Review of Literature - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/36243/11/11...Review of Literature 7 2.1.2 Ti plasmid Agrobacterium genus carry a plasmid that is responsible

Review of Literature

2. REVIEW OF LITERAT

2.1 Agrobacterium tumefaciensAgrobacterium tumefaciensdiscovered while elucidating the phytopathogen responsible for crown gall tumours in grapevines. Smith and Townsend, (1907) were the first to identify this bacterium as a cause for this disease. It is responsible for forming the crowdifferent dicotyledonary plants (Binns and Thomshaw, 1977).

A. tumefaciens originally named as tumefaciens belongs to Rhizhobiace family. This family is represented by sp. and four different members of radiobacter and A. tumefaciensto 'Agrobacterium' is being much debated (Farrand et al., 2003; Young et al., 2001) 2.1.1 Agrobacterium Whole genome sequencing has been carried out for biovar C58, which consists of four replicons namely, a circular and a linear chromosome and two plasmids (pTiC58 and pAtC58). Chromosomal sequencing of all four replicons was carried out by different groups for the commonly used strain C58 in the plant genetic engineering experiments (Goodner et al., 2001; Wood et al., 2001). A dedicated world wide web site (exploration and usage of genomic information of of all four replicons are g

Figure 2.1: Schematic representation of genomic DNAs of

A - circular chromosome; B

5

. REVIEW OF LITERATURE

Agrobacterium tumefaciens Agrobacterium tumefaciens, a bacteria belonging to Rhizhobiacediscovered while elucidating the phytopathogen responsible for crown gall tumours in grapevines. Smith and Townsend, (1907) were the first to identify this bacterium as a cause for this disease. It is responsible for forming the crown galls observed in different dicotyledonary plants (Binns and Thomshaw, 1977).

originally named as Bacterium phytomonas and then belongs to Rhizhobiace family. This family is represented by

sp. and four different members of Agrobacterium genus i.e., A. rubi, A. rhizogenus, A. tumefaciens. However, lately the nomenclature and status of genus

' is being much debated (Farrand et al., 2003; Young et al., 2001)

Agrobacterium genome composition Whole genome sequencing has been carried out for Agrobacterium tumefaciensbiovar C58, which consists of four replicons namely, a circular and a linear chromosome and two plasmids (pTiC58 and pAtC58). Chromosomal sequencing of all four replicons was carried out by different groups for the commonly used strain

netic engineering experiments (Goodner et al., 2001; Wood et al., 2001). A dedicated world wide web site (www.Agrobacterium.orgexploration and usage of genomic information of Agrobacterium. Cumulative features of all four replicons are given in the figure 2 and table 2.1.

: Schematic representation of genomic DNAs of Agrobacterium

B - circular Ti plasmid; C - plasmid pAt; D - linear chromosome pAtC.


Rhizhobiace family was discovered while elucidating the phytopathogen responsible for crown gall tumours in grapevines. Smith and Townsend, (1907) were the first to identify this bacterium as a

n galls observed in

and then Phtyomonas belongs to Rhizhobiace family. This family is represented by Rhizobium

A. rubi, A. rhizogenus, A. . However, lately the nomenclature and status of genus

' is being much debated (Farrand et al., 2003; Young et al., 2001).

Agrobacterium tumefaciens biovar C58, which consists of four replicons namely, a circular and a linear chromosome and two plasmids (pTiC58 and pAtC58). Chromosomal sequencing of all four replicons was carried out by different groups for the commonly used strain

netic engineering experiments (Goodner et al., 2001; Wood et al., www.Agrobacterium.org) is available for

. Cumulative features

Agrobacterium. linear chromosome pAtC.


6

Table 2.1: Details of genes encoded by different chromosomes of Agrobacterium.

Circular chromosome

Linear chromosome At plasmid Ti plasmid

Size (bps) 2841579 2075560 542869 bps 214234

Total genes 2815 1875 542 197 Protein coding

genes 2765 1851 542 197

T-RNAs 40 15 0 0

Other RNAs 10 9 0 0

Figure 2.2: Schematic representation of the Agrobacterium tumefaciens genome. The outer two bands indicate opposing transcriptional orientations of predicted genes. Colours indicate orthology to proteins in the Sinorhizobium meliloti replicons: blue - chromosome; green - pSymA; gold - pSymB; red - nonorthologous. The inner circle depicts GC content for each coding region, with lower GC content indicated by darker shading. The vir and T-DNA regions of pTiC58 and the AT island of pAtC58 are indicated (after Wood et al., 2001).


7

2.1.2 Ti plasmid Agrobacterium genus carry a plasmid that is responsible for transfer of its DNA to plant cells and is named accordingly as tumour inducing plasmid (pTi or simply Ti). Ti plasmids of Agrobacterium are classified according to the type of amino acid metabolites called opines they produce. There are four different kinds of opines so far believed to be synthesised by Agrobacterium strains: nopaline (pTi C58), octapine (pTi A6), succinamopine (pTi Bo546), and leucinopine (EU 6) (Chang et al., 1983). The basic structure of Ti-plasmid is same in all the types with the major difference being present in the T-DNA, the part that is transferred to plants and codes for enzymes that synthesize the opines. Other differences are with reference to insertion elements (IS) and repetitive sequences present in the non-T-DNA part of the plasmid. Homology studies among Ti plasmids revealed both homologous and non-homologous sequences and are considered as evolutionary mosaics with non-homologous sequences acquired through horizontal transfer of DNA (Otten et al., 1992).

