Research ArticleCharacterization of Annur and Bedakam Ecotypes ofCoconut from Kerala State India Using Microsatellite Markers

M K Rajesh1 K Samsudeen1 P Rejusha1 C Manjula12

Shafeeq Rahman1 and Anitha Karun1

1 Division of Crop Improvement Central Plantation Crops Research Institute Kasaragod Kerala 671124 India2Nehru Arts and Science College Kanhangad Kerala 671314 India

Correspondence should be addressed to M K Rajesh mkrajucpcrigmailcom

Received 30 September 2013 Revised 20 December 2013 Accepted 26 December 2013 Published 23 February 2014

Academic Editor Arianna Azzellino

Copyright copy 2014 M K Rajesh et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

The coconut palm is versatile in its adaptability to a wide range of soil and climatic conditions A long history of its cultivationhas resulted in development of many ecotypes which are adapted to various agro-eco factors prevalent in a particular regionThese ecotypes usually are known by the location where they are grown It is important to explore such adaptation in the coconutpopulation for better utilization of these ecotypes in coconut breeding programs The aim of the present study was to identify thegenetic diversity of the Bedakam and Annur ecotypes of coconut and compare these ecotypes with predominant West Coast Tall(WCT) populations from which they are presumed to have been derived using microsatellite markers All the 17 microsatellitemarkers used in the study revealed 100 polymorphism The clustering analysis showed that Annur and Bedakam ecotypes weretwo separate and distinct populations compared to WCT It was also evident from the clustering that Annur ecotype was closer toWCT than Bedakam ecotype

1 Introduction

Coconut (Cocos nucifera L) a monotypic species is one ofthe major perennial oil crops of the tropics The palm formsthe basis in many developing countries for food products aswell as serving industrial purposes [1] It is often referred toas ldquoKalpavriksardquo the tree which provides all the necessitiesof life The coconut palm is versatile in its adaptability to awide range of soil and climatic conditions In India it growswell in coastal alluvium of both the West and East coastsriver alluvium of the deltaic regions and the literate and redloam soil of the inland areas It is estimated that about 70 ofthe cropped area is under sandy loam soil Sandy loam soilwith good cation-exchange capacity and soil water level atabout 4mdepth is considered as the best soil type for coconut[2] Coconut cultivars are generally classified into tall anddwarf types The tall types are primarily outcrossing whilethe dwarf types are predominantly self-pollinated [3] In acultivar certain members have been reported to differ fromone another in a single or a constellation of characters [4]

Coconut is a perennial crop with indeterminate floweringand the productive features of the palm are considerablyinfluenced by environmental variables weather factors likesunshine hours light intensity ambient temperature humid-ity and rainfall have been reported to play a significant role influctuations of coconