of 9 /9
Vol. 4. No. 10 MOLECULAR AND CELLULAR BIOLOGY, OCt. 1984, p. 2161-2169 0270-7306/84/102161-09$02.00/0 Copyright © 1984, American Society for Microbiology Molecular Cloning and Nucleotide Sequence Analysis of the Saccharomyces cerevisiae RADI Gene ELIZABETH YANG AND ERROL C. FRIEDBERG* Laboratory of Experimental Oncology, Department of Pathology, Stanford University Sc hool of Medicine, Stanford, California 94305 Received 10 April 1984/Accepted 10 July 1984 We have screened a yeast genomic library for complementation of the UV sensitivity of mutants defective in the RADI gene and isolated a plasmid designated pNF1000 with an 8.9-kilobase insert. This multicopy plasmid quantitatively complemented the UV sensitivity of two radi mutants tested but did not affect the UV resistance of other rad mutants. The location of the UV resistance function in pNF1000 was determined by deletion analysis, and an internal fragment of the putative RADI gene was integrated into the genome of a RADI strain. Genetic analysis of several integrants showed that integration occurred at the chromosomal RADI site, demonstrating that the internal fragment was derived from the RADI gene. A 3.88-kilobase region of pNF1000 was sequenced and showed the presence of a small open reading frame 243 nucleotides long that is apparently unrelated to RADI, as well as a 2,916-nucleotide larger open reading frame presumed to encode RADl protein. Depending on which of two possible ATG codons initiates translation, the size of the RAD1 protein is calculated at 110 or 97 kilodaltons. Biochemical complexity in the incision of damaged DNA during the process of excision repair is evident in the procaryote Escherichia coli, in which the products of three genes (uvrA, uvrB, and uvrC) are required for incision of UV-irradiated DNA both in vivo and in vitro (19, 21, 22, 30, 31). No equivalent DNA incising activity has been purified or characterized from any eucaryotic source to date. Previ- ous studies carried out in this laboratory (17) and by Wilcox and Prakash (28) have demonstrated that in the lower eucaryote Saccharomyces cerevisiae, multiple genes are required for DNA incision during excision repair by UV- irradiated cells. Specifically, of a number of different RAD loci examined, mutants defective in the RADI, RAD2, RAD3, RAD4, and RADIO genes showed no detectable incubation-dependent strand breaks in nuclear DNA during post-UV incubation at 30°C (17). In addition, with the use of pyrimidine dimer-specific enzyme probes, it was shown that these mutants did not detectably lose enzyme-sensitive sites from their DNA during post-irradiation incubation (28). Since DNA incision is apparently a specific enzymatic event during excision repair of damaged DNA, we are currently investigating the role of these five RAD genes in the incision of DNA at sites of base damage (6). We have undertaken the molecular cloning of these genes, with a view to characterizing each and to studying the biochemistry of the proteins that they encode. We have previously described the isolation of recombination plasmids containing the yeast RAD3 (14) and RAD2 (16) genes of S. cerevisiae. In this report, we present the complete nucleotide sequence of the RADI gene. This gene was sequenced after the isolation and characterization of a recombinant plasmid designated pNF1000. The molecular cloning of the RADI gene has also been described by Yasui and Chevalier (29) and by Higgins et al. (7). MATERIALS AND METHODS Yeast and bacterial strains. Haploid yeast strains carrying the ura3-52 mutation were constructed by mating radi * Corresponding author. 2161 mutants to strain SX46a (ura3-52), sporulating the diploids, and isolating the appropriate haploids. Strains radl-1, rad2- 1. rad3-2, rad44, and radiO-I were obtained from the Yeast Genetic Stock Center, Berkeley, Calif. The radl-i9, rad2-2, and rad24 strains were provided by R. Reynolds, School of Public Health, Harvard University, Cambridge, Mass. E. coli HB101 is maintained in our laboratory stocks. E. coli SR73(uvrA6 recA13), E. coli SR58(uvrB5 recA56), and E. coli SR57(uvrC recA56) were obtained from N. Sargentini, Stanford University, Stanford, Calif. Culture media. E. coli was grown in L broth, supplement- ed with ampicillin (50 ,ug/ml) where appropriate. Yeast minimal medium consisted of 0.17% yeast nitrogen base (Difco Laboratories, Detroit, Mich.) without amino acids or ammonium sulfate, plus 0.5% ammonium sulfate and 2% dextrose. This medium was supplemented with 30 ,ug of histidine, 30 p,g of tryptophan, 20 ,ug of uracil, and 30 ,ug of adenine per ml as required. Complete medium contained 1% yeast extract, 2% peptone, and 2% dextrose (YPD). Sporula- tion plates contained 0.1 M potassium acetate, 0.25% yeast extract, 2% dextrose, and 2% agar. For transformation with plasmid DNA, yeast cells treated with glusulase were plated on regeneration agar consisting of minimal medium plus 1.0 M sorbitol in 3% agar. Preparation of DNA. Yeast lysates were prepared from spheroplasts or by the use of glass beads (14). Plasmids were extracted from E. coli transformants by an alkaline lysis procedure (2). Large-scale purification of plasmid DNA from E. coli was carried out in cesium chloride-ethidium bromide gradients as described by Davis et al. (5). Transformation of cells with DNA. Transformation of E. coli with plasmid DNA was carried out according to Cohen et al. (4). Transformation of yeast cells was performed by the procedure of Hinnen et al. (8). Characterization of DNA. Restriction enzymes were pur- chased from Bethesda Research Laboratories, Bethesda, Md., and from New England BioLabs, Boston, Mass., and were used according to the directions in Davis et al. (5). Calf alkaline phosphatase was obtained from Boehringer Mann- heim Biochemicals, Indianapolis, Ind. Gel electrophoresis of on January 30, 2018 by guest http://mcb.asm.org/ Downloaded from

Saccharomyces cerevisiae RADI Gene

Embed Size (px)

Citation preview

Page 1: Saccharomyces cerevisiae RADI Gene

Vol. 4. No. 10MOLECULAR AND CELLULAR BIOLOGY, OCt. 1984, p. 2161-21690270-7306/84/102161-09$02.00/0Copyright © 1984, American Society for Microbiology

Molecular Cloning and Nucleotide Sequence Analysis of theSaccharomyces cerevisiae RADI Gene

ELIZABETH YANG AND ERROL C. FRIEDBERG*Laboratory of Experimental Oncology, Department of Pathology, Stanford University Sc hool of Medicine, Stanford,

California 94305

Received 10 April 1984/Accepted 10 July 1984

We have screened a yeast genomic library for complementation of the UV sensitivity of mutants defective inthe RADI gene and isolated a plasmid designated pNF1000 with an 8.9-kilobase insert. This multicopy plasmidquantitatively complemented the UV sensitivity of two radi mutants tested but did not affect the UV resistanceof other rad mutants. The location of the UV resistance function in pNF1000 was determined by deletionanalysis, and an internal fragment of the putative RADI gene was integrated into the genome of a RADI strain.Genetic analysis of several integrants showed that integration occurred at the chromosomal RADI site,demonstrating that the internal fragment was derived from the RADI gene. A 3.88-kilobase region of pNF1000was sequenced and showed the presence of a small open reading frame 243 nucleotides long that is apparentlyunrelated to RADI, as well as a 2,916-nucleotide larger open reading frame presumed to encode RADl protein.Depending on which of two possible ATG codons initiates translation, the size of the RAD1 protein is calculatedat 110 or 97 kilodaltons.