Ti plasmids belong to group of repABC replicons with respect to their replication origin. This replicon is present in most of α-proteobacteria including the family of Rhizhobiace (Suzuki et al., 2000). The first two genes of repABC cassettes, repA and repB are implicated in active partitioning, whereas the third repC, encodes a replication initiator protein (Pappas, 2000). repABC replicons are large, low copy number plasmids that are stable and generally do not function outside the class of α-proteobacteria. Nevertheless, the copy number of Ti-plasmids fluctuate depending on plant signals that are responsible for induction of its virulence genes. The so called plant inducers such as phenols, low pH before the formation of tumours in the plants and quorum signals secreted by the Agrobacteria after formation of tumours increases the copy number of Ti plasmids. Reciprocal decrease in copy number to the basal level is brought about by different novel mechanisms such as protein repressors at the operator site of the repABC promoter site and also by the antisense RNA (Pappas, 2000). 2.2 Mechanism of T-DNA Transfer Successful transfer of the T-DNA from Agrobacterium to plant cells involves multiple steps both in the Agrobacterium and in the plant cells. It initiates by sensing possible


8

host by multiple plant compounds, inducing the genes required for the processing and transfer of T-DNA, transfer of the T-strand and finally the integration of the T-strand into the plant genome. This complex inter kingdom transfer of the DNA is brought about by careful orchestral action of multiple proteins of Agrobacterium as well as the plant cell. 2.2.1 Recognition of plant cell and virulence induction Initial recognition of a probable host either for a symbiotic or a pathogenic relationship is critical as the bacterium devotes a lot of resources for this purpose. Altogether a different set of genes are to be expressed and normally active genes are to be shut off and more importantly the bacterium has to counteract the defence mounted by the host. 2.1.1 Host Recognition Plants release various compounds to the surroundings based on the physiological state of the cell. For example, the roots exude large number of organic compounds to the surroundings, which often includes various amino acids, organic acids, sugars, polysaccharides, proteins, and aromatics (Marschner, 1995). This forms a typical rhizosphere and several microbial communities form a niche in this environment. These compounds, some of which are specific to particular plants such as flavnoids for the legumes can aid in the formation of a specific host-microbe interaction.

The interaction of Agrobacterium with its putative host depends on recognition of the plant exudates and it determines the host range of the bacterium. The chemical signature detected by Agrobacterium comprises of phenolic compounds, monosaccharide sugars (Cangelosi et al., 1990) and the pH of the surrounding environment. The host recognition of Agrobacterium can be arbitrarily divided into two steps (i) involving detection and travelling towards the signals termed as chemotaxsis and (ii) attachment of the bacterium to the surface. These events are made possible by different proteins expressed by the chromosomal DNA and Ti-plasmid of Agrobacterium.


9

2.2.1.1. Chemotaxis For an interaction to materialize, the proximity of the host and microbe is required and the movement of the bacterium towards its host by recognising the chemical compounds elicited by the host is termed as Chemotaxis. Agrobacterium sp. are peritrichous motile bacteria with multiple flagella (Winans, 1992). The movement of the bacterium towards its host is brought about these flagella upon activation by the inducers. During chemotaxsis, the chemical environments are sensed through the chemoreceptors, and intracellular signals are produced and transferred to the flagellar motor through protein–protein interaction, which influences the direction of flagellar rotation and consequently, cellular movement of the bacterium towards the host (Grebe and Stock, 1998).

The molecular mechanism and activation of chemotaxis involves both chromosomal DNA (Palmer and Shaw 1992) and Ti-plasmid encoded factors (Shaw et al., 1988). Phenolic compounds such as Acetosyringone are involved in the chemotaxis along with induction of the virulence genes required for the inter kingdom transfer of the T-DNA. The detection of these phenolic compounds is facilitated by two components, sensory kinases VirA/VirG and Ti-Plasmid encoded proteins along with CheB which is a chromosomal encoded protein (Lee et al., 1996) .The chemosensory system involves an operon consisting of several genes and deletion of this operon results in severe impairment of chemotaxsis in Agrobacterium. This operon begins with orf1, followed by orf2, cheY1, cheA, cheR, cheB, cheY2, orf9, and orf10 (Wright et al., 1998). CheY1 and CheY2 are the regulators, of which CheY1 is a Phosphatase and CheY2 acts as a sink for the phosphate (Harighi, 2008). Che A, CheR and CheY are methly transferases that transfers the methyl from s-adenosyl methionine to methyl accepting chemotaxsis proteins that rests the chemotactic system. CheR is an methly transfer protein that transfers the methyl group to MCPs while CheA is an methyl esterase that removes the methyl group from the MCPs (Harighi, 2008). Genes involved in chemotaxis are complied in table 2.


10

Table 2.2: The genes involved in attachment of Agrobacterium to plant cell, their site of transcription and functional activity.

Gene Encoded Function virA Ti-Plasmid Sensory Component virG Ti-Plasmid Sensory Component chvB Circular chromosome Sensory component cheY1 Circular chromosome Regulatory protein cheY2 Circular chromosome Regulatory protein cheR Circular chromosome Methyl Esterase cheB Circular chromosome Methyl Transferase

2.2.1.2 Attachment Once the bacterium has reached the proximity of its host next steps involves making contact with the host and attaching to its surface so as to facilitate the transfer of DNA to the plant cell. The proteins involved in attachment of Agrobacterium to plant cells are majorly encoded by chromosomal DNA and AtChromosome. None of the proteins involved in attachment are found in the Ti-Plasmid. Binding of Agrobaterium to the plant cells is considered a two step process (Brencic and Winnans, 2005). The first is a rather weak and reversible binding step that involves a variety of bacterial polysaccharides. chvA and chvB genes in A. tumefaciens are involved in the synthesis of a cyclic glucan (Cangelosi et al., 1989; De Iannino and Ugalde, 1989) which could act as an adhesin via gelling interactions with host polysaccharides. Mutations in the chv genes reduce the binding of the Agrobacteria to cultured cells and abolish tumorigenesis (Douglas et al., 1982 & 1985). However, these mutations are pleiotropic, and so it is difficult to know whether the cyclic glucan is a direct adhesin or whether its loss perturbs some other functions that are important in binding. chvB is involved in glycan biosynthesis (Zorreguieta and Ugalde, 1986), while chvA is involved in transport of this polysaccharide from cytoplasm to periplasm or extracellular fluid (De Iannino and Ugalde, 1989).

