Upload
others
View
5
Download
0
Embed Size (px)
Citation preview
THE Pl PLASMID PARTITION PROTEIN ParA: ROLES FOR ATP BINDING AND HYDROLYSIS IN PLASMID PARTITION
Megan Jeannette Davey
Thesis subrnitted in confomiity with the requirements for the Degree of Doctor of Philosophy,
Graduate Department of Molecular and Medical Genetics in the University of Toronto.
O by Megan Jeannette Davey 1997
National Library 191 ,Cm,& Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographic Services services bibliographiques
395 Wellington Street 395, nie Wellington Ottawa ON K1 A ON4 OttawaON K1AON4 Canada Canada
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or seil copies of this thesis in rnicrofom, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/fïlm, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
The P l plasmid partition protein ParA: Roles for ATP binding and hydrolysis in plasmid
partition.
Doctor of Philosophy , 1997
Megan Jeannette Davey
Department of Molecular and Medical Genetics, University of Toronto
The Pl prophage plasmid is stably maintained in its bacterial host despite its low
copy number. This stability is due in part to an active partition systern, par, that encodes the
genes for two proteins, ParA and ParB, as well as a cis acting site, parS. ParA is required
for at least two roles during partition in vivo. First, ParA represses expression of its own
gene as well as pari3 from a promoter upstream of parA. This repression by ParA is
stimulated by ParB. There is a second requirement for ParA that is thought to reflect a
direct, as yet undefmed role for ParA in the partition process. In vitro, ParA is an ATPase
that is stimulated by ParB and by non-specific DNA. In addition, ParA binds the par operon
promoter region, consistent with ParA's repressor activity in vivo. In this thesis I examine
the effects of ATP binding and hydrolysis on ParA, particularly on ParA interaction with
parOP and with ParB. 1 show that adenine nucleoside di- and triphosphates stimulate ParA
DNA binding. ATP hydrolysis is not required for ParA DNA binding and, in fact, inhibits
ParA DNA binding. The efiects of ATP binding and hydrolysis on ParA-parOP interaction
are correlated with changes in ParA conformation including, but not limited to, ParA
dimerization. 1 have also found that ParB stimulates ParA DNA binding in vitro, consistent
with ParB's role as a CO-repressor in vivo. ParB stimulation of ParA DNA binding requires
ATP hy droly sis. However, preliminary results suggest that ATP hydroly sis is not required
on ParA-ParB
repressor
for physical association of ParA and ParB, therefore ATP must exert its effect
interaction via a different mechanism. My results have led to a mode1 of ParA
function in which ATP binding and ATP hydrolysis have separable roles and have led to the
suggestion that ATP binding and hydrolysis have separable roles in ParA's partition function
as well.
iii
ACKNOWLEDGEMENTS
1 am highly appreciative of the support of fnends. family and colleagues d u ~ g my
graduate career. In paaicular, 1 thank my supervisor, Barbara FunneU, for her guidance and
fnendship. Other members of the FunneIl lab, past and present, have also contributed
inteikctuaiiy and otherwise to my graduate life. In panicular, 1 wish to thank Liane Gagnier
for plasmids and humour, and Jennifer Surtees for His-tagged ParB and for periodic
perspective adjustments. I have dso benefited from the input of other members of the
department iocluding Dr. Gold and Mike Moran, who were on my supervisory cornmittee. In
addition, 1 thank Man Davidson and the members of his lab for their assistance with CD. I
aclcuowledge financial support from Ontario Graduate Scholarships and University of Toronto
Open Fellowships.
1 have made many fiends in graduate school and 1 am grateful for their friendship
and shared experiences, especially the not-so- "New Kids" . 1 also thaok my "non-science"
friends for their patience and encouragement. Finally, 1 have always enjoyed the love and
support of my family, Dad, Mom, Fran, Katherine, Chris and Janie and 1 thank them for
their encouragement.
TABLE OF CONTENTS
PREFACE Thesis abstract Acknowledgements Table of contents List of tables List of figures List of abbreviations
CHAPTER 1: GE- INTRODUCTION
PLASMID PARTITION General mechanisms
Limiting site versus plasmid pairing modefs Role of the membrane in partition One pair partition versus equipartition S m
Pl partition The partition complex ParA plays two roles in partition Regdation of par gene expression ParA ATPase ParA and ParB interactions ParA and ParB homologs s m w
Other plasmid partition systems F and P7 plasmids Incm plasmids RK2 Other plasmids
OTHER FACTORS CONTRIBUTING TO PLASMID STABILITY Copy number control
Replication control of copy number Multimer resolution
Kilier sy stems
CHROMOSOME PARTITION Events prior to positioning
Decatenation of the chromosome Resolution of chromosome multimers
ii iv v viii k
TABLE OF CONTENTS (cont.)
Chromosome positionhg The E. coli muk mutants Other mutants
ATP BINDING AND IfYDROLYSIS
THESIS RATIONALE
CHAPTER 2: A ROLE FOR ATP IN SITE-SPECIFIC DNA BINDING BY PUA
INTRODUCTION
EXPER.IMENTAL PROCEDURES Strains and plasmids Reagents and buffers Antibody production and purification ParA purification DNase 1 protection assays
RESULTS Purification of PUA DNA binding is stimulated by, but does not require, ATP Effects of ATP hydrolysis on DNA binding ATP and ADP affect the sedimentation behaviour of ParA ParA forrns dimers
DISCUSSION
CHAPTER 3: MODULATION OF ParA BY ATP, ADP AND ParB
INTRODUCTION
EXPERIMENTAL PROCEDURES Reagents and buffers Proteins Nucleotide binding Protein concentration detennination DNA binding assay Quantification of DNase 1 protection assays
RESULTS ATP and ADP binding by ParA Nucleotide effects on ParA stability ATP binding and hydrolysis alter ParA conformation ParB stimulates ParA DNA binding Nucleotide specificity of ParB stimulation of ParA DNA-binding activity
TABLE OF CONTENTS (cont.)
DISCUSSION ParA conformation with and without nucleotide Differentiation between adenine nucleoside diphosphates and triphosphates Effects of ATP hydrolysis on ParA structure and finction ParA-ParB interactions Roles of ATP in par gene regulation and partition
CHAPTER 4: ISOLATION OF ParA-ParB COMPLEXES AND FUTURE DIRECTIONS
INTRODUCTION
METHODS Preparation of 35S-labelled ParA extracts Preparation of "S-PUA protein Antibodies and Protein A Sepharose beads Co-immunoprecipitation of ParA and ParB
DISCUSSION AND FUTURE DIRECTIONS ParA-ParB interactions ParA interaction with the partition complex Roles of ATP binding and hydrolysis in par gene expression and partition
REFERENCES
LIST OF TABLES
CHAPTER 3
Table 3-1: Relative binding of AT' and ADP by ParA as measured
using equilibriurn gel filtration.
Table 3-2: Effects of adenine nucleotides on ParA helicity, measured by CD. 91
Table 3-3: Effects of adenine nucleotides on heat denaturation of PUA. 95
LIST OF FIGURES
CHAPTER 1 Page
Figure 1-1: Limiting site and plasmid pairing partition models. 6
Figure 1-2: The Pl plasmid partition system. I l
Figure 13: ParA and PqB contain regions of homology to other proteins. 17
Figure 1-4: A mode1 for Pl plasmid partition. 20
Figure 1-5: The plasmid partition systems of F. W, RI and RK2. 23
Figure 1-6: ATP binding and hydrolysis 35
C-R 2
Figure 2-1: Purification of ParA. 45
Figure 2-2: ATP and dATP hydrolysis by ParA. 47
Figure 2-3: ATP stimulation of ParA-purOP interaction. 50
Figure 2-4: Summary of the extent and pattern of protection from DNase 1 cleavage 52
by ParA protein.
Figure 2-5: Nucleotide effects on ParA DNA-binding activity. 54
Figure 2-6: ATP and ADP affect ParA sedimentation rate. 58
Figure 2-7: EGS crosslinking of ParA. 63
CHAPTER 3
Figure 3-1: Equilibrium gel filtration analysis of ATP binding by ParA.
Figure 3-2: Am, ATPyS and ADP stabilize ParA.
Figure 3-3: ParA conformation with and without nucleotide.
Figure 3-4: The effects of adenine nucleotides on ParA stability .
LIST OF FIGURES (cont.) Page
Figure 3-5: ParB stimulates ParA DNA binding in the presence of ATP. 98
Figure 3-6: ParB does not sùmulate ParA DNA binding in the presence of ADP 100
or in the absence of nucleotide.
CHAPTER 4
Figure 4-1: Physical association of PUA and ParB.
Figure 4-2: Association of ParA and ParB in the absence of nucleotide.
LIST OF ABBREVIATIONS
AMP-PNP: adenylyl-imidodiphosphate
ATPyS : adenosine-5 '-O-(3-thiotriphosphate)
b p : basepair(s)
BSA: bovine serum albumin
CD: circular dichroism
DNase 1: bovine pancreatic deoxynbonuclease 1
DTT: 1,4-dithiothreitol
EDTA: disodium ethylenediaminetetra-acetate
EGS: ethylene glycolbis(succinimidyl succinate)
GST: glutathione-S-transferase
IgG: immunoglobulin G
IHF': integration host factor
WïG: isopropyl-0-D-thiogalactopyranoside
K, : dissociation constant
kDa: kilodaltons
parOP: the P l par operon operator/promoter sequences
TLC: thin layer chromatography
CHAPTER 1 : Generai Introduction
Nanirally occurring plasmids such as Pl, F, and R1 are stably maintained in
bacterial populations despite the fact that their copy number is extremely low. Their stability
is dependent on an active segregation or "partition" system. The mechanism of partition is
not howu, however it can be thought of as a process that positions plasmids to ensure that
each daughter ce11 receives a copy of the plasmid. For many plasmids, including P 1, F, and
RI, the plasmid-encoded elements required for partition have been identified, although their
functions in the partition process are not completely understood. Host-encoded factors are
also thought to participate in plasmid partition, but very few host factors have been
identified. In addition. very linle is known about the partition of bactenal chromosomes.
Plasmid partition systerns are thought to mimic the partition system of the bactenal
chromosome and may utilize components of the chromosome partition apparatus. In
particular, P l and F partition systems, studied in Escherichia coli, serve as good rnodels for
chromosome partition because they are the best characterized systems to date and the
plasmids are the same copy number as the E. coli chromosome. These plasmids are easy to
study, because unlike the chromosome, plasmids are not usually essential to the growth of
the cell. Pl and F also serve as models for other low-copy-number plasmids. Of particular
interest are homologous systems encoded by naturally occurring low-copy-nurnber plasmids
that carry virulence factors or antibiotic resistance genes and by the chromosomes of several
pathogenic bacteria.
The partition systems of low-copy-number plasmids such as F, Pl and R1 share
several common characteristics (see below), which suggest some sirnilarities in their partition
mechanism. Many plasmid partition systems encode an ATPase that is requhed for plasmid
partition, however a role for these ATPases in plasmid partition has not yet been identified.
In this thesis, 1 discuss the roles of ATP binding and hycûolysis in the function of the Pl
plasmid partition ATPase, ParA.
PLASMID PARTITION
General mechadans: Partition systems have been identified on many different Iowtopy-
number plasmids. Partition loci usuaily encode one or more tram acting factors that bind to a
cis acting site on the plasmid. This "partition site" is the site of assembly of the partition
apparatus which presumably consists of both plasmid and host encoded factors.
In order for partition to occur, a plasmid must be able to sense its position with
respect to the division plane in the ce11 and with respect to the other copy or copies of the
plasmid in the cell. One can predict therefore that the plasmids will interact via their partition
sites with specific components in the host ce11 and/or with each other. These predictions must
also account for the phenomenon of "partition-mediated incompatibility" expressed by the cis
acting partition sites. Partition-mediated incompatibility refers to the inability of two different
plasmids carrying the same partition site to exist stably in the same cell. This incompatibility
or cornpetition is specific for a particular partition site; plasmids with different partition sites
do not compete. The phenomenon of partition-mediated incompatibility predicts that plasmids
are randomiy selected from a pool of plasmids for partition.
An early mode1 for partition (86) incorporates some, but not dl, of these predictions
and has greatly influenced the development of subsequent models. Jacob et al. (86) proposed
that plasmids are continually bound to specific sites on the ceIl membrane. Both replication
and partition of the plasmid would be mediated by the plasmid's interaction with these sites.
Replication would result in duplication of the plasrnid and of the site to which the plasmid is
bound. Partition would be achieved by the ordered growth of membrane between the two
sites; the daughter plasmids would be moved apart as the ce11 elongates. While most current
partition models favour some type of membrane atmchment, several observations are
inconsistent with the Jacob model. First, this mode1 predicts that replication and partition
would be fûnctionally Iinked . However , plasmid par loci stabilize heterologous replicons
(Le., plasmids with different replication origins; 10, 28, 63, 1 12, 149). In addition, for Pl at
least, replication is not required for partition (188). Second. this model requires that new
membrane growth is selectively deposited at the center of the cell, pushing older material to
the poles. However, w w material is deposited in the membrane dispersively (71),
consequently membrane growth would not necessarily direct partition of plasmids. Finaily,
this model predicts that plasmids would not be selected at random for partition since
replication and partition occur at the same site. This is inconsistent with the observation that
partition sites carried on otherwise compatible replicons mediate incompatibility.
Limiring sire versus plasmid pairing models: Two more recent models incorporate aspects of
the Jacob model, but are more consistent with experimental observations. In one of these
models, plasmids are proposed to interact with specific sites in the host cell, on the inner
membrane for example (Fig. 1-1A). These sites are Iirnited in number (ideally, two per cell
at cell division), specific for the plasmid's partition apparatus, and located on either side of
the division plane. Following DNA replication, sister plasmids bind to these sites via their cis
sites. The location of one site on either side of the division plane ensures that each daughter
ce11 receives a copy of the plasmid. Incompatibility would result from cornpetition among
plasmids carrying the same partition locus for the limited sites. This model aiso predicts that
the ce11 would contain a different type of limiting site for each plasmid type or
incompatibility group. The large number of different plasmid incompatibility groups (more
than 20; 145) makes this model less appealing because the ce11 would require at least that
number of these putative limiting sites. Atternatively, plasmids could pair via their cis sites
limiting site J \ pairing
O lowcopy-number plasmid
Figure 1 - 1. Limiting site and plasmid pairing models. The plasmids (biack
circles) are partitioned by their par sites (blue circles). In A plaunids are partitioned
by interacting with a specific site in the host that is W t e d in number (orange
shape). In B plasmids pair before being partitioned by a general partition
mechanism,
(Fig. 1-1B) (10). The paired plasrnids would then be partitioned by a general partition
apparatus. In this model, the specificity for partition is provided by the plasmid rather than
by the host. Incompatibility would &se from heterologous pairing of plasmids. This
"pairing" model is generally favoured over the f ~ s t , "limiting site" model, however there is
no direct evidence for plasmid pairing.
Role of the membrane Ni panition: These models predict that plasmids will interact with
specific components in the host ce11 via the plasmid's partition system. Host-encoded factors
that spatially confime or move plasmids have not yet been identified. The only known
subcellular structures in E. coli cells are the chromosome and the ce11 membrane. Potentially,
plasmids could be partitioned sirnply by attaching to the chromosome via specific DNA sites.
However, F and Pl, two unit copy plasmids, segregate independently of the chromosome
(49, 62). Therefore, the membrane is a likely site of plasmid interaction with the host cell.
Partition-specific interactions with the membrane have not yet been fully exarnined. Although
it has been reported that plasmids or Par proteins precipitate with ce11 membranes during ce11
fractionation (72, 194), further examination of one of these reports (194) indicated that there
was no membrane association (78). In addition, the purification properties of several partition
proteins show that they are soluble and therefore these proteins are not exclusively membrane
bound. Nevertheless, some type of membrane association is a common characteristic in
partition models.
One pair partition versus equipanition: Another question that must be addressed is how many
copies of the plasmid are actively partitioned. Since plasmid copy number is measured per
bacterial chromosome, in a rapidly growing E. coli ce11 where there are more than two
copies of the chromosome, there wiii be more than IWO copies of a unit copy plasrnid. At
one extreme, only one pair of plasmids is paaitioned, referred to as "one pair partition".
7
Any remaining plasmids would be randomly segregated. At the other extreme, al1 plasmid
copies are actively segregated, referred to as "equipartition" . Alternatively , some copies of
the plasmid may be actively partitioned and some copies may be randomly segregated. One
pair partition is most consistent with a limiting site model and equipartition is most attractive
for the plasmid pairing model. However, an observation that one pair partition or
equipartition occurs would not exclude either the limiting site or pairing models.
Experimentally, it has not been possible to distinguish between one pair partition and
equipartition (eg . 143, 188). This question will most likely be answered when al1 plasmid-
host interactions have been identified.
Swnmary: It has not been possible to distinguish between the limiting site and plasmid
pairing models and between the one pair and equipartition models in vivo. Researchers are
restricted by having to measure populations of cells rather than individual cells and by the
modest amount of information about the factors involved in the positioning process. 1 have
taken the approach of characterizing one of the known components of the Pl partition
system, ParA. This characterization as well as the identification and characterization of other
factors involved in plasmid partition are necessary steps for the development of in vitro tests
of partition models.
Pl Partition: The Pl prophage is a unit copy plasmid that is stably maintained in its
Escherichia coli host; Pl is lost from a bacteriai ce11 less than once in every lû" ce11
divisions (84, 162). This faithful segregation is dependent on the plasmid's partition system
termed par (10). Pl par is included in a 2.6 kb Hindm-EcoRV fragment of Pl (Fig . 1-2A)
(3) that is sufficient to stabilize heterologous replicons (10, 12). The par region contains the
genes for two proteins, ParA and ParB, and a cis-acting site, pars (Fig. 1-2A and B) (3).
parA and parB constitute an operon, and are aanscribed from an autoregulated promoter
Figure 1-2. The P l plasmid partition system. A: The Pl par operon. The genes for ParA
and ParB are marked by the arrows, pars by the grey box and the promoter region @nrOP)
by the white box (3). The positions of restriction sites referred to in this and subsequent
chapters are indicated. The scaie in kbp is shown below the fragment. B: Sequence of the
pars site (3). The Box A and Box B ParB recognition motifs (60) are indicated by the white
orrows and grey boxes, respectively. The position of the IHF binding site (57) is indicated by
the hatched bar and restriction sites are indicated by the square brackets. C: The 388 bp
HindIII-XhoI fragment from Pl that contains the par operon promoter region. The positions
of the -35 and -10 transcriptional signals as well as the ribosome binding site (RBS) and the
parA start codon (ATG) (3) are marked by the boxes. The inverted arrows mark the position
of the 20 bp imperfect inverted repeat (3). The transcriptional start site is indicated by the
star (77). The scale, in bp, is marked above and below the fragment.
- nql n TCGATAAAAAGCCGAAGCCTTAAAC ATTAACTGACTGTTT
L
TTAAAGTAAATTACTCT d
Drsl
upstream of parA (in purOP; Fig 1-2C) (55). Disruption of parA, parB or pars results in
piasmid destabiiization (3). Pl partition is believed to hvolve the assembly of Pl and E. culi
encoded partition factors at parS. This assemblage mediates positionhg of the plasmid in a
process that is not yet understood. The only known host factor for Pl partition is integration
host factor 0 which contributes to partition but is not required (58). Other host factors
are believed to be involved, but they have not yet ken identified. Since Pl segregates
independently of the chromosome, the host factor is not a DNA site on the E. coli
chromosome (62).
The Paniriorz Compla: The earliest recognized step in partition is ionnation of the partition
complex1 by binding of ParB and IHF to pars (38. 57, 58). ParA is no& required for
formation of t h i s complex and the protein is thought to act at a later undefmed step in
partition (see below) (38, 57, 58). The pars site is the only element that is required on a
low-copy-number plasmid to ensure its proper segregation (as long as ParA and ParB are
provided Ni tram; 11). Its action is likened to eukaryotic centromeres; it foms the site at
which the segregation machinery is thought to assemble and at which pairing of the plasmids
is thought to occur (1 1).
pars is located in a 109 bp TaqI-Sv1 fragment from Pl (Fig. 1-2B). This region
includes two sets of ParB binding sites separated by an MF binding site. As determined by
footprinting assays, DMS interference assays and mutagenesis, ParB binds two different
sequence motifs, denoted "Box A" (A'MTCAA/C) and "Box B" (TCGCCA) (Fig. 1-2B) (40,
60). There is one copy of each Box to the left of the MF binding site and three copies of
Box A and one copy of Box B to the nght of the MF binding site. The limits of a functional
-- - - - . - - - - - -
'In this thesis, "partition complex" refen specifically to the complex formed when Pl ParB and MF bind to Pl parS. This term should not be confused with partition apparatus or partition mechanisrn which refer to generai complexes of partition factors.
11
pars site can be defined by its partition and incompatibility phenotypes. The 109 bp Ta@-
SgI fragment is referred to as pars' and is wild-type for partition and incompatibility.
However, pars-srnail, the 34 bp DraI-StyI fragment which does not contain the left half of
pars or the IHF binding site (Fig. 1-2B). is also active for partition (117). However,
pars-small is a less efficient par site than pars and is unable to compete with (ie. exert
incompatibility against) pars+ in an MF-dependent manner.
A role for IHF in P 1 partition was fmt discovered by its ability to stimulate ParB
binding to pars in vitro (58). IHF also stimulates, but is not required for, partition in vivo.
In E. coli mutants lacking MF. Pl is relatively stable. However, the plasmid is less stable in
MF* mutants than it is in wild-type cells (58). In addition, the
pars-small which lacks the DIF binding site, supports partition NI vivo (57, 118). Aithough
MF is not essential for partition, the incompatibility phenotype of pars-small bearing
plasmids indicates that MF is a component of the wild-type partition apparatus: In wild-type
cells, P l is destabilized by heterologous plasmids bearing pars+ whereas pars-small-bearing
plasmids are unable to compete (117). In MF- mutants, pars' behaves essentially as
pars-small and pars-small plasmids c m now compete with parSc (58). These observations
show that in wild-type cells the partition complex contains MF and that partition complexes
that do not contain MF cannot compete with partition complexes that do contain IHF,
probably because of their differing aff i t ies for ParB (58).
Several observations suggest that the partition cornpiex has a specific three
dimensional structure in which pars sequeaces are wrapped around a core of ParB and MF.
Fint, IHF binds to its site between the left and nght anns of pars, inducing a large bend
(57). In the absence of MF, ParB binds better to its sites in the nght half than in the Ieft half
of pars (57, 60). However, when IHF is present both arms are bound equally well by ParB.
12
Since IHF increases ParB a"nity for purs? this suggesu that IHF stimulates ParB binding by
aüowing ParB to contact both the left and right halves of pars simultaneously (57, 60). In
addition, the ParB-MF-purs complex prefen to form on supercoiled DNA (57); supercoiling
would favour a wrapped complex. Finally, helical phasing between ParB sites in the lefi and
right halves of pars is important suggesting that these sites interact with each other via ParB
(60, 74).
ParA plays a? l e m two roles in panirion. The fmt function of ParA is to repress
transcription of the par genes (55). A second function for ParA is ioferred from the
foilowing genetic experiments. First, mutations in parA are not complemented by plasmids
carrying only pari3 expressed from a heterologous promoter. even though such plasmids
efficiently complement parB mutants. These parA mutants require both parA and parB for
plasmid stability (55). Second, a mutant par promoter was constmcted that is not regulated
by ParA but expresses parA and parB at levels that allow partition. Under these conditions
ParA is not required for its regulatory function but is still required for partition (41). ParA's
second function in partition, referred to as its partition function, is assumed to be a direct
role in the positioning process.