Biochemical complexity in the incision of damaged DNAduring the process of excision repair is evident in theprocaryote Escherichia coli, in which the products of threegenes (uvrA, uvrB, and uvrC) are required for incision ofUV-irradiated DNA both in vivo and in vitro (19, 21, 22, 30,31). No equivalent DNA incising activity has been purifiedor characterized from any eucaryotic source to date. Previ-ous studies carried out in this laboratory (17) and by Wilcoxand Prakash (28) have demonstrated that in the lowereucaryote Saccharomyces cerevisiae, multiple genes arerequired for DNA incision during excision repair by UV-irradiated cells. Specifically, of a number of different RADloci examined, mutants defective in the RADI, RAD2,RAD3, RAD4, and RADIO genes showed no detectableincubation-dependent strand breaks in nuclear DNA duringpost-UV incubation at 30°C (17). In addition, with the use ofpyrimidine dimer-specific enzyme probes, it was shown thatthese mutants did not detectably lose enzyme-sensitive sitesfrom their DNA during post-irradiation incubation (28).

Since DNA incision is apparently a specific enzymaticevent during excision repair of damaged DNA, we arecurrently investigating the role of these five RAD genes inthe incision of DNA at sites of base damage (6). We haveundertaken the molecular cloning of these genes, with a viewto characterizing each and to studying the biochemistry ofthe proteins that they encode. We have previously describedthe isolation of recombination plasmids containing the yeastRAD3 (14) and RAD2 (16) genes of S. cerevisiae. In thisreport, we present the complete nucleotide sequence of theRADI gene. This gene was sequenced after the isolation andcharacterization of a recombinant plasmid designatedpNF1000. The molecular cloning of the RADI gene has alsobeen described by Yasui and Chevalier (29) and by Higginset al. (7).

MATERIALS AND METHODSYeast and bacterial strains. Haploid yeast strains carrying

the ura3-52 mutation were constructed by mating radi

* Corresponding author.

2161

mutants to strain SX46a (ura3-52), sporulating the diploids,and isolating the appropriate haploids. Strains radl-1, rad2-1. rad3-2, rad44, and radiO-I were obtained from the YeastGenetic Stock Center, Berkeley, Calif. The radl-i9, rad2-2,and rad24 strains were provided by R. Reynolds, School ofPublic Health, Harvard University, Cambridge, Mass. E.coli HB101 is maintained in our laboratory stocks. E. coliSR73(uvrA6 recA13), E. coli SR58(uvrB5 recA56), and E.coli SR57(uvrC recA56) were obtained from N. Sargentini,Stanford University, Stanford, Calif.

Culture media. E. coli was grown in L broth, supplement-ed with ampicillin (50 ,ug/ml) where appropriate. Yeastminimal medium consisted of 0.17% yeast nitrogen base(Difco Laboratories, Detroit, Mich.) without amino acids orammonium sulfate, plus 0.5% ammonium sulfate and 2%dextrose. This medium was supplemented with 30 ,ug ofhistidine, 30 p,g of tryptophan, 20 ,ug of uracil, and 30 ,ug ofadenine per ml as required. Complete medium contained 1%yeast extract, 2% peptone, and 2% dextrose (YPD). Sporula-tion plates contained 0.1 M potassium acetate, 0.25% yeastextract, 2% dextrose, and 2% agar. For transformation withplasmid DNA, yeast cells treated with glusulase were platedon regeneration agar consisting of minimal medium plus 1.0M sorbitol in 3% agar.

Preparation of DNA. Yeast lysates were prepared fromspheroplasts or by the use of glass beads (14). Plasmids wereextracted from E. coli transformants by an alkaline lysisprocedure (2). Large-scale purification of plasmid DNA fromE. coli was carried out in cesium chloride-ethidium bromidegradients as described by Davis et al. (5).

Transformation of cells with DNA. Transformation of E.coli with plasmid DNA was carried out according to Cohenet al. (4). Transformation of yeast cells was performed by theprocedure of Hinnen et al. (8).

Characterization of DNA. Restriction enzymes were pur-chased from Bethesda Research Laboratories, Bethesda,Md., and from New England BioLabs, Boston, Mass., andwere used according to the directions in Davis et al. (5). Calfalkaline phosphatase was obtained from Boehringer Mann-heim Biochemicals, Indianapolis, Ind. Gel electrophoresis of

on January 30, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

Page 2: Saccharomyces cerevisiae RADI Gene

2162 YANG AND FRIEDBERG

DNA was carried out as described by Davis et al. (5). 32plabeling of DNA by nick translation was performed asdescribed by Rigby et al. (18). DNA was transferred to ATPpaper prepared as described by Seed (23) and hybridizedaccording to Alwine et al. (1).BAL-31 nuclease (New England BioLabs) was used for

constructing plasmid deletions. Reactions (50 to 100 ,ul)contained 12 mM CaCl2, 12 mM MgCl2, 0.2 M NaCl, 20 mMTris-hydrochloride (pH 8), and 1 mM EDTA. Reactionswere at 37°C for various times and were terminated byadding EGTA [ethyleneglycol-bis(O-aminoethyl ether)-N, N-tetraacetic acid] to a 50 mM final concentration. The DNAwas precipitated with ethanol and cut with restriction en-zymes. Fragments of desired sizes were isolated by gelelectrophoresis and cloned into appropriate plasmid vectors.DNA sequencing. Various restriction fragments were sub-

cloned into pBR322, and convenient restriction sites wereradiolabeled at their 5' ends with [y-32P]ATP and polynucle-otide kinase (11) or at their 3' ends with [a-32P]deoxynucleo-sidetriphosphate and the Klenow fragment of E. coli DNApolymerase I (11). Sequencing chemistries were performedby the procedure ofMaxam and Gilbert (12, 13). Electropho-resis was carried out in 5 or 6% 85-cm sequencing gels or in8% 40-cm gels. Both strands of each fragment were se-quenced, and in most cases each strand was sequenced morethan once. Sequencing across all restriction sites used forradiolabeling was also performed. Computer analysis ofsequences was carried out by using the SUMEX-AIM pro-gram and the program by Wilbur and Lipman (27).Measurement of UV survival of yeast strains. Quantitative

UV survival of transformed yeast strains was performed asdescribed by Naumovski and Friedberg (14).