The second binding step requires the synthesis of bacterial cellulose, which causes a tight, irreversible binding and formation of bacterial aggregates on the host surface (Robertson et al 1988). Mutants with mutations of the A. tumefaciens celABCDE


11

operon no longer synthesize cellulose and can be readily dissociated from cultured plant cells by vortexing. However, these mutants are still tumorogenic (Matthysse, 1983; Matthysse and Kijne, 1998). The cel gene products are important for cellulose biosynthesis. Strains with mutations in cel still bind to plant cells, but do so individually rather than forming aggregates (Matthysse, 1983). Mutations in celG and celI genes brings about overproduction of cellulose which results in larger biofilms through increased aggregation of Agrobacterium cells and their tumorogensis capacity (Matthysse et al., 2005). A third set of genes involved in attachment of Agrobacterium to the plants cells are att genes that are encoded by the linear chromosome of Agrobacterium and are considered to be not required for the virulence. These att genes have been identified by insertional mutagensis of the bacterial chromosome with an encoding size of more than 20kb (Matthysse, 1987).

At the plant interface, the attachment of Agrobacterium is considered to be specific and involves specific receptor present on the plant cell membrane. This notion stems from the observations that the competence of Agrobacterium attachment to plant cells is different for different cells and different species (Wagner and Matthysse, 1992; Chateau et al, 2000). Although the exact candidate receptor proteins for Agrobacterium attachment have yet not been identified, however Wagner and Matthysse, (1992) believed that vitronactin-like protein could be involved. 2.2.2 Transformation machinery of Agrobacterium Inter kingdom DNA transfer ability of Agrobacterium is majorly due to the presence of Ti-plasmid. The proteins needed for elaborate transfer of its T-DNA are mainly encoded by the Ti-plasmid. Ti-plasmid bears various genes that encodes for different group of proteins, viz. ori genes that maintenance of the plasmid , tra genes responsible for conjugation, occ genes for opine catabolism, and the vir genes responsible for the tumour formation , apart from the genes that produce opines which are present on the T-DNA and which expresses only in the plant cells.

The virulence (vir) genes in Agrobacterium C58 strain are organized in continuous operons each named by the order of their discovery. There are about seven operons in this gene cluster namely virA, virB, virG and virC, D, E, F with each transcriptional unit playing unique function in the T-strand formation and transfer.


12

2.2.2.1 VirA and VirG: The sensors A successful biological system has to communicate with its environment to manage its resources and activate or shut down the gene expression accordingly. In Agrobacterium this role of sensing a potential host is carried out by a Two Component System (TCS) formed by VirA and VirG proteins coupled with CheB encoded by chromosomal DNA. TCS is characterized by two proteins, of which one senses the signals outside the cell and phosphorylates the second component which activates the downstream processes. VirA plays the former role of sensor and VirG takes up the later role of activator. VirA recognizes and modulates the signals which include phenolic compounds that are essential (Winnans, 1990) and monosaccharide sugars (Ankenbauer and Nester, 1990) and low pH which act as enhancers when the phenolic compunds are limiting. VirA forms a homodimer having individual functional domains. The transmembrane region forms the periplasmic domain(P) and the cytosolic region can be divided to Linker (L), Kinase (K) and Receiver (R) regions. The signal perceived by the periplasmic domain is passed on to the cytosolic domains through the linker domain leading to the activation of VirA by self phosphorylation. The activated VirA then phosphorylates VirG leading to activation and transcriptional induction of virulence genes (Andrew and Binns, 2004). The same has been shown in figure 2.3.

Figure 2.3: Activation mechanism of VirA and VirG by plant released compounds such as phenols, monosaccahride sugars and low pH (after Andrew and Binns, 2004).


13

The active phosphorylated VirG is transcriptional activator that binds to specific sequences present on the vir operon promoters. A conserved region of 6 bp DNA region is identified in all the promoters of vir genes. The consensus sequence is identified as 5'-TG (A/T) AA (C/T) and named as vir box (Fig. 2.4) (Das et al., 1986; dSouza et al., 1993).

Figure 2.4: Conserved nucleotide sequence of vir promoter regions. Sequences in red are vir box sequences and in blue are inverted vir box sequences (Adapted from Oka et al., 1993). 2.2.2.2 VirD and VirE: T-Complex formation Once the virulence machinery is activated, the genetic information that has to be transferred to the plants is to be delineated and processed. This role is taken up by the proteins encoded by the virD operon. virD operon codes for four proteins VirD1,VirD2, VirD3 and VirD4 and an additional orf5 which is independently expressed from the rest (Lin and Kado, 1993). VirD1, VirD2 and VirD3 are considered analogous to the plasmid conjugation protein TraI, TraJ and TraH which recognizes, nicks and stabilizes the relaxosome complex of the plasmid respectively (Ziemienowicz A, 2001). As with the analogy, VirD1 is found to interact with and recognizes the border sequences and VirD2 is found to nick the DNA between the third and fourth bases of the border sequences and VirD3 to stabilize the complex.

