting myeloid KG1a cells withmiRNA precursor molecules and transfected cells were subse-quently studied for ERG mRNA expression levels. Of all 11 miRNAs,only transfection of the miRNA precursor molecules of miR-196a(Pre-miR-196a) and miR-196b (Pre-miR-196b) induced a signifi-cant reduction of ERG mRNA expression levels. After 24 h pan-ERGwas significantly downregulated by 29% (after Pre-miR-196a trans-fection) and by 33% (after Pre-miR-196b transfection); after 48 hby 34% (after Pre-miR-196a transfection) and by 36% (after Pre-miR-196b transfection) compared to Pre-miR negative controls(Fig. 1A). Moreover, analysis of the expression regulation of the spe-cific isoforms revealed a downregulation of ERG3 expression levelsby miR-196a and miR-196b in KG1a (Fig. 1B). Due to lack of ERG2expression in KG1a cells, we further studied the T-lymphoblasticcell line MOLT-4, which showed downregulation of both ERG2 by38% and 36% (after Pre-miR-196a and Pre-miR-196b transfection),and ERG3 by 43% and 33% (after Pre-miR-196a and Pre-miR-196b)24 h after transfection (Fig. 1C). Transfection efficiency was con-firmed with increased expression levels of the miRNAs after 24 h inKG1a and MOLT-4 (data not shown).

3.2. miR-196a and miR-196b target ERG 3′UTR

Validation of ERG as a direct target of miR-196a and miR-196bwas performed by a luciferase reporter assay. The predicted miR-196 recognition site of the ERG 3′UTR was cloned into a luciferasereporter vector. The vector contained either the wt or a mutated

sequence of the ERG 3′UTR. Subsequently, the vectors were cotrans-fected with Pre-miR-196a or Pre-miR-196b molecules into 293Tcells. After 24 h, a 33% and 28% reduction of luciferase activitywas observed in cells cotransfected with psicheck-ERG-wt vectorand Pre-miR-196a or Pre-miR-196b molecules compared to the

210 E. Coskun et al. / Leukemia Research 35 (2011) 208–213

F wnrega ecifice

cmpd

3d

idciafiFtidEd

3p

l1mic

Fccd

3.5. Association of miR-196a and miR-196b with clinical andmolecular characteristics in T-ALL

To examine the association of miR-196a and miR-196b expres-sion levels with clinical and molecular features, T-ALL patients

ig. 1. Transfections with precursor molecules Pre-miR-196a and Pre-miR-196b dond ERG3 mRNA expression in MOLT-4 (C) compared to cells transfected with unspxperiments.

ontrols (Fig. 2). In contrast, transfection of the miRNA precursorolecules did not reduce the luciferase activity with the mutated

sicheck-ERG-mut vector. The results show that ERG expression isirectly regulated by miR-196a and miR-196b.

.3. miR-196a and miR-196b expression during cellifferentiation of normal CD34+ cells

The expression pattern of miR-196a and miR-196b was exam-ned in CD34+ progenitor cells isolated from human BM of healthyonors. The cells were kept in maintenance culture using theytokines SCF and IL-3, and lineage-specific differentiation wasnduced by the addition of EPO or G/GM-CSF. Flow cytometrynalysis of the surface markers GlyA and CD15 expression con-rmed lineage-specific maturation (Fig. 3A and B). As shown inig. 4A, the expression of miR-196a was nearly constant duringhe differentiation, whereas the expression of miR-196b was highn undifferentiated CD34+ cells and decreased with early onset ofifferentiation stimulus (maintenance culture: 20-fold reduction;PO: 20-fold reduction; G/GM-CSF: 14-fold reduction—day 0 vs.ay 9, Fig. 4B).