RESULTSIsolation of plasmid pNF1000. A haploid radl-J ura3-52

strain was transformed with the yeast gene pool constructedby Carlson and Botstein (3), and Ura+ transformants werescreened for UV resistance at 25 J of UV radiation per m2 bythe replica plating technique previously described (14). Afterthe screening of ca. 3,500 transformants, a single UV-resistant colony was identified. This transformant was sub-cultured on complete medium (i.e., under nonselective con-ditions), and individual colonies were tested for the presence

raJ 11rad2-2rad3-2rad4-4RAD*

pNFIOOO YEp24

FIG. 1. Plasmid pNF1000 specifically complements the UV sen-sitivity of radi mutants. The various rad strains shown weretransformed with either pNF1000 or YEp24, and cultures werestreaked across agar plates. An untransformed RAD+ strain wasstreaked as a positive control. The plates were exposed to stepwisegraded doses of UV radiation (0 to 50 J/m2 from right to left) andincubated at 30°C.

.-,%

0.1

-j

>4

0.0a

UV DOSE (J/m2)

FIG. 2. Quantitative determination of survival of yeast strainsafter exposure to UV radiation. Cells were grown in minimalmedium to an absorbance at 600 nm of 1 to 1.5. Appropriatedilutions were made in 66 mM sodium phosphate (pH 7.5). Samplesof cells were spread on YPD plates, irradiated under non-photoreac-tivating light at the doses indicated, and incubated at 30°C for 5 daysbefore colonies were quantitated. Symbols: 0, SX46a (RAD+); 0,

SX46a transformed with YEp24; &, SX46a transformed withpNF1000; A, radl-1; A, radl-l transformed with YEp24; A. radl-Jtransformed with pNF1000; U, rad24; O, rad24 transformed withYEp24; E, rad24 transformed with pNF1000.

of a plasmid containing the putative RADI gene by demon-strating cosegregation of the UV resistance and Ura+ pheno-types when plated on minimal medium (i.e., under selectiveconditions). DNA was extracted from one such colony andwas propagated in E. coli HB101. A single plasmid wasrecovered from the transformants and was designatedpNF1000.When transformed back into yeast cells, this plasmid

complemented the UV sensitivity of radl-J and radl-19mutants but not that of rad2-2, rad3-2, rad44 (Fig. 1) or of

i.-.

MOL. CELL. BIOL.

.,dmbm-

"

on January 30, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

Page 3: Saccharomyces cerevisiae RADI Gene

RADI GENE OF S. CEREVISIAE 2163

(A)

PLASMID

pNF1000

40 >vI a.cn

I I

C) (0UZHQJ CTY |cCLJ l I I

c4 o Y..0m

CD- 00D CDw to 9-

LI L

ORF

pNF1007pNF1002pNF1004

pNF1001pNF1007 D9

pNF1007 D12pNF1007 DllpNF1007 D16

ORF

UVRP

C)'C) c

1 kb

I i

I ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~I

5'

(B)3'

-.._. _

_

3'

5'

FIG. 3. Restriction map of pNF1000 and various deletion plasmids and a diagrammatic representation of the restriction fragments used forthe nucleotide sequence determination of RADI. (A) The locations of some of the restriction sites in pNF1000 are indicated by numbers thatcorrespond to the 5' nucleotide of the restriction site in the sequence shown in Fig. 6. The beginning of the sequenced region is indicated as 1,and the locations of the two ORFs are shown. The UV resistance (UVR) phenotype of various deletion plasmids and the extent of the deletionsin each are shown. (B) Diagrammatic representation of the strategy used for the sequencing of 3.884 kb of DNA from plasmid pNF1007.

rad24 or radIO-I mutants (data not shown). Quantitativesurvival of yeast strains is shown in Fig. 2. Plasmid pNF1000transformed radi-i and radl-19 strains to levels of UVresistance very close to that of the wild-type strain S288C.The UV resistance of this strain was unaffected by transfor-mation with the vector YEp24 (Fig. 2). A rad2 mutanttransformed with pNF1000 or YEp24 also showed no detect-able increase in UV resistance by this quantitative analysis(Fig. 2).

Restriction and deletion mapping of pNF1000. Digestion ofplasmid pNF1000 with various restriction enzymes andanalysis of DNA fragments by gel electrophoresis yieldedthe restriction map shown in Fig. 3. The cloned yeast DNAinsert that complemented radl mutants is 8.9 kilobases (kb)in size. To localize the gene within this insert, a 3.8-kb BglIIfragment was deleted and the plasmid was religated, yieldingplasmid pNF1002. This derivative no longer complementedradl mutants (Fig. 3A). Similarly, when a 2.6-kb SstIfragment (Fig. 3A) was deleted, the resultant plasmid(pNF1001) conferred only partial resistance to radl-i andradl-19 strains (Fig. 4). To establish that the putative RADIgene was not contained entirely within the BglII fragment,we subcloned this 3.8-kb segment of DNA into the BamHI

site of plasmid YEp24. The plasmid so derived did not conferdetectable UV resistance to radl-l or radl-i9 (data notshown). We therefore conclude that the UV resistancedeterminant that complements radl mutants spans the inter-nal BglII and SstI sites shown in Fig. 3 at positions 3,124 and815, respectively, of the nucleotide sequence (see below).

Plasmid pNF1000 contains the RADl gene. To prove thatthe enhanced UV resistance of radl mutants transformedwith pNF1000 reflects the expression of the RADI generather than a nonspecific phenotypic effect, we carried outgenetic analysis of transformants derived by integration ofan internal fragment of the cloned gene into the genome of aRad+ strain. A 1.69-kb EcoRI-BgIII DNA fragment (frompositions 1,431 to 3,124 of the nucleotide sequence [Fig. 3])missing both the 5' and 3' ends of the putative RAD1 gene, asdefined by the deletion mapping described above, wassubcloned into the integrating vector Ylp5 (26). After trans-formation of a Rad+ strain with this plasmid (pNF1005),integration by homologous recombination between thecloned internal fragment and the chromosomal RAD1 genewould generate a Ura+ Rad- mutant strain containing twodefective radl genes, one truncated at its 3' end and onetruncated at its 5' end, separated by the vector sequences

+

+

+

-I-

+

+

i I

I

Ii I

VOL. 4, 1984

on January 30, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

Page 4: Saccharomyces cerevisiae RADI Gene

2164 YANG AND FRIEDBERG

present in the two control (nonintegrant) DNA samples. Aunique hybridization band of -5.7 kb was observed indigests of the nonintegrant RADl and radl DNAs (Fig. 5).Hybridization to the restricted integrant DNA, on the otherhand, yielded two bands of -5.8 and -7.2 kb, indicating thatplasmid pNF1005 had integrated into the genome of thestable transformants.Proof that the integration event occurred by homologous

recombination at the chromosomal RADI locus was ob-tained by tetrad analysis. The two integrants were mated toRAD and radl strains, diploids were isolated by microma-nipulation, and conventional tetrad analysis was carried outafter sporulation. All tetrads derived from crosses with aRAD ura3-52 strain showed a 2+ :2- segregation of the UV-resistant (Rad+) phenotype (Table 1). In all cases, the twoUV-resistant spores were phenotypically Ura- and the twoUV-sensitive spores were Ura+ (Table 1). On the otherhand, all tetrads isolated from crosses of the integrants withthe radl-J mutant segregated 0:4 for Rad+:Rad-, whereas

1 2 3

kb

-23.7

- 9.5

- 6.7

- 4.3

70UV DOSE (J/m2)

FIG. 4. Plasmid pNF1001 only partially complements the UVsensitivity of radl mutants. Quantitative UV survival was deter-mined as described in the legend to Fig. 2.