Regularion of par gene expression: The genes for ParA and ParB form an operon, the
transcription of which is initiated from a promoter upstream of parA (Fig. 1-2A and C).
ParA represses transcription from this promoter in vivo (55). ParA repressor activity is
stimulated by ParB, however ParB has no repressor activiq on its own (55). A second
putative promoter lies between parA and parB (3) and there is some evidence that ParB may
also be expressed (unreylated) from this promoter (3, 55) but this has not yet been cleariy
demonstrated. ParA and ParB levels are important for proper segregation; overexpression of
either, or in some cases both, ParA ancilor ParB destabilizes P l (3, 56, 77). Overexpression
13
of partition proteins in other plasmid partition systerns has similar effefts (e.g . 9 1, 103). In
addition, many other plasmid partition genes are autoregulated, including those encoded by
F, P7, RIINRI, RK2, and pTAR (42, 47, 63, 65, 77, 91, 132, 182). PUA and ParB
provided from a mutant par promoter that is not autoregulated and expresses less protein than
the unregulated wild-type promoter support partition (41). It seems likely therefore that
autoregulation is required to maintain a low, but sufficient, level of protein. ParA binds site-
specificaliy to the par operon promoter region (par00 in virro (39). This binding activity is
thought to mediate ParA repressor activity in vivo. The sequence requirements for ParA
DNA binding are not well understood, but the information for ParA binding is probably
included in the 20 bp imperfect, inverted repeat sequence located between the -10
transcriptional signal and the ribosome binding site (Fig. 1-2C). The region of purOP
protected from DNase 1 attack by ParA includes these repeats (Chapter 2; 35, 39) and
mutations in these repeats affect ParA's ability to repress par gene expression in vivo (77).
ParA DNA binding was reported to require ATP (39), but more recently my results
demonstrate that ATP is not required for ParA DNA binding, although ATP greatly
stimulates ParA DNA binding (Chapter 2; 35).
The region protected fiom DNase 1 cleavage by ParA corresponds to the region
protected by RNA polymerase at other promoters (-45 to +20; Ref. 70) and includes the
major transcription start site (Chapter 2; 35, 39, 77). This suggests that ParA represses
transcription by preventing RNA polymerase from binding to the promoter rather than
affecting RNA polymerase a c t i v i ~ after it has bound to the promoter. It is not clear why a
repressor that seems to act by preventing RNA polymerase from binding would utilize ATP.
ATP also affects the repressor activity of TyrR, a negative and positive regulator of the tyr
regulon in E. coli (156, 200). TyrR interaction with tyrosine requires ATP, and TyrR
interaction with tyrosine is in tum required for repression by TyrR (9, 156).
ParA ATPase: ParA ATPase activity was fmt suggested by sequence homology to the
Walker nucleotide binding motifs A and B (Fig . 1-3A) (133, 193). ParA ATPase activity is
quite weak (about 1@ times lower than the RecBCD ATPase, for example Refs. 39 and 100).
It is stimulated by DNA of no specific sequence or topology and by ParB (39). The ATPase
activity does not seem to reflect either a protein kinase activity or a topoisornerase activity
(39). Deletion or mutation of the Walker A motif results in loss of ParA's regulatory and
partition functions (41). Partition is a process that requires energy and one can speculate that
ParA provides this energy via its interaction with ATP. The steps at which the ParA ATPase
may act are not known, however putative steps in the partition process, such as plasmid
movement andfor plasmid pairing, may require ParA's ATPase activity.
Very few site-specific DNA binding proteins are directly affected by ATP. Some of
these proteins, such as the replication initiation protein ORC of Saccharomyces cerevisiae and
T antigen of SV40, are involved in processes that are regulated with respect to the ce11 cycle.
It has been suggested that ATP may regulate the activities of these proteins with respect to
the ce11 cycle (16). Shce partition is likely to be similarly regulated, perhaps ATP also
regulates ParA activity with respect to the ce11 division cycle.
ParA-ParB interachu: ParB stimulates ParA's repressor actvity in vivo (55) and ParA's
ATPase activity in vitro (39) suggesting that the two proteins interact. There is presumably a
direct role for this interaction in partition since ParB is a component of the partition complex
(57, 58) and ParA is also required for partition (41, 55). A direct role for ParA in partition
requires that ParA interact with the partition complex. Further characterization of the
interaction between ParA and ParB is required to understand its potential roles in partition.
15
ParA and ParB homologs: Homologs to ParA and ParB are encoded by other plasmids as
well as by several bacterial chromosomes. The ParA homologs have been grouped in a
superfamily by vimie of their sequence similanties, particularly in the A motif for nucleotide
binding (Fig. 1-3) (99. 133, 193). This superfarnily includes proteins of diverse fiinctions
including ce11 division, nitrogen fixation, membrane transport as well as partition. Some of
these homologs, including some chromosomally encoded homologs, have not been
characterized functionally but are proposed to have roles in partition because (i) they are
more similar to the partition proteins than to proteins of other known functions and (ii) many
of these homologs are encoded by genes upstrearn of a gene for a ParB homolog (99).
Bacillus subtilis encodes ParA and ParB hornologs, Soj and SpoOJ, respectively, that are
involved in sporulation (146). SpoOJ is required for chromosome partition in Bacillus,
however Soj is not (85). E. coli encodes no ParA-ParB homolog pair (the entire E. coli
chromosome has been sequenced) although it dws encode homologs to ParA. For example,
these homologs include MinD, a ce11 division protein that is not thought to be directly
involved in partition (see below) .
The proteins in the ParA superfamily are most sirnilar in motif A, motif B and
another motif between the two, referred to as either "motif 2" or "motif A"' (Fig. 1-3A) (99,
133). One member of this superfamily . NifH, has been crystallized (64). Its structure
suggests that motif 2 may also form part of the nucleotide binding site. Some of the ParA-
like proteins including the putative and known partition proteins, share similarities in another
region called "motif 3" (133). The functional significance of these homologies in ParA is not
completely understood.
Figure 1-3. ParA and ParB contain regions of homology to other proteins. A: The
positions and sequences of the nucleotide binding motifs (motif A and matif B) as well as
morifAD and motif 3 in ParA (398 amino acids) are shown. The one letter code for the amino
acid sequence is used. Underlined residues in motifs A, A' and B are invariant residues in
the PUA superfmily (99). The underlined amino acid in motif 3 is conserved in the ParA-
like partition proteins (133). B: Some of the conserved regions in ParB (333 amino acids) are
indicated. The putative helix-tum-helix motif sequence is sho wn (single letter amino acid
code) (46). The underlined amino acids are conserved in at least five of six proteins
compared (1 10). The positions of the conserved acidic residues, potentially phosphorylation
sites, are indicated by the stars (133).
18
ParB shares short regions of homology with other proteins in the database (Fig . 1 -
3B) (1 10, 133). The conserved regions include a putative helix-nim-helix DNA binding motif
(46) and amino acids that could be substrates for phosphorylation (133). Four acidic residues
at positions 68, 204, 250 and 314 are conserved among ParB homologs. By analogy to
Salmonella fyphimuBum CheY, these amho acids might form an acidic pocket, a potential
site for phosphorylation (133). Although ParB phosphorylation has not been detected in vitro
(39; my unpublished observations), mutation of two of these amino acids, at positions 204
and 250, result in a Par- phenotype in vivo, but do not affect any of the ParB in vitro
activities tested, such as DNA binding and dimerization (110).
Swnmary: P l partition is summarized in schematic form in Fig. 14. The f i t recognized
step in partition is formation of the partition complex by interaction of ParB and MF with
pars. The subsequent steps in partition are not defmed, however they must allow the plasmid
to recognize where it and its cognate plasmid are within the cell. The latter can be achieved
by pairing of the plasmids via their partition complexes. The former c m be achieved by
plasmid interaction with specific sites in the host. 1 have drawn plasmids interacting with the
developing septum, however this is only one possible way to orient plasmids within the cell.
Either or both of these events could require the action of ParA a.nd/or host factors. For
example, ParA interaction with the partition complex may mediate interaction of the partition
complex with host factors. Plasrnid interaction with specific factors in the host could in tum
position plasmids. As part of, or subsequent to, the positioning step, plasmid pairs must be
separated so that each daughter ce11 receives a copy of the plasmid. Al1 of these events must
be CO-ordinated with ce11 division.
Other plasmid partition systems: Partition loci have been identified on many different low-
copy-number plasmids. As with the P l partition system, more is known about the plasmid
Figure 1-4. A model for P l plasmid partition. This schematic depicts a general description
of Pl partition. Briefly, after formation of the partition complex, ParA andor host factors
may associate with the partition complex to assist in positioning of the plasmid and perhaps
plasmid pairing. The model is descnbed in greater detail in the text.
ParB and IHF
ParA and 0 h,
c d t division
1 KEY
ParB
* IHF
0 ParA
1 H host
21
encoded components of the partition apparatus ihan the host encoded components and the
mechanism of partition is not known. Some partition systems encode proteins that share
sequence homology to the P l proteins and some partition systems have analogous
components, however other partition systems exhibit very little resemblance to the Pl
partition system. Many of the partition systems have, or are postulated to have, a cis acting
site that expresses incompatibility. As well, these systems encode a protein(s) that acts at this
site. The genes for these proteins are usually autoregulated. Most of the plasmids encode a
putative ATPase that is required for partition, although the role(s) of ATP binding and
hydrolysis in partition remains unclear. These similarities suggest that the different partition
systems utilize similar partition mechanism, at least at sorne steps .
F and P7pZasmidr: Both the F plasrnid partition system, sop, and the P7 partition system,
par, are functionally analogous to Pl par. The F sop region stabilizes otherwise unstable
plasmids without altering the copy number of the plasmid (149). F sop encodes two tram
acting factors, SopA and SopB, that have limited identity to Pl ParA and ParB respectively,
as well as a cis acting site downstream of the genes for the two proteins, sopC (Fig. 1-5)
(13 1). As with P 1 pars, sopC exerts incompatibility against F (13 1). sopC however is very
different from parS. sopC contains 12 copies of a 43 bp repeat sequence (105, 13 1) to which
SopB binds (73, 132). One copy of the 43 bp repeat is sufficient to support partition (19,
115). The SopB-sopC complex may fonn a high order protein-nucleic acid complex of
defiwd three dimensional structure, analogous to the P l partition complex (20, 114).
Putative host factors for F plasmid partition have k e n identified, however they have not
been well characterized. These host factors include 75 kDa and 33 kDa proteins that were
isolated fiom E. coli extracts by v h e of their ability to bind sopC in the presence of SopB
(73). Like P l ParA, SopA is an ATPase that is stimulated by its cognate B protein
Figure 1-5. The plasmid partition systems of F, P7, RI and RIC2. The genes for proteins
thought to be involved in the partition of the various plasmids are indicated by the arrows.
The purple arrows indicate the (putative) ATPases . Cis-acting sites (where known) are
indicated by the blue boxes. Promoter regions (P) are indicated. The binding site of the site-
specific RK2 ParA recombinase is marked by the black box. The scaie is indicated at the top
of the figure in kilobase pairs. The W partition system is most closely related to the P l
partition system. The maps are derived from Refs. 27, 1 12, 13 1 and 196.
24
(1 95) and SopA binds specificaliy to the sop promoter region (132). The latter interaction
presumably mediates regulation of expression from this promo ter (1 32). SopB s tirnulates
SopA interaction with the promoter region in vitro, suggesting that SopB may also have a
role in autoregdation (132).
The partition system of the P7 plasmid, par, is homologous to Pl par (112) and
their components (ParA, ParB and par9 behave similarly (Fig. 1-5) (39, 77). Although
homologous, the Pl components cannot substitute for the P7 components and vice versa (39,
75). Hybrîd proteins and sites have been used to defme parts of the proteins and of the sites
that determine the species specificity (75, 157). For example, P l and W pars Box A
sequences are interchangeable, but the Box B sequences are not (76). A hybrid Pl ParB
protein that contains P7 sequences in its C-terminus binds to P7 pars, suggesting that the C-
terminus recognizes Box B sequences (157).
The sirnilarities shared by the partition systems of F, Pl, and P7 suggest that these
systems may utilize similar mechanisms. These plasmids are compatible so their partition
systems must have different specificities, perhaps determined at a pairing step.
ZncFIIpl~smidr: R1 and NR1 belong to the Incm incompatibility group (a different group
from Pl) and have identical partition loci. The partition locus of RI parA shares some
superficial similarity to the Pl par locus but has no sequence similarity to Pl par. The R1
parA region stabilizes a Sop' F plasmid without affecting plasmid copy number or the growth
of the host ce11 (65). R1 parA encodes two tram-acting factors, ParR and ParM, the genes
for which are coexpressed from a promoter upstream of parM (Fig. 1-5) (129, 9 1). In
addition, a centromere-like site parc is located upstream of parR and parM rather than
downstream of the par genes as in Pl, F, and P7 (Fig. 1-5) (33, 65). ParR binds to two sets
of five direct repeats in parc located on either side of the parA promoter (33). ParR
25
interaction with pu< has two functions. It represses transcription of the parA operon (91)
and is aiso required for a partition function (27). There are conflicting reports as to whether
ParM stimulates ParR repressor activity in vivo (91, 182). No interaction between ParM and
parc has k e n detected, nor has any effect of ParM on ParR DNA binding been detected
(33, 182). Like P l pars, parc expresses incompatibility , however ody weakly (33). It has
been suggested that this weak uicompatibility results from the preference of ParR and
perhaps ParM to bind parc in cis. ParM is an ATPase (as cited in Ref. 27) and it has been
proposed that the ParM ATPase like P l ParA provides the energy for partition. ParM is
homologous to other ATPases (24), but it does not share any sequence homology with the
ParA superfamily suggesting that partition ATPases may have evolved more than once.
RK2: RK2, also known as RP4, is a promiscuous transmissible medium copy number
plasmid (5-8 copies per host chromosome; 52). Two putative partition regions have been
identified on the plasmid (67, 133, 160). Very Little is understood about the function of these
partition systems. They are fairly cornplex, encoding other functions in addition to theu
partition functions.
The korABF region encodes several genes, korA, incC, korB, korFI, kkoFZZ and @-A
(Fig. 1-5) which have been shown to have regulatory roles in control of expression of several
RK2 genes including their own (14, 89, 90, 185, 186, 201). Roles for at least some of these
genes in partition are based on the foilowing observations. First, the korABF region stabilizes
a heterologous medium-copy-number replicon without changing plasmid copy number or
affecting ce11 growth (133). Second, IncC and KorB share sequence homology to P l ParA
and ParB, respectively (133). Finally, disruption of IncC destabilizes plasmids canying the
rest of the region (133). IncC expresses incompatibility against RK2 (172). however no cis
26
acting site has yet been identifed. It is not clear what contribution, if any, the other genes in
this operon make to plasmid partition.
A second RK2 partition region is encodeci by the parCBA operon (Fig. 1-5) which is
divergently aanscribed from a post-segregational killing system parDE (also involved in
plasmid stability, see below) (42, 47, 160, 161). Both operons are autoregulated (42, 47). A
role for the parCBA region in partition is suggested by its ability to stabilize medium copy
number plasmids without altering the copy number of the plasmids (174). ParA encodes a
site-specific recombinase, that promotes multimer resolution using a site in the promoter
region (67). Multimer resolution systems can stabilize plasmids (see below), however ParA's
resolution function is not sufficient to account for the stabilizing effect of the parCBA region
(67, 159, 174). ParA also regulates transcription from the parC'A promoter (42, 47). ParB
has an endonuclease activity whose function is not hown (as cited in Ref. 174). The role of
parc in RK2 partition is also not known. The parCBA region exerts incompatibility against
RK2, however no cis acting site has been identified so far (169).
Other plasmidi: There are several other putative partition loci that have been identified on
various plasmids (eg. 28, 63, 109, 123, 183). Many of these loci are uncharacterized except
for their sequences and were identified as partition systems by virtue of their homology to
the systems I have described. In al1 cases the mechanism of partition is not known. The
similarities between some of these systems, such as a cis site and an ATPase, suggest
similarities in their mechanisms. Further characterization of these systems as well as
identification of host factors, is required to determine if a general partition mechanism exists.
OTHER FACTORS CONTRIBUTING TO PLASMID STABILITY
Stable maintenance of a plasmid is effected by several different systems. In addition
to partition these systems include mechanisms that maintain the optimal copy number of the
27
plasmid and impair the growth of plasmid-free segregants. With the exception of replication
control, the contributions that these mechanisms make to plasmid stability are not as large as
the contribution of the partition systerns to plasmid stability (3, 13, 23).
Copy number control: Both the average plasmid copy number and the distribution of
plasmid copy number will affect the stability of a plasmid in a cell. For proper segregation,
the ce11 must contain at least two copies of a plasmid at the time of ce11 division. In addition,
many naturally occurring plasmids are quite large (P 1 is about 90 kbp; 84) and their copy
number is kept Iow so as not to drain the host's resources. The distribution of copy number
in a ce11 population also affects plasmid stability. If the distribution is relatively broad, then
there is a greater frequency of plasmid free cells (144). Consequently, plasmids are more
stable when their copy numbers are maintained within a narrow range. The number of copies
of a plasmid is controlled by replication and recombination systems.
Replication control of copy number: Three different mechanisms have k e n shown to
regulate initiation of plasmid replication: regulation by a repressor protein, by antisense RNA
and by iterons. Iterons are multiple repeats of DNA sequences to which a plasmid-encoded
Rep protein binds (reviewed in Ref. 142). Plasmids such as F and P l are maintained at very
low copy number, about one per host chromosome (53, 84). Pl copy number is controlled,
at least in part, by iterons located in a region called inc . . Deletion of this region results in
an 8 to 10 fold increase in Pl copy number (153). RepA binds to the iterons in ind as well
as to sites in oriR, the plasmid origin of replication (1, 29). Binding of RepA to these sites
mediates interaction between incA and oriR, presumably via RepA-RepA interactions (152).
It has k e n suggested that this interaction between onR and incA interferes with initiation of
plasmid replication, perhaps by steric hindrance (2, 134, 142, 152). As the copy number of
the plasmid increases the number of possible interactions that RepA molecules bound at
different sites cm make with each other increases, thereby inhibithg replication.
Multimer resolution: In Rec+ ceiis, plasmids can recombine to form multimers, in effect
lowering the copy number of the plasmid. Many plasmids encode site-specific recombination
systems that catalyze the resolution of plasmid multimers to monomers. This maximizes the
number of independently partitionable molecules. Deletion of plasmid-encoded multimer
resolution systems results in an increase in plasmid multimea and a concomitant decrease in
plasmid stability (13, 180). Pl encodes a multimer resolution system consisting of the loxP
site and the Cre recombinase (176). Pl plasmids without a functioning loxPICre system are
less stably maintained in Rec+ strains than plasmids that do have a functioning recombinase
(13). A bias in the loxPICre reaction towards resolvase function, that is towards formation of
monomers, would be preferred to perform this stabilizing function. Although in vitro snidies
suggest that Cre îünctions equally well to promote and resolve dimers, some observations
suggest that it may function predominantly as a resolvase in vivo (4).
m e r systems: Killer systems contribute to the stability of a plasmid by kiiiing cells that
lose the plasmid. In al1 the systems characterized to date, the plasmid encodes a toxin and an
antidote for the toxin's lethal action (for reviews see Refs. 66 and 92). The antidote is less
stable than the toxin so when the plasmid is lost from a cell, the antidote is degraded before
the toxin and the ce11 is killed. The toxin is usually a protein, but antidotes c m be either a
protein, or an antisense RNA that prevents expression of the toxin (66, 92).
Pl has a kiiler system encoded by the genes pM and doc Qrevents b s t &ath and
death on curing, respectively; 106). Doc is lethal to E. coli in the absence of Phd, however - the cellular target of the Doc toxin is not known (106). Phd is a target for the E. coli ClpXP
protease in vivo. In ClpXP strains, Phd is stable and the killer system does not function
(107). Analogous killer systems have been characterized on F, R1 and RK2 (148, 161, 189).
29
The F killer system, ccd, encodes two proteins, CcdA and CcdB (88, 124, 126, 148). CfdB
is toxic to E. d i and its target is DNA gyrase (18, 125). DNA gyrase is not thought to be
the target of Pl Doc (106).
Curiously, the E. coli chromosome encodes homologs to the RI pem kiiler locus
(1 19) and at least three different homologs to the R1 Hok toxin (25. 65). The pem homologs
ChpAK and ChpBK inhibit cellular growth when overexpressed in the absence of ChpAI or
ChpBI proteins, respectively. The chpA and chpB genes are located near stringent response
genes and it is suggested that the ChpA and ChpB I and K proteins may serve to inhibit
growth under conditions where rapid growth might be hannful to the ce11 (1 19). The roles of
the other homologs are not known.
CHROMOSOME PARTITION
Little is known about the partition mechanism of the bacterial chromosome.
Chromosome partition has been examined to a lirnited extent cytologically, by following the
movement of stained chromosomes. These types of experiments were initially interpreted to
suggest that chromosomes moved rapidly fiom mid-ceIl positions after DNA replication was
complete to positions that are 114 and 314 along the length of the cell (15, 80). In these
experiments chromosome position was measured from the center of the chromosome to the
ce11 poles. When the position of the chromosome was subsequently measured from the edge
of the chromosome to the ce11 poles a more gradua1 movement of the chromosome,
concomitant with ce11 growth and DNA replication was observed (192). The seemingly rapie
movement of the chromosome in the fust set of measurements argued for a positionhg
mechanism similar to mitosis in eukaryotic cells (80). The second set of measurements
suggested that chromosome segregation may occur by a more passive, non-motive m d~..m
30
(192). Regardless, there must be a mechanism to ensure proper distribution of the
chromosome as less than 0.03 % of E. coli ceils are anucleate (79).
Events prior to positioning: Very few of the "partition" mutants that have been identified in
E. coli are thought to directly affect the positioning of chromosomes. Many of the mutants
that have k e n identified affect steps prior to this event, such as replication, multimer
resolution and decatenation. Defects affecting these earlier steps produce a different
phenotype (called Pd-) from defects affecting the positioning step of partition (cailed ParII-).
The ParI' phenotype is characterked by elongated cells with one large centrally located
nucleoid (203). Sometirnes anucleate cells of variable length will be produced. The ParI-
phenotype includes decatenation and recombination defecu; chromosomes are entangled or
dimeric so that the positioning mechanism cannot separate them. The ParII- phenotype is
typified by an increased number of anucleate cells the same length as newbom cells. The
nucleoids are of normal size (203). ParII' mutants are thought to directly affect the
positioning reaction.
Decatemtion of the chromosome: DNA replication causes two topological problems. First,
unwinding of double stranded DNA by the advancing replication fork introduces tighter
twists ahead of the fork which must be removed to allow continued fork movement. Second,
catenanes are formed that interfere with separation of the chromosomes during partition.
There are two type 2 topoisornerases in E. col& D N A gyrase and topoisomerase IV (topo
IV), that can resolve catenanes in vitro and in vivo (5, 101, 1 16, 154). The genes encoding
DNA gyrase, gyrA and gyrB, and the genes encoding topo IV, parc and parE, are essentia'
genes. Decatenation of the products of DNA replication is thought to be carried out
predorninantly by topo IV, since plasrnid catenanes that result from replication accum ..,G in
strains defective in topo IV and these strains have the Pari- phenotype. In additic ., topo IV
31
more efficiently unlinks catenanes in vitro than DNA gyrase unlinks catenanes (190). It has
been suggested that DNA gyrase makes a minor contribution to this activity in vivo, but that
the primary function of DNA gyrase is to introduce negative supercoils ahead of the
replication fork (5, 202). However, some mutations in the DNA gyrase genes result in a
ParI- phenotype and catenated chromosomes. This observation is unexplained since these cells
contain wild-type topo IV (95, 150, 175). Whether one or both enzymes catalyse
decatenation in vivo, this activity is clearly a necessary step before positioning of
chromosomes.
Resoiution of chromosome multimers: The E. coii chromosome possesses a multimer
resolution system that presumably contributes to chromosome segregation by generating
monomers from dimeric daughter chromosomes that arise because of homologous
recombination. This site-specific recombination system. located in the replication terminus
region of the chromosome is not directly involved in the positioning process. Site-specific
recombination at the dif site in the E. coli replication terminus region by the XerCD
recombinase was discovered concurrently by three different labs (21, 31, 102). The 33 bp
site, dif. is located in the replication terminus region of the bacterial chromosome and is
sufficient for either inter- or intramolecular recombination by the XerC and XerD
recombinases (2 1, 3 1, 32, 102, 108, 184). Deletion of dif or xerC results in füamentation
and aberrant nucleoid distribution and size (Pa& phenotype ; 2 1, 102). XerCDldif can be
replaced by Pl CrelloxP without disrupting the ce11 (108). The dif locus is homologous to tk
cer site on ColEl (21) which is also a substrate for XerCD (22, 32). Unlike at cer, the ac:
of XerCD at dif is not biased towards resolution (monomer formation) in vitro. It has bet
suggested that resolution bias occurs in vivo simply because chromosomes are segrega-
away from each other (21, 102).
Chromosome positioning:
nie E. coli muk mu?mzts: The muk mutants were isolated using a screen that selected for
non-lethal mutants that gave rise to a high frequency of anucleate ceils (ParII- phenotype; 79,
140). The m M , mukB, mukC and mukD mutants were identified in this screen. mukC and
mukD have not yet been characterized. MukA is identical to TolC, an outer membrane
protein (79). The effects of tolC mutations on E. coli are pleiotropic, affecting resistance to
detergents, antibiotics, colicins as well as expression of other outer membrane proteins (37).
TolC's role in partition is not well understood. One suggestion is that it helps to foxm
attachrnent of the chromosome to the ce11 membrane via a cotranscriptional complex whereby
concomitant transcription, translation and membrane insertion of an integral membrane
protein gene, such as tolC, form a transient link between the chromosome and the inner
membrane (1 13, 192).
mukB encodes a 177 kDa protein with lirnited homology to rat dynamin D 100 (79).
The predicted secondary structure of M W suggests that it resembles eukaryotic motor
proteins. MukB is predicted to have two globular domains, one at the amino temiinus and
one at the carboxyl terminus, separated by a central rod domain that contains a flexible
"hinge" region (140). MukB binds ATP and GTP as well as DNA of no specific sequence
(139). It was originalïy proposed that MukB propels the chromosomes to their proper
positions in the ce11 dong some as yet undefmed network of fdaments (140). More recently
however it has been suggested that M W may have a role in chromosome condensation
based on the observations that (i) its proposed structurai organization is similar to eukaryotic
proteins that are involved in chromosome condensation (82, 155, 178) and (ii) mukB
mutations are suppressed by genes that affect chromosome condensation when these genes are
expressed Born high-copy-number plasmids (82, 198). Chromosome condensation may be
33
required for partition to occur or may be a motive force in chromosome positionhg (82).
The genes for two other proteins, MukF and M U E . were identified upstream of
muk, and their disruption causes anucleate ce11 formation (199). The functions of these
proteins in partition are not known. MukF, which is similar to histone-like proteins, may
have a role in chromosome condensation since a mukF nul1 mutant strain has irregularly
s haped diffuse nucleiods ( 1 99).
Other mutants: Mutation of sorne chromosomal genes that have functions in other cellular
processes in E. coli give rise to anucleate cells. Mutations Ui r e d for instance, give rise to
anucleate cells without affecting DNA replication (171, 203). However, this phenotype was
shown to be the result of chromosome degradation (170). Certain mutations in min, a ce11
division locus, result in aberrant chromosome segregation (6, 87, 135). The min mutants
were originally identified as mutations that give nse to minicells resulting from aberrant
septum placement at the poles of cells (7, 36). Interestingly, one of the proteins encoded by
this locus, MinD, is a member of the ParA ATPase superfamily (99, 133). However more
recent results suggest that the effect of min mutations on chromosome partition are indirect
via their effects on septum formation (34).
No other ParA homologs, particularly ones encoded by genes upstream of the gene
for a ParB homolog, are encoded by the E. coli chromosome. Other bactena such as Bacillus
subtilis, Pseudornonas putida and Mycobacterium leprae encode ParA and ParB homologs on
their chromosomes (59, 99). Of these homologs, ody the B. subrilis ParB homolog, SpoOJ,
has so far been shown to have a role in chromosome partition (85).
Clearly more information is required to understand chromosome segregation in
bacteria. This will require an understanding of the fûnctions of the genes already identifid as
well as identification of other factors involved in partition.
ATP BINDING AND HYDROLYSIS
As noted earlier, many plasmid partition systems encode an ATPase that is required
for plasmid partition. Sorne of these partition ATPases have been grouped into a superfamily
by vimie of their sequence sirnilarities (99, 133). The Waker A and B motif sequences
found in the ParA superfarnily of ATPases are also found in many but not al1 ATPases and in
GTP-binding proteins (99, 165, 193). The general consensus for motif A is G/AX,GKS/T
and is X,KGGX,KT/S for the ParA superfamily (one letter amino acid code, X is any amino
acid; Fig. 1-3A) (99, 193). The less-well conserved motif B contains an invariant aspartic
acid preceeded by hydrophobie arnino acids (193). Some of the proteins that contain these
motifs have been characterized struchirally, including one member of the ParA superfamily,
the nitrogenase Fe-protein (Nia) from Azotobacter vinlandii (64). These structural studies as
well as mutagenesis of proteins containing these motifs implicate these motifs in interaction
with the phosphate moiety of nucleotides and consequently in nucleotide hydrolysis (eg. Refs.
64, 15 1 and 177). The structure formed by motif A is similar in the different proteins
containing it and foms a loop, called the P-loop, containing the partially conserved glycines
(64, 127, 128, 136, 177). The highly conserved lysine residue in motif A (the second lysine
in the ParA superfamily consensus) is in close proximity to the f l and y phosphates of the
bound nucleotide in many structures (Fig. 1-6) (eg . Refs. 64, 165 and 177). In addition,
mutation of this residue usually affects ATP binding andfor hydrolysis in these
proteins, including Pl ParA (eg . Refs. 41, 45, 165 and 168). The invariant aspartic acid of
motif B is also implicated in interaction with the phosphate moiety either directly or via
coordination of Mg++ (Fig. 1-6) (93, 177, 197). The consemecl serine or threonine of the
motif A may also coordinate Mg++ (Fig. 1-6) (15 1, 177). A sequence motif that interacts
Figure 1-6. ATP binding and hydrolysis. Interaction between the phosphate moieq of the
bound nucleotide and the conserved residues of the A and B nucleotide binding motifs,
denved from the structure of RecA bound to ADP (177) is shown. Only the conserved
residues of the motifs that interact with the phosphate groups are shown. The Thr and Lys
residues are from motif A and the Asp residue is from motif B. The black circle represents a
water molecule. Not drawn to scale.
36
with the sugar and base of ATP has not been identified in proteins containing motif A. There
is some similarity in terms of shape and hydrophobicity in the regions that interact with the
adenylyl group but no sequence similarity, suggesting that many aitemative sequences are
capable of forming the correct binding environment (130).
Hydrolysis of ATP or GTP is thought to occur by an in-line attack of a water
molecule on the y-phosphate. The phosphate is either transferred directiy to the water
molecule or via formation of a phosphoprotein intermediate (eg. Refs. 48, 5 1 and 68).
THESIS RATIONALE
The two roles that ParA plays in partition, repression of par gene expression (55)
and a second as yet undefmed role (41, 55). both require an intact nucleotide-binding motif
in ParA (41). The steps at which ATP binding and hydrolysis function are not well
understood. ParA interaction with parOP, which is affected by ATP (39), Iikely mediates
ParA repressor activity in vivo. 1 have examined the interaction of ParA with adenine
nucleotides and the par promoter region in vitro to address the roles of ATP binding and
hydrolysis in ParA function. ParA interaction with ParB was also examined since (i) ParB
affects ParA repressor activity in vivo (55), (ii) ParB stimulates ATP hydrolysis by ParA (39)
and (iii) ParB interaction with ParA very likely plays a role in the positioning reaction. My
results point to separable roles for ATP binding and ATP hydrolysis in ParA repressor
activity and perhaps in the positioning process.
CHAPTER 2: A role for ATP in ParA site-specific DNA-binding activity
1 performed al1 of the experiments presented in this chapter except for construction of pMD4 and pMD9 which were made by Liane Gagnier.
This chapter is a modified version of the paper:
Davey, M. J., and B. E. Funneil. 1994. The Pl plasmid partition protein ParA: A role for ATP in site-specific DNA binding. J. Biol. Chem. 269:29908-29913 Reproduced with permission fkom the American Society for Biochemistry and Molecular Biology , Inc.
38
INTRODUCTION
The bacteriophage Pl prophage is a plasmid that is maintaineci in Escherichia coli at one
or two copies per host chromosome (162). Consequentiy, stable inheritance of the plasrnid in
a bacterial population is dependent on an active partition system, which ensures that plasmids
are positioned correctly so that each daughter ce11 receives a copy of the plasmid.
P l encodes two proteins, ParA and ParB, and a cis-acting site, parS. that are required
for partition (3). An excess of either protein (3, 56), or in some cases both proteins (77),
interferes with partition. The genes for the Par proteins comprise the par operon and are
transcnbed from a promoter upstream of parA (55). ParB and the E. coli-encoded protein,
integration host factor (IHF), bind to pars to form the partition complex (38, 56-58, 60,
117). The partition complex is thought to mediate cognate plasmid pairing prior to ce11
division (1 1, 149). ParA is not required for formation of the partition complex (38, 56, 58)
and it is not known when, or in fact whether, ParA interacts with the partition cornplex.
ParA regulates par gene expression by repressing transcription from the par
promoter, rneasured using lac2 fusions to the par operon (55). ParB inhibits expression even
further, although ParB alone has no repressor activity (55). The partition systems of other
low-copy-number plasmids such as F, P7, pTAR, RllNRl and RK2 are also autoregulated,
suggesting that this may be a general feature of partition system regulation (42, 47, 63, 65,
77, 91, 132, 182).
Genetic evidence indicates that the regulatory function of ParA is not its only role
(41, 55). When ParA's regulatory function is bypassed by expressing the par genes from an
unregulated promoter, ParA is s t i l l required for plasmid stability. It is assurned that this
requirement reflects a direct role for ParA in plasmid positioning.
Two biochemical activities have been associated with ParA. ParA has a weak
ATPase activity that is stimulateci two-fold by nonspecific DNA and about five-fold by ParB
(39), however the step at which ParA's ATPase activity acts in partition is not known. In
vitro DNase 1 protection assays indicate that ParA binds to the par promoter region in a site-
specific, ATP-dependent manner (39). Over 100 bp of DNA are protected from DNase 1
cleavage by ParA (39) and Little is known about the sequence detenninants of ParA binding.
Protection from DNase 1 cleavage centers on a 20 bp imperfect inverted repeat sequence
located upstrearn of parA (39). Mutations in the inverted repeat sequence that interfere with
ParA's ability to repress expression from the pur promoter have been described (77). No
effect of ParB on ParA DNA-binding activity has yet been detected (39).
The interaction between ParA and the par promoter is somewhat unusual; it is a
site-specific DNA-binding activity that requires ATP. Here . 1 have further examined this
ATP requirement for DNA binding. My results in this chapter lead me to propose that the
effects exerted on DNA binding by ATP, ADP, and ATP analogues are mediated through
ParA oligomerization.
40
EXPERIMENTAL PROCEDURES
Strains and Plasmids: The Escherichia coli KI2 strain DH5 (F e n d l hsdUI7 (rK-mK+)
supE44 thi-I recAl gyrA96 relA1) was used to maintain d l plasmids. The strain BUl(XDE3,
pLysS) ( h a gal (hcIts857 indl Sam7 nin5 lacWS-T7 gene 1)) (Novagen; 179) was used to
express ParA protein from pBEF198.
Restriction digests, ligations , and transformations were performed using standard
methods (164). The plasmid used for ParA protein production, pBEF198 (33, contains the
parA gene under the control of a bacteriophage T7 promoter in the vector pET17b
(Novagen) .
The plasmids pMD6 and pMD9 contain the par promoter region. pMD6 contains the
388 bp Pl HindIII-Hz01 par fiagrnent (Fig. 1-2) in pBlueScript SK+ (Stratagene), and pMD9
contains the 153 bp Rra1 fragment (Fig . 1-2) in the SmaI site of pBlueScript SK + . The
plasmids pMD3 and pMD4 were constnicted to express TrpE-ParA and GST-ParA fusion
proteins, respectively . The TaqI site at the start of the parA coding h e (Fig . 1-2) was
changed to BamHI without destroying the start codon. The BamHI-Bgm fragment encoding
al1 but the f d amino acid of ParA was ligated into the pATH2 (98) BamHI site, creating an
in frame fusion with the 323 amino terminai residues of the E. coli rrpE gene product. The
1202 bp SmaI-XbaI fragment from pMD3 was inserted into the Sm1 site of pGEX-3X
(Pharmacia) to create pMD4.
Reagents and Buffers: Sources for reagents and resins were as follows: S-Sepharose resin
and Mono Q column, Phannacia; ATP, GTP, glutathione-Sepharose, bovine s e m albumin
(BSA), Sigma; isopropyl-0-D-thiogalactopyranoside (IPTG), ADP, adenylyl-
imidodiphosphate (AMP-PNP) and adenine-5'-O-(3-thiotriphosphate) (ATPyS), Boehringer-
Mannheim; ethy lene glycolbis(succinllnidylsuccinate) (EGS) , Pierce; [g2P]ATP, [d2P] dATP
41.
and [d2P]dCTP, NEN-Dupont; lUI-labelled donkey-anti-rabbit-immunoglobulin antibody,
Amersham; polyethyleneimine ceilulose thin layer chromatography (TLC) sheets, Machery-
Nagel; and Bradford concentrated dye, BioRad. Enzymes were purchased from the following
companies: enzymes for cloning, New England Biolabs or Boehringer-Mannheim; bovine
pancreatic DNase 1, Boehringer-Mannheim.
The following buffers were used for ParA purification: Sonication buffer, 50 m M
Tris HCl pH 7.5, 50 mM (m&S04, 1 mM EDTA and 0.5 mM 1,4-dithiothreitol @TT); S
buffer, 25 mM imidazole pH 6.5, 0.1 mM EDTA, 10% (vh) glycerol; Q buffer, 25 mM
HEPES pH 7 3, 0.1 mM EDTA, 10 % (vlv) glycerol. ParA assay buffer consists of 50 mM
Tris-acetate pH 7.5, 100 rnM NaCl and 10 m M MgCI,.
Antibody Production and Purification: Antibodies were raised in rabbits against TrpE-ParA
fusion protein, which was expressed from pMD3 and prepared essentially as previously
described (97). Injection into rabbits and subsequent blood sampling were performed by the
Division of Comparative Medicine at the University of Toronto. Anti-ParA antibodies were
affinity purified from crude sera using the GST-ParA fusion protein immobilized on
nitrocellulose (164). GST-ParA fusion protein was isolated from cmde ce11 lysates using
glutathione-Sepharose affinity chromatography as described (173).
ParA Purification: The strain BL2 1 (XDE3 ,pLysS ,pBEF198) was grown at 37 OC in 2 liters
LB medium (164) containing 40 pg cchlramphenicollml and 100 pg ampicillin/ml to an %,
of approxirnately 0.4. IPTG was added to 0.5 mM, and the culture was incubated at 37OC
for another hour. Cells were chilled on ice, collected by centrifugation, washed and
resuspended in sonication buffer and fiozen in liquid nitrogen. The cells were thawed on ice,
lysed by sonication, and cenmfuged at 25,000xg for 1 h at 0°C. T ' e n 0.35 g of (NH4),S04
per ml of supernatant were added and the mixture was re-centîifuged. AU subsequent steps
42
were d e d out at 4°C. The protein pellet was resuspended in, and then didysed against, S
buffer with 1 rnM DTT. This protein (FrII) was loaded on a 20 ml S-Sepharose column
equilibrated with S buffer containing 25 mM NaCl and 1 mM DTT, and bound proteins were
eluted with a linear 400 ml, 25 mM to 1 M NaCl gradient in S buffer and 1 mM Dm.
Fractions containing ParA were c o d m e d by Western blotting. Peak fractions were pooled
(FrIII) and loaded on a 1 mi Mono Q column equilibrated with Q buffer containing 100 mM
KCl and 1 mM DTT. Bound proteins were eluted with a 20 ml, 100 mM to 1 M KCI
gradient in Q buffer containing 1 mM DTT. The fractions containing ParA were pooled
(FrIV) and used in al1 assays. ParA was stored in Q buffer containing 300 mM KCl and 10
m M DTT at -80°C.
DNase 1 Protection Assays: Substrates were DNA fragments derived from pMD6 and pMD9
(see text). Fragments were labelled on their 3' ends with [d2P]d~TP or -dCTP using DNA
polymerase I large fragment (164). Footprint assays contained (in 25 pl), 10-50 fino1 (see
text) 32P-end-labelled par promoter fragment, 10-2000 ng ParA FrIV, 2 pg sonicated salmon
sperm DNA, 20 pg BSA, and 2 rnM CaCI, in ParA assay buffer. Assays were incubated for
10 min at 30°C and then 1 pl of 1.25 pg bovine pancreatic DNase I/ml was added. M e r
further incubation at 30°C for 60 sec, cleavage was stopped with 75 pl of 1.6 M ammonium
acetate, 200 pg sonicated salmon spem DNA/ml and 0.1 M EDTA. After phenol/chloroform
extraction of proteins, the DNA was precipitated with ethanol and resuspended in 4 pl of
formamide dye (164). Samples were electrophoresed on a 6% polyacrylamide urea gel. The
gel was dried on Whatman DE81 paper and exposed to film or storage phosphor screens for
quantification on a PhosphorIrnager (Molecular Dynamics).
43
RESULTS
Purifkation of ParA: ParA protein was purifiai to over 99% homogeneity, as judged by
Coomassie Blue stained SDS-polyacrylamide gels (Fig. 2-1). Afier S-Sepharose and Mono Q
chromatography (ParA FrIV), I detected both the Pa*-stimulateci ATPase activity and the
DNA-binding activity reported for ParA (39). DNA binding to the par promoter was not
detected in less pure pooled ParA fractions, although binding was detected in the most pure
peak fraction from the S-Sepharose column. ParA's ATPase activity is relatively weak (39)
as compared to other cellular ATPases (e.g., approximately 2xlP-fold lower than the
RecBCD ATPase; lm), so ATPase activity was not assayed in samples less pure than FrIV.
ATPase time courses of ParA (FrIV) with or without ParB confirxned that ParB
stimulates ParA's ATPase activity (Fig. 2-2A) (39). In addition to ATP, ParA also
hydrolysed dATP, albeit at a lower rate (Fig. 2-2B). My experiments showed that ATP
hydrolysis by ParA continues to increase linearly for at least 120 minutes at 30°C with and
without ParB (Fig. 2-2A). Since ParB does not affect ParA's KM for ATP (39), these data
suggest a direct stimulation of the catalytic activity of ParA by ParB rather than an indirect
effect via stabilization of ParA by ParB. In the latter case, one might expect a stimulation of
the extent of hydrolysis (ie., a non-linear increase in product) rather than the rate of ATP
hydrolysis, particularly after a 90 minute incubation.
DNA binding is stimuiated by, but does not require, ATP: Previous snidies (39) indicated
that ParA binds to the par operon promoter in an ATPdependent, sequence-specific manner.
When binding by ParA FrIV was assayed in the absence of ATP at an approximate 1000-fold
excess of ParA monomers to DNA molecules, binding to the promoter fragment was easiiy
detected (Fig. 2-3A). ATP (1 mM) stirnulated binding by about 10 fold; that is, ten-fold less
ParA was necessary to see the same footprint (Figs. 2-3, A and B) . It was formaily possible
Fig. 2-1. hification of ParA. Fractions from a ParA purification were analyzed on a 12%
SDS-polyacrylamide gel (104) stained with Coomassie Blue. Lmes with total cells are: in the
"-" lane (no ParA), 0.15 %, units of BUl(XDE3,pLysS) cells; and in the " +" lane (with
ParA), 0.15 %, units of BL2 1 (XDE3, pLysS, pBEF 198) cells after a one-hour induction. The
protein fraction lanes are 10 pg offrnctiom I (crude lysate), II ((rn4)2S04 precipitate), III
(pooled S-Sepharose eluate) and N (pooled Mono Q eluate) as indicated. ParA was identified
as the major band at approximately 45 kDa (its predicted size from the DNA sequence is 44
kDa; 3), because it reacted with affity-purified anti-ParA antibody (data not shown), and
was absent from cells containing no ParA. The positions of molecular size standards are
indicated on the fefl in kilodaltons @Da).
total protein ceils fractions
Figure 2-2. ATP and dATP hydrolysis by ParA. A: T h e course of ATP hydrolysis by
ParA with and without ParB. ParA (1000 ng) with (A) or without (i) 1400 ng ParB was
incubated in a total volume of 20 pl ParA assay buffer containhg 1 mM [~'*P]ATP (1
gCi/pmol) and 100 ng sonicated salmon spem DNNpl at 30°C. At the indicated times 2 pl
was removed and spotted ont0 a 0.6 x 6 cm polyethyleneimine cellulose TU: strip. The TLC
strips were developed in 0.5M LiCl in 1 M formic acid (8) and exposed to a Phosphor
storage screen overnight. The amount of ATP hydrolysis in each sample was determined
using ImageQuant software (Molecular Dynamics) by cornparing the amount of 32Pi (which
migrates faster than 3 2 ~ - ~ T ~ through the TLC strips) on each sûip to known amounts of "P-
ATP on undeveloped strips. The amount of ATP hydrolysis in the absence of ParA and ParB
( 7 ) as well as with ParB in the absence of ParA ( 0 ) are also shown. Each point is the
average of quadruplicate assays. B: ParA hydrolyses dATP. ATP ( i ) and dATP (*)
hydrolysis by ParA was measured using [y32P]ATP and [d2P]dATP (respectively, 1 mM, 1
pcilpmol) in 20 pl of PUA assay buffer containing 100 ng sonicated salmon sperm DNA/pl
and the indicated amounts of ParA. The assays were incubated for 90 min at 30°C before 2
pl of each assay was spotted on a TLC strip. Thin Iayer chromotography and quantification
of the assays were carried out as in A, except that for the dATP assays, the amount of dATP
hydrolysis was determined from the amount of [ d 2 ~ ] d ~ ~ ~ produced in each assay. Each
point is the average of duplicate assays.
no protein
time (min)
ATP
48
that the ParA fi-action contained a low level of nucleotide that supported DNA binding when
a large volume of ParA was used. A ParA sample, which had been purified over two ion-
exchange columns, was dialysed for 18 h against Q buffer containhg 300 mM KCl and 1
mM D'IT. This highly dialysed sample behaved identically to the original FrIV in the
absence and presence of ATP (data not shown). I concluded therefore, that ParA site-specifc
DNA binding is stimulated by, but not dependent on, ATP.
The protection pattern obtained with ParA in the absence of ATP at high protein
concentrations was identical to that observed at lower ParA levels with ATP. For example,
compare lane 6 (700 ng ParA, no ATP) with lane 8 (70 ng ParA, with ATP) in Fig. 2-3A.