VirD1 and VirD2 are the only proteins required in vitro for the formation of ssT-DNA which are the substrates for transfer to the plant cell. VirD1 and VirD2 specifically recognize the 25bp inverted repeats which are the only cis-elements required for cleavage of the T-DNA. VirD1 acts as a relaxase that possibly distorts the superhelical DNA at the border site therby making the border sequences accessible for VirD2 protein for cleavage (Scheiffele et al., 1995). After recognition of the border sequences, VirD2 nicks the T-DNA and attaches covalently to the 5' end of the DNA (Fig. 2.5) (Estrella et al., 1988; Jasper et al., 1994; Scheiffele et al., 1995). The exact role of VirD3 is unknown and mutagenesis and complementation experiments have shown its

virA : GTTTCATTTGAAACAAACTGAGTCGACGTCTGTGATTTCAAACCCATTTACAAAGCCTACCGTGCGGCCTAAGCGCCACGGvirB : AACCGTTTTCGCTTCAAATGAAATCGAAAAGAAGAAAACGAAAATCCTAGAGTAACCGACCCTCCCGATAATCGTGAACAT

virC: GGATTATTTCCTCTATAATTGTTACATTTGCAACTATTCTATAACAACAAACAATGAAATATAGTTCAGATAATTATTTTCTTATT

virD : ATAGTTGCAAATGTAACAATTATAGAGGAAATAATCCTTATCTGTTCTTGATTCGAGTTTTTATAGGCGTAGGTTTTCGTCTGC

virE: CCCCCGCAGGCCCGCCACGAATTGCAGTTGAAACACGATATTCGTTCAACGCATTTCGCTGAGGTGCTAGGCTTCGCGTAT

virG: TGTTACAAAATTACATTGTAGCAAAGCTCAGCAATCTTTGTCATCAAGCTGAAACATATTGTTTGCATTTTTGTCATGCACGG


14

presence is not absolutely required for the virulence (Vogel and Das, 1992; Lin and Kado, 1993). VirD4 protein forms a part of virD operon but plays a distinct role by acting as a coupling factor between the T-DNA and transfer apparatus (Kumar and Das, 2002). It localizes in the cell membrane of Agrobacterium recruits the ssT-DNA complex and virE2 protein that are transferred to the plant cytoplasm (Hamilton et al., 2000)

Figure 2.5: Formation of T-strand complex in Agrobacterium. The border sequences are recognized by VirD1-D2 complex and cleaved. VirD2 attaches to the 5' end (RB) of the T-strand covalently ( after Tzifra et al., 2004).

2.2.2.3 VirB: The channels for transport Once the T-complex has been formed, it has to be transferred into the host cells. This gateway is formed by the proteins of virB operon and virD4 protein. The bacterial secretion system that transports the T-complex belongs to Type-IV secretion system that is generally involved in conjugal transfer of bacterial plasmids. Homologs for the virB genes were identified in different pathogens that transport toxins to their hosts such as pstI operon of Bordetella pertussis that exports pertussis toxins to humans (Winans et al., 1996). The virB operon comprisies of 11 proteins (VirB1-VirB11) and VirD4 that makes up this Type4 Secretion System (T4SS). Basing on the functions these proteins carry out they can be grouped into three functional classes, proteins forming appendages with the host cells (VirB1, B2 and B5), proteins that form the conducting channels for T-complex (VirB3, VirB6, VirB7, VirB8, VirB9 and VirB10) and the ATPases that provide the energy required for the transport of the T-complex.


15

VirD4 also is a putative ATPase and thought to couple the T-complex with the transfer apparatus (Fig. 2.6 ) (Christie, 2004; Christie and Vogel, 2000).

Figure 2.6: Different proteins of T4SS of Agrobacterium facilitating transfer of T-Complex and proteins into the plant cell. Proteins VirB1 - B10 are encoded by virB operon and VirD4 is coded by virD operon, together making up the T4SS (After Christie, 2004). 2.2.2.4 Miscellaneous components: virC and virF operons Apart from the essential proteins mentioned above other proteins from virF and virC operon are also required for the virulence of Agrobacterium. The exact role of VirF is yet to be elucidated. Mutants of virF showed attenuated tumors and can be complemented by expression of virF in plants demonstrating its role in the plant cells after T-complex transfer. Later, VirF was shown to interact with plant homologues of the yeast Skp1 protein through its F-box proteins. These proteins are subunits of a class of E3 ubiquitin ligases that target specific proteins and mediate targeted proteolysis (Schrammeijer et al., 2003). It is thought that the VirF protein uncoats the T-complex of its proteins VirD2 and VirE2 for integration of T-DNA into the host genome (Dafny-Yelin et al., 2008). Although it is an essential step in integration of T-DNA not all plants showed attenuation for the transfer of the foreign DNA. Another protein of virE operon virE3 was thought to complement this function and both VirF and VirE3 are transported to the plant cell through the VirB channel.

VirC operon encodes for three genes virC1, virC2 and virC3 which are thought to be involved in host range determination. The mutants in different genes of the virC operon caused total avirulence or attenuated virulence depending on the plant system


16

involved (Srinivasan et al., 1989). It was hypothesised that they bind to the overdrive sequence present in some of the Agrobacterium strains and causes increased production of T-strands when the induction of virulence genes is less.

The bacterial virulence proteins, their determined or putative role(s) are summarized in the table 2.3 below.

Table 2.3: Agrobacterium virulence operons, their encoded proteins and functional role in T-DNA transfer and integration.