(15, 20, 25). Integration by homologous recombination at thehost URA3 gene would leave the host RADI gene unaffectedand would result in a Ura+ Rad+ phenotype. Seven stableUra+ Rad- integrants were obtained by transformation ofthe RAD strain SX46a with pNF1005, and two of these werestudied further.

Direct physical evidence for the integration event wasprovided by probing restricted DNA from integrant andnonintegrant strains with the 1.69-kb internal fragment sub-cloned into pBR322. DNA was digested with HpaI andPvuII, both of which cut outside the putative RADI gene(Fig. 3A). We expected the probe to hybridize to a singleband in wild-type and radl nonintegrant DNA digests.However, the probe should hybridize to two discrete bandsin the integrant DNA because the integrating plasmid con-tains a single PvuII site in the vector. Since the integratingplasmid is 6.9 kb long, the additive sizes of the two bandsshould be -6.9 kb larger than the single hybridizing fragment

2.3

- 2.0

FIG. 5. Southern hybridization of integrant and nonintegrantDNAs. Yeast DNAs were restricted with HpaI and PvuII, electro-phoresed on a 0.7% agarose gel, transferred to ATP paper, andhybridized with a radiolabeled 1.6-kb EcoRI-BgIII RADI fragmentin pBR322. Lane 1, DNA from the RAD+ strain SX46a; lane 2, DNAfrom radl-1, lane 3, DNA from SX46a transformed with pNF1005.The fragment sizes shown on the right were derived from X

restriction fragments of known size.

100'

10

0.1

0.01

eJ5:DOf)

0.001

0.0001

0.00001

MOL. CELL. BIOL.

4w,.

.I''s -. on January 30, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

Page 5: Saccharomyces cerevisiae RADI Gene

RADI GENE OF S. CEREVISIAE 2165

TABLE 1. Genetic analysis of RADI integrantsNo. of tetrads showing marker segregation

MarkerGenetic cross segregation Mating

ratio Type Ade Ura UVR(a/c)

radl-I x SX46a 4+:0-(ade2 ura3 radl) (ade2 ura3 RADI) 3+:l-

2+:2- 17 171+:3-0+ :4- 17 17

Int2 x EY101 4+:0-(ade2 URA3 radl) (ADE2 ura3 RADI) 3+:1-

2+:2- 24 24 24 241+:3-0+ :4-

Int4 x EY101 4+:0-(ade2 URA3 radl) (ADE2 ura3 RADI) 3+ :1 -

2+:2- 26 26 26 261+:3-0+:4-

Int2 x radl-J 4+:0-(ade2 URA3 radl) (ade2 ura3 radl) 3+:l-

2+:2- 23 231+:3-0+ :4- 23 23

Int4 x radl-J 4+:0-(ade2 URA3 radl) (ade2 ura3 radl) 3+:l-

2+:2- 16 161+:3-0+ :4- 16 16

the Ura markers segregated 2+:2- (Table 1). Normal segre-gation of all control genetic markers was observed (Table 1).These results indicate that the cloned internal fragmentintegrated into the RADI gene of the wild-type strain,converting the integrants to radl mutants, i.e., the internalfragment is derived from the yeast RADI gene. Consistentwith the interpretation that the integrants are radl mutants,full complementation of UV sensitivity was observed indiploids derived from matings of both integrants with rad2-1,rad3-1, rad4-2, and radiO-I mutants (data not shown). Basedon these collective data, we conclude that the insert inpNF1000 contains the yeast RADI gene.

Nucleotide sequence of the RADI gene. Plasmid pNF1007contained a 5.7-kb insert that included the RADI gene andfully complemented the UV sensitivity of radl-1 and radl-19(Fig. 3A). The basic strategy for sequencing a 3,884-nucleo-tide region from this insert is shown diagrammatically in Fig.3B. The nucleotide and predicted amino acid sequences areshown in Fig. 6. At position 130 in the sequence weidentified the beginning of a short open reading frame (ORF)that included a total of 243 base pairs before terminating at aTGA translational stop codon at position 373. A second,much longer ORF of 2,916 bp starts 403 bp downstream fromthe shorter one at position 779, and also terminates with thestop codon TGA at position 3,695. This ORF contains theSstI, EcoRI, and BglII sites that were shown above to berequired for normal functioning of the RADI gene.We considered the possibilities that the two ORFs might

reflect the presence of two exons in the RADI gene, or thatthe small ORF encodes a product that regulates the expres-sion of RADI (the larger ORF). These possibilities wereexamined by constructing plasmids with deletions extendingin from the region 5' to the small ORF. All of the deletedplasmids, including pNF1007D16, which extended partlyinto the small ORF but which left the EcoRI site at position

339 in the sequence intact (Fig. 3A), as well as plasmidspNF1007D9, D12, and Dll, which deleted the entire smallORF (Fig. 3A), fully complemented the UV sensitivity ofradl-i and radl-19 strains as determined qualitatively bystreak testing. In addition, computer analysis of 1,000 bpbetween positions 101 and 1,000 of the sequence did notreveal the consensus internally conserved sequenceTACTAAC, located 35 to 70 bp upstream from the 3' splicejunction (9, 10) in all studied RNA polymerase II-transcribedyeast genes that contained introns. Based on these results, itis likely that the large ORF contains the entire codingsequence of the RADI gene. However, it is not yet estab-lished which ATG codon is the translation initiation site,since in addition to the ATG codon at position 779, a secondATG in frame with the first is present 333 bp into thesequence at position 1,112 (Fig. 6).We identified the putative consensus polyadenylation sig-

nal AATAAA 38 bp downstream from the TGA translationalstop codon at position 3,695 of the sequence (Fig. 6).Additionally, the sequence AATAAG is present close to thetermination of the sequenced region (Fig. 6). Beginning atposition 3,824, 127 bp 3' to the stop codon, the sequenceTAG ... (A-T rich) ... TTT is present and bears closeresemblance to the consensus sequence thought to be re-quired for transcription termination in yeast (32). Severalvery A-T-rich regions were identified 5' to both ATG codonsin the large ORF. However, unlike higher eucaryotes, yeastTATA boxes are not always located at -35 bp from thetranscriptional start, but may be situated as far as 200 bpupstream (24). Hence it is not particularly useful to attemptto locate transcriptional promoters from the nucleotide se-quence alone.The frequency of codon usage in the 972-codon large ORF

shows no remarkable codon bias (data not shown). Acomputer search revealed no significant homology between