The extended footprint seen at high ParA with ATP (lane 11, Fig. 2-3A), was dso observed
at very high ParA (approximately 3 pg) without ATP (data not shown; summarized in Fig. 2-
4). At high ParA concentration the protected region extended from upstrearn of the -35
region into the parA coding sequence, including the 20-bp inverted repeat. The footprint
covered approxirnately 150 bp (Fig. 2-3). 1 consistently observed a pattern of ParA-
dependent enhanced cleavages and poorly protected residues as compared to most nearby
residues that were fully protected from DNase 1 cleavage (Figs. 2-3 and 2-4).
Effects of ATP hydrolysis on DNA binding: 1 tested the effects of the non-hydrolysable
ATP analogues, ATPyS and AMP-PNP, and of ADP on ParA DNA-binding activity. Al1
tkee nucleotides had a stronger effect than ATP. Fig. 2-SA shows the results of a nucleotide
titration experiment at a level of ParA that gave a partial footprint with ATP. Under these
conditions, the ParA footprint with ADP, ATPyS and AMP-PNP was much more extensive,
and equivalent to that at higher ParA concentrations with ATP. The differences observed
were probably not due to a difference in ParA affinity for the nucleotides, since ParA
required a similar concentration of each nucleotide to bind parOP at this concentration of
Figure 2-3: ATP stimulation of ParA-pdP interaction: A: DNase I protection assays
were performed using 16 h o 1 of the pMD9 BamHI-Rra1 169 bp fragment labelled at BamHI
on the coding strand (upper strand in Fig . 2-4). Where added, ATP was present at 1 mM.
nie amount of ParA added was: lanes 2 and 7 , none; lanes 3 and 8 , 70 ng; ianes 4 and 9,
140 ng; fanes 5 and 10, 280 ng; lanes 6 and 11, 700 ng. Lane 1 is the same fragment treated
with dimethyl sulphate where cleavages at G are stronger than cleavages at A (120).
B: DNase 1 protection assays performed at lower ParA concentrations, with ATP, than in A.
Each assay contained 7 h o 1 of pMD6 HindIII-XhoI fragment labelled at HindIII on the
non-coding strand. The amount of ParA was: fane 1, none; fane 2, 55 ng; lane 3, 110 ng
and fane 4 , 220 ng. In both A and B. the inverted 20 bp repeat (inverted arrows), the -35 and
-10 promoter signals, ribosome binding site (RBS) and parA start codon (ATG) are shown on
the lefr. Sequences upstrearn of the &ai site in pMD9 (in A) have been replaced with vector
sequences resulting in a partial -35 promoter signal.
Figure 2 4 . Summary of the extent and pattern of protection from DNase 1 cleavage by
ParA protein. The results from several DNase 1 protection assays of the par promoter are
summarized on the DNA sequence (GenBankTM accession X02954). The brackets indicate the
lirnits of protection by ParA from DNase 1 cleavage. Positions of enhanced cleavage are
indicated by the solid arrowheads and positions that were poorly protected are indicated by
the open arrowheads. The upper strand is the coding strand for parA and parB. The -35
and -10 regions, ribosome binding site (RBS), and parA start codon (ATG) are indicated by
the boxes. The inverted, imperfect repeat is delineated by the inverted arrows. The major
transcription start site is indicated by the star (77). The patterns depicted here are from
several different experiments using both pMD6 and pMD9 labelled on the coding and non-
coding strands as substrates. No difference in the protection pattern was detected using either
plasmid as a source of substrates. The protection pattern upstream of the &a1 site is from
f o o t p ~ t s of pMD6 oniy; however, the Iength of the protected region was similas on pMD9
where the sequences upstrearn of the Rra1 site were replaced with vector sequences (data not
shown).
GGAGGATGCCAAAGCATGTTGTG CCTCCTACGGTTTCGTACAACAC
JI Rsa I
CATGCAGAGAATGCT GTACGTCTCTTACGA + -1 0
* JI JI A
TTTATGCAGCATTTTTAATTAAATTCAAAAATACAGCATAAAGGA ~ A A G T T T T T A T G T C G T A T T T C C T
4' + +RBS
# CACAAGGTTGCTCAA GTGTTCCAACGAGTT
parA start codon
Figure 2-5. Nucleotide effects on ParA DNA-binding activity: A: ATP, ADP, ATPyS,
AMP-PNP and GTP were added to DNase 1 protection assays at the concentrations indicated
(millirnolar). The fmt lane (G> A) is a dimethyl sulphate cleavage ladder of the fragment.
Each reaction mixture contained 14 fmol of the 388 bp XhoI-Ifindm fragment from pMD6,
labelled on the non-coding s ~ d and 220 ng of ParA, except ime C which is a control assay
that contained neither ParA nor nucleotide. B: ParA binding in the presence of 1 mM ATP
or ADP. The substrate was 30 h o 1 of pMD6 Hindm-XhoI fragment labelled at HindIII end
(the non-coding strand). Each assay contained: Ianes 1 and 8 , no ParA; lanes 2 and 9 , 70 ng;
lnnes 3 and 10, 140 ng; lunes 4 and 1 1 , 280 ng; iane 5, 700 ng; lane 6, 1400 ng and lane 7 ,
2800 ng of ParA. C: ParA interaction with parOP in the presence of either 1 mM ATP or
dATP. Each assay contained 10 mol of the pMD6 388 bp Hindm-XhoI fragment, labelled at
Hindm. The amount of ParA in each assay was: Iane 1 and 5 , none; lunes 2 and 6 , 26 ng;
lanes 3 and 7 , 52 ng; and lanes 4 and 8 , 104 ng. In A. B and C, the location of the -35 and -
10 promoter signals, inverted repeat (inve~ed arrows) ribosome binding site (RBS), and parA
start codon (ATG) are shown on the lep.
A ATP ADP A T m AMP-PNP QW -II--- A
ATG 0
ATG RBS
ATP ADP
ATG =
56
ParA (Fig. 2-5A). In fact, 1 later show that ParA has a lower affinity for ADP thm for ATP
(Chapter 3). ParA protein titrations in the presence of various nucleotides confmed that
ADP (Fig. 2-SB), A m S and AMP-PNP (data not shown) stimulated ParA binding about 5-
fold more than ATP. The ADP used in these assays contained less than 0.5 % ATP, as
determined by thin layer chromatography (as in the legend to Fig. 2-2). AMP, adenosine,
adenine and sodium pyrophosphate (data not shown), or GTP (Fig. 2-4A) had no effect on
binding activity. dATP, which is hydrolysed to a lesser extent than ATP by PUA (Fig. 2-2B)
stimulated ParA DNA-binding activity slightiy better than ATP (Fig . WC). Therefore,
adenine nucleoside di- or tri-phosphates are required to stimulate ParATs DNA-binding
activity. My observation that ADP stimulated DNA binding to the same degree as the non-
hydrolysable analogues, and the previous fiiding that ADP and phosphate are the products of
the ParA ATPase (39), suggest that a bound ADP or ATP is required for stimulation, but
that the act of hydrolysis itself inhibits DNA binding. The observation that the ability of a
cofactor to stimulate ParA DNA binding is inversely related to the rate at which it is
hydrolysed by ParA supports this conclusion.
ATP and ADP affect the sedimentation behaviour of ParA: One possible explmation for
the effect of ATP and ADP on ParA's DNA-binding activity is that they affect the
conformation or the oligomerUation of the protein. The extensive protection from DNase 1
cleavage of the par promoter region suggested that more tban one ParA molecule was bound
to the site. 1 used glycerol gradient sedimentation to examine whether ATP or ATP
analogues affected the hydrodynamic properties of ParA. ADP was used as the cofactor in
most experiments, since ADP had a stronger effect than ATP on the DNA-binding activity.
Without ADP, ParA sedimented at a rate consistent with a molecular size slightly larger
than predicted for a monomer of ParA (44 kDa; Fig. 2-6A). The presence of ADP (1 mM)
Figure 2-6. ADP and ATP affect ParA sedimentation rate. Purified ParA (FrIV) was
analyzed by glycerol gradient sedimentation. Each panel depicts the results from two parallel
gradients, one with no ADP (O) and the other with 1 m M ADP included throughout the
gradient (e). Glycerol gradients (3.9 ml of 10 to 40% (v/v) glycerol in ParA assay bufier)
were poured in seven steps, allowed to diffise for 1 h at 21°C and then equilibrated to 4 T
for 1 h. A mixture of the indicated arnount of ParA and 300 pg BSA in 78 pl was layered
ont0 the top of each gradient. The gradients were centrifuged at 55,000 rpm for 18 h at 5°C
in a TST60.4 swinging bucket rotor (Dupont). Two drop fractions (80-100 pl) were collected
from the bottom of the tube using a syringe needle. Fractions were analyzed on Western
blots using anti-ParA antibody and '=I-labelled donkey-anti-rabbit IgG antibody as the
primary and secondary antibodies, respectively. The blots were exposed to a storage
phosphor screen and bands were quantified on a Phosphorhager (Molecular Dynamics).
BSA, which was included with ParA in the gradients, was detected using Bradford assays
(A,,, dashed fine). At each concentration of ParA, gradient profdes with and without ADP
were aligned by their BSA peaks (relative fraction number=O) to correct for one or two
fraction differences that resulted from variations in collection needle insertion. The positions
of other size standards, run in parallel gradients, are also indicated. The standards were
bovine IgG (158 kDa), chicken ovalbumin (ovd; 44 kDa) and equine myoglobin (myo, 17
kD a).
ov I myo tw
BOTOM Relative fraction number TOP
Figure 2-6 cont. B: The sedimentation of ParA in the presence of 1 mM ATP (m) or 1 mM
ADP (a). The gradients were perfomed as described in A using 8.6 pg of ParA for each
gradient. BSA (A5,, dashed line) was included in each of the gradients and its sedimentation
was used to align the gradients. C: The sedimentation of ParA through gradients with (+ )
and without (O) 1 mM GTP are shown. The experiments were performed as described in A
using 8.6 pg PUA. The scale on the lef: is in arbitrary units (fiom the PhosphorIrnager
values) since the protein was not quantified to ParA standards in this experiment.
Relative ParA concentration 1 mM GTP
0-0 none
ParA concent ration (nglpl) H 1 mM ADP H 1 mM ATP A tu cd O O O
P , O O
61
increased ParA's sedimentation rate to a position intermediate to monomer and dimer shes at
low concentration, and to dimer size at high ParA concentration. These sizes were estimated
by comparing ParA sedimentation to BSA (66 kDa) in the same gradient, or to other size
standards nin in parallel gradients. The change in sedimentation rate caused by ADP was
sensitive to the concentration of PUA such tbat the sedimentation rate increased with
increasing ParA (Fig. 2-6A). ATP had the same effect as ADP in these experirnents, whereas
GTP had no effect on sedimentation rate (Fig. 26B and C).
These observations indicate that ADP and ATP affect ParA structure. Since
sedimentation is sensitive to size and shape, ATP and ADP could be influencing one or both
properties of ParA. However, the concentration dependence of the sedimentation rate
suggested a size effect; that ADP was influencing a monomer-dimer transition. Proteins that
exist in a rapid monomer-dimer (or oligomer) equilibnum can sediment as a single peak
whose size is closer to the predominant species. This hypothesis makes a couple of
predictions: First, ParA must be able to form dimers (or oligomers), and second, that this
transition is reversible. ParA, collected from a gradient containing ADP, sedirnented at the
same rate as a previously untreated sample of ParA when run through separate gradients
without ADP (data not shown), suggesting a reversible effect of ADP on ParA sedimentation.
ParA forms dimers: 1 used chemical cross-linking to analyze the oligomeric state of ParA.
ParA was treated with EGS, a homobifunctional chemical cross-linker, in the presence (1
mM) or absence of ADP. EGS reacts with available primary amine groups, mainly at
lysines. Higher molecular weight forms of ParA were observed after addition of EGS both in
the presence and absence of ADP, consistent with the formation of dimers (Fig. 2-7). A very
small amount of tetramer may also be formed, although the majority of the cross-linked
products were dimer-sized. The doublet bands in the samples treated with cross-linker
Figure 2-7. EGS crosslinking of ParA: ParA (80 nglpl) in ParA assay buffer, with or
without 1 mM ADP (as indicated), was treated with EGS (15 pg/ml). At the indicated times,
500 pl were removed and quenched in 150 mM lysine. Samples were precipitated in 15%
(w/v) trichloroacetic acid, washed w ith acetone, resuspended in Laemmli sarnple buffer and
analyzed by electmphoresis on an 8 % SDS-polyacrylamide gel (104) which was stained with
Coomassie Blue. In this experiment, there was a slight difference in recovery at each time
point. The no EGS lane contains 10 pg ParA FrIV that has not been treated with EGS or
precipitated with trichloroacetic acid, diluted in Laemmli buffer. Migration of size standards
is indicated on the nghr in kDa. Identical patterns were observed when cross-linking was
performed at lower ParA concentration (40 pglml).
na ADP 1 mM ADP na I
EGS O 1530 O 15 30 min
64
indicate intramolecular cross-links. Both the monomer- and dimer-sized populations consisted
of two bands suggesting that these intramolecular cross-links did not interfere with
dimerization. These experirnents were performed at low concentrations of ParA to ensure
that monomers did not cross-link, and these conditions may not have k e n sensitive enough
to detect a kiwtic effect of ADP on dimer formation. Alternatively. the cross-linking
reaction might push the equilibriurn towards dimer formation by irreversibly forming dimers.
Nevertheless, this experiment demonstrates that ParA forms dimers in solution.
DISCUSSION
P l ParA protein binds specifically to a site in the par operon promoter region (39). 1
have found that its DNA-binding activity was dramatically infiuenced by several adenine
nucleotides. ATP and dATP, which are both hydrolysed by ParA, stimulated ParA's DNA-
binding activity approxirnately 10-fold. ADP, one of the products of ATP hydrolysis, and the
non-hydroly sable analogues, ATPy S and AMP-Pm , stimulated ParA binding about 50-fold.
ParA bound to its specific site on DNA in the absence of ATP suggesting that ATP
stabilises a less stable ParA conformation that represents the more active DNA binding fom.
Non-hydrolysable ATP analogues, or the product of ATP hydrolysis (ADP), showed a much
greater stimulation of ParA DNA-binding activity than ATP alone. These observations
suggest that bound nucleotide (ATP or ADP) is required for stimulation of ParA's DNA-
binding activity, and that the act of ATP hydrolysis by ParA inhibits DNA binding, perhaps
by causing dissociation of ParA-DNA complexes. Initial attempts to measure the off-rate of
ParA from DNA indicated that ParA dissociation was too rapid to measure in my assays
( < 30 sec. ; unpublished observations). Alternatively , the act of ATP hydrolysis by ParA
could be inactivating ParA before it binds to DNA, in effect reducing the concentration of
active protein. ATP hydrolysis has been demonstrated to cause dissociation of the E. coli
RecA protein from DNA (121, 122). RecA is a DNA-dependent ATPase (147, 158) that
binds DNA non-specifically (122). RecA's DNA-binding activity is also stimulated by ATP.
However, unlike ParA's DNA-binding activity, the product of hydrolysis, ADP, promotes
RecA-DNA complex dissociation (121). 1 cannot determine from my results whether ATP
hydrolysis infiuences the binding or the release of DNA by ParA.
ATP and ADP also had ciramatic effects on the hydrodynamic properties of ParA.
Both nucleotides increased the sedimentation rate of ParA in glycerol gradients, suggesting
66
either oligomerization or a change to a more spherical, less asymmetric, shape. ParA forrned
at l e s t dimers as indicated by chernical cross-linking experiments with both EGS (Fig. 2-7)
and dithiobis(succinimidylpropionate) @SP; data not shown). A rapid monomer-dimer
equilibrium will yield an average sedimentation rate between true monomer and dimer;
shifting the equilibrium towards dimer formation will increase the average sedimentation
rate. 1 believe that ATP and ADP are promoting dimer formation, or siabilking existing
dimers, such that the equilibrium is shifted towards dimer formation. I favor this idea
because the increase in sedimentation rate caused by nucleotide was also influenced by
protein concentration. More complicated interpretations of the sedimentation data are of
course possible, perhaps involving a combination of shape and size changes. However, und
firther physical analyses of ParA structure are performed (see Chapter 3), 1 think that the
simplest interpretation is that ADP and ATP affect the oligomerization state of ParA.
I predict therefore, that the most active DNA-binding form of ParA is an oiigomer,
and most likely a dimer, and that adenine nudeoside di- or tri-phosphates stimulate DNA
binding by promoting or stabilizing dimer formation. Both ADP and ATP increased ParA
sedimentation rate and both stimulated DNA-binding activity (Figs. 2-3, 2-5 and 2-6). GTP
neither affected sedirnentation behaviour nor stimulated ParA's DNA-binding activity (Figs.
2-6C and 2-5A). Finally, although the sequence requirements for ParA recognition have not
been completely defmed, binding probably requires the inverted repeat sequence (77), which
is often diagnostic of dimeric DNA binding proteins.
ParA bound to the par promoter, although weakly, in the absence of nucleotide,
under conditions where 1 detected no significant change in ParA sedimentation behaviour.
Since ParA cm dimerize Ui the absence of nucleotide (Fig. 2-7), a low concentration of
67
dimer may be present but undetectable by sedimentation. Alternatively, DNA may stabilize
dimer formation, or ParA monomers may bind parOP weakly.
The same increase in sedimentation rate was observeci when ATP was added to the
gradients as when ADP was added (Fig. 26%). ATP was hydrolysed under these conditions
(18 hr at 4°C; data not shown). Why do ATP and ADP have sunila. effects on ParA
dimerkation, when these nucleotides affected DNA binding differentiy? Several explanations
are possible. These gradients may not be sensitive enough to detect small differences in
dimer formation caused by ATP and ADP. Alternatively, the dBerence between the ATP
and ADP foms of ParA may be manifested ody in the presence of DNA. For example,
ATP hydrolysis could cause dimer dissociation only in the presence of DNA. Or f d l y , the
act of ATP hydrolysis by ParA may be coupled to some other change in ParA, inhibithg
DNA binding. In the next Chapter (Chapter 3) 1 will extend my analyses of these complex
roles of ATP binding and hydrolysis on ParA activity.
About 150 bp of DNA were protected from DNase 1 cleavage by ParA (Fig. 2-3).
Although the more active ParA DNA binding form may be a dimer, the footprint length
argues that several dimers bind to this region. The extent and pattern of cleavage could be
explained by ParA binding in a linear array, or by DNA wrapping around ParA. The pattern
of poorly protected residues partially resembled the protection pattern observed in wrapped
complexes, such as nucleosomes (96, 141). However, the poorly protected residues in the
ParA footprint did not strictly confonn to a helical periodicity observed in footprints of
nucleosomes (10 bp, staggered by 5 bp on opposite strands).
There are very few proteins whose sequence-specific DNA bimiing activities are
directiy affected by ATP. Two such factors, aside from ParA, are the origin recognition
complex (ORC) isolated from Saccharomyces cerm'siae (16) and the SV40 and polyoma
virus large himour antigens (T antigens) (43, 44, 1 1 1). These proteins are involved in
initiation of DNA replication as well as other processes. SV40 T antigen is the better
understood protein biochemically and ATP has similar effects on T antigen and ParA. Aside
from stimulating T antigen DNA-binding activity, ATP also stimulates T antigen
oligomerization into structures as large as hexamers (69, 163). The involvement of ATP in
the activities of T antigen and ORC, as well as other replication initiators, led to the proposa1
that ATP may be involved in regulating the activities of these proteins with respect to the ce11
cycle, although not necessarily their DNA binding activities (16). If ATP-mediated regulation
or coordination of Pl partition with respect to E. coli ce11 division does exist, it could be
through the control of ParA's activities.
1 have focused on the effects of ATP, ADP, and ATP analogues on ParA,
specifically on the ParA DNA-binding activity . Presumably , this binding activity mediates
the ParA repression of transcription from the par promoter. How do these activities relate to
ParA activities during partition, and to ParA interaction with ParB? ParB stimulates ParA
ATPase in virro (39) yet increases repression at the par promoter by ParA in vivo (55) . In
agreement with previous studies (39), Pa* had no effect on ParA DNA-binding activity in
my assays (under the conditions assayed, see Chapter 3). it may be that the effect of ParB in
vivo is mediated through a third as yet unidentified protein. Perhaps stimulation of the ParA
ATPase by ParB reflects a role for the ATPase and PUA-ParB interaction in the positioning
process. The formation of the partition complex at the partition site, pars, requires ParB and
M F but not ParA (38, 56, 58). 1 infer that partition complex assembly is an early event in
partition, with ParA acting later. For example, ParA could be acting to position plasmids via
an interaction with this ParB/IHFlparS complex. An amactive possibility is that ParA
dimerkition mediates plasmid pairing and that ATP hydrolysis causes dissociation of plasmid
69
pairs at ce11 division. Association of ParA and ParB in this context may stimulate the ATPase
activity which may serve to regulate assembly, disassembly or positioning of these
complexes. Clearly , a better understanding of ParA/ATP and ParMarB interactions will
help in d e f d g the role of ParA in P l plasmid partition.
CHAPTER 3: Modulation of the P l Plasmid Partition Protein ParA by ATP, ADP and Pl ParB
1 performed al1 of the experiments in this chapter.
A version of this chapter has been submitted for publication to the Journal of Biological Chemistry .
mODUCTION
ParA is an essential component of the Pl plasmid partition system (3). The prophage
of bacteriophage P l exists as an autonomously replicating plasrnid and its copy number is
about the same as that of the bacterial chromosome (84). The P l partition system, par,
directs proper segregation and thus stable maintenance of the plasmid. The mechanisrn of
partition is unknown, but cm be thought of as a positioning process that via interaction with
the E. coli host ensures proper distribution of the plasmid. par encodes two essential
tram-acting proteins, ParA and ParB, and contains a DNA site called p a s that is required in
cis (3). In addition, the E. coli integration host factor, MF, also participates, dthough it is
not absolutely required (58). ParB and MF bind to pars to form the partition complex (38,
57, 58). Assembly of this complex is assumed to be an early step in the partition pathway.
Formation of this complex does not require the action of ParA (38, 57, 58), and I infer that
ParA acts during a later step in the partition process.
ParA has at least two roles in partition. First, ParA represses transcription of its
own gene and parB from a prornoter upstrearn of parA (55). ParA repressor activity is
stimulated by ParB, however ParB has no efiect on par gene expression on its own. A
second role for ParA in partition is inferred from genetic data that show a requirement for
ParA in partition even when its regulatory role is bypassed (see Chapter 1) (41, 55).
Therefore, 1 consider ParA's repressor activity its "regulatory" function, and this second, as
yet undefmed role as ParA's "partitiont' function because 1 think it reflects a direct role of
ParA in the positioning reaction. The latter function requires that ParA interact, directly or
indirectly, with the ParB-MF-pars partition complex.
ParA is an ATPase and a site-specific DNA binding protein (39). The ATPase is
stimulated by Par!3 and non-specific DNA (39). ParA is one of the better characterized
proteins in a s u p e r f d y of ATPases defined by a modified Wallcer type A motif in the
protein sequence (99, 133, 193). This s u p e r f ' y includes other plasmid partition proteins
such as F SopA as well as plasmid and chromosomally-encoded proteins from various
bacteria species whose functions have not yet k e n determined (59, 99, 133). Many of the
plasmids and bacterial chromosomes also encode a ParB homolog adjacent to the ParA
homolog. The similarities of these ParA-like proteins with P l ParA and F SopA have led to
the suggestion that these homologs are also involved in plasmid or chromosome segregation
(99, 133).