Operon Protein Function virA VirA component of TCS that recognizes the virulence factors virG VirG Transcriptional activator of vir genes

virD

VirD1 Part of relaxasome that unwinds the DNA at nicking sites VirD2 Part of relaxasome that nicks the DNA at border sites and guides the

T-DNA to host nucleus VirD3 Unknown VirD4 Part of T4SS that chaperons the T-complex through the channel Orf5 Unknown

virE

VirE1 Chaperone of VirE2, prevents oligomerization of VirE2 VirE2 a single stranded DNA binding proteins that coats the T-DNA and

guides it into host nucleus. VirE3 Transported independently to plant cell and thought to uncoat the

T-complex of its proteins

virC VirC1

Involved in host range determination VirC2 VirC3

virF VirF1 A ubiquitin ligase like enzyme that is thought to uncoat the T-complex of its proteins

virB

VirB1 A Transglycolase that causes local lysis of peptidoglycan cell wall. VirB2 Component of T-pilus, forms homodimers VirB3 Forms the Periplasmic domain of the T-pilus VirB4 ATPase that energises the transfer of T-complex VirB5 Outer membrane protein that is a part of T-pilus VirB6 Highly hydrophobic protein that spans the membrane possibly forming

the channel VirB7 Outer membrane lipoprotein that stabilizes the T-pilus VirB8 Channel protein VirB9 Interacts with VirB7 and stabilizes the T-pilus VirB10 Channel protein, provides thermo stability VirB11 ATPase at cytoplasmic side that is thought to either unwinds/chaperons

the T-complex to the channel


17

2.3 T-DNA Integration into Host Genome The T-complex that is transferred to the plant cytoplasm has to be delivered into nucleus and the it has to be stripped of its proteins and integrated into the host genome. This plethora of events takes by hijacking the plant proteins and the bacterial proteins that are recruited into the plant nucleus through T4SS.

The import of the T-complex into the nucleus is carried through the hosts importin α-dependent pathway. The T-complex consists of VirD2 protein attached covalently at 5' end of the T-strand and VirE2 protein attached non-specifically throughout the T-strand (Tzfira and Citovsky, 2002). Both the proteins have nuclear localization signals of the plants and are efficiently imported into the plant nucleus. VirD2 can directly interact with the α-importin for nuclear import whereas VirE2 does not interact efficiently with α-importin but is imported via its interaction with a plant protein VIP1 (VirE2 interacting Protein1) that acts as a molecular adapter (Lacorix and Citovsky, 2009). Once the T-complex has reached the host cell nucleus, it has to be stripped off its proteins to facilitate its integration into the host genome. This is achieved by the bacterial VirF protein, that is recruited to the host cell nucleus. VirF protein uncoats the T-complex along with VIP1 protein that is bound to the VirE2 protein. The timing of this stripping seems to be regulated so as to allow the T-strand to find a suitable site of integration. VirF is a F-box protein that forms a Skp1-Cdc53-cullin-F-box (SCF) complex that targets the T-complex for proteolysis of the Agrobacterium protein VirE2 and the host protein VIP1, that coat the transferred DNA. Although this is an essential step in integration of the T-DNA, it was shown that VirF is not essential for virulence in some plants. Zaltsman et al. (2010) showed that Agrobacterium can induce the plant F-box proteins that can carry out similar function, making the requirement of VirF not absolutely necessary.

The integration step of T-DNA into plant chromatin is the least understood step. However, several plant proteins were shown to take part in this integration step. Basing on the study of the sequences at the integration site of T-DNA two models of integration were proposed. The double-strand-break repair (DSBR) and single-strand-gap repair (SSGR) integration models. In the DSBR integration model, a double-stranded (ds) break (DSB) in the target DNA is a prerequisite for T-DNA integration. The unwound or


18

exonuclease-processed ends of the T-DNA are then annealed to the target DNA and, following ss-overhang removal by endo- and/or exonucleases, the ends are repaired and ligated. According to the SSGR integration model (Figure 2b), a single nick, later converted to a gap by a 5'-3'-endonuclease, is required for the initiation of T-DNA integration. The T-strand ends then partially anneal to the target DNA and the T-strand overhangs are trimmed. Following ligation of the T-strand to the target DNA, a nick is introduced in the second strand of the target DNA and extended to a gap by exonucleases. The synthesis of a strand that is complementary to the T-strand and ligation of the 3'-end of this newly synthesized complementary strand to the target DNA finalize the integration (Tzfira et al., 2004). Initially although SSGR model of integration was preferred the later evidences like high frequency of targeting the T-DNA into the restriction sites of rare cutter like SceI in the plant genome, some researchers such as Chilton and Que. (2003) and Tzfira et al. (2003) favoured the DSRB model. In plants, although the Double stranded break repair pathway can occur by two modes via Homologous Recombination (HR) or by Non-Homologous End Join Repair (NHJR) methods, the T-DNA integration seems to be occurring by NHJR pathway. 2.4 Agrobacterium: Plant Pathogen to a Genetic Engineer

The discovery of Tumor Inducing Principle (TIP) in crown galls by Armin Braun (Braun,1958) led to the development of Agrobacterium biology. Later the discoveries of Ti-plasmid (Zaenen et al., 1974; Willmitzer et al., 1980) that is responsible for the development of the tumors and is the actual TIP paved the way for Agrobacterium to become a genetic engineer. The simultaneous discoveries that Agrobacterium could be used for transforming the plants by Bevan et al. (1983), Herrera-Estrella. (1983), Fraley et al. (1983) catapulted the plant transformation methodologies. The foray of the plant transformation protocols stemmed from the development of vectors that could be easily manipulated and could be used for transfer of the foreign DNA into the plant cells. 2.4.1 Plant Transformation Vectors Initial plant transformation vectors are the large plasmids that were responsible for the induction of neoplastic growth in plant tissue. The Ti-plasmids were modified to