VOL. 4, 1984

on January 30, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

Page 6: Saccharomyces cerevisiae RADI Gene

2166 YANG AND FRIEDBERG MOL. CELL. BIOL.

10 20 30 40 50 60 70 80 90 100CAAAACAACCGCATATTTAAAAGGCGATTCGATTGAGAAACAAGCCAAACAACCCCAATAGGTAAGTTACCTCGAAGAGCCAAAATATTCCTGATTCCTG

' 200CATTATAACATCTATCCAGCGCATCATCAATGATGGCTTTTTCTGTGTTTGTACAGGTCAAATGCATACAAACTGGTATATTTAGTGTCTGCTGTGCCAA

MetMetAlaPheSerValPheValGlnValLysCysIleGlnThrGl yIlePheSerValCysCysAlaLy

300GGAAGCTAATGTCAGAGTCTTTTCCGCAGTAGTACCACCTGCTCCCCAAGTAACCGTGATAAACAGTGGATCTAAAGCAGTCATACGATGCATACGTTCCsGluAlaAsnValArgValPheSerAlaValValProProAlaProGlnValThrValIleAsnSerGlySerLysAlaValIleArgCysIleArgSer

EcoRl 400ATCAAATTTCTCGTCCCTAATTCAGTCTTTGGAGGGGAAAATTCTAACGATATAAAAGGGGAAGCCCTCGCATGATATAAATCTCTGATGGACATGTTTAIleLysPheLeuValProAsnSerValPhelyGlyyLysAsnSerAsnAsnIleLysGlyGluAlaLeuAla

500

600CCAACAACCTGAAGTGTTCTCTGTTTGCCTTTATTTTGCGACTTTTCTTCGTCATTGAAGTTAGAAAAAGCTTACTCGCTTATCTCCTGGAGTAAGCTAT

700AGCCACAGTCAATATCGCGTCTAATGAAAAAAAAAAGTCGGGACGAGTAAACTTTTGTCTGCGTGGCGCATAGGAGAGGAGAGAGCACAGGTGTACTGGA

800GGGTTCAGGACGTTGGTAGAGCATTTGCTAAATGTGTAAAAATAATATTGCACTATCCTGTTGAAAATATCTTTTCA1rFCTCAGTTATTTTATCAGG

MetSerGlnLeuPheTyrGlnG

Sst I. 900GCGACTCTGATGATGAGCTCCAGGAGGAACTTACGAGGCAGACAACTCAAGCATCTCAAAGTTCTAAAATTAAAAATGAAGATGAACCCGACGACTCCAA1 yAspSerAspAspGl uLeuGlnGl uGl uLeuThrArgGlnThrThrGlnAlaSerGlnSerSerLysIleLysAsnGl uAspGl uProAspAspSerAsII I'I 1000

TCATCT TAATGAGGTGGAAAATGAAGATAGCAAAGTTTTAGATGACGATGCAGTGTTATACCCTCTTATACCTAATGAGCCAGATGACATAGAAACGTCTnHisLeuAsnGl uValGl uAsnGl uAspSerL ysValLeuAspAspAspAlaValLeuTyrProLeuIleProAsnGl uProAspAsplleGl uThrSer

IIIII 1100AAGCCCAATATTAACGATATTAGGCCAGTTGATATTCAATTGACTTTACCATTGCCGTTTCAGCAAAAAGTGGTAGAGAATTCATTAATTACTGAAGATGLysProAsnIleAsnAspIleArgProValAspIleGlnLeuThrLeuProLeuProPheGlnGlnL ysVal ValGl uAsnSerLeuIleThrGl uAspA

1200CATTAATCATAEGGGAAAGGACTAGGATTGCTTGATATTGTGGCCAATTTATTGCATGTTTTAGCTACACCAACATCCATTAACGGACAACTAAAGCGlaLeuIleIleMetGlyLysCl yLeuGlyLeuLeuAspIleValAlaAsnLeuLeuHisValLeuAlaThrProThrSerIleAsnGlyGlnLeuLysAr

$ | 1300AGCGCTCGTCCTAGTGTTGAATGCAAAACCTATAGATAATGTAAGAATCAAGGAGGCCTTAGMGAGCTGTCGTGGTTCTCTAATACTGGGAAGGACGACgAlaLeuValLeuValLeuAsnAlaLysProIleAspAsnValArglleLysGl uAlaLeuGluGl uLeuSerTrpPheSerAsnThrGl yLysAspAsp

. , 1400

GACGATACTGCTGTCGAGAGCGATGATGAACTTTTTGAAAGGCCTTTTAACGTAGTTACCGCGGACTCGCTGAGCATTGAAAAGAGAAGAAAGCTATATAAspAspThrAlaValGl uSerAspAspGl uLeuPheCluArgProPheAsnVal Val ThrAlaAspSerLeuSerIleGl uLysArgArgLysLeuTyrI

I 1 500TTTCTGGCGGAATCTTGAGCATTACTTCTAGAATTCTCATTGTGAATCTCTTATCCGGCATTGTTCACCCAAATAGGGTTACGGGTATGCTGGTATTGAAleSerGl yGl ylleLeuSerlleThrSerArgIleLeulleValAsnLeuLeuSerGl ylleValfHisProAsnArgVal ThrGl yMetLeuValLeuAs

I* 1600T GCAGAC-TCACTTCGACATAATTCGAATGAATCGTTTATAT-TAGAGAT TTACAGG TCTAAMAATAC TTGGGGT TTTATTAAAGCC TTTT CTGAAGCACCAnAl aAspSerLeuArgHisAsnSerAsnGl uSerPheIleLeuGl uIleTyrArgSerLysAsnThrTrpGl yPheIleLysAlaPheSerGl uAlaPro

1700

GAGACGTTTGTCATGGAATTTTCACCCCTCAGGACGAAAATGAAAGAATTACGGCTAAAGAACGTTTTGCTATGGCCGAGGTTCAGGGTAGAGGTCTCTTGl uThrPheValMetGl uPheSerProLeuArgThrL ysMetL ysGl uLeuArgLeuL ysAsnValLeuLeuTrpProArgPheArgValGl uValSerSIIII 1800

CCTGTTTGAATGCCACTAATAAGACGTCACACAATAAAGTCATTGAAGTCAAGGTCTCCTTAACAAATTCCATGTCTCAGATACAGTTTGGCTTGATGGAerCysLeuAsnAlaThrAsnLysThrSerHisAsnLysValI1eGl uValLysValSerLeuThrAsnSerMetSerGln1leGlnPheGl yLeuMetGl

' 1900ATGTTTGAAAAMATGTATTGCTGAGTTAAGCAGAAAAMATCCTGAACTAGCTCTGGACTGGTGGAATATGGAAAATGTCCTAGATATAAACTTTATCAGGuCysLeuLysLysCysIleAlaGluLeuSerArgLysAsnProGl uLeuAlaLeuAspTrpTrpAsnMetGl uAsnValLeuAspIleAsnPhelleArg