ParA binds to a specific DNA site in the par promoter region (39), and this binding
is thought to mediate ParA repressor activity in vivo. The recognition site for ParA is likely
a large inverted repeat in the par promoter region (caiied parof), since (i) several mutations
in these repeats reduce or elirninate ParA repression in vivo (77) and (ii) in DNase 1
foo tp~ t ing experiments, protection centers over these inverted repeats, especially at low
ParA concentrations (39; Chapter 2). ParA DNA-binding activiw is strongly stimulated by
ATP (39; Chapter 2). ATP hydrolysis is not required for this stimulation; in fact, it appears
to be inhibitory since ATP./S, AMPPNP and ADP stimulate ParA DNA binding about 5-fold
better than ATP (Chapter 2). In addition, ATP and ADP promote ParA dimerization
(Chapter 2), suggesting that ParA prefers to bind DNA as a dimer.
1 am interested in how ParA performs both its regulatory and partition roles.
Mutation of the ParA nucleotide binding motif interferes with both ParA repressor and
partition functions (41). However, the steps at which ATP binding and hydrolysis modulate
ParA function are not understood. To address these questions, I have further probed ParA
interaction with ATP, ADP and ParB, by examining their effects on ParA structure and
function. 1 show that ATP binding and hydrolysis alter ParA conformation and that these
conformational changes can be correlatecl to changes in ParA activity. In addition, 1
demonstrate that ParB stimulates ParA site-specifc DNA-binding activity , consistent w ith
ParB's role as a corepressor. ParB modulation of ParA DNA-binding activity requires ATP
hydrolysis. 1 conclude that ATP binding and hydrolysis have different roles in repression and
perhaps partition, presumably mediated by their effects on the conformation of ParA.
74
EXPERIMENTAL PROCEDURES
Reagents and Buffers: Sources for reagents were as foiiows: Mono Q and Mono S columns,
GTP, Sephadex G-25 M, Pharmacia; bovine senun aibumin (FrV), ATP and ADP, Sigma;
ATPyS , bovine pancreatic DNase 1, Boehringer Mannheim; heparin agarose, Bio-Gel Pd,
dithiothreitol (DTT) and Bradford protein assay dye, BioRad; and [d2P] ~ATP, [$'Pl ATP
and [2,8 'HIADP, NEN. Restrictions enzymes and E. coli DNA polymerase I large fragment
were purchased from New England Biolabs.
Buffer A contains 10 mM Tris-acetate, pH 7.5, 30 mM NaCl and 5 mM MgCl,.
Buffer B is 50 mM HEPES pH 7.5, 0.1 mM EDTA and 20% glycerol. Dilution buffer is 50
rnM Tris-HC1, pH 7.5, 100 rnM NaCl and 10% glycerol.
Proteins: ParA was prepared as described (Chapter 2) except that the glycerol concentration
of FrIV was adjusted to 50% (vlv) and the protein was stored at -20°C. 1 consistently
maintain ParA in buffen containing 10 mM DTT (Chapter 2) because 1 have observed that at
lower DTî concentrations ParA oxidizes and forms disulphide cross-linked multimers,
particularly after long-term storage (data not shown).
ParB (FrTV) was prepared as descnbed (57, 58) except that ParB FrIII was
concentrated using a 1 ml Mono S column prior to gel filtration. ParB FrIII was diluted to 50
mM KCl in buffer B containing 2 m M DTT and then loaded on a Mono S column
equilibrated in the same buffer . ParB was eluted in one step with 600 rnM KCI in buffer B
containing 2 mM DTT. Fractions containing P a s were then purified by gel filtration (57).
ParB (FrIV) occasionally contained a contaminiiting ATPase activity that could
potentially interfere with the ParA assays. This ATPase activity was removed by
chromatography through a heparin agarose column. ParB (FrlV) in buffer B containing 50
mM KCI and 2 m M DTT was applied to a 5 ml column equilibrated in the same buffer and
75
eluted with a 100 ml, 50 mM-1 M KCl gradient in buffer B. ParB was stored at -80°C.
For DNA-binding assays, ParB W o r ParA were equiiibrated in dilution buffer by
gel fikation through either 1 ml Sephadex G 25 M or Bio-Gel P-6 columns.
Nucleotide binding: Hummel1 and Dreyer equilibnum gel fdtration experiments were used to
measure ATP and ADP binding by ParA (83, 137). Binding was determined as the amount
of ATP andfor ADP that CO-eluted with ParA through a gel filtration column. The column
was equilibrated in the same buffer and "P-ATP ancilor 3 H - ~ D P concentration as the ParA
sample. A 5 ml Bio-Gel P-6 column was equilibrated in bufier A containhg [y'2P]~TP
(10-20 pCiIpmol) andfor [2 ,83Hl~DP (10 pCiIpmo1). Two hundred microliters of ParA in
the same buffer with the same concentration of nucleotide was applied to the column. Four
drop fractions were collected (150-180 pl) and the radioactivity in 100 gl of each fraction
was measured by liquid scintillation counting. The amount of ParA in the peak fractions was
determined by Bradford assay, using a ParA standard whose concentration was determined
by arnino acid analysis (next section). The amount of ATP bound by ParA was detemined as
the arnount of ATP in the peak minus the background ATP (in the buffer). Experirnents were
perfomed with bufien containing 0.5, 2, 5, 10, 15, 20, 30, or 50 pM ATP, using either 31
pM or 62 p M ParA in the sample loaded on the column. At ieast two experiments were
performed at each concentration of ATP. Concentrations used in the ADP binding assays are
in Table 3-1.
Protein concentration determination: Protein concentration was routinely measured by
Bradford assay (26). The accuracy of this assay for ParA was determined by comparing the
measurement of protein concentration by amino acid analysis to the measurement by
Bradford assay. For amino acid analysis, ParA was equilibrated to 20 mM NH,HCO, by gel
filtration through a 1 ml Bio-Gel P-6 column. ParA hydrolysis and amino acid analysis were
performed at the HSC Biotech Service Centre (Universify of Toronto). ParA molar
concentration is expressed as a monomer and ParB as a dimer.
DNA binding assay: ParA DNA binding to parOP was measured using DNase 1 protection
assays (Chapter 2). The substrate was the 388 bp Hindm.-Bo1 fragment from pMD6
(Chapter 2) and was labelled at H i n m on the 3' end with [ d 2 P ] d ~ T P using DNA
polymerase 1 large fragment (164). A typical binding assay contained between 0.1- 10 pmol
ParA (monomer), 10 fmol pMD6 HindIII-XhoI fragment and 1 pg sonicated salmon spem
DNA in 15 pl buffer A. Nucleotide, when added. was present at 1 mM. The mixtures were
incubated for 10 minutes at 30°C, 1.25 pg of bovine pancreatic DNase 1 was added and the
mixtures were incubated for a further 60 sec at 30°C. DNase 1 digestion was stopped by the
addition of 5 pl of "stop" solution (98% forniamide, 10 m M Na2EDTA pH 8, 0.025% xylene
cyanol, 0.025 % bromphenol blue; 164). The samples were heated to 90 OC for 3 minutes and
loaded on a 6 % acry lamide urea gel. After electrophoresis , the gel was dried on Whatman
DE81 paper and exposed to a PhosphorIrnager screen (Molecular Dynamics) and/or to Kodak
XRP film.
Quantification of DNase 1 protection assays: DNase I protection assays were quantified
using a Phosphorhager and ImageQuant software (Molecular Dynamics). 1 defined binding
as protection fiom DNase 1 digestion of the inverter? repeat sequences in parOP by ParA. To
quantify this binding in each iane 1 drew a box in the area that corresponded to the inverted
repeats and another box around a set of bands outside of the protected region but in the same
lane. The volume ("counts") of the box correspondhg to the inverted repeats was divided by
the volume of the box outside of the footprint to yield the relative DNase 1 sensitivity of the
inverted repeats. The sensitivity values obtained were normalized so that the assays that did
n not contain ParA had a DNase 1 sensitivity of 1. As the sensitivity to DNase 1 decreases, the
protection or binding by ParA increases.
RESULTS
ATP and ADP bhding by ParA: Since ATP affects ParA activity I decided to directiy
measure ATP binding by ParA. I used equilibrium gel fdtration (83, 137) which measures
ATP binding as the amount of ATP that co-elutes with protein through a gel filnation
column. Since this is an equilibrium technique, one can deduce ATP stoichiometry as well as
binding affinity. ParA was loaded on a Bio-Gel P-6 column that had been equilibrated in the
same 32P-~TP concentration as the ParA sample. ATP that bound to ParA CO-eluted with the
ParA peak and there was a corresponding trough of ATP concentration after ParA eluted
(Fig 3-1A) (83). ParA concentration was detexmined by amino acid analysis (see
Experimental Procedures). A typical gel filtration experiment is shown in Fig. 3-1A. The
experiment was repeated multiple times, varying ATP concentration from 0.5 to 50 pM and
using two different concentrations of ParA (31 or 62 PM). The ratio of ATP bound per
monomer of ParA was calculated for each experiment and each expriment represents one
point on a binding curve (Fig. 3-1B) or a Scatchard transformation of the data (Fig. 3-1C). 1
was unable to measure ATP binding by ParA to saturation (i.e. at higher nucleotide and
protein concentrations) because of limitations of ParA solubility at high concentration.
Regression analysis on the Scatchard transformation of the data resulted in a & of 33 p M
ATP and 0.8 ATP binding sites (n) per ParA monomer. This K, is close to the K, for ParA
ATPase (50 PM; 39).
Mixing experiments indicate that ParA has a slightiy lower affinity for ADP than for
ATP. When [YZP]ATP and [2,8 3H]ADP were present at equai concentrations in an
equilibrium gel fdtration experiment , ParA bound approximately 1.5 times less ADP than
ATP (Table 3-l), suggesting that the ParA affinity for ADP is about 1.5 times weaker than
ParA affinty for ATP. When the ADP concentration was 1.5 times that of ATP,
Figure 3-1: Equilibrium gel ritration analysis of ATP binding by ParA: A: The profde
from a typical equilibrium gel filtration experiment is shown. In this experirnent a 200 pl
sampie containing 50 pM ATP and 62 pM ParA was loaded on a 5 ml Bio-Gel P-6 column
and eluted as descnbed in "Experimental Procedures". The ATP concentration in each
fraction (a) and the ParA concentration in peak fractions (O) is plotted against the fraction
number. Note that the fractions containing proteîn have a slightly larger volume than the
fractions without protein, thus the peak appears srnaller than the trough. B: Binding curve of
the results from many equilibrium gel filtration experiments performed at 31 pM (*) and 62
p M (i) ParA (in the sarnple load) at various ATP concentrations in the column buffers (see
"Experimental Procedures") is shown. AU data points (ie both data sets) were used to derive
the curve. C: The data from B are plotted on a Scatchard curve (166).
O 10 20 30 40 50
Fraction Number
pmol ATPIpmol ParAJpM ATP pmol ATPIpmol ParA
Table 3-1: Relative binding of ATP and ADP by ParA as measured using
equilibrium gel filtrationa.
Nucleotide concentrationb
(PM)
nucleotide bound per ParA monomer
(prnoYpm01)
ATP ADP ATP:ParA ADP:ParA
a ParA concentration was 60 pM
These assays measured binding of '*P-ATP and 'H-ADP (alone or together) to ParA
as described in " Experimentai Procedures " .
83
approxirnately equal amounts of each nucleotide were bound by ParA (Table 3-1). In the
presence of ADP, less ATP was bound by ParA than when the same concentration of ATP
alone was used, suggesting that ATP and ADP are binding to the same site. 1 estirnated a K,
of 50 p M for ADP, approximately 1.5 times weaker than the K, for ATP (33 PM). The
different affinties of ParA for ATP and ADP indicate that ParA can distinguish between
adenine nucleoside diphosphates and triphosphates.
Nucleotide effects on ParA stabüity: Adenine nucleoside di- and tri-phosphates strongly
stimulate ParA DNA bindkg (Chapter 2; 39), however ADP and ATPyS are better cofacton
than ATP (Chapter 2). To test whether the ability of adenine nucleotides to modulate ParA
activity was a consequence of their effects on ParA conformation 1 examined ParA stability
with and without nucleotide. 1 found that although ParA was quite stable at O°C (for at l e s t
4 days), it was rapidly inactivated by short heat treabnents at 52 OC (Fig . 3-2) and 1 used this
treatment to detect nucleotide-dependent changes in ParA conformation.
ParA stability at 52OC was measured in the presence of various nucleotides (Fig. 3-
2). When ParA was heated to 52°C for 3 minutes in buffer containhg 1 mM ATP or ATPyS
the protein retained significantly more DNA-binding activity than when heated in buffer with
1 m M GTP (Fig. 3-2A and B). ADP (1 rnM) also stabilized ParA, although not to the same
extent as did ATP and ATPyS (Fig. 3-2A and B). After this heat treatment, ParA with GTP
was essentially inactivated (Fig. 3-2A and B). After a shorter heat treatment (1 min), ParA
with GTP retained the same activity as ParA that was heated without any nucleotide (Fig. 3-
2C), consistent with cther assays that indicate that ParA does not bind GTP (Chapter 2; 39).
Therefore ATP, ADP and ATPyS stabilize ParA, suggesting that ParA interaction with these
nucleotides alters ParA conformation. However ADP is less effective than ATP or ATPyS.
Figure 3-2: ATP, ATPyS and ADP stabilize ParA. A: Activity of heat-treated ParA
assessed by DNase 1 footprinting at the parOP site. ParA was heated for 3 min at 52°C in
buffer A containing 100 mM NaCl, 10% (vlv) glycerol, 100 ng bovine serum albumidpl and
1 mM of the indicated nucleotide (ATP, ATPyS, ADP or GTP; above each set of lanes).
Following the heat treatment, ParA was diluted and titrated into DNA binding assays
containing 1 mM ATP at 30°C. as described in "Experimental Procedures". Each lane is
labelled with the amount of PUA in pmol added to the DNA binding mixture. Note that this
ParA scale varies; ParA concentration was lower in assays containing ATP or ATPyS than
ones containing ADP or GTP. The labels and boxes on the lep indicate the -10 and -35
transcriptional signals, the ribosome binding site (RBS) and the parA start codon (ATG) . The
irnperfect inverted repeat sequence is delineated by the inverfed arrows. B: ParA DNA-
binding activity was quantified from the data in A as described in "Experimental
Procedures". The relative sensitivity to DNase 1 cleavage of the inverted repeat sequence in
each lane was plotted against the amount of ParA (pmol), heated in buffer containing 1 rnM
ATP (a), 1 rnM ATPyS (O), 1 m M ADP (a) or 1 mM GTP (O). C: DNase 1 footprints of
ParA following a heat treatment with (+) or without (-) 1 rnM GTP. ParA was heated for 1
minute at 52°C in buffer A c o n t a k g 100 mM NaCl, 100 ng bovine semm albumidpl, 10%
(v/v) glycerol with or without 1 m M GTP before measuring DNA binding. ParA DNA
binding was assayed in the presence of 1 rnM ATP at 30° C as described in " Experimental
Procedures". The heating step was shorter in this experirnent than in A because ParA is less
stable in these conditions. The positions of the DNA sequence elements are represented as
described in A.
Relative DNase I cleavage of the inverted repeats
GTP - +
87
In these experiments, ParA was heated with different nucleotides and then assayed
for DNA-binding activity in 1 mM ATP. Although different adenine nucleotides stimulate
ParA DNA binding to different extents (Chapter 2). the differences in DNA-binding activity
observed here were not due to carry over of nucleotide fiom the heating step into the DNA
binding step for the following reasons. First, the nucleotide specificity for stability (Fig 3-2)
was different than the nucleotide specificity for DNA binding (Chapter 2). Second. when
ParA was incubated at 0°C rather than 52°C in buffer containhg 1 mM ATP, ADP or
ATPyS and then assayed for DNA-binding activity in 1 m M ATP, there was no difference in
activity compared to each other or to untreated ParA (data not shown) . Finally , when ATP
was added to ParA after rather than before the incubation at 52"C, the ATP had no
stabilizing eEect on ParA (not shown). Therefore, 1 have rneasured the effect of nucleotide
on protein stability, not on DNA-binding activity, in these assays (Fig. 3-2).
ATPyS and ATP stabilized ParA to the same extent in this assay, suggesting that
ATP hydrolysis is not required for maximum ParA stability under these conditions. However
because some ATPases can hydrolyse ATPyS, 1 tested whether ParA hydrolysed ATPyS at
52°C. I did not detect any ParA-dependent hydrolysis of ATPyS at 52°C under conditions
where 1 could detect 1 % or more hydrolysis (data not shown). Under the same conditions,
2-596 of ATP (at 1 mM) was hydrolysed, which is approximately 2- to 5-fold more than the
rate of hydrolysis at 30°C (data not shown). The sirnilarity between the results with ATP and
those with ATPyS was not due to ATP contamination of ATPyS. When a sample of ATPyS
was fractionated on a Mono Q column, using conditions where ATP and ATPyS elute
differently, no ATP was detected in the sample (as littie as 1 % could be detected; data not
shown) .
These experirnents show that adenine nucleotides stabilize ParA, however the
triphosphate-bound forms are more stable than the diphosphate-bound form. This difference
may reflect the difference in ParA affinity for adenine nucleoside diphosphates and
triphosphates, but may also reflect a difference in ParA conformation. These observations
suggest that ParA interaction with adenine nucleotides alter ParA conformation, resulting in
increased stabiiity of ParA.
ATP binding and hydrolysis alter ParA conformation: I tested the conclusion that adenine
nucleotides alter ParA conformation using circular dichroism (CD). Addition of 1 m M ATP
elicited a decrease in ParA molar ellipticity (8) indicating that ATP alters ParA conformation
(Fig. 3-3). ADP or ATPyS (1 mM) each had a smaller, but measurable effect in this assay
(Fig . 3-3). AMP, which does not stimulate ParA DNA-binding activity (Chapter 2), had no
effect on ParA conformation (Fig. 3-3). The high absorbance of light in the samples
containhg nucleotide prevented accurate measurement of ellipticity below 219 m. In this
assay 1 used AMP rather than GTP as a negative control so that the absorption spectra of al1
nucleotides in the buffers were identical. The decrease in molar ellipticity at 222 xm
indicated an increase in helicity upon ParA interaction with nucleotides (Table 3-2) (30). This
increase in helicity corresponded to approximately 16 peptide bonds changing conformation
in a ParA monomer (398 amino acids) with ATP and approximately 8 peptide bonds
changing conformation with ADP or ATPyS. ParA, therefore, assumes three different
conformations as detected by CD: ParA without nucleotide, ParA bound to nonhydrolysable
nucleotide (ADP or ATPyS) and ParA bound to hydrolysable nucleotide (ATP). 1 did not
detect a change in ParA helical content that could be attributed to binding of adenine
nucleoside diphosphates versus triphosphates. 1 conclude therefore that ParA interaction with
nucleotide alters ParA structure and that hydrolysis M e r alters that structure. Hydrolysable
Figure 3-3: ParA conformation with and without nucleotide: A: CD spectra of ParA
(20 pM) in buffer A containhg 100 mM NaCl without nucleotide (@) or with 1 mM AMP
(O), 1 mM ADP (A), 1 mM ATPyS (A) or 1 mM ATP (i) are shown. Spectra were
measured on an Aviv 62A DS circular dichroism specîmmeter. Measurements were read
from 300 to 219 nm in 1 nm intervals with a 1 sec averaging t h e . The spectrum of a buffer
blank with or without 1 m M nucleotide was subtracted Born the ParA spectrum with or
without the corresponding nucleotide. Each experiment is the average of five scans and each
experiment was performed at least three times. B: The data between 219 and 225 nm from A
replotted on an expanded scale.
240 260 280 wavelength (nm)
Table 3-2: Effects of adenine nucleotides on ParA helicity,
measured by CD.
nucleo tide % helicity'
none
AMP
ADP
ATPyS
ATP
' Calculated from the molar ellipticity at 222 nm as described in Chen
et al. (30). The data are the average of at least three different
experiments .
92
and nonhydrolysable nucleotides also have different effects on ParA DNA binding (Chapter
2). It follows therefore that one role for the conformational changes induced by ATP
hydrolysis as well as those induced by ATP binding is to modulate ParA DNA binding and
likely ParA repressor function in vivo.
1 aiso used circular dichroism to examine the effects of adenine nucleotides on ParA
stability and confmed rny initial results (Fig. 3-2). 1 measured temperature dependent
changes in ParA conformation by monitoring ParA molar ellipticity at 220 nm between 25°C
and 65 OC (Fig . 3-4). Since ParA precipitated when it was heated, denaturation was not
reversible and 1 cannot make any conclusions about the thennodynamics of ParA
conformation in response to heat, such as the free energy change. However, 1 can estimate
the temperatures at which ParA denatured with and without nucleotide (Table 3-3). As in the
initial stability assay, adenine nucleotides increased ParA stability as indicated by the
increased temperature at which ParA denatured in the presence of nucleotides (Fig. 3-4,
Table 3-3). However, in this assay ATPyS did not stabiiize ParA as well as ATP did (Table
3-3). This result suggests that ATP hydrolysis modifies ParA conformation, as was also
suggested by the ATP hydrolysis dependent increase of ParA helical content (Fig. 3-3).
However, ADP-bound ParA was still less stable than both adenine nucleoside triphosphate
bound forrns.
ParB sümulates ParA DNA binding: ParB stimulates ParA repressor activity in vivo,
however ParB has no repressor activity on its own (55). Simplistically one might expect that
ParB stimulates ParA repressor activity in vivo via a direct interaction of ParB with ParA at
parOP. 1 predicted that such an interaction would influence ParA DNA binding to the
operator, either by increasing ParA affrnity for parOP or by aitering ParA activity, making it
a more effective block to RNA polymerase (resulting, for example, in a change in the DNase
Figure 3-4: The effects of adenine nucleotides on ParA stability: ParA conformation was
monitored by CD at 220 nm (averaging time 15 sec) from 25 "C to 65 OC. The temperature
was increased in 2°C increments, and the sample was equilibrated to each temperature for 1
minute before measurement of the signal. ParA (20 pM) was in buffer A containing 100 mM
NaCl and 1 rnM ATP (A). 1 mM ADP (i) or no nucleotide (a). The experiment shown is
one of three experiments performed.
temperature (OC)
Table 3-3: Effects of adenine nucleotides on heat denaturation of ParA.
none
ADP
ATPyS
ATP
a Concentration of nucleotide, when present, was 1 mM
Temperature at which the signal at 220 nm had changed by 50% of
total change. The data are the averages from three experiments.
%
1 footprint). In initial experiments no ParB effect on ParA DNA binding was detected
(Chapter 2; 39). However, 1 show here that a large molar excess (10-fold as ParB dimers to
ParA monomers) of ParB over ParA stimulated ParA DNA-binding activity up to 5-fold in
the presence of ATP (Fig. 3-SA). At low ParB to ParA ratios, ParB stimulation of ParA
DNA binding was observed when ParA and ParB were preincubated together More assaying
for DNA binding. Less stimulation of ParA DNA binding by ParB was observed under these
conditions (about 2-fold; Fig. 3-5B). Without this preincubation, no effect of ParB on ParA
DNA binding was observed, consistent with previous results (Fig. 3-5B) (Chapter 2). Since
ParB stimulates ParA DNA binding at lower ParB to ParA ratios after preincubation 1 think
it reasonable that the initial requirement for a large excess of ParB over ParA is the result of
a weak ParB-ParA interaction rather than a high stoichiometric ratio. ParB did not protect
purOP from DNase I cleavage on its own (Fig. 3-SB) nor did ParB alter the pattern of
DNase 1 cleavage in the presence of ParA (e.g. compare the last lane without ParB to the
fifth lane with ParB in Fig. 3-5A). This implies that ParB does not directly contact the DNA
and that ParB probably acts by increasing ParA affinity for parOP.