.4. Expression of miR-196a and miR-196b in T-ALL and AMLatients

To investigate the role of miR-196a and miR-196b in acute

eukemia, we measured the expression of miR-196a and miR-96b in pretreatment BM samples from T-ALL and AML patients.iR-196a and miR-196b were significantly higher expressed

n AML (miR-196a median = 0.29 and miR-196b median = 1.46)ompared to T-ALL (miR-196a median = 0.02, P < .01 and miR-

ig. 2. Dual-luciferase assay of 293T cells cotransfected with luciferase vectorontaining the cloned 3′UTR region of ERG and Pre-miR-196a or Pre-miR-196bompared to cells cotransfected with unspecific Pre-miR negative control. The dataepict the mean ± S.D. from three independent experiments.

ulate the expression of pan-ERG and ERG3 mRNA in KG1a (A and B), as well as ERG2Pre-miR negative control. The data depict the mean ± S.D. from three independent

196b median = 0.02, P < .01) and healthy donors (miR-196amedian = 0.05, P = .03 and miR-196b median = 0.18, P = .05) (Fig. 5),whereas no significance was observed in miR-196a and miR-196bexpression in T-ALL compared to healthy donors (P = .36 and P = .39).

Fig. 3. Expression of the surface markers Glycophorin A for erythropoietic differen-tiation (A), and CD15 for granulopoietic differentiation (B) confirm lineage-specificdifferentiation of CD34+ progenitor cells measured with flow cytometry at days 3,6, and 9.

E. Coskun et al. / Leukemia Research 35 (2011) 208–213 211

Fig. 4. Expression of miR-196a (A) and miR-196b (B) during in vitro differentiationof CD34+ progenitor cells with the addition of following cytokines: SCF and IL-3,plus EPO or plus G-/GM-CSF. Real time RT-PCR was performed on days 0, 3, 6, 9,13, 16, and 20. The expression of miR-196a was nearly constant, whereas miR-196bexpression decreased with time. Data is expressed relative to day 0. A representativeresult from two independent experiments is shown.

Fig. 5. Expression of miR-196a and miR-196b in AML and T-ALL patients. Realtime RT-PCR was performed in pretreatment BM samples from AML (n = 46), T-

Table 1Clinical and molecular characteristics of T-ALL patients with respect to miR-196a and miR

Characteristic miR-196a low (n = 52) miR-196a high (n = 52)

Age, yearsMedian 36 34Range (18–65) (15–60)WBC (× 109/L)Median 58 23Range (2–429) (1–315)Early T-ALL (n = 27)No. 7 20(%) (13) (38)Thymic T-ALL (n = 66)No. 39 27(%) (75) (52)Mature T-ALL (n = 11)No. 6 5(%) (12) (10)CD34 expression, surface, %Mean 12 25Range (0–80) (0–97)CD33 expression, surface, %Mean 3 19Range (0–26) (0–98)

P value of Mann–Whitney’s U-test and �2-test. WBC indicates white blood counts.* Overall P value for the frequency of the three immunophenotypes across the miRNA

ALL (n = 105) patients and BM samples from healthy donors (n = 4). The median isshown by a horizontal bar. Significance of Mann–Whitney’s U-test values comparedto controls are as follows: *P ≤ .05, and ***P ≤ .001.

were divided into two miRNA expression groups using the medianof the miRNA expression levels as the arbitrary cutoff. Patientswere classified as having low miR-196a or low miR-196b if themiRNA expression values were below the median and as high miR-196a or high miR-196b if they had miRNA expression values abovethe median (see Fig. 5). With respect to age, no significant corre-lation was observed between high miR-196a and low miR-196agroups (Table 1). T-ALL patients with low miR-196a expressionhad higher white blood count (WBC) (P < .001) at initial diagnosisas compared to patients with high miR-196a expression. Addi-

tionally, high miR-196a expression was significantly associatedwith an early immunophenotype of T-ALL (P = 0.01), CD34 expres-sion (P = .02), and with the aberrant expression of the myeloidmarker CD33 (P < .01). Similar trends were seen for miR-196b,

-196b expression.

P miR-196b low (n = 52) miR-196b high (n = 52) P

0.60 0.5737 33(18–65) (15–60)

<0.001 0.0149 24(1–429) (2–326)

0.01* 0.11*9 18(17) (34)

36 30(69) (58)

7 4(14) (8)

0.02 0.0514 24(0–80) (0–97)

<0.01 <0.014 18(0–53) (0–98)

low and high groups.