2000

TCAATTGACTCGGTGATGGTGCCGAACTGGCACCGAATTTCTTATGAATCAAACAACTGGTTAAGGATATAAGATTCCTACGCCACCTTTTAAAGATGCSerIleAspSerValMetValProAsnTrpHisArgIleSerTyrGl uSerLysGlnLeuValLysAsplleArgPheLeuArgHisLeuLeuLysMetL

2100TCGTMACTTCAGACGCAGTTGACTTTTTTGGAGAGATTCAATTAAGTTTGGATGCCAATAAACCGTCAGTATCCCGAALyTACAGCGAATCACCGTGGCTeuVal ThrSerAspAla ValAspPhePheGl yGl uIleGlnLeuSerLeuAspAl aAsnLyJsProSer ValSerArgLyCsTyrSerGl uSerProTrpLe

on January 30, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

Page 7: Saccharomyces cerevisiae RADI Gene

VOL. 4, 1984 RADl GENE OF S. CEREVISIAE 2167

2200ATTGGTCGATGAGGCACAATTAGTCATATCGTATGCGAAGAAAAGAATATTTTACAAAAATGAATATACTTTAGAAGAAAATCCAAAATGGGAACAACTTuLeuValAspGluAlaGlnLeuValleSerTyrAlaLysLysArgIlePheTyrLysAsnGl uTyrThrLeuGl uGC uAsnProLysTrpGl uGlnLeu

' 2300ATTCATATATTACATGATATTTCACATGAGAGAATGACCAATCACCTTCAGGGGCCTACTTTAGTTGCCTGTTCCGACAACCTTACATGTTTAGMCTAGIleHisIleLeuHisAspIleSerHisGluArgHetThrAsnJiisLeuGlnGl yProThrLeuValAlaCysSerAspAsnLeuThrCysLeuGl uLeuA

2400CAAAGGTCTTGAATGCCTCAAACMMAAMAAGAGGAGTACGTCAAGTGCTTCTGAATAAATTGAAATGGTACAGAMAACAGAGGGAGGAAACGAAAMAATTlaLysValLeuAsnAlaSerAsnLysLysArgGl yValArgGlnValLeuLeuAsnLysLeuLysTrpTyrArgLysGlnArgGl uGluThrLysLysLe

I 2500GG TCAAAGAAGTGCAAAGTCAGGACACTTTTCCAGAGAATGCAACATTAAATGTAAGCTCGACATTTTCCAAAGAACAAGTGACCACGAAAAGAAGAAGGu VaiLLsGl uValGlnSerGlnAspThrPheProGluAsnAlaThrLeuAsnValSerSerThrPheSerLysGl uGlnVal ThrThrLysArgArgArg

IIIIIIII 2600ACAAGAGGTGCTTCACAAGTTGCGGCCGTTGAAAAGCTAAGGAATGCAGGTACCAATGTAGATATGGAGGTGGTTTTTGAGGATCATAAGTTATCTGMGThrArgGl yAlaSerGlnValAlaAla Va. Gl uLysLeuArgAsnAlaGl yThrAsnValAspHetGl uVal ValPheGl uAspHisLysLeuSerGl uG

' 2700AAATTAAGAAGGGAAGCGGTGATGAT TTGGATGACGGTCAGGAAGAAMATGCCGCAAMCGATTCAAAGATT TTTGAAATACAAGAACAGGAAAATGAAAT1 uIleLysLysGl ySerGl yAspAspLeuAspAspGl yGlnGl uGl uAsnAlaAlaAsnAspSerLysIlePheGl uIleGlnGl uGlnGl uAsnGl uI1

I.I 2800CC TTATCGATGATGGGGATGCTGAATTTGACAACGGAGAATTAGAGTATGTGGGCGACCTTCCGCAGCACATCACAACCCATTTCAATAAGGATTTATGGeLeuIl eAspAspGl yAspAlaGl uPheAspAsnGl yGl uLeuGl uTyrValGI yAspLeuProGlhHisIleThrThrHisPheAsnLysAspLeuTrp

II ' 2900GCAGAACATTGCAACGAGTATGAATATGTTGATCGTCAGGACGAAATTTTAATCTCTACGTTTAAAAGTCTCAATGACAATTGCTCATTGCAGGAGATGAAl aGl uHi sCysAsnGl uTyrGl uTyrValAspArgGlnAspGl uIleLeuIleSerThrPheLysSerLeuAsnAspAsnCysSerLeuGlnGl uMetM

IIIIII3000TGCCCTCTTACATTATAATGTTTGAACCAGATATATCGTTTATCAGGCAGATTGAAGTTTATAAGGCCATAGTGAAGGATTTGCAACCAAAAGTATACTTetProSerTyrIleIleMetPheGl uProAspIleSerPheIleArgGlnIleGl uVal TyrLysAlalleValLysAspLeuGlnProLysVal TyrPh

3100CATGTACTACGGTGAAAGTATTGAAGAGCAAAGTCATTTGACTGCTATCAAGAGAGAGAAAGATGCTTTCACAAAGTTGATTAGAGAGAATGCAAATCTGeMetTyrTyrGl yGluSerIleGluGluGlnSerHisLeuThrAlaIleLysArgGluLysAspAlaPheThrLysLeuIleArgGluAsnAlaAsnLeu

3200TCCCATCACTTtGAAMCGAATGAAGATCTTTCTCACTACAMAAATTTAGCTGAAAGGAAGTTGAAGCTTTCAAAMTTACGAAAATCTAATACCAGAAMTGSerHisHisPheGl uThrAsnGl uAspLeuSerHisTyrLysAsnLeuAlaGl uArgLysLeuLysLeuSerLysLeuArgLysSerAsnThrArgAsnA

I 3300CGGGTGGGCAGCAGGGATTCCATAATCTTACTCAGGATGTCGTCATTGTGGATACACGTGAGTTTAATGCCTCATTACCAGGCTTACTCTACCGATATGGlaGl yGl yGlnGlnGl yPheHisAsnLeuThrGlnAspVal Val IleValAspThrArgGl uPheAsnAlaSerLeuProGl yLeuLeuTyrArgTyrGlII 3400

CATAAGGGTTATTCCTTGTATGTTGACAGTCGGCGATTATGTGATAACTCCTGATATTTGTCTCGAAAGAAAATCGATTTCTGACTTAATTGGGTCATTAyIleArgVa 1 IleProCysMetLeuThrValGl yAspTyrVal1IleThrProAsplleCysLeuGl uArgLysSerIleSerAspLeuIleGlySerLeu

*III3500CAGAATAACAGATTAGCCAACCAATATAAAAAAATATTAAAATACTATGCATATCCGACACTATTAATTGAGTTTGATGAAGGACAGTCGTTTTCTTTAGGlnAsnAsnArgLeuAlaAsnGlnTyrLysLysIleLeuLysTyrTyrAlaTyrProThrLeuLeuIleGl uPheAspGl uGlyGlnSerPheSerLeuG

