Students Constructing Their Own Knowledge

to Understand

Mutation

Lauren Schultz, Trista Strauch, Tasia Taxis, Lindsey Veautour

Facilitator: John Merrill

Background

• Please respond as a student in intro bio• You’ve been exposed to basic info about

mutation, phenotype, genotype, and central dogma.

30-Second Sentence

Write down a definition of

mutation

1. An organism fails to thrivein its environment.

Is this a mutation?

Yes ANo B

2. An organism is exceptionally successful in its environment. Is this a mutation?

Yes ANo B

3. An organism has a new variant protein that is detrimental.

Is this a mutation?

Yes ANo B

4. An organism has a new variant protein that is beneficial.

Is this a mutation?

Yes ANo B

5. There is a genetic change that results in no change in the protein.

Is this a mutation?

Yes ANo B

1. An organism fails to thrive in its environment.

2. An organism is exceptionally successful in its environment.

3. An organism has a new variant protein that is detrimental.

4. An organism has a new variant protein that is beneficial.

5. There is a genetic change that results in no change in the protein.

Vote

Positive Mutation A

Negative Mutation B

Defend your vote to your neighbor

Revote

Positive Mutation A

Negative Mutation B

Holstein Piedmontese

Belgian Blue

Teaching ChallengeStudents memorize a definition of mutation as a “change in the genetic material,” but hold onto misconceptions that are at odds with this definition.

Teachable Unit Framework

Learning Objectives Students will formulate a working definition of a mutation

and use it assess whether a mutation has occurred. Tidbit One- 30 second paper, Guided-Inquiry Clicker Qs Given various scenarios, students will be able to evaluate

whether a mutation will lead to a phenotypic variation. Tidbit Two- Double-Muscle Cattle Scenario

Students will be able to predict how a given mutation would change an individual’s fitness in a specific environment.

Students will be able to show that mutations comprise the basis of genetic variability in a population.

Teachable Unit Framework

Sickle-Cell Case Study- Mutations can affect an organism’s fitness based on environment.

Tidbit #3

• A mutation occurs such that there is a single amino acid change in the resultant protein. If an individual has two copies of this mutated gene, an illness occurs that can lead to frequent infections and shortened lifespan.

• Individuals with a single copy of this variant have 60% protection against mortality from an endemic disease.

Would you expect this gene variant to persist in the population?

Tidbit #3

Coat Color Variation Scenario- Mutations comprise the basis of genetic variability.

Tidbit #4

A small group of animals moves from the mainland to an island, founding a new population. There is no subsequent movement of animals on or off the island. This initial population included coat color variation. Some years afterward, however, a new pattern variation arose that was previously not observed in the population. Following subsequent genetic analysis, it is determined that this haircoat is the result of a new variant of a protein.

In simplest terms, how did it arise?

Tidbit #4

Post Class Formative Assessment

Question #

Change in DNA

Change in Protein

Change in Phenotype

Effect on Organism

Is this a Mutation?

Why or Why Not?

1 Yes Yes Yes Negative Y There is a change in DNA.

2 Yes Yes Yes Positive Y There is a change in DNA.

3 Yes Yes Yes None Y There is a change in DNA.

4 Yes Yes No None Y There is a change in DNA.

5 Yes No No None Y There is a change in DNA.

6 No Yes No None N No change in DNA.

7 No No No None N No change in DNA.

Learning Objectives 1 and 2

Post Class Formative AssessmentLearning Objectives 3 and 4

You have new variations of haircoat—dark with stripes, dark with no stripes, light with stripes, and light with no stripes. Consider the selective pressures that might exist on an island, and how this variation in coat color and pattern could impact survival and fitness in different habitats on the island. Pick one of the coat colors and describe an environment on this island where you think this variant would have better fitness than the other variants.

Summative AssessmentLearning Objectives 1 and 2

ACTGCCTGATACATGTAGGC

Based on the sequence above decide whether a mutation occurred, and predict any effect on the population.

Suppose the sequence shown above is part of the non-coding portion of a chromosome. The first G from the left in the above sequence changes to an A. Did a mutation occur? Predicted effect on the population: Suppose the sequence shown above is part of the non-coding portion of a chromosome. The first G from the left in the above sequence changes to a C. Did a mutation occur? Predicted effect on the population:

Thank you!