212 E. Coskun et al. / Leukemia Research 35 (2011) 208–213

Table 2Association of miR-196a and miR-196b expression in AML with NPM1-wt vs. NPM1-mutant subgroups.

NPM1-wt (n = 32) NPM1-mutant (n = 14) P value

0.2–00.9–1

P

hmeaemnAhw

3

mwllAdtsl(

4

iei[ttreoae

ppTNrEmlmat

mtfttb

miR-196a expression Median (CI) 0.2 (miR-196b expression Median (CI) 1.3 (

value of Mann–Whitney’s U-test.

owever no significant correlations were observed betweeniR-196b and immunophenotype with 34% of high miR-196b

xpressers classified as early T-ALL, 58% as thymic T-ALL and 8%s mature T-ALL compared to 17%, 69% and 14% of low miR-196bxpressers (P = .11). Moreover, the expression of miR-196a andiR-196b positively correlated with each other (P < .0001), whereas

o correlation was found between the miRNAs and ERG expression.dditionally, no significant differences in clinical outcome betweenigh vs. low miR-196a and high vs. low miR-196b expression levelsere observed.

.6. miR-196a and miR-196b expression in AML

We further characterized the association of the expression ofiRNAs with clinical and molecular features in AML. When patientsere grouped according to the median of the miRNA expression

evels, no significant differences were observed between high vs.ow miRNA expression groups with respect to age, WBC, French-merican-British classified subtypes, and FLT3 internal tandemuplication mutations. There was also no difference with respecto outcome (complete remission, relapse-free survival and overallurvival). Patients having NPM1-mutations had higher expressionevels of miR-196a and miR-196b compared to NPM1 wt patientsP = .01, Table 2).

. Discussion

miRNAs have emerged as important gene expression regulatorsnvolved in a variety of biological processes [19]. Analyses of miRNAxpression in hematopoiesis implicate miRNAs to be involvedn fine-tuning of the hematopoietic differentiation machinery20–22]. In addition, recent evidence indicates that the deregula-ion of genes, involved in leukemogenesis, might be partly due tohe aberrant expression of regulatory miRNAs, displaying an activeole in acute leukemias [28,29]. Importantly, transcription factors,ssential for normal hematopoietic maintenance, might be targetsf miRNAs. For instance, miR-181a was found to regulate RUNX1,nd TEL/AML, and was shown to impair cell proliferation in TEL/AMLxpressing cells [30].

The oncogenic ETS transcription factor ERG has an importanthysiological role in hematopoiesis, and was found to be an adverserognostic factor in a subset of adult patients with CN-AML and-ALL [14,15]. Here, we explored the regulation of ERG by miR-As, and demonstrate that among several miRNAs predicted to

egulate ERG, only miR-196a and miR-196b specifically modulatedRG expression at a posttranscriptional level. By overexpressingiR-196a and miR-196b in the myeloid cell line KG1a and in the T-

ymphoblastic cell line MOLT-4, we observed downregulation of theRNA levels of pan-ERG, as well as of the two main isoforms ERG2

nd ERG3. Moreover, direct binding of miR-196a and miR-196b tohe ERG 3′UTR was confirmed with luciferase reporter assay.

Recent studies have already implicated both miR-196a andiR-196b in normal cell differentiation, proliferation, and in

umorgenesis of various cancer types [31–34]. miR-196a wasound to inhibit proliferation and promote osteogenic differen-iation in adipose tissue derived mesenchymal stem cells byargeting HOXC8 [31]. On the other hand, targeting of annexin A1y miR-196a in esophageal cancer promoted cell proliferation,

.4) 0.7 (0.4–1.3) 0.01

.9) 3.4 (2.3–8.8) 0.01

anchorage-independent growth and suppressed apoptosis [33],suggesting the oncogenic potential of miR-196a and implying itsdiverse functions in various cell types.