Nucleotide specifcity of ParB stimulation of ParA DNA-binding activity: ParB stimulated
ParA DNA-binding activity only in the presence of ATP. I did not detect any stimulation of
ParA DNA binding by ParB in the presence of ADP (Fig. 3-6A) or in absence of nucleotide
(Fig. 3-6B). In the absence of nucleotide, ParA bhds parOP weakly, about 10-fold less well
than ParA-ATP binds parOP (Chapter 2). Because a large amount of protein was required in
these assays and because non-specific DNA binding interfered, 1 could not add a 10-fold
molar excess of ParB to ParA DNA binding assays without nucleotide. Instead, less ParB
was used and the two proteins were preincubated on ice before assaying for ParA DNA-
binding activity (as in Fig 3-SB). Under these conditions, ParB did not affect ParA activity
Figure 3-5: ParB stimulates ParA DNA binding in the presence of ATP. A: DNase 1
footprints of ParA binding to parOP in the absence of ParB (-) or in the presence of a
10-fold molar excess of ParB (+) were performed as describeci in "Experimental
Procedures". Each assay contained the indicated amount of ParA and 1 mM ATP. The
amount of ParB, when present, was 10 pmol ParB (dimer) for every 1 pmol ParA
(monomer). In the absence of ParB the same molar concentration of BSA in ParB buffer was
added to the assays. The parA start codon (ATG), the ribosome binding site (RBS) and the
-10 and -35 transcriptional signais are indicated by the boxes to the lep. The position of the
inverted repeat sequence is indicated by the inverted arrows. B: DNA binding was measured
in the presence or absence of ParA and a 2-fold molar excess of ParB (ParB dimers to ParA
monorners). The proteins were preincubated together (b) or separately (a, c and d) on ice in
dilution buffer for 1 hour before assaying for DNA binding at 30°C. In the third set of lanes
("c") ParA and ParB were pre-incubated separately before being added to the DNA binding
assays. DNase 1 footprints were performed in the presence of 1 mM ATP as described in
"Experimental Procedures". The positions of the DNA sequence elements are labelled as in p
part A.
Figure 3-6: ParB does not stimulate ParA DNA bindhg in the presence of ADP or in the
absence of nucleotide: A: DNase 1 footprints of ParA binding to parOP in 1 mM ADP with
or without a 10-fold molar excess of ParB (dimer), as indicated. The positions of the ParA
start codon (ATG), the ribosome binding site (RBS) and the -10 and -35 transcriptional
signals are indicated by the boxes on the f@. The invened arrows mark the position of the
inverted repeat sequences. B: ParA binding to parOP in the absence of nucleotide, with and
without ParB, was measured using DNase 1 footprints as descnbed in "Experimental
Procedures". ParA was mixed in dilution buffer with a 2-fold molar excess of either bovine
serum albumin ("-") or ParB (dimer) and preincubated on ice for 1 hour before assaying for
ParA DNA-binding activity at 30°C. The positions of the various DNA sequence elements
are marked as described in A.
ParB ParA i-
ATG O
f
ATG =
101
(Fig. 3-6B). In the presence of ADP or ATPyS (but without ParB), ParA binds to parOP
very well; about 5-fold better than in the presence of ATP. When a 10-fold molar excess of
ParB was added to ParA DNA binding assays in the presence of 1 mM ADP, no effect of
ParB was detected (Fig. 3-6A). ParB also did not stimulate ParA DNA binding in the
presence of ATPyS (data not shown).
Since ParA-ADP binds to DNA better than PUA-ATP binds (Chapter 2), and ParB
stimulates ParA ATPase (39), one explanation of my results is that ParB stimulates ParA
DNA binding via ParB stimulation of ParA ATPase and hence production of ADP. This
seemed a remote possibüity since approximately 0.1 m M ADP is required to stimulate ParA
DNA binding (Chapter 2), ParA has a lower affinity for ADP than ATP (Table 3-1) and
previous measurements of ParA ATPase with a large molar excess of ParB indicated that
insufficient ADP was produced to stimulate ParA DNA binding (39). Nevertheless, I
measured ATP hydrolysis by ParA under DNA binding conditions with a 10-fold molar
excess of ParB. Insuficient ADP was produced ( f u l concentration < 1 pM; data not shown)
to account for ParB stimulation of ParA DNA-binding activity. It is also unlikely that ADP
was a contaminant in my ParB preparations since ParB was purified in several steps and
ParB did not stimulate ParA DNA binding in the absence of nucleotide (Fig. 3-6B).
1 suggest therefore that ParB stimulates ParA DNA binding via a direct interaction
with ParA. Interestingly , ParB stirnulated ParA DNA binding (with ATP) to the same extent
that ADP does over ATP without ParB (up to 5-fold; Chapter 2; Fig. 3-SA). Since ParB
stimulates ParA ATPase (39) and ATP hydrolysis by ParA is inhibitory to ParA DNA
binding (Chapter 2), 1 propose that ParB stimulates ParA DNA binding by circumventing the
negative action of ATP hydroly sis on ParA DNA- binding activity .
DISCUSSION
P l ParA binds (Fig . 3- 1) and hydrolyses ATP (39), and one or both of these
activities are essential for both its regulation and partition activities (41). Nucleotide-binding
experiments (Fig. 3-1) suggest one ATP-binding site per ParA monomer, which agrees well
with the presence of one putative ATP-binding site defined by sequence d y s i s (133), and
the observation that deletion of this region of the protein destroys ATPase activity (41). I
have used different adenine nucleotide cofactors to probe the structure and function of ParA.
My results suggest that ATP binding and ATP hydrolysis by ParA induce different
conformations of ParA that in nini have different roles in ParA's activity. In addition, I
suggest that ATP binding and hydrolysis play separable roles in ParA activities in vitro and
consequently in partition and par gene expression in vivo.
ParA conformation with and without nucleotide: Upon interaction with ATP, ADP and
ATPyS, ParA changes conformation (Fig. 3-3) and ParA dimerization and DNA binding are
stimulated (Chapter 2; 39). The nucleotide specificities of the changes in ParA helical content
detected by CD and of the stimulation of PUA DNA binding are the same, irnplying that the
effects of ATP binding and hydrolysis on ParA DNA-binding activity are mediated by their
effects on ParA conformation. However, the nucleotide specificities for dimerization and
helical content are different, suggesting that dîmerization is not the ody factor detennining
the change in ParA conformation upon interaction with nucleotides. The concentration of
intracellular nucleotide pools is sufficiently high (eg, ATP is in the millimolar range; 54) that
ParA would rarely be free of nucleotide in vivo. However, differences between ParA-ATP
and ParA-ADP or perhaps the interchange between these conformations are likely to be
important for ParA function in partition.
103
Differentiation between adenine nudeoside di phosphates and triphosphates: 1 found it
intriguing that ADP and ATPyS behaved similarly in my assays, such as site-specifc DNA
binding (Chapter 2) and conformation (Fig . 3-3). This raised the formal possibility that ParA
did not discriminate between nucleoside di- and triphosphates, except via the act of ATP
hydrolysis. Here, measurements of nucleotide binding indicate a slightly better affinty for
ATP than for ADP, and a large difference in the ability of adenine nucleoside tri- and
diphosphates to stabilize ParA. The differences in stability may be a function of the
differences in affhity for nucleotide, andlor due to differences in ParA conformation that 1
cannot detect by CD. Differences in ParA stability mediated by nucIeotide could also
potentially play roles in partition or reguiation.
Effects of ATP hydrolysis on ParA structure and function: ParA consistently behaves
differently when bound to a hydrolysable nucleotide than when bound to a nonhydrolysabie
nucleotide. The ATP bound form of ParA has a lower affinity for DNA (Chapter 2), it has a
different conformation than the other fonns (Fig. 3-3 & 3-4) and it is the only form
detectably modrilated by ParB (Fig. 3-5 & 3-6). My current results provide further support
that ATP hydrolysis plays roles in ParA function that are distinct and separable fiorn ATP
b ind ing .
ParA-ParB interactions: ParB stimulates ParA binding to parOP, but only in the presence
of ATP. ParB did not stimulate DNA binding by ParA lacking nucleotide (Fig. 3-6B), a form
of ParA that binds parOP weakly (Chapter 2). 1 detected no ParB effect on DNA binding by
ParA-ADP or ParA-ATPyS (Fig. 3-6A; data not shown), forms of PUA which bind to DNA
about bfold better than ParA-ATP binds to DNA (Chapter 2). ParB stimulates ParA-ATP
DNA-binding activity to the same level as ParA-ADP DNA-binding activity with or without
ParB. Since ATP hydrolysis by ParA in the absence of ParB is inhibitory to DNA binding
104
(Chapter 2), 1 think that the simplest explanation is that ParA association with ParB prevents
the inhibitory action of ATP hydrolysis on PUA DNA binding. This mode1 also explains the
observation that ParB stimulates both ParA ATPase and ParA DNA binding, since one might
otherwise expect increased ATP hydrolysis by ParA to further interfere with ParA DNA
binding. Mutations have been identified in other ATPases that can bind but not hydrolyse
ATP (165, 191). My hypothesis predicts that a similar ParA mutant would repress
transcription from purOP as well as wild-type ParA represses in the presence of ParB (S),
and that this repression would be independent of ParB.
Skce ParB stimulates ParA DNA-binding activity only in the presence of ATP (Fig.
3-5) and not with ADP, ATPyS or without nucleotide (Fig. 3-6; data not shown) 1 conclude
that ParA-bound nucleotide is required for ParB stimulation of ParA DNA binding and this
bound nucleotide must be hydrolysable. Why is hydrolysis required? One possible
explanation is that ATP hydrolysis is required for physical association of ParA and ParB.
Preliminary CO-immunoprecipitation experiments suggest that ParA and ParB associate in the
absence of ATP (Chapter 4), so 1 favor other interpretations of these results. Perhaps a
ParA-ParB complex foms regardless of the nucleotide present but is detectable by my DNA
binding assay only in the presence of ATP hydrolysis. ParA has no detectable kinase activity
(39; my unpublished data) so 1 think it unlikely that phosphorylation of either protein by
ParA is required for activity.
Roles of ATP in par gene regulation and partition: The ATP site in ParA is essential for
both ParA's regulatory and partition activities in vivo (41). One role of ATP binding is to
promote ParA binding to parOP for ParA repressor activity (Chapter 2; 39). A role for ATP
hydrolysis in repression is suggested by its ability to make ParA DNA binding and thus ParA
repressor sensitive to ParB levels. Alternatively, one rnight argue that the role of ParB in
105
repression is to make ParA DNA binding insensitive to ATP hydrolysis. I do not yet kuow
what other roles ATP binding and hydrolysis have for ParA function in vivo. It is possible,
for example, that ATP hydrolysis is necessary only for partition and not regdation. Thus a
putative ParA mutant that c m bind but not hydrolyse ATP would function as a repressor, but
would not be able to support partition in vivo. InhiitiveIy, 1 think it likely that ATP
hydrolysis is required for the positioning reaction, to fulfd the energy requirement inherent in
the partition process. For example, confoxmational changes induced by ATP binding and
hydrolysis in some proteins are thought to mediate the displacement of other structures in the
cell, such as tramport across membranes (MalK; 167), passage of one DNA strand through
another (topoisornerase II; 17) or movement dong microtubules (kinesin; 8 1). Perhaps the
conformational changes induced in ParA by ATP binding and hydrolysis result in the
movement or orientation of the partition apparatus. As a component of the partition cornplex,
ParB could assist with ParA function via ParB interaction with ParA and by ParB stimulation
of ParA ATPase.
ParA-ParB interactions are likely important for ParA7s activity in the positioning
reaction. PUA interaction with the partition cornplex via interaction with ParB may be
required for subsequent steps in the positioning process, such as interaction with host factors.
Host factors rnight Uiteract with ParA, ParB or both proteins. These host factors are still
undefmed although they are not DNA sites on the host chromosome (62). 1 assume that they
are proteins or membrane components that position partition complexes andlor time
positioning events with respect to the cell division cycle. A careful analysis of ParA-PUB
interactions at pars, including the roles of ATP binding and hydrolysis in these interactions,
as well as identification of host factors, are crucial to the dissection of the P l plasmid
partition pathway .
CHAPTER 4: Isolation of ParA-ParB complexes and Future Directions
This chapter presents prelirninary experiments to isolate ParA-ParB complexes.
INTRODUCTION
ParA-ParB imractions have a role in repression (Chapter 3; 55) and are potentiaiiy
important for ParA hinction in the positionhg process. ParB's role in par gene expression is
to stimulate ParA repressor activity (55). My results in Chapter 3 suggest that at least part of
ParB's stimulatory effect on ParA DNA-binding activity is the result of ParB's abüity to
overcome the inhibitory effects of ATP hydrolysis on ParA-parOP interaction. ParA's second
role in partition, inferred from genetic experiments (Chapter 1 ; 55, 77), is likely mediated by
ParA interaction with ParB in the partition complex (ParB-MF-pars complex). Further
characterization of ParA interaction with ParB and the partition complex as well as
examination of the effects of adenine nucleotides on these interactions are crucial to
understanding ParA function in partition.
Although ParA and ParB interact (Chapter 3; 39. 5 3 , a complex of the two proteins
has not previously been isolated. ParB effects on ParA activity have been detected only in the
presence of ATP hydrolysis by ParA (Chapter 3; 39). suggesting that ATP hydrolysis may be
required for physical association of ParA and ParB. Here. 1 isolate ParA-ParB complexes
using CO-immunoprecipitation assays and present pre1imhx-y results that suggest that ATP
hydrolysis is not required for formation of these complexes. The results in this chapter as
well as in the previous chapters make certain predictions about ParA and its interactions with
ATP, ADP and ParB in partition.
METHODS
Preparation of 35S-labelled ParA extracts: ParA-encoding ceIIs (BL2 1 (XDE3 pLysS
pBEF198); 35). which express parA under control of the T7 RNA polymerase promoter,
were grown in M9 minimal medium (164) containing 1% (wlv) glucose, 100 pg
arnpicillin/mi and 25 pg chloramphenicoYml. When the A, of the culture had reached 0.5,
ParA expression was induced with 0.5 mM IPTG (BioRad). After 15 minutes at 37OC, 10
pCi 35S-methionine (Amersham)/rnl was added and the cells were grown for another 30
minutes at 37°C. The cells were harvested, excess label was removed by two washes in M9
media and the cells were resuspended in 50 mM Tris-HCI pH 7.5, 10% (wlv) sucrose and
frozen to -80°C. Cells were lysed by lysosome lysis (58) and ce11 debris was removed by
centrifugation. The amount of ParA in the ce11 lysate was estimated by comparing to known
arnounts of pure ParA on a Western blot using anti-ParA antibodies (Chapter 2).
Preparation of 3 5 S - ~ a r ~ protein: Labelled crude extracts were prepared from BL21 (hDE3
pLysS pBEF198) cells as described above except that rifampicin was added 7 minutes after
IPTG induction to suppress transcription by E. coli RNA polymerase. 35S-methionine was
then added afier a further 8 minutes incubation at 37°C. Cells were incubated for 30 minutes
before processing as described above. "S-ParA (FrJII) was isolated from these crude extracts
as described in Chapter 2. except on a smailer scale.
Antibodies and Protein A Sepharose beads: Anîi-ParB antibody (61) was affinity purified
against a version of ParB tagged at the amino tenninus with 6 histidine residues and a heart
muscle kinase recognition site (a gift from J. Surtees; 181). The ParB hision protein was
immobilised on nitrocellulose and used to affiiinity puri@ anti-ParB antibody using standard
methods (164). The Protein A Sepharose beads (Sigma) were swelled in IP buffer (10 mM
109
Tris-acetate, pH 7.5, 100 mM NaCl, 5 mM MgCl, and 0.1 % (dv) Triton X-100) for at least
one hour and washed twice in IP buffer before use.
Co-immunoprecipitation of ParA and ParB: ParA was precipitated with ParB using affin@
punfied anti-ParB antibodies and Protein A Sepharose beads. Each 100 pl assay contained
approximately 3 pg ParA in crude extract or 3sS-ParA ( F r a , 8 pg ParB (FrN; 57, 58) and
40 pg BSA (Sigma FrV) in IP buffer (10 mM Tris-acetate, pH 7.5, 100 mM NaCl, 5 mM
MgCl, and 0.1 % (vlv) Triton X- 100). Five microliters of 10 % (w/v) Protein A Sepharose in
IP buffer was added to each assay. Following a 30 min incubation at room temperature, the
mixtures were cenaifbged at 12,000 rpm for 10 min. Approxirnately 5 pg of a f f i t y purified
anti-ParB antibody was added to the supernatant and the mixture was incubated for 1 hou at
room temperature with constant mixing. Twenty-five microliters of 10% (w/v) Protein A
Sepharose in IP buffer were added. The mixtures were incubated for 1 hr at room
temperature with constant end-over-end rnixing. The Sepharose beads were then pelleted by
centrifugation and the supernatant was removed. The beads were washed three times with IP
buffer and then resuspended in 50 pl L a e d i sample buffer (104). The proteins were
separated by SDS-PAGE (10%) and exposed to a PhosphorIrnager (Molecular Dynamics)
screen.
RESULTS
Using a CO-immunoprecipitation assay 1 have isolated a ParA-ParB complex from
crude E. coli extracts that contained ParA (Fig. 4-1). ParB was incubated with 35S-labelled
crude E. coli lysates containing ParA, and ParB was precipitated using anti-ParB antibodies
and Protein A Sepharose. Co-precipitation of ParA depended on the presence of ParB (Fig.
4-2) and anti-ParB antibodies (Figs. 4-1 and 4-2). There was some background binding of
ParA to the Protein A Sepharose beads, however signifcandy more ParA was precipitated
when antibody and ParB were present (approxirnately 8-fold more, Fig. 4-1B). When
partially purified, 35S-labelled ParA (Frm) was used identical results were obtained (Fig. 4-
2). These data c o n f i i that ParA and ParB interact directly and show that a ParA-ParB
complex can be isolated.
IR vitro, effects of ParB on ParA activity have only been detected in the presence of
ATP hydrolysis (Chapter 3; 39), suggesting that ATP hydrolysis may be required for
formation of a ParA-ParB complex. However, I detected CO-irnrnunoprecipitation of ParA
( F r a with ParB in the absence of any added ATP. Although it has not yet been fomally
demonstrated, ParA (FrIII), ParB, a f f ~ t y purified antibody and the Protein A Sepharose
beads are unlikeIy to contain nucleotide; ParA and ParB were purified using at least one ion-
exchange column and the antibody was af f i ty purified. Therefore since ParA and ParB
interact in the absence of nucleotide, ATP and ATP hydrolysis do not seem to be required
for association of ParA and ParB.
Relatively large amounts of both ParA and ParB were present in these assays.
Although the precipitation of ParA was specific and ParB-dependent, only a small percentage
(about 2-5%) of the total ParA present was precipitated. This low recovery may reflect a
weak ParA-Pd interaction. Consistent with a weak ParA-ParB interaction, a relatively high
Figure 4-1. Physical d a t i o n of ParA and ParB. A ParA-ParB complex was isolated by
precipitation of ParA by ParB and anti-ParB antibodies. An SDS-polyacrylamide gel of "S-
labelled ParA in crude extracts before ("Lw) or after ("IP") CO-immunoprecipitation is shown.
Antibody (no Aby) or Protein A Sepharose beads (no beadr) was omitted in the indicated
lanes. The migration of rnolecular size markers (New England Biolabs) is indicated to the le#
of each gel. The band correspondhg to ParA is marked by the arrow. B: ImageQunt
(Molecular Dynamics) software was used to quanti@ the relative amount of ParA precipitated
from crude lysates by ParB. anti-ParB antibody and Protein A Sepharose beads ("complete")
compared to assays from which antibodies ("no A b " ) or Protein A Sepharose beads ("no
beadr") had been omitted. Quantification of a line through each of the three "IP" lanes in A
was used to obtain the arbitrary values in the Y-axis.
ParA
47.5 'w 1 ParA
Figure 4-2. Association of ParA and ParB in the absence of nucleotide. Co-
immunoprecipitation of purified ParA (FrIII) and ParB using anti-ParB antibodies and Protein
A Sepharose beads ("cornpiete"). Anti-ParB antibodies ("no Aby") or ParB ("no ParB") was
omitted fiom the indicated lanes. The faster migrating species in the FrIII ParA sample are
likely degradation products of ParA since they reacted with anti-ParA antibodies on a
Western blot (data not shown). The migration of molecular size standards through the gel is
indicated to the Z e j t of the gel.
concentration of ParB is required to rnaximdiy stimulate ParA DNA binding and ParA
ATPase in vitro (Chapter 3; 39). Perhaps nucleotide stimulates ParA-ParB interaction and
more complex would be isolated in the presence of nucleotide. The amount of ParB
immunoprecipitated in these assays has not k e n quantified and it is possible that not al1 of
the ParB was precipitated. In addition, the anti-ParB antibodies are polyclonal and may
interfere with ParA-ParB interactions. Therefore fuIther optimi7irtion of these preliminary
assays is required to make any conclusions about the strength of the interaction between ParA
and ParB using these assays (see Discussion and Future Directions).
1 15
DISCUSSION AND Fü'ïURE DIRECTIONS
In this thesis, 1 have presented experiments that address the roles of ATP binding and
hydrolysis in ParA function, particularly in ParA repressor function. In addition to its role in
repression, ParA is required for an undefmed role in the partition process (41, 55). The
importance of ParA repressor activity for P l plasmid stability is illustrated by the
destabilizing effect of ParA andor ParB overexpression on Pl (3, 56, 77). ParA repressor
activity is probably mediated by ParA interaction with parOP. 1 have s h o w that ATP is not
required for ParA interaction with parOP (Chapter 2) as was previously believed (39),
although ATP does greatly stimulate ParA-parOP interaction (Chapter 2 ) . 1 have
demonstrated that either adeniae nucleoside di- or tn-phosphates are required to stimulate
ParA DNA binding, and that ATP hydrolysis by ParA inhibits ParA DNA binding (Chapter
2). These effects of adenine nucleotides on ParA are mediated by their effects on ParA
conformation, including but not limited to, stimulation of ParA dimerization (Chapters 2 and
3). My results have led to a mode1 of ParA repressor function in which ATP binding and
ATP hydrolysis have separable roles (Chapter 3). ParA interaction with ParB is also
important for ParA function in repression (55) and, 1 believe, for ParA's partition function. 1
have s h o w that ParB stimulates ParA interaction with parOP in vitro (Chapter 3), consistent
with ParB's role as a CO-repressor in vivo (55). This stimulation by ParB requires ATP
hydrolysis (Chapter 3) which has implications for ParA-ParB interactions (see below). As a
first step towards addressing the roles of ParA-ParB interactions in partition 1 have begun to
examine the physical association of the two proteins.
ParA-ParB interactions: What are the potential roles for ParA-ParB interactions in
partition? I think it likely that ParB interaction with ParA mediates ParA interaction with the
partition cornplex, an interaction that must occur if ParA has a direct role in the positionhg
116
process. ParA interaction with the partition complex may be required for plasmid pairing or
for specific interactions with host components that in tum mediate positioning of the
plasmids. Alternatively, ParATs effect on the partition complex may be negative, for example
by causing dissociation of paired or attacheci complexes.
The CO-immunoprecipitation assays provide the f ~ s t evidence that a complex of ParA
and ParB can be isolated. This information wii1 be important in developing assays to detect
and measure ParA-ParB interaction at pars (see below). In addition, these assays are a good
qualitative assay for ParA-ParB interaction and will be useful for assessing ParA and ParB
point mutations and deletions for their abilities to interact.
Only a small percentage of the total ParA added to the assays was precipitated, and
although this may reflect a weak ParA-ParB interaction, it may also be due to lirniting
quantities of anti-ParB and Protein A Sepharose beads in the assays. In addition, the
antibodies used in these assays are polyclonal and may interfere with ParA-ParB interaction.