19

contain the gene of interest by recombination with the E.coli plasmids containing the same. These were called the Co-integrate plasmids. These experiments were cumbersome as they involve manipulation of large plasmids and selecting the recombination events with the gene of interest and also the confirmation of the insert was not straight forward, and restriction sites for the insertion was difficult to find (Chilton, 2001; Komari et al 2006;Lee and Gelvin, 2008). The discoveries that the only cis-elements required for the transfer of T-DNA are the inverted repeats called border sequences and the functional virulence genes can be complemented in trans led to development of new vectors systems called binary vectors (Fig. 2.7). 2.4.2 Binary vectors Vectors that can replicate and maintain in two different kind of bacteria are called binary vectors. The introduction of binary vectors for plant transformation propelled the technology to all the labs worldwide due to ease of their use and maintenance. Hoekema et al, (1983) and de Framond et al, (1983) determined that the vir gene containing and T-DNA regions of Ti-plasmids could be split onto two separate replicons and yet can obtain the desired result of plant transformation. The vector on which the T-DNA resides is called the binary vector which can be used for the molecular manipulations to clone the gene of interest while maintaining in E.coli and can be used for plant transformation when introduced into Agrobacterium. The disarmed Ti-Plasmid i.e., plasmid from which the oncogenic T-DNA is removed, provides the vir gene functions in trans (Gelvin 2002).

Figure 2.7: (A) Co-integrate vectors: they involve a recombination between the vector in which the gene of interest (goi) is cloned along with homologous sequence of Ti-plasmid to facilitate recombination. (B) Binary vector system: they involve a plasmid that could be maintained in E. coli for gene cloning and a helper plasmid to provide the vir gene functions (After Lee and Gelvin, 2008)


20

The features required for binary vector are similar to normal cloning vector such as small size, high copy number for ease in plasmid isolation, simplicity in cloning, etc. With time several of these features were inserted into the binary vectors. First generation binary vectors were of large size eg., pBIN19 -11.2 kb and with gene of interest added it is much longer. This is due to presence several unwanted sequences in the vector backbone as well as in T-DNA region (such as lacI). Also, they are low copy number plasmids due to presence of board host range origin of replication like RK2. Next generation binary vectors like pGreen are high copy number plasmids, due to presence of ColE1 replication origin. They have also, divided the plasmid into dual vectors with one vector providing the elements necessary for replication of another plasmid which harbors the T-DNA. This effectively decreased the length of the T-DNA and maintain high copy number in E.coli for easy isolation of plasmids (Hellens and Mullineaux, 2000; Komari et al., 2007; Lee and Gelvin, 2008). Along with size and copy number one of the important factor in construction of T-DNA is the position of the selectable marker. The transfer of T-DNA is vectoral and occurs from 5' to 3' end or from right border (RB) side to left border (LB) side. Often truncations are seen at the LB side. Initial vectors have the selectable marker at the RB side increasing the frequency of truncations in gene of interest thereby making the raised events unwanted. This feature was corrected in the later vectors.

One more feature that is important for plant transformation is the selectable marker gene. There are different types of marker genes available and the selection system to be used depends on the plant that is to be transformed. Different plants are sensitive/resistant to different antibiotics and are to be chosen accordingly. The summary of the features of some of the commonly used binary vectors are given in table 2.4:


21

Table 2.4: Commonly used binary vectors in plant transformation and their features. The size of the basic vectors with commonly used marker gene is given.

Vector Size (kb)

Bacterial Selection Marker

Plant Selectable Marker

Position of

Selectable Marker

Replication Origin (E.coli)

Replication Origin

(Agrobacterium)

pBIN19 11.7 Kanamycin Kanamycin RB pRK2 pRK2

pC22 17.5 Ampicillin, Steptomycin, Spectinomycin

Kanamycin RB ColE1 pRi

pGA482 13.2 Tetracyclin Kanamycin RB ColE1 pRK2 pPCV001 9.2 Ampicillin Kanamycin RB ColE1 pRK2 pCGN1547 14.4 Gentamycin Kanamycin LB ColE1 pRi pJJ1881 25.7 Tetracyclin LB pRK2 pRK2 pPZP111 8.9 Chloramphenicol Kanamycin LB ColE1 pVS1

pGreen 4.6 Kanamycin Variable (Kan, Hyg, Pat) LB pUC pSa

BIBAC 21.5 Kanamycin Hygromycin Kanamycin LB F-Factor pRi

pORE 8.0 Kanamycin Kanamycin/Pat LB pRK2 pRK2

pCAMBIA 11.2 Kanamycin Variable (Kan, Hyg, Pat, Sul) LB ColE1 pVS1

2.5 Fidelity of T-DNA processing The only cis-elements required for T-DNA transfer are the border sequences that limits the boundaries of the T-DNA. It is often conceived that the DNA present in between these borders is only transferred, but often than not this is not the case. In several cases, especially with binary vectors superfluous DNA sequences outside the borders are found inserted into the plants irrespective of the plant systems and binary vectors and Agrobacterium strains used in the studies. Ooms et al, (1982) for the first time detected that the DNA sequences outside the T-DNA may be integrated into plants. Later Martineau et al, (1994) generalized that this insertion of superfluous sequences occurs frequently and at high frequency when using binary vectors. Insertion of these vector backbone sequences/superfluous sequences are widely studied and different hypothesis were put forward to explain them and different


22

strategies were employed to either counteract them or select against the insertion of these vector backbone sequences. 2.5.1 T-DNA processing of Ti-plasmid The molecular mechanism of T-DNA formation was largely deciphered with the Ti-plasmids. The invitro studies carried out initially to find out the part of Ti-plasmid inserted/transferred to the plant cells established that the T-DNA is limited by imperfect 25bp inverted repeats. Studies carried out with nopaline strains such as C58 were only able to find a single species of ssDNA nearly exact size of the T-DNA delimited by the borders (Stachel et al., 1986). In octapine strains such A6, where multiple internal border sequences are present. Stachel et al. (1987) and Veluthambi et al. (1988) were able to find 6 different T-strands comprising various combination of the four borders present. Although it is widely perceived and accepted that only ssDNA (T-strands) could be transferred to the plant cells Steck et al. (1989) were able to detect dsDNA that is processed from pGV3801 plasmid.

Reports regarding the detection of sequences of Ti-plasmid outside the borders in crown galls are limited. Ooms et al (1982) were able to detect erroneous part of Ti-plasmid to insert into the plant cells. Joss et al. (1987) were able to detect complete transfer of Ti-plasmid into petunia cells. Ramanathan and Veluthambi (1995) were able to recover kanamycin resistant calli from the Ti-Plasmid (pTiA6) with kanamycin cassette cloned outside the left border. Also, unidirectional transfer of total Ti-plasmid DNA was shown to occur only when left border is present albeit at a low frequency (Miranda et al., 1992). 2.5.2 T-DNA processing of binary vectors Agrobacterium mediated transformation technology is based on the principle that the sequences of interest could be cloned in between the boundary delimiting borders. Initial studies demarked the border sequences as the boundaries of the T-DNA transferred to the plants (Zambryski et al., 1994). Martineau et al. (1994) reported that the sequences outside the borders are transferred to plants at a high frequency (30%) and across plant species. While investigating integration pattern of T-DNA in cells of


23

various plant species such as Arabidopsis (Meza et al., 2002), Aspen (Kumar and Fladung, 2002), Rice (Kim et al., 2003; Kuraya et al., 2004), Cotton (Zhang et al., 2008), Tomato (Thomas and Jones, 2007), Wheat (Wu et al., 2006), Tobacco (Filipenko et al., 2007), Grapevine (Gambino et al., 2009) the integration of vector backbone sequences was recorded. The integration of vector backbone sequences and their frequencies were complied in the table 2.5.

Table 2.5: Frequency of integration of vector backbone sequences in transgenic plants, strains and plant species used in the study

Plant Agrobacterium strain Binary Vector Frequency of

integrations Reference

Grapevine LBA 4404 pGA643 29 Gambino et al.,2009

Potato AGL1 pCLDO4541 8.2 Petti et al., 2009 LBA 4404 15 Cotton

AGL1 pZP-GFP 15.8 Zhang et al, (2008)

Tobacco pBI121 47.1 Filipenko et al, 2007 Wheat pAL156 (pGreen) 62 Wu et al, 2006 Rice EHA105 pCAMBIA1301 25.5 Sha et al, 2004 Rice AGL1 pGreen/pSoup 39 Vain et al, 2004 Rice LBA4404 pGA2144 45 Kim et al 2003.

Arabidopsis GV3101 pPCV002 - Meza et al, 2002 C58C1 rifr pKOH110/pMHA2 -

Rice AGL1

pCXa21K 32.4

Yin and Wang, 2000 EHA105 35.3 LBA4404 30.8

Tobacco LBA4404

pBSG-1 (from pBIN19)

54 Kononov et al , 1997 GV3101 39

EHA105 22

Different experiments were conducted specifically to find out the reasons behind erroneous T-DNA processing and to eliminate the same. Kononov et al. (1997) constructed specific vectors for studying these type of integrations and found that about 75% of plants contains the sequences outside the borders. By constructing vectors with a visual marker gus independently at either end of the borders the researchers realized that


24

virtually all possible combinations of erroneous processing of T-strands could be found i.e. superfluous sequences linked to either or both left and right borders and vector backbone devoid of T-DNA. De Buck et al. (2000) reported that integration is of T-DNA into cells is not influenced by (i) plant species effect of different parameters such as plant species (Arabidopsis and tobacco), explant (Arabidopsis-root and leaf, tobacco-protoplast and leaf) , origin of replication (ColE1 and VS1) and selection marker (kanamycin and hygromycin) on insertion of vector backbone sequences. They found that none of the factors influence the insertion of erroneous processing T-DNA into plants. Contrastingly, to Kononov et al. (1997) they have found that vector backbone sequence linked to LB are found at a higher frequency and vector backbone sequences attached to both RB and LB have been found. Podevin et al. (2004) studied the effect of border sequence sources and their effect on the erroneous T-DNA processing and integration into Arabidopsis plants. By using multiple borders from either octapine or nopaline strains they demonstrated that multiple borders on the left border could decrease the frequency of vector backbone insertions. Also, they found that read through at the left border is the main cause of the imperfect T-DNA processing although Left border initiation could also takes place at high frequency. In addition they noted an interesting observation that their exists an variation between the transformation experiments with regard to vector backbone insertions. 2.5.2.1 Strategies to counteract vector backbone insertions Different strategies were formulated to counteract vector backbone insertion in transgenic plants due to different reasons. On a commercial perspective, the regulatory authorities demand the absence of superfluous sequences in the transgenic plants as they could contain the gene sequences and origin of replication of prokaryotic origin and their effects on horizontal gene transfer has been not documented and in a research perspective in T-DNA and promoter tagging experiments these insertions are undesirable. Also, the presence of vector backbone sequences could lead to gene silencing of the transgene as the plants could recognize the sequences of prokaryotic origin and silence them (De Buck et al., 2000; Podevin et al., 2006; Ye et al., 2011).