Microarray profiles of miRNA expression patterns have shownthat highest expression of miR-196b levels was found in humanBM and spleen cells compared to other organs [35]. Moreover, miR-196b was found to be most abundant in short-term hematopoieticstem cells in mouse and was downregulated in more differenti-ated hematopoietic cells [34]. Our analysis of CD34+ progenitor cellsdemonstrated that miR-196b was highly expressed in undifferenti-ated CD34+ progenitors and decreased with onset of differentiation,suggesting a role for miR-196b in early hematopoiesis.

We further explored the role of miR-196a and miR-196b in acuteleukemias. The expression levels of miR-196a and miR-196b inAML and T-ALL patients correlated with specific molecular char-acteristics. In particular, in T-ALL, high expression of miR-196a andmiR-196b was associated with an early immunophenotype of T-ALL, CD34-positivity and with the aberrant expression of CD33. InAML, the expression of miR-196a and miR-196b was significantlyhigher in the patient samples compared to healthy donors. Addi-tionally, both of the miRNAs were also higher expressed in themolecular subgroup of AML carrying NPM1-mutations compared toNPM1 wt. This is in line with the study from Jongen-Lavrencic et al.,showing up-regulated miR-196a and miR-196b expression levels inAML carrying NPM1-mutations [36]. miR-196a and miR-196b arelocated within the genomic clusters of HOXB and HOXA families thatare overexpressed in AML with NPM1-mutations [37]. Furthermore,miR-196a was found to regulate HOXB8 [38], and the regulation ofmiR-196b was found to be similar to that of the surrounding HOXgenes [34]. Thus, these observations implicate a role for miR-196a,miR-196b, and HOX genes in AML with NPM1-mutations.

The expected inverse correlation between the expression ofmiRNAs and ERG mRNA that was not observed possibly reflectsthe heterogeneity in AML and T-ALL populations. The involvementof additional regulatory mechanisms of ERG needs to be furtherexplored.

In conclusion, this study demonstrates miR-196a and miR-196bas regulators of ERG. Furthermore, the decrease of miR-196b mRNAabundance during hematopoietic maturation indicates a possiblerole for miR-196b in early hematopoiesis. The aberrant expressionof miR-196a and miR-196b in AML, and the association of miR-196a and miR-196b with an immature immunophenotype, CD34expression and with aberrant expression of CD33 in T-ALL implicatea potential role for these miRNAs in acute leukemia.

Conflict of interest statement

The authors reported no conflicts of interest.

Acknowledgements

This study was supported by grants from the Deutsche Kreb-shilfe (Max Eder Nachwuchsförderung). We thank Jutta Ortiz

Tanchez for technical support and Liliana Mochmann for her criticalreading of the manuscript.

Contributions: E.C.: carried out laboratory-based research andwrote the manuscript; E.K.V. and C.S.: carried out laboratory-basedresearch; A.K.: performed statistical analysis; N.G. and D.H.: head of

a Rese

GKtw

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

E. Coskun et al. / Leukemi

MALL study center, provided patient samples and clinical data; W-.H. and E.T.: contributed intellectual insights and C.D.B.: designed

he research, contributed to the analysis of this study, and to theriting of this manuscript.

eferences

[1] Hoelzer D, Gokbuget N, Ottmann O, Pui C, Relling MV, Appelbaum FR, etal. Acute lymphoblastic leukemia. Hematol Am Soc Hematol Educ Program2002:162–92.

[2] Estey E, Döhner H. Acute myeloid leukaemia. The Lancet 2006;368:1894–907.[3] Mrózek K, Heinonen K, Bloomfield CD. Clinical importance of cytogenetics in

acute myeloid leukaemia. Best Pract Res Clin Haematol 2001;14:19–47.[4] Grimwade D. The clinical significance of cytogenetic abnormalities in acute

myeloid leukaemia. Best Pract Res Clin Haematol 2001;14:497–529.[5] Yanada M, Matsuo K, Suzuki T, Kiyoi H, Naoe T. Prognostic significance of FLT3

internal tandem duplication and tyrosine kinase domain mutations for acutemyeloid leukemia: a meta-analysis. Leukemia 2005;19:1345–9.