Optimization of the amounts of ParA, ParB, antibody and beads in these prelirninary assays
will address some of these questions. If these assays are to be used to examine nucleotide
effects then the reagents must be assayed for contaminating ATPase activity and nucleotides.
However, further characterization of ParA-ParB interactions, specifically measurement of the
strength of the interaction and measurement of the effects of adenine nucleotides on ParA-
ParB interaction, may require a different approach.
ParA interaction with ParB in vitro has only been observed in the presence of ATP
hydrolysis (Chapter 3; 39). Using CO-immunoprecipitation assays 1 have shown that ATP
hydrolysis does not seem to be required for physical association of ParA and ParB (Fig . 4-2),
so ATP hydrolysis must have some other effect on ParA-ParB interactions at parOP. ATP
hydrolysis may affect ParA affinïty for ParB and without this increase in affinity, ParB
117
stimulation of ParA DNA binding could not be detected. Alternatively, ParB rnay alter ParA-
ATP conformation so that it resembles ParA-ADP and hence binds parOP with greater
aff i ty. These possibiiities have implications for ParA function in partition. If ATP
hydrolysis stimulates PUA-ParB interaction then ATP hydrolysis may also stimulate ParA
interaction with the partition compIex. Thus ParA-ADP would be less active for partition
than ParA-ATP. Quantification of the interaction between ParA and ParB as weIl as
rneasurement of the effects of different factors such as ATP or ADP on this interaction can
be measured using surface plasmon resonance (related to refiactive index) on a BIAcore
Biosensor system (eg., 138). BIAcore measures interactions between proteins or proteins and
DNA (94) and can be used to determine the aff ï ty and kinetic parameters of the interactions
kg., 50).
If ParB alters ParA-ATP conformation then perhaps the transition from one
conformation to the other plays a role in positioning. Conformational changes hiduced by
ATP binding and hydrolysis in other proteins mediate movement of molecules in the ce11
(eg . , Refs . 17, 8 1 and 167). ParB interaction with ParA would facilitate ParA's function in
this capacity by stimulating ParA ATPase, by inducing the conformational change in ParA
and by anchoring ParA to the partition complex. One possible way to examine
conformational changes in ParA and/or ParB associated with ParA-Pa* interactions is
limited proteolysis of the proteins.
ParA interaction with the partition complex: If ParA interacts directiy with ParB at pars,
then one might expect ParA to affect ParB interaction with parS. There are several different
DNA binding assays for ParB binding to pars (38, 57, 60) that can be used to examine ParA
effects on ParB DNA binding using conditions similar to those used to detect ParB
stimulation of ParA DNA binding (Chapter 3) and those used to isolate ParA-ParB
118
complexes (Figures 4-1 and 4-2). Conversely, effects of the partition complex on ParA
activities, such as its ATPase activity, can also be examined.
Roles of ATP binding and hydrolysis in pur gene expression and partition: An energy
requirement is inherent in the positioning process ; it is an entropically unfavourable event.
Many plasmid partition systems encode ATPases that are required for partition (Chapter 1),
suggesting that these ATPases are important for plasrnid partition. For example, these
ATPases may be required to move or orient plasmids in the ce11 (see Chapter 3). Davis et. al
(41) show that mutating the Walker A motif of the putative ATP binding site interferes with
ParA repressor and partition functions. However, their mutant was inactive for al1 activities
tested and they did no: test their mutant for ATP binding, therefore one cannot make any
fm conclusions about the differential roles of ATP binding and hydrolysis by ParA in
repression and partition from this mutant. It wodd be interesting to search for ParA mutants,
created by random or site-directed mutagenesis, that affect ATP hydrolysis and/or binding in
vitro and test thern for their abilities to support par gene repression and partition in vivo.
In addition to these approaches, specific roles for ParA in positioning c m be tested.
For instance, plasmid interaction with the ce11 membrane has been proposed in many
partition models (Chapter 1). 1s ParA the anchor that holds Pl at the membrane? This
activity would require that ParA is localized, at least some of the tirne, to the membrane.
There is no evidence to suggest that ParA is an integral membrane protein (the purification
properties of ParA suggest that it is soluble), however ParA may associate with specific
factors at the membrane. Some members of the ParA superfarnily are associateci with the
membrane (45, 187). If ParA interacts with the membrane then specifc membrane
components rnay also affect ParA biochemical activities in vitro, such as ParA ATPase
activity or ParA interaction with ParB. Further analysis of ParA interaction with ATP, ADP
119
and ParB, as well as examination of potentiai interactions of ParA with host factors, are
crucial to derstanding the function of ParA, and partition ATPases in general, in the
positioning process.
REFERENCES
121
Abeles, A. L. 1986. P l Plasmid replication. mirification and DNA-binding activity of
the replication protein RepA. J. Biol. Chem. 261:3548-3555.
Abeles, A. L., and S. J. Austin. 1991. Antiparallel plasmid-plasmid pairing may
control P l plasmid replication. Proc. Natl. Acad. Sci. USA. 88:9011-9015.
Abeles, A. L., S. A. Friedman, and S. J. Austin. 1985. Partition of unit-copy
miniplasmids to daughter cells III. The DNA sequence and functiod organization of
the Pl partition region. J. Mol. Biol. 185261-272.
Adams, D. E., J. B. Bliska, and N. R. CozzarelIi. 1992. Cre-lox recombination in
Escherichia coli cells. Mechanistic differences from the in vitro reaction. J . Mol.
Biol. 226:66l-673.
Adams, D. E., E. Shekhtman, E. L. Zechiedrich, M. B. Schmid, and N. R.
Cozzarelli. 1992. The role of topoisornerase IV in partitioning bacterial replicons and
the structure of catenated intermediates in DNA replication. Cell. 71:277-288.
herlund, T., R. Bernander, and K. Nordstrom. 1992. Cell division in
Escherichia coli minB mutants. Molec. Microbiol. 6:2073-2083.
Alder, H. I., W. D. Fisher, and A. A. Hardigree. 1969. Ce11 division in
Escherichia coli. Tram N.Y. Acad. Sci. 31:1059-1070.
Arai, K., S. Yasuda, and A. Kornberg. 1981. Mechanism of dnaB protein action 1.
Crystallization and properties of dnaB protein, an essentiai replication protein in
Eschenchia coli. J . Biol. Chem. 2565247-5252.
Argaet, V. P., T. J. Wilson, and B. E. Davidson. 1994. Purification of the
Escherichia coli regulatory protein TyrR and analysis of its interactions with ATP,
tyrosine, phenylalanine and tryptophan. J. Biol. Chem. 269:5 17 1-5 178.
122
Austin, S., and A. Abeles. 1983. Partition of unit-copy miniplasmids to daughter
cells 1. Pl and F miniplasmids contain discrete, interchangeable sequences sufficient
to promote equipartition. J. Mol. Biol. 169:353-372.
Austin, S., and A. Abeles. 1983. Partition of unit-copy miniplasmids to daughter
ceils II. The partition region of miniplasmid P l encodes an essential protein and a
centromere-like site at which it acts. J. Mol. Biol. 169~373-387.
Austin, S., S. Friedman, and D. Ludtke. 1986. Partition functions of unit-copy
plasmids can stabilize the maintenance of plasmid pBR322 at low copy nurnber. J.
Bacteriol. 168: 1010-1013.
Austin, S., M. Ziese, and N. Sternberg. 1981. A novel role for site-specific
recombination in maintenance of bacterial replicons. Cell. 25729-736.
Bechofer, D. H., J. A. Kornacki, W. Fiihein, and D. A. Figurski. 1986. Gene
control in broad host range plasmid RK2: expression, polypeptide product, and
multiple regulatory functions of korB. Proc. Natl. Acad. Sci. USA. 83:394-398.
Begg, K. J., and W. D. Donachie. 1991. Experiments on chromosome separation
and positioning in Escherichia coli. New Biologist. 3:475-486.
Beil, S. P., and B. Stillman. 1992. ATP-dependent recognition of eukaryotic origins
of DNA replication by a multiprotein cornplex. Nature. 357: 128-1 34.
Berger, J. M., S. J. Gambh, S. C. Harrison, and J. C. Wang. 1996. Structure
and mechanism of DNA topoisornerase 11. Nature. 379:225-232.
Bernard, P., and M. Couturier. 1992. Ce11 killing by the F plasmid CcdB protein
involves poisoning of DNA-topoisornerase II complexes. J. Mol. Biol. 226:735-745.
123
Biek, D. P., and J. Shi. 1994. A single 43-bp su& repeat of plasmid mini-F is
sufficient to allow assembly of a functiond nucleoprotein cornplex. Proc. Nati. Acad.
Sci. USA. 91:8027-803 1.
Biek, D. P., and J. Strings. 1995. Partition functions of mini-F affect plasmid
topology in Escherichia coli. J . Mol. Biol. 246:38840û.
Blakely, G., S. Colloms, G. May, M. Burke, and D. Sherratt. 1991. Escherichia
coli XerC recombinase is required for chromosomal segregation at ce11 division. New
Biologist. 3:789-798.
Blakeiy, G., G. May, R. McCulloch, L. K. Arciszewska, M. Burke, S. T. Lovett,
and D. J. Sherratt. 1993. Two related recombinases are required for site-specific
recombination at dif and cer in E. coli K12. Cell. 7 5 3 5 1-361.
Boe, La, K. Gerdes, and S. Molin. 1987. Effects of genes exerting growth inhibition
and p lasmid stability on plasmid maintenance. J. Bacteriol . l69:4646-4650.
Bork, P., C. Sander, and A. Valencia. 1992. An ATPase domain comrnon to
prokayotic ce11 cycle proteins, sugar kinases, actin and hsp7O heat shock proteins.
Proc. Natl. Acad. Sci. USA. 89:7290-7294.
Borodovsky, M., E. V. Koonlli, and K. E. Rudd. 1994. New genes in old
sequence: a strategy for fmding genes in the bacterial genome. Trends Biochem. Sci.
19:309-3 13.
Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye binding. Anal.
Biochem. 72:248-254.
Breüner, A., R. B. Jensen, M. Dam, S. Pedersen, and K. Gerdes. 1996. The
centromere-like parc locus of plasrnid R1. Mol. Microbiol . 20: 58 1-592.
124
28. Cerin, Hm, and J. Hackett. 1993. The parVP region of the Salmonella typhimurium
virulence plasmid pSLT contains four loci required for incornpatibility and partition.
Plasmid. 30:30-38.
29. Chattoraj, D. K., K. M. Snyder, and A. L. Abeles. 1985. P l plasmid replication:
multiple functions of RepA protein at the ongin. Proc. Natl. Acad. Sci. USA.
82:2588-2592.
30. Chen, Y. II., J. T. Yang, and H. M. Martinez. 1990. Determination of the
secondary structure of proteins by circular dichroism and optical rotary dispersion.
Biochern. ll:4120-4l3l.
3 1. Clerget, M. 199 1. Site-specific recombination promoted by a short DNA segment of
plasmid R1 and by a homologous segment in the terminus region of the Escherichia
coli chromosome. New Biologist. 3:780-788.
32. Coiioms, S. D., P. Sykora, G. Szatmari, and D. J. Sherratt. 1990. Recombination
at ColEl cer requires the Escherichia coli xerC gene product, a member of the
lambda integrase family of site-specific recombinases. J. Bactenol. 172:6973-6980.
33. Dam, M., and K. Gerdes. 1994. Partitioning of plasmid RI. Ten direct repeats
flanking the parA promoter constitute a centromere-like partition site parc, that
expresses incompatibility . I. Mol. Biol. 236: 1289- 1298.
34. Dassain, M., and J.-P. Bouche. 1994. The min locus, which confers topological
specificiv to ce11 division, is not involved in its coupling to nucleoid separation. J.
Bacteriol. l76:6 143-6145.
35. Davey, M. J., and B. E. Funneil. 1994. The P l plasmid partition protein ParA: A
role for ATP in site-specific DNA binding. J. Biol. Chem. 269:29908-29913.
Davie, E., K. Sydnor, and L. 1. Rothfeld. 1984. Genetic basis of minice11
formation in Eschenchia coli K12. J . Bactenol. 158: 1202- 1203.
Davies, J. K., and P. Reeves. 1975. Genetics of resistance to colicins in Escherichia
coli K-12: Cross-resistance among colicins of group A. J. Bacteriol. 123: 102-1 17.
Davis, M. A., and S. J. Austin. 1988. Recognition of the Pl plasmid centromere
analog involves binding of the ParB protein and is modified by a specific host factor.
EMBO 1. 7~1881-1888.
Davis, M. A., K. A. Martin, and S. J. Austin. 1992. Biochemical activities of the
ParA partition protein of the Pl plasmid. Moi. Microbiol. 6: 1 141-1 147.
Davis, M. A., K. A. Martin, and S. J. Austin. 1990. Specificity switching of the
Pl plasmid centromere-like site. EMBO J. 9:99 1-998.
Davis, M. A., L. Radnedge, K. A. Martin, Fm Hayes, B. Youngren, and S. J.
Austin. 1996. The Pl ParA protein and its ATPase activity play a direct role in the
segregation of plasmid copies to daughter cells. Mol. Microbiol. 21: 1029-1036.
Davis, T o La, D. R. H e b k i , and R. Cm Roberts. 1992. Transcription and
autoregulation of the stabilizing functions of broad-host-range plasmid RK2 in
Escherichia coli, Agrobactenum tumefaciens and Pseudomonas aemginosa . Mol.
Microbiol. 6: 1981-1994.
Dean, F. B., M. Dodson, Hm Echols, and J. Aurwitz. 1987. ATP-dependent
formation of a specialized nucleoprotein structure by simian virus 40 (SV40) large
hmor antigen at the SV40 replication origin. Proc. Natl. Acad. Sci. USA.
84:8981-8985.
Deb, S. P.. and P. Tegtmeyer. 1987. ATP enhances the binding of simian vims 40
large T antigen to the origin of replication. J. Virol. 61:3649-3654.
126
45. de Boer, P. A. J., Ra E. Crossley, A. R. Hand, and L. 1. Rothï~eld. 1991. The
MinD protein is a membrane ATPase required for the correct placement of the
Escherichia coli division site, EMBO J. lO:4371-4380.
46. Dodd, 1. B., and J. B. Egan. 1990. Improved detection of helix-tum-helix
DNA-binding motifs in protein sequences. Nucleic Acids Res. l8:5019-5027.
47. EberI, L., M. Givskov, and H. Schwab. 1992. The divergent promoters mediating
transcription of the par locus of plasmid RP4 are subject to autoregulation. Mol.
Microbiol . 6: 1969- 1979.
48. Eckstein, F. 1985. Nucleoside phosphorothioates. Annu. Rev. Biochem. S4:367-402.
49. Ezaki, B., To Ogura, H. Niki, and S. Hiraga. 1991. Partitionhg of a rnini-F
plasmid into anucleate cells of the mukB nul1 mutant. J. Bacteriol. 173:6643-6646.
50. Fagerstam, L. Go, A. Frostell-Karisson, Ra Karisson, B. Persson, and 1.
Ronnberg. 1992. Biospecific interaction analysis using surface plasmon resonance
detection applied to kinetic, binding site and concentration analysis. I. Chromatog.
597:397-410.
5 1. Feuerstein, J., R. S. Goody, and M. R. Webb. 1989. The mechanism of guanosine
nucleotide hydrolysis by p21 c-Ha-ras. The stereochemical course of the GTPase
reaction. J. Biol. Chem. 264:6188-6190.
52. Figurski, D. Hm, R. J. Meyer, and Dm R. Helinski. 1979. Supression of ColEl
replication by the IncP1 plasmid RK2 in hybrid plasmids constructed in vitro. J.
Molec. Biol. l33:295-3 18.
53. Frame, R., and J. O. Bishop. 1971. The number of sex-factors per chromosome in
Escherichia coli. Biochem. J . l21:93-103.
127
Franzen, J. S., and S. B. Binkley. 1961. Cornparison of the acid-soluble nucleotides
in Escherichia coli at different growth rates. J. Biol. Chem. 236515-519.
Friedman, S. A., and S. J. Austin. 1988. The Pl plasmid partition system
synthesizes two essential proteins from an autoregulated operon. Plasmid. 19:103-112.
Funneil, B. E. 1988. Mini-P 1 plasmid partitioning : Excess ParB destabilizes plasrnids
containing the centromere parS. J. Bacteriol . 170: 954-960. .
Funneli, B. E. 1991. The Pl plasmid partition complex at pars. The influence of
Eschenchia coli integration host factor and of substrate topology . J. Biol. Chem.
266: 14328-14337.
Fumeli, B. E. 1988. Participation of Escherichia coli integration host factor in the
P 1 plasmid partition system. Proc. Nati. Acad. Sci. USA. 85:6657-666 1.
Funnell, B. E. 1996. The Role of the Bacterial Membrane in Chromosome
Replication and Partition. R.G. Landes, Austin, Texas.
Funneii, B. E., and L. Gagnier. 1993. The Pl plasmid partition complex at pars II.
Analysis of ParB protein binding activity and specificity . J. Biol. Chem.
268:36 16-3624.
Funneli, B. E., and L. Gagnier. 1994. Pl plasmid partition: Binding of Pl ParB
protein and Escherichia coli integration host factor to altered pars sites. Biochimie.
76: 924-932.
Funnell, B. E., and L. Gagnier. 1995. Partition of P l plasmids in Escherichia coli
mukB chromosomal partition mutants. J. Bacteriol. l77:2381-2386.
Gallie, D. R., and C. 1. Kado. 1987. Agrobacterium tumefaciens pTAR parA
promoter region involved in autoregulation, incompatibility and plasmid partitioning.
J. Mol. Biol. 193:465-478.
128
Georgiadis, M. M., H. Komiya, P. Chakrabarti, Do Woo, J. J. Kornuc, and D.
C. Rees. 1992. Crystallographic structure of the nitrogenase iron protein from
Azotobacter vinelandii, Science. 257: 165 3- 1659.
Gerdes, K., and S. Molin. 1986. Partitioning of plasmid RI: Structural and
functional analysis of the parA locus. J. Mol. Biol. lgO:269-279.
Gerdes, K., L. K. Poulson, T. Thisted, A. K. Nielsen, J. Martinussen, and P. Ho
Andreasen. 1990. The hok killer gene family in gram-negative bacteria. New
Biologist . 2:946-956.
Geriitz, M., O. Hrabak, and Ho Schwab. 1990. Partitioning of broad-host-range
plasmid RP4 is a cornplex system involving site-specific recombination. J. Bacteriol.
172:6194-6203.
Gerlt, J. A., J. A. Coderre, and S. Mehdi. 1983. Oxygen chiral phosphate esters.
Adv. Enzymol. 55:291-380.
Gidoni, Do, A. Scheiler, B. Barnet, P. Hantzopouios, M. Oren, and C. Rives.
1982. Different foms of simian virus 40 large tumor antigen varying in their
aff i t ies for DNA. J. Virol. 42:456-466.
Graiia, J. Do 1990. Promoter recognition and mRNA initiation by Escherichia coli
Eu70. Meth. Enzymol. 185:37-54.
Green, Eo W., and M. Schaechter. 1972. The mode of segregation of the bacterial
ce11 membrane. P m . Natl. Acad. Sci. USA. 69% 12-23 16.
Gustafsson, P., H. Wolf-Watz, L. Lind, K.-Eo Johansson, and K. Nordstrom.
1983. Binding between the par region of plasmids R1 and pSClOl and the outer
membrane fraction of the host bacteria. EMBO J. 2:27-32.
l29
Hayakawa, Y., T. Murotsu, and K. Matsubara. 1985. Mini-F protein that binds to
a unique region for partition of plasmid DNA. J. Bacteriol. 163:349-354.
Hayes, F., and S. Austin. 1994. Topological scanning of the P 1 plasmid partition
site. J. Mol. Biol. 243:19&198.
Hayes, F., and S. J. Austin. 1993. Specificity detenniDants of the P l and W
plasmid centromere analogs. Proc. Natl. Acad. Sci. USA. 90:9228-9232.
Hayes, Fe, M. A. Davis, and S. J. Austin. 1993. Fine-structure analysis of the W
plasmid partition site. J. Bacteriol. 175(1 l):3443-345 1.
Hayes, F., L. Radnedge, M. A. Davis, and S. J. Austin. 1994. The homologous
operons for Pl and P7 plasmid partition are autoregulated fiom dissimila operator
sites. Mol. Microbiol. 11:249-260.
IIiraga, S. 1992. Chromosome and plasmid partition in Escherichia coli. Annu. Rev.
Biochem. 61:283-306.
Hiraga, S., H. Nüci, T. Ogura, C. Ichinose, H. Mori, B. Ezaki, and A. Jaffé.
1989. Chromosome partitionhg in Escherichia coli: Novel mutants producing
anucleate cells. J. Bacteriol. 171:1496-1505.
Hiraga, S., T. Ogura, H. Ni, C. Ichinose, and H. Mori. 1990. Positioning of
replicated chromosomes in Escherichia coli. J. Bacteriol. l72:3 1-39.
Hirose, K., A. Lockhart, R. A. Cross, and L. A. Amos. 1995.
Nucleotide-dependent angular change in kinesin rnotor domain bound to tubulin.
Nature. 376:277-279.
Hu, K. H., E. Liu, K. Dean, M. Gringas, W. DeGraff, and N. Je Trun. 1996.
Overproduction of three genes leads to camphor resistance and chromosome
condensation in Eschenchia coli. Genet. 143: 152 1- 1532.
Hummeil, J. P., and W. J. Dreyer. 1962. Measurement of protein-binding
phenornena by gel filtration. Biochim. Biophys. Acta. 63530-532.
Ikeda, H., and J.4. Tomizawa. 1968. Prophage P 1, an extrachromosomal
replication unit. Cold Spring Harbor Symp . Quant. Bi01 . 33:79 1-798.
ireton, K., N. W. Gunther N, and A. D. Grossman. 1994. spdlJ is required for
normal chromosome segregation as well as the initiation of sporulation in Bacillus
subrilus. J. Bacteriol. 1765320-5329-
Jacob, F., S. Brenner, and F. Cuzin. 1963. On the regulation of DNA replication
in bactena. Cold S p ~ g Harbor Symp. Quant. Biol. 28:329-336.
Jaffé, A., R. D'Ari, and S. EIiraga. 1988. MiniceIl-forrning mutants of Escherichia
d i : production of minicells and anucleate rods. J. Bacteriol. 170:3094-3 101.
Jaffé, A., T. Ogura, and S. Riraga. 1985. Effects of the ccd function of the F
plasmid on bacterial growth. J. Bacteriol. 163:841-849.
Jagura-Burdzy, G., J. P. Ibbotson, and C. M. Thomas. 1991. The korF region of
broad-host-range plasmid RK2 encodes two polypeptides with transcriptional repressor
activity . J. Bactenol. 173:826-833.
Jagura-Burdzy, G., and C. M. Thomas. 1992. @kA gene of broad host range
plasmid RK2 encodes a novel DNA-binding protein. J. Mol. Bi01 . 225: 65 1-660.
Jensen, R. B., M. Dam, and K. Gerdes. 1994. Partitionhg of plasmid RI. The
parA operon is autoregulated by ParR and its transcription is highly stimulated by a
downstream activating element. J. Mol. Biol. 236: 1299-1309.
Jensen, R. B., and K. Gerdes. 1995. Prograrnmed ce11 death in bacteria: proteic
plasrnid stabilization systerns. Mol. Microbiol. 17:205-210.
131
Jurnak, F. 1985. Structure of the GDP domain of EF-Tu and location of the amino
acids homologous to ras oncogene proteins. Science. 230:32-36.