III 3600AACCT TT TAGTAAACGTAGAAATTATAAGAATAAAGACATATCAAACTATTCATCCTATATCAAGCAAGTTATCCCAGGTGAAATTCAGCTAAACTAGC1 uProPheSerL ysArgArgAsnTyrLysAsnLysAspIleSerAsnTyrSerSerTyrIleLysGlnValIleProGl yGluIleGlnLeuLysLeuAl

3700CAAATTAGTATTGCGGTTTTCCCACTTTAAMGATTATATGGTCTTCCTCACCCCTGCAAMCTGTAAATATAATCCTAGAGTTGAAATTAGGACGTGAGCAaLysLeu ValLeuArgPheSerHisPheLysAspTyrMet ValPheLeuThrProAlaAsnCysLysTyrAsnProArgValGl uIleArgThrIII 3800

ACCTGACCCTAGTAATGCAGTTATATTGGGAACGAATAAAGTTAGATCGGATTTTAATAGCACTGCAAAGGGCCTGAAGGATGGTGATAACGAGTCTAAA

III ' 3880TTCAAGAGACTGTTGAATGTTCCTAGAGTGTCAAAAATTGATTATTTCAATCTCCGCAAAAAGATCAAGAGCTTCAATAAGCTT

FIG. 6. The sequence of 3,884 nucleotides from plasmid pNF1007 that contains the RADI gene. The basic strategy for sequencing variousrestriction fragments is shown in Fig. 3B. The two open reading frames (ORFs) are identified by the predicted amino acid sequences. TheEcoRI site in the small ORF provides a landmark for the extent of the various deletions shown in Fig. 3A. The SstI site in the larger ORFshows the extent of the deletion in plasmid pNF1001. The ATG codon that marks the beginning of the large ORF is boxed, as is the ATG co-don 333 bp downstream in this ORF. Possible polyadenylation signals near the end of the sequence are noted with dashed lines. Thesequences underlined with the continuous line may be a transcriptional termination signal (31).

on January 30, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

Page 8: Saccharomyces cerevisiae RADI Gene

2168 YANG AND FRIEDBERG

the predicted amino acid sequence of RADI and otherproteins in the data base surveyed. There is also no signifi-cant homology between the nucleotide sequence of RAD1and that of RAD3 (L. Naumovski and E. C. Friedberg,unpublished data). Finally, the plasmid pNF1000 did notcomplement the UV sensitivity of uvrA, uvrB, or uvrCmutants of E. coli (data not shown).

DISCUSSIONScreening a yeast genomic library for plasmids that com-

plement the UV sensitivity of yeast strains defective in theRAD1 gene yielded a single plasmid (pNF1000) with a yeastchromosomal insert of 8.9 kb. Quantitative studies showedthat this plasmid restored the UV resistance of radl mutantsto levels that were not significantly different from that of ayeast strain that is wild type for RADI. Since the plasmidcan replicate as a multicopy plasmid in transformed cells, itappears that overexpression of the RADI gene is not delete-rious. However, we cannot exclude the interesting possibili-ty that the expression of RAD1 protein is regulated in thesetransformants.We have provided genetic evidence that the plasmid

pNF1000 contains the RADI gene and that complementationof the UV sensitivity of radl mutants is not due to phenotyp-ic suppression. Specifically, integration into the genome of aRAD+ strain of a fragment of the putative gene resulted indisruption of the RADI gene, converting the integrants toradl mutants. These integrants retained normal viability inthe haploid state, demonstrating that unlike the RAD3 of S.cerevisiae (15), which is also required for the excision repairof damaged DNA (17, 28), RADI is not an essential gene.Southern hybridization showed a single copy ofRADI in thegenome of haploid yeast cells.

Nucleotide sequencing of 3,884 bp revealed a small ORFthat could encode a protein of -10 kilodaltons, and a largerORF 403 bp downstream that could encode proteins withcalculated molecular weights of 110,000 or 97,000, depend-ing on which of two ATG codons is used for translationalinitiation. The results of deletion analysis suggest that thesmall ORF is not an exon of RADI. Indeed, the deletionanalysis indicates that this ORF is not related to the functionof the RADI gene at all. Studies are currently in progress toestablish whether the small ORF is transcribed in yeast cells.The size of the large ORF (2.916 kb) is consistent with the

size of the RADI transcript (3.1 kb) reported by Higgins etal. (7). At present, we cannot be sure that the ATG codonwhich marks the beginning of the large ORF is the transla-tional start codon of the RAD1 gene. The probability of thechance existence of an ORF of 111 sense codons is very low;however, our deletion experiments do not exclude thepossibility that the second ATG codon, present in the samereading frame 333 bp downstream, is an additional or eventhe exclusive translational initiation site. More definitiveconclusions must await mapping of the 5' end of the RADItranscript. Such studies are currently in progress.

Deletion of a 2.6-kb SstI fragment that includes the firstATG and extends for 37 bp into the large ORF resulted inpartial loss of the ability to complement the UV sensitivity ofradl mutants. One possible explanation for this result is thatthe deletion removed an upstream regulatory element or thepromoter. Another is that the deletion removed the 5' end ofthe coding region of RADI, causing partial loss of genefunction. Other explanations are tenable. Our results withthe plasmid which had the Sstl fragment deleted from itdisagree with those recently described by Higgins et al. (7).These investigators observed complete complementation of

the UV sensitivity of radl mutants by a plasmid missing thisfragment. It may be relevant that their deleted plasmidcontains a more extensive DNA sequence upstream from thedeletion (relative to the orientation of RADI). Knowledge ofthe precise transcriptional start site(s) should help to clarifythese observations.The RADI amino acid sequence shows no significant

homology with other proteins of known sequence. Thetheoretical molecular weight of the proteins that could beencoded by the large ORF (110,000 or 97,000) is very similarto the apparent molecular weight reported for the purifieduvrA protein required for the excision repair of DNAdamage in E. coli. The sequence of the coding region of theuvrA gene has not yet been reported; however, transforma-tion of an E. coli uvrA mutant with pNF1000 did not enhancethe UV resistance of this mutant, nor was complementationof mutants defective in the uvrB or uvrC genes observed. Asyet, we do not have information on the RAD1 proteinstructure to compare it with other proteins known to interactwith DNA, such as DNA-binding proteins.

Future studies are directed at understanding the structureand function of the RADI gene product. It is our hope thatafter the purification of RAD1 protein we can begin toexplore the role of this protein in the incision of damagedDNA and chromatin, a process that apparently requires theparticipation of at least five RAD proteins.

ACKNOWLEDGMENTSWe thank David Austen and Douglas Brutlag for computer

assistance, Reinhard Fleer, Louie Naumovski, Roger Schultz, andBill Weiss for their review of the manuscript, and Jean Oberlin-dacher for her patience in typing.

This research was supported by U.S. Public Health Service grantCA-12148 from the National Institutes of Health.