[6] Dohner K, Schlenk RF, Habdank M, Scholl C, Ru FG, Corbacioglu A, et al. Mutantnucleophosmin (NPM1) predicts favorable prognosis in younger adults withacute myeloid leukemia and normal cytogenetics: interaction with other genemutations. Blood 2005;106:3740–6.

[7] Mrózek K. Cytogenetics in acute leukemia. Blood Rev 2004;18:115–36.[8] Pui C, Jeha S. New therapeutic strategies for the treatment of acute lymphoblas-

tic leukaemia. Nat Rev Drug Discov 2007;6:149–65.[9] Armstrong SA, Look AT. Molecular genetics of acute lymphoblastic leukemia. J

Clin Oncol 2005;23:6306–15.10] Baldus CD, Thiede C, Soucek S, Bloomfield CD, Thiel E, Ehninger G. BAALC

expression and FLT3 internal tandem duplication mutations in acute myeloidleukemia patients with normal cytogenetics: prognostic implications. J ClinOncol 2006;24:790–7.

11] Heuser M, Beutel G, Krauter J, Dohner K, von Neuhoff N, Schlegelberger B, et al.High meningioma 1 (MN1) expression as a predictor for poor outcome in acutemyeloid leukemia with normal cytogenetics. Blood 2006;108:3898–905.

12] Spoo AC, Lubbert M, Wierda WG, Burger JA. CXCR4 is a prognostic marker inacute myelogenous leukemia. Blood 2007;109:786–91.

13] Loughran SJ, Kruse EA, Hacking DF, de Graaf CA, Hyland CD, Willson TA, et al.The transcription factor Erg is essential for definitive hematopoiesis and thefunction of adult hematopoietic stem cells. Nat Immunol 2008;9:810–9.

14] Baldus CD, Burmeister T, Martus P, Schwartz S, Gökbuget N, Bloomfield CD, et al.High expression of the ETS transcription factor ERG predicts adverse outcomein acute T-lymphoblastic leukemia in adults. J Clin Oncol 2006;24:4714–20.

15] Marcucci G, Maharry K, Whitman SP, Vukosavljevic T, Paschka P, Langer C,et al. High expression levels of the ETS-related gene, ERG, predict adverseoutcome and improve molecular risk-based classification of cytogeneticallynormal acute myeloid leukemia: a Cancer and Leukemia Group B Study. J ClinOncol 2007;25:3337–43.

16] Kruse EA, Loughran SJ, Baldwin TM, Josefsson EC, Ellis S, Watson DK, et al. Dualrequirement for the ETS transcription factors Fli-1 and Erg in hematopoieticstem cells and the megakaryocyte lineage. PNAS 2009;106:13814–9.

17] Bohne A, Schlee C, Mossner M, Thibaut J, Heesch S, Thiel E, et al. Epigenetic con-trol of differential expression of specific ERG isoforms in acute T-lymphoblastic

leukemia. Leukemia Res 2009;33:817–22.

18] Naguibneva I, Ameyar-Zazoua M, Polesskaya A, Ait-Si-Ali S, Groisman R, SouidiM, et al. The microRNA miR-181 targets the homeobox protein Hox-A11 duringmammalian myoblast differentiation. Nat Cell Biol 2006;8:278–84.

19] Bartel DP, Lee R, Feinbaum R. MicroRNAs: genomics, biogenesis, mechanism,and function genomics: the miRNA genes. Cell 2004;116:281–97.

[

arch 35 (2011) 208–213 213

20] Felli N, Fontana L, Pelosi E, Botta R, Bonci D, Facchiano F, et al. MicroRNAs 221and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kitreceptor down-modulation. PNAS 2005;102:18081–6.

21] Fazi F, Rosa A, Fatica A, Gelmetti V, De Marchis ML, Nervi C, et al. A minicircuitrycomprised of microRNA-223 and transcription factors NFI-A and C/EBPalpharegulates human granulopoiesis. Cell 2005;123:819–31.

22] Lu J, Guo S, Ebert BL, Zhang H, Peng X, Bosco J, et al. MicroRNA-mediatedcontrol of cell fate in megakaryocyte–erythrocyte progenitors. Dev Cell2008;14:843–53.