Karisson, R., A. Michaelsson, and L. Mattsson. 1991. Kinetic analysis of
monoclonai antibody-antigen interactions with a new biosensor based analytical
system. J. Immunolog . Meth. 145229-240.
Kato, J., Y. Nishimura, R. Lmamura, H. Ni, S. Hiraga, and H. Suzuki. 1990.
New topoisornerase essential for chromosome segregation in E. coli. Cell.
63:393-404.
Kerrigan, L. A., and J. T. Kadonaga. 1992. Periodic binding of individual core
histones to DNA: inadvertant purification of the core histone H2B as a putative
enhancer-binding factor. Nucleic Acids Res. 20:6673-6680.
Kieid, Dm G., O. Yansura, B. Srnail, D. Dowbenko, D. M. Moore, M. J.
Grubman, P. D. McKercher, D. O. Morgan, B. H. Robertson, and H. L.
Bachrach. 1979. Cloned viral protein for foot-and-mouth disease: Responses in cattle
and swine. Science. 214: 1125-1 129.
Koerner, T. J., J. E. Hill, A. M. Myers, and A. Tzagoloff. 1991. High-expression
vectors with multiple cloning sites for construction of trpE hision genes: pATH
vectors. Meth. Enzymol. 194:477-490.
Koonin, E. 1993. A superfamily of ATPases with diverse functions containhg either
classical or deviant ATP-binding motif. J. Mol. Biol. 229: 1 165- 1 174.
Korangy, F., and D. A. Julin. 1992. Aiteration by site-directed mutagenesis of the
conserved lysine residue of the ATP-binding consensus sequence of the RecD subunit
of the Escherichia coli RecBCD enzyme. J . Biol. Chem. 267: 1727-1732.
132
Kreuzer, K. N., and N. R. Cozzareili. 1980. Formation and resolution of DNA
catenanes by DNA gyrase. Cell. 20:245-254.
Kuempel, P. L., J. M. Henson, L. Dircks, M. Tecklenburg, and D. F. Lim.
1991. dif. a recA-independent recombioation site in the terminus region of the
chromosome of Eschenchia coli. New Biologist. 3:799-811.
Kusukawa, N., H. Mori, A. Kondo, and S. Hiraga. 1987. Partitioning of the F
plasmid: overproduction of an essential protein for partition inhibits plasmid
maintenance. Mol. Gen. Genet. 208:365-372.
Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature. 227:680-685.
Lane, D., R. Rothenbuehler, A.-M. Mermat, and C. Aiken. 1987. Analysis of
the F plasmid centromere. Mol. Gen. Genet. 207:406-4 12.
Lehnherr, Hm, E. Maguin, S. Jafri, and M. B. Yarmolinsky. 1993. Plasmid
addiction genes of bacteriophage P l : doc, which causes death on curing of prophage,
and phd, which prevents host death when prophage is retained. J. Mol. Biol.
233:4 14-428.
Lehnherr, H., and M. B. Yarmolhky. 1995. Addiction protein Phd of plasmid
prophage Pl is a substrate of the ClpXP se&e protease of Escherichia coli. Proc.
Nat1 . Acad. Sci. USA. 92:3274-3277.
Leslie, N. R., and D. J. Sherratt. 1995. Site-specific recornbination in the
replication terminus region of Escherichia coli: hinctional replacement of dif. EMBO
J. 14:1561-1570.
Lin, Z., and L. P. Maliavia. 1994. Identification of a partition region carried by the
plasmid QpHl of Coxella bumeîîi. Mol. Microbiol. 13:s 13-523.
133
1 10. Lobocka, M., and M. Yarmolinsky. 1996. P l plasmid partition: A mutational
analysis of ParB. J. Mol. Biol. 259:366-382.
111. Lorimer, H. E., E. H. Wang, and C. Rives. 1991. The DNA-binding properties of
polyomavirus large T antigen altered by ATP and other nucleotides. J. Virol.
65:687-699.
112. Ludtke, D. N., B. G. Eichorn, and S. Je Austin. 1989. Plasmid-partition functions
of the P7 prophage. J. Mol. Biol. 209:393-406.
113. Lynch, A. S. , and J. C. Wang. 1993. Anchoring of DNA to the bacterial
cytoplasmic membrane through cotranscriptional synthesis of polypeptides encoding
membrane proteins or proteins for expoa: a mechanisrn of plasmid hypernegative
supercoiling in mutants deficient in DNA topoisornerase 1. J. Bacteriol.
175: 1645-1655.
114. Lynch, A. S., and J. C. Wang. 1995. SopB protein-mediated silencing of genes
linked to the sopC locus of Escherichia coli F plasmid. Proc. Nat. Acad. Sci. USA.
92: 1896-1900.
115. Lynch, A. S., and J. Cm Wang. 1994. Use of an inducible site-specific recombinase
to probe the structure of protein-DNA complexes involved in F plasrnid partition in
Escherichia d i . J. Mol. Biol. 236:679-684.
116. Marians, K. Je 1987. DNA gyrase-catalyzed decatentation of multiply linked DNA
dirners. J. Biol. Chem. 262: 10362-10368.
1 17. Martin, K. A., M. A. Davis, and S. Austin. 199 1. Fine-structure analysis of the P 1
plasmid partition site. J. Bacteriol. 173: 3630-3634.
118. Martin, K. A., S. A. Friedman, and S. J. Austin. 1987. Partition site of the P l
plasmid. Proc. Natl. Acad. Sci. USA. 84:8544-8547.
134
119. Masuda, Y., K. Miyakawa, Y. Nishimwa, and E. Ohtsubo. 1993. chpA and chpB,
Ercherichia coli chromosomal homologs of the pem locus responsible for stable
maintenance of R100, I. Bacteriol. l75:6850-6856.
120. Maxam, A. M., and W. Gilbert. 1977. A new method for sequencing DNA. Proc.
Nati. Acad. Sci. USA. 74560-565.
121. McEntee, K., G. M. Weinstock, and 1. R o Lehman. 1981. Bhding of the recA
protein of Escherichia coli to single- and double-stranded DNA. J. Biol. Chem.
256:8835-8844.
122. MeEntee, K., G. M. Weinstock, and 1. R. Lehman. 1979. Initiation of general
recombination catalyzed in vitro by the red protein of Escherichia coli. Proc. Natl.
Acad. Sci. 76:2615-2619.
123. Meacock, P. A., and S. N. Cohen. 1980. Partitioning of bacterial plasmids during
ce11 division: a cis-acting locus that accomplishes stable plasrnid inheritance. Cell.
20:529-542.
124. Miki, T., 2.-T. Chang, and T. Horiuchi. 1984. Control of ce11 division by sex
factor F in Escherichia coli II . Identification of genes for inhibitor protein and trigger
protein on the 42.84-43 -6 F fragment. J. Mol. Biol. 174:627-646.
125. Miki, T., J. A. Park, Ko Nagao, N. Murayama, and T. Horiuchi. 1992. Control
of segregation of chromosomal DNA by sex factor F in Escherichia coli: Mutants of
DNA gyrase subunit A supress letD (cc@) product growth inhibition. J. Mol. Biol.
225:39-52.
126. Miki, Tm, K. Yoshioka, and T. Horiuchi. 1984. Control of ce11 division by sex
factor F in Escherichia coli 1. The 42.84-43.6 F segment couples ce11 division of the
host bactena with replication of plasmid DNA. 3. Mol. Biol. 174:605-625.
135
127. Milner-White, E. J., J. R. Coggios, and 1. A. Antoo. 1991. Evidence for an
ancestral core structure in nucleotide-binding proteins with the type-A motif. J. Mol.
Biol. 221:751-754.
128. Mimura, C. S., S. R. Holbrook, and G. F.-L. Ames. 1991. Structura1 mode1 of the
nucleotide-binding consemed component of periplasmic permeases. Proc . Natl. Acad .
Sci. USA. 88:84-88.
129. Min, Y.-N., A. Tabuchi, D. D. Womble, and R. H. Rownd. 1991. Transcription
of the stability operon of IncFII plasmid NRl. J. Bactenol. 173:2378-2384.
130. Moodie, S. L., J. B. O. Mitchell, and J. M. Thorton. 1996. Protein recognition of
adenylate: An example of a fuzzy recognition template. J. Mol. Biol. 263:486-500.
131. Mon, a., A. Kondo, A. Ohshima, T. Ogura, and S. Hiraga. 1986. Stnicture and
function of the F plasmid partitioning genes essential for partitioning. J. Mol. Biol.
192: 1-15.
132. Mori, H., Y. Mori, C. Ichinose, H. Niki, T. Ogura, A. Kato, and S. Hiraga.
1989. Purification and characterization of SopA and SopB proteins essential for F
plasmid partitioning. J. Biol. Chem. 264:15535-15541.
133. Motaliebi-Veshareh, M., D o A. Rouch, and C. M. Thomas. 1990. A family of
ATPases involved in active partitioning of diverse bacterial plasmids. Molec .
Microbiol. 4: 1455- 1463.
134. Mukhopadhyay, G., S. Sozhamannan, and D. K. Chattoraj. 1994. Relaxation of
replication control in chaperone-independent intiator mutants of plasmid Pl. EMBO J.
13:2089-2096.
136
Mulder, E., M. EI'Bouhaii, E. Pas, and C. L. Woldringh. 1990. The Eschenchia
coli minB mutant resembles gyrB in defective nucleoid segregation and decreased
negative supercoiling of plasmids. Mol. Gen. Genet. 221:87-93.
Munin, A. G., S. E. Brenner, T. Hubbard, and C. Chothia. 1995. P-loop
containhg nucleoside triphosphate hy drolase fold and superfamiiy . 0 strand ordering
within the sheet. J. Molec. Biol. 247536440.
Myles, G. M., J. E. Hearst, and A. Sancar. 1991. Site-specific mutagenesis of
conserved residues within Walker A and B sequences of Escherichia coli UvrA
protein. Biochem. 30:3824-3834.
Naktinis, V., R. Onrust, L. Fang, and M. O'Donneli. 1995. Assembly of a
chrornosomal replication machine: Two DNA polymerases, a clamp loader, and
sliding clamps in one holoenzyme particle. J. Biol. Chem. 270: 13358-13365.
Niki, H., R. Imamura, M. Kitaoka, K. Yamanaka, T. Ogura, and S. Hiraga.
1992. E. coli MukB protein involved in chromosome partition forms a homodimer
with a rod-and-hinge structure having DNA binding and ATPIGTP binding activities.
EMBO J. 115101-5109.
Niki, A., A. Jaffé, R. Imamura, T. Ogura, and S. Hiraga. 1991. The new gene
mukB codes for a 177 kd protein with coiled-coi1 domains involved in chromosome
partitionhg of E. coli. EMBO J. 10: 183-193.
Noll, M. 1974. Internai structure of the chromatin subunit. Nucleic Acids Res.
1: 1573-1578.
Nordstriun, K. 1990. Control of plasrnid replication-how do DNA iterons set the
replication frequency? Cell. 63: 1121-1 124.
137
143. Nordstrom, K., and S. J. Austin. 1989. Mechanisms that contribute to the stable
segregation of plasmids. AMU. Rev. Genet. 23:37-69.
144. Nordstrom, K., S. Molin, and H. Aagaard-Hansen. 1980. Partitionhg of plasmid
R1 in Escherichia coli 1. Kinetics of loss of plasmid derivatives deleted for the par
region. Plasmid. 4:2 15-227.
145. Novick, R. P., R. C. Clowes, S. N. Cohen, R. Curtiss III, N. Datta, and S.
Fakow. 1976. Uniforni nomenclature for bacterial plasmids: A proposal. Bactenol.
Rev. 40:168-189.
146. Ogasawara, N., and A. Yoshikawa. 1992. Genes and their organization in the
replication ongin region of the bacterial chromosome. Mol. Microbiol . 6:629-634.
147. Ogawa, T., H. Wabiko, T. Tsurimoto, T. Horii, H. Masukata, and H. Ogawa.
1978. Characterization of purified recA protein and regulation of its synthesis in vivo.
Cold Spring Harbor S ymp. Quant. Bi01 . 43: 909-9 16.
148. Ogura, T., and S. Hkaga. 1983. Mini-F plasmid genes that couple host ce11 division
to plasmid proliferation. Proc. Natl. Acad. Sci. USA. 80:4784-4788.
149. Ogura, T., and S. Riraga. 1983. Partition mechanism of F plasmid: Two plasmid
gene-encoded products and a cis-acting region are involved in partition. Cell.
32:35 1-360.
150. Orr, E., N. F. Fairweather, 1. B. Hoiiand, and R. H. Pritchard. 1979. Isolation
and characterisation of a strain carrying a conditional lethal mutation in the cou gene
of Escherichia coli K12. Molec. Gen. Genet. 177: 103-1 12.
151. Pai, E. F., U. Krengel, G. A. Petsko, R. S. Goody, W. Kabsch, and A.
Wittinghofer. 1990. Refmed crystal structure of the triphosphate conformation of
138
H-ras p21 at 1.35 A resolution: implications for the mechanism of GTP hydrolysis.
EMBO J. 9:2351-2359.
Pal, S. K., and D. K. Chattoraj. 1988. Pl plasmid replication: Initiator
sequestration is inadequate to explain control by intitiator binding sites. J. Bactenol.
170:3554-3560.
Pal, S. K., R. J. Mason, and D. R. Chattoraj. 1986. Pl plasmid replication: Role
of initiator titration in copy number control. J. Molec. Biol. 192:275-285.
Peng, H., and K. J. Marians. 1993. Decatenation activity of topoisornerase IV
during oriC and pBR.322 DNA replication in vitro. Proc. Nati. Acad. Sci USA.
90t8571-8575.
Petenon, C. L. 1994. The SMC farnily : Novel proteins for chromosome
condensation? Celf . 79: 3 89-392.
Pittard, A. J., and B. E. Davidson. 199 1. TyrR protein of Escherichia coli and its
role as repressor and activator. Molec. Microbiol. 5: 1585-1592.
Radnedge, L., M. A. Davis, and S. J. Austin. 1996. P l and P7 plasmid partition:
ParB protein bound to its partition site makes a separate discriminator contact with the
DNA that detemines species specificity . EMBO J. 15: 1 155-1 162.
Roberts, J. W., C. W. Roberts, N. L. Craig, and E. M. Phizicky. 1978. Activity
of the Escherichia coli red-gene product. Cold Spring Harbor Symp. Quant. Biol.
43:917-920.
Roberts, R. C., R. Burioni, and D. R. Helinski. 1990. Genetic characterization of
the stabilizing functions of a region of broad-host-range plasmid RK2. J. Bacteriol.
l72:62O4-62 16.
Roberts, R. C., and D. R. Helioski. 1992. Defuition of a minimal plasmid
stabilization system from the broad-host range plasmid RK2. J. Bacteriol.
174:8119-8132.
Roberts, R. C., A. R. Strom, and D. R. Helinksi. 1994. The parDE operon of the
broad- host range plasmid RK2 specifies growth inhibition associated w ith plasrnid
loss. J. Molec. Biol. 237:35-51.
Rosner, J. L. 1972. Formation, induction and curing of bactenophage Pl lysogens.
Virology . 48:679-689.
Runzler, R., S. Thompson, and E. Fanning. 1987. Oligomerization and ongin
DNA-binding activity of Simian Virus 40 large T antigen. J. Virol. 61:2076-2083.
Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: a
Laboratory Manual, Second ed. Cold Spring Harbor Laboratory , Cold Spring Harbor,
NY.
Saraste, M., P. R. Sibbald, and A. Wittinghofer. 1990. The P-loop- a common
motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15430-434.
Scatchard, G. 1949. The attractions of proteins for small molecules and ions. An..
New York Acad. Sci. 513660-672.
Schneider, E., S. Wilken, and R. Scbmid. 1994. Nucleotide-induced conformational
changes of MalK, a bacterial ATP binding cassette transporter protein. J. Biol. Chem.
269: 2O456-2O46 1.
Seefeldt, L. C., T. V. Morgan, D. R. Dean, and L. E. Morteason. 1992. Mapping
the site(s) of MgATP and MgADP interaction with the nitrogeaise of Azotobacter
vinlandii. J. Biol. Chem. 267:668O-6688.
140
169. Sia, E. A., R. Cm Roberts, C. Easter, D. R. Helinski, and D. H. Figurski. 1995.
Different relative importances of the par operons and the effect of conjugal transfer
on the maintenance of intact promiscuous plasmid RK2. J. Bacteriol. l77:2789-2797.
Skarstad, K., and E. Boye. 1993. Degradation of individual chromosomes in recA
mutants of Escherichia coli. J. Bacteriol. 174: 5505-5509.
Skarstad, K., and E. Boye. 1988. Perturbed chromosomal replication in recA
mutants of Escherichia c d . J. Bacteriol. 170:2549-2554.
Smith, C. A., and C. M. Thomas. 1984. Molecular genetic analysis of the r fB and
korB region of broad-host range plasmid RK2. J. Gen. Microbiol. 130: 165 1-1663.
Smith, D. B., and K. S. Johnson. 1988. Single-step purification of polypeptides
expressed in Escherichia coli as fusions with glutathione-S-tramferase. Gene.
67:3 l-4O.
Sobecky, P. A., Cm L. Easter, P. D. Bear, and D. R. Helinski. 1996.
Characterization of the stable maintenance properties of the par region of
broad-host-range plasmid RK2. J. Bactenol. 178:2086-2093.
Steck, T. R., and K. Drlica. 1984. Bacterial chromosome segregation: evidence for
DNA gyrase involvement in decatenation. Cell. 36:1081-1088.
Sternberg, N., and D. Hamilton. 198 1. Bacteriophage P 1 site-specific recombination
1. Recombination between loxP sites. J. Mol. Biol, lS0:467-486.
Story, R. M., and T. A. Steitz. 1992. Structure of the recA protein-ADP complex.
Nature. 3SS:374-376.
Strunnikov, A. V., V. L. Larionov, and D. Koshland. 1993. SMCI: An essentid
yeast gene encoding a putative head-rod-tail protein is required for nuclear division
and defmes a new ubiquitous protein family. J. Ce11 Biol. 123:1635-1648.
Studier, F. W., and B. A. Moffatt. 1986. Use of bactenophage Ti RNA
polymerase to direct selective high level expression of cloned genes. J. Mol. Biol.
189: 113-130.
Summers, D. K., and Do J. Sherratt. 1984. Multimerization of high copy number
plasmids causes instability: ColEl encodes a detenninant essential for plasmid
rnonomerization and stability . Cell. 36: lO97- 1 103.
Surtees, JO A. 1996. MSc. University of Toronto.
Tabuchi, A., Y. N. Min, D. D. Womble, and R. H. Rownd. 1992. Autoregdation
of the stability operon of IncFII plasmid NR1. J. Bacteriol. 174:7629-7634.
Taghavi, S., A. Provoost, M. Mergeay, and D. van der Leiie. 1996. Identification
of a partition and replication region in the Alcaligenes eutruphus megaplasmid
pMOL28. Mol. Gen. Genet. 250: 169-179.
Tecklenburg, M., A. Naumer, O. Naggapan, and P. Kuempel. 1995. The dif
resolvase locus of the Escherichia coli chromosome can be replaced by a 33-bp
sequence, but function depends on location. Proc. Natl. Acad. Sci. USA.
92: 1352-1356.
Theophilus, B. D. M., and C. M. Thomas. 1987. Nucleotide sequence of the
transcriptional repressor gene korB which plays a key role in the regulation of the
copy number of broad host range plasmid W . Nucleic Acids Res. 157443-7450.
Thomas, C. M. 1986. Evidence for the involvement of the incC locus of broad host
range plasmid RK2 in plasrnid maintenance. Plasmid. 16: 15-29.
Tisa, L. S., and B. P. Rosen. 1990. Molecular characterization of an anion pump.
ArsB protein is the membrane anchor for the ArsA protein. J. Biol. Chem.
265: 190-194.
142
188. Treptow, Na, R. Rosenfeld, and M. YarmolinsJcy. 1994. Partition of nonreplicating
DNA by the par system of bacteriophage Pl. J. Bacteriol. 176: 1782-1786.
189. Tsuchimoto, S., H. Ohtsubo, and E. Ohtsubo. 1988. Two genes, p e M and peml,
responsible for stable maintenance of resistance plasmid R1 00. J. Bacteriol.
170: 1461-1466.
190. UUsperger, C., and N. R. Cozzareiii. 1996. Contrasting activities of topoisornerase
IV and DNA gyrase frorn Escherichia coli. J. Biol. Chem. 27l:3 1549-3 1555.
191. van der Woik, J., M. Klose, E. Breukink, R. A. Demel, B. de Kruijff, R.
Freudl, and A. J. M. Driessen. 1993. Characterization of a Baciïïw subrilu~ SecA
mutant protein deficient in translocation ATPase and release from the membrane.
Mol. Microbiol. 8:3 1-42.
192. van Helvoort, J. M. L. M., and C. L. Woldringh. 1994. Nucleoid partitionhg in
Escherichia coli during steady-state growth and upon recovery from chlorarnphenicol
treatment. Molec . Microbiol. 13577-583.
193. Walker, J. E., M. Saraste, M. J. Runswick, and N. J. Gay. 1982. Distantly
related sequences in the alpha and beta-subunits of ATP synthase, myosin, kinases
and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J.
l:945-95 1.
194. Watanabe, E., S. tuamoto, M.-H. Lee, S. U. Kim, T. Ogura, H. Mori, S.
Hiraga, M. Yamasaki, and K. Nagai. 1989. Purification and characterization of the
sopB gene product which is responsible for stable maintenance of mini-F plasmid.
Mol. Gen. Genet. 2l8:43 1-436.
143
195. Watanabe, E., M. Wachi, M. Yamasaki, and K. Nagai. 1992. ATPase activity of
SopA, a protein essential for active partitioning of F plasmid. Mol Gen Genet.
234:346-352.
196. Williams, D. R., and C. M. Thomas. 1992. Active partitioning of bacterial
plasmids. J. Gen. Microbiol. 138: 1-16.
197. Wolle, D., D. R. Dean, and J. B. Howard. 1992. Nucleotide-iron-sulfur cluster
signal transduction in the nitrogenase iron-protein: The role of Asp'? Science.
258:992-995.
198. Yamanaka, K., T. Mitani, T. Ogura, H. Niki, and S. Hiraga. 1994. Cloning,
sequencing and characterization of multicopy suppressors of a mukS mutation in
Escherichia coli. Mol. Microbiol. IWO 1-3 12.
199. Yamanaka, K., T. Ogura, 8. Niki, and S. Hiraga. 1996. Identification of two new
genes, mukE and mukF, involved in chromosome partition in Escherichia coli. Mol .
Gen. Genet. 2SO:241-25 1.
200. Yang, J., S. Ganesan, J. Sarsero, and A. J. Pittard. 1993. A genetic analysis of
various functions of the TyrR protein of Escherichia coli. J. Bacteriol.
175: 1767-1776.
201. Young, C., R. S. Burlage, and D. H. Figurski. 1987. Control of kiLl gene of the
broad-host-range plasmid RK2: Involvement of korA, korB and a new gene, korE. J.
Bacteriol. 169: 13 15- 1320.
202. Zethiedrïch, E. L., and N. R. Cozzarelli. 1995. Roles of topoisornerase IV and
DNA gyrase in DNA unlinking during replication in Eschekhia coli. Genes Dev.
9:2859-2869.
144
203. Zyskind, J. W., A. L. Svitil, W. B. Stine, M. C. Biery, and D. W. Smith. 1992.
RecA protein of Escherichia coli and chromosome partitioning. Mol. Microbiol.
6:2525-2537.
IMAGE EVALUATION TEST TARGET (QA-3)
APPLiEi IMAGE . lnc 1653 East Main Street
Q 1993. Applied Image. lm.. Ail Riqhts ReserWd