LITERATURE CITED

1. Alwine, J. C., D. J. Kemp, and G. R. Stark. 1977. Method fordetection of specific RNAs in agarose gels by transfer todiazobenzyloxymethyl-paper and hybridization with DNAprobes. Proc. Natl. Acad. Sci. U.S.A. 74:5350-5354.

2. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extractionprocedure for screening recombinant plasmid DNA. NucleicAcids Res. 7:1513-1523.

3. Carlson, M., and D. Botstein. 1982. Two differentially regulatedmRNAs with different 5' ends encode secreted and intracellularforms of yeast invertase. Cell 28:145-154.

4. Cohen, S. N., A. C. Y. Chang, and L. Hsu. 1973. Nonchromo-somal antibiotic resistance in bacteria: genetic transformation ofEscherichia coli by R-factor DNA. Proc. Natl. Acad. Sci.U.S.A. 69:2110-2114.

5. Davis, R. W., D. Botstein, and J. R. Roth. 1980. Advancedbacterial genetics. Cold Spring Harbor Laboratory, Cold SpringHarbor, N.Y.

6. Friedberg, E. C., L. Naumovski, E. Yang, G. A. Pure, R. A.Schultz, W. Weiss, and J. D. Love. 1983. Approaching thebiochemistry of excision repair in eukaryotic cells, p. 63-76. InE. C. Friedberg and B. A. Bridges (ed.), Cellular responses toDNA damage. Alan R. Liss, Inc., New York.

7. Higgins, D. R., S. Prakash, P. Reynolds, and L. Prakash. 1983.Molecular cloning and characterization of the RADI gene ofSaccharomyces cerevisiae. Gene 26:119-126.

8. Hinnen, A., J. B. Hicks, and G. R. Fink. 1978. Transformation ofyeast. Proc. Natl. Acad. Sci. U.S.A. 75:1929-1933.

9. Langford, C. J., and D. Gallwitz. 1983. Evidence for an intron-contained sequence required for the splicing of yeast RNApolymerase II transcripts. Cell 33:519-527.

10. Langford, C. J., F. J. Klinz, C. Donath, and D. Gallwitz. 1984.Point mutations identify the conserved, intron-containedTACTAAC box an an essential splicing signal sequence inyeast. Cell 36:645-653.

MOL. CELL. BIOL.

on January 30, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

Page 9: Saccharomyces cerevisiae RADI Gene

RADI GENE OF S. CEREVISIAE 2169

11. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

12. Maxam, A. M., and W. Gilbert. 1977. A new method forsequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74:560-564.

13. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

14. Naumovski, L., and E. C. Friedberg. 1982. Molecular cloning ofeucaryotic genes required for excision repair of UV-irradiatedDNA: isolation and partial characterization of the RAD3 gene ofSaccharomyces cerevisiae. J. Bacteriol. 152:323-331.

15. Naumovski, L., and E. C. Friedberg. 1983. A DNA repair generequired for the incision of damaged DNA is essential forviability in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci.U.S.A. 80:4818-4821.

16. Naumovski, L., and E. C. Friedberg. 1984. Saccharomycescerevisiae RAD2 gene: isolation, subcloning, and partial charac-terization. Mol. Cell. Biol. 4:290-295.

17. Reynolds, R. J., and E. C. Friedberg. 1981. Molecular mecha-nisms of pyrimidine dimer excision in Saccharomyces cerevisi-ae: incision of ultraviolet-irradiated deoxyribonucleic acid invivo. J. Bacteriol. 146:692-704.

18. Rigby, P. W., J. M. Dieckmann, C. Rhodes, and P. Berg. 1977.Labeling deoxyribonucleic acid to high specific activity in vitroby nick translation with DNA polymerase I. J. Mol. Biol.113:237-251.

19. Sancar, A., and W. D. Rupp. 1983. A novel repair enzyme:uvrABC excision nuclease of Escherichia coli cuts a DNAstrand on both sides of the damaged region. Cell 33:249-260.

20. Scherer, S., and R. W. Davis. 1979. Replacement of chromo-some segments with altered DNA sequences constructed invitro. Proc. Natl. Acad. Sci. U.S.A. 76:4951-4955.

21. Seeberg, E. 1978. Reconstitution of an Escherichia coli repairendonuclease activity from the separated uvrA+ and uvr-B+IuvrC+ gene products. Proc. Natl. Acad. Sci. U.S.A.75:2569-2573.

22. Seeberg, E., and A.-L. Steinum. 1983. Properties of the uvrABC

endonuclease from E. coli, p. 39-49. In E. C. Friedberg andB. A. Bridges (ed.), Cellular responses to DNA damage. AlanR. Liss, Inc., New York.

23. Seed, B. 1982. Diazotizable arylamine cellulose papers for thecoupling and hybridization of nucleic acids. Nucleic Acids Res.10:1799-1810.

24. Sentenec, A., and B. Hall. 1982. Yeast nuclear RNA polymer-ases and their role in transcription, p. 561-606. In J. N.Strathern, E. W. Jones, and J. E. Broach (ed.), The molecularbiology of the yeast Saccharomyces. Metabolism and geneexpression. Cold Spring Harbor Laboratory, Cold Spring Har-bor, N.Y.

25. Shortle, D., J. E. Haber, and D. Botstein. 1982. Lethal disruptionof the yeast actin gene by integrative DNA transformation.Science 217:371-373.

26. Struhl, K., D. T. Stinchcomb, S. Scherer, and R. W. Davis. 1979.High-frequency transformation of yeast: autonomous replica-tion of hybrid DNA molecules. Proc. Natl. Acad. Sci. U.S.A.76:1035-1039.

27. Wilbur, W. J., and D. J. Lipman. 1983. Rapid similaritysearches of nucleic acid and protein data banks. Proc. Natl.Acad. Sci. U.S.A. 80:726-730.

28. Wilcox, D. R., and L. Prakash. 1981. Incision and postincisionsteps of pyrimidine dimer removal in excision-defective mutantsof Saccharomyces cerevisiae. J. Bacteriol. 148:618-623.

29. Yasui, A., and M.-R. Chevalier. 1983. Cloning of photoreactiva-tion repair gene and excision repair gene of the yeast Saccharo-myces cerevisiae. Curr. Genet. 7:191-194.

30. Yeung, A. T., W. B. Mattes, E. Y. Oh, and L. Grossman. 1983.Enzymatic properties of the purified Escherichia coli uvrABCcomplex, p. 77-86. In E. C. Friedberg and B. A. Bridges (ed.),Cellular responses to DNA damage. Alan R. Liss, Inc., NewYork.

31. Yeung, A. T., W. B. Mattes, E. Y. Oh, and L. Grossman. 1983.Enzymatic properties of purified Escherichia coli uvrABC pro-teins. Proc. Natl. Acad. Sci. U.S.A. 80:6157-6161.

32. Zaret, K. S., and F. Sherman. 1982. DNA sequence required forefficient termination in yeast. Cell 28:563-573.

VOL. 4, 1984

on January 30, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from