23] Zhao H, Wang D, Du W, Gu D, Yang R. MicroRNA and leukemia:tiny molecule, great function. Crit Rev In Oncol/Hematol 2009,doi:10.1016/j.critrevonc.2009.05.001.

24] Marcucci G, Radmacher MD, Maharry K, Mrózek K, Ruppert AS, Paschka P, etal. MicroRNA expression in cytogenetically normal acute myeloid leukemia. NEngl J Med 2008;358:1919–28.

25] Marcucci G, Maharry K, Radmacher MD, Mrózek K, Vukosavljevic T, Paschka P,et al. Prognostic significance of, and gene and microRNA expression signaturesassociated with, CEBPA mutations in cytogenetically normal acute myeloidleukemia with high-risk molecular features: a Cancer and Leukemia Group BStudy. J Clin Oncol 2008;26:5078–87.

26] Zanette DL, Rivadavia F, Molfetta GA, Barbuzano FG, Proto-Siqueira R, Silva-JrWA, et al. miRNA expression profiles in chronic lymphocytic and acute lym-phocytic leukemia. Braz J Med Biol Res 2007;40:1435–40.

27] Romania P, Lulli V, Pelosi E, Biffoni M, Peschle C, Marziali G. MicroRNA 155modulates megakaryopoiesis at progenitor and precursor level by targetingEts-1 and Meis1 transcription factors. Br J Haematol 2008;143:570–80.

28] Garzon R, Garofalo M, Martelli MP, Briesewitz R, Wang L, Fernandez-CymeringC, et al. Distinctive microRNA signature of acute myeloid leukemia bearingcytoplasmic mutated nucleophosmin. PNAS 2008;105:3945–50.

29] Mi S, Li Z, Chen P, He C, Cao D, Elkahloun A, et al. Aberrant overexpression andfunction of the miR-17-92 cluster in MLL-rearranged acute leukemia. PNAS2010;107:1–6.

30] Hickey C, Schwind S, Becker H, Alachkar H, Garzon R, Wu Y, et al. MicroRNA-181a targets TEL/AML1 expression and impairs cell proliferation in t(12;21)acute lymphocytic leukemia (ALL) cells. ASH Annual Meeting Abstracts2009;114:766.

31] Kim YJ, Bae SW, Yu SS, Bae YC, Jung JS. miR-196a regulates proliferation andosteogenic differentiation in mesenchymal stem cells derived from humanadipose tissue. J Bone Miner Res 2009;24:816–25.

32] Schimanski CC. High miR-196a levels promote the oncogenic phenotype ofcolorectal cancer cells. World J Gastroenterol 2009;15:2089.

33] Luthra R, Singh RR, Luthra MG, Li YX, Hannah C, Romans AM, et al. MicroRNA-196a targets annexin A1: a microRNA-mediated mechanism of annexin A1downregulation in cancers. Oncogene 2008;27:6667–78.

34] Popovic R, Riesbeck LE, Velu CS, Chaubey A, Zhang J, Achille NJ, et al. Regula-tion of mir-196b by MLL and its overexpression by MLL fusions contributes toimmortalization. Blood 2009;113:3314–22.

35] Baskerville S, Bartel DP. Microarray profiling of microRNAs reveals fre-quent coexpression with neighboring miRNAs and host genes. RNA 2005;11:241–7.

36] Jongen-Lavrencic M, Sun SM, Dijkstra MK, Valk PJ, Lowenberg B. MicroRNAexpression profiling in relation to the genetic heterogeneity of acute myeloidleukemia. Blood 2008;111:5078–85.

37] Alcalay M, Tiacci E, Bergomas R, Bigerna B, Venturini E, Minardi SP, et al.

Brief report Acute myeloid leukemia bearing cytoplasmic nucleophosmin(NPMc + AML) shows a distinct gene expression profile characterized by up-regulation of genes involved in stem-cell maintenance Study design. Blood2005;106:899–902.

38] Yekta S, Shih I, Bartel DP. MicroRNA-directed cleavage of HOXB8 mRNA. Science2004;304:594–6.