25

Hanson et al. (1999) adapted a method to curtail the transformants having non- T-DNA sequences by incorporating a lethal gene into vector backbone of binary vector. However, Eamens et al. 2004 found that using this system transformants having limited amount of backbone sequences could still be detected. Vain et al. (2004) studied the effect of additional vir genes (virG/B/C and constitutive virG) on the quality of the transgenic events. They found that additional vir genes increased the quantity of vector backbone sequence insertion by two fold. They have placed the vir genes in-cis and could detect the transfer of the vir genes in 39% of the transformants. Two different experiments have shown that addition of extra border sequences could decrease these superfluous sequences into transformants. Kuraya et al. (2004) tested the additive effect of multiple left borders (1-4) on the vector backbone insertions in rice. They found that the frequency drastically decreased from 92% to 3% when using one LB and 4 LBs in tandem. A more comprehensive experiments involving multiple borders of different origins (octapine and nopaline) were carried out by Podevin et al. (2006). They tested a combination of octapine or nopaline borders in combination or alone to understand the importance of borders in causing vector backbone insertions and found that octapine or nopaline borders alone caused higher insertions whereas having natural inner/outer octapine borders increased the fidelity of T-DNA processing and curtailed the insertions of vector backbone sequences in the transformants. Ye et al. (2008) have again revisited the use of lethal/inhibitory genes on the backbone to decrease these insertions. They have tested four different genes viz. levansucrase (sacB), cytokinin oxidase (ckx), giberrilic acid 2-oxidase (ga-2-ox), phtoene synathase (cetB) and their efficacy in reducing the transformants containing the non-T-DNA sequences. They could decrease the insertion of vector backbone sequences in the single copy plants to a great extent One more interesting observation is made by Podevin et al. (2006), the single copy transformants have relatively low level of these erroneous T-DNA processing events. Incidentally, this property of imprecise T-DNA processing in Agrobacterium was used by Huang et al. (2004) to develop marker and backbone free transgenic maize plants by segregating the transformants. As the marker gene is placed outside the regular Left Border and the resulting co-transformants can be segregated to produce marker/backbone free transgenic plants. A more complex and different approach is taken up by Oltmanns et al. (2010) for eliminating backbone insertions into plants. They launched the T-DNA from picA


26

locus of the chromosome. The observations that extremely long T-DNA sequences have a decreased frequency of integration in the plants (Ramanathan and Veluthambi 1996, Miranda et al., 1992), have promoted them to take up this approach. Although, complete inhibition of the non-T-DNA sequences is not possible, the frequency of integrations are very low (less than 3%) and also transformants with low copy number were obtained. However, this method resulted in decreased transformation efficiency.

Ye et al. (2011) devised the method of using Ri based origin of replication containing plasmid to produce backbone free single copy transformants. They have tested this in three different plant species viz. maize, canola and soybean and found that Ri Ori decrease the vector backbone insertions and increase the single copy transformants against the RK2 OriV origin of replication containing binary vectors.

Although, different strategies have been formulated and tested to counteract the vector backbone insertions in the transgenic plants they have their own inherent glitches. For example, using a lethal gene could decrease the transformation frequencies and in principle could not eliminate the sequences outside the borders as a complete gene cassette has to be expressed to eliminate the regeneration of transformants containing the vector backbone insertions. Using multiple borders although tempting could not totally eliminate these superfluous insertions. 2.5.3 Imprecise processing of T-DNA: Theories and models Experiments carried out by different groups regarding insertions of vector backbone sequences in transgenic plants(Martineau et al., 1994; Kononov et al., 1997; Yin and Wang, 2000; Meza et al., 2002; Kim et al., 2003; Sha et al., 2004; Vain et al., 2004; Afolabi et al., 2004; Wu et al., 2006; Filipenko et al., 2007; Zhang et al., 2008; Gambino et al.,2009; Petti et al., 2009)and data obtained while studying the flanking sequences of T-DNA insertions revealed that the vector sequences linked to left borders are more frequently transferred than the sequences linked to right borders although, Kononov et al. (1997) could not detect this preference. Basing on this observation it was postulated that LB are not recognized as the termination signals and read through happens from the left borders into the vector sequence (De Buck et al., 2000; Podevin et al., 2006). Also, Ramanathan and Veluthambi (1995) by


27

inserting a selection gene outside the left border showed that T-DNA initiation starts at the left border and again terminates at the left border.

Broadly, there are two theories explaining the presence of vector backbone sequences in transgenic plants. As shown by Ramanathan and Veluthambi (1995) and proposed by Van der Graff, (1996) the initiation of T-DNA transfer at LB and again terminates at LB and correct initiation at RB but is failure to recognize LB as the termination signal (Podevin et al, 2006) (Fig. 2.8). Miranda et al. (1992) showed that transfer of T-DNA is a unidirectional process and starts from RB. Also, when only LB were present the initiation of T-DNA transfer could occur and resulted in transfer of whole Ti-plasmid (Culianez-Macia and Hepburn, 1988).

Figure 2.8: Model for the transfer and integration of the entire vector sequences in transgenic plants. The T-DNA transfer is hypothesized to start at the RB, passes the T-DNA, read-through at the LB and goes along the entire vector backbone sequence. In a number of cases, the transfer is assumed not to stop at the RB but to continue for the second time through the T-DNA and finally to stop at the LB.

2.6 Transfer of Agrobacterium chromosomal DNA into plants Besides the erroneous T-DNA processing and insertion of vector sequences, Ulker et al. (2008) analysed that chromosomal DNA could also be transferred to the plants. By analysing and testing the T-DNA insertion mutant lines of Arabidopsis and rice they have come to a conclusion that one in 250 transgenic lines could have this transferred DNA. It is not clear whether this transfer is independent of T-DNA transfer due to co-integration or occurs through T-DNA linkage.

Documents

Review of Literature - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/36243/11/11...Review of Literature 7 2.1.2 Ti plasmid Agrobacterium genus carry a plasmid that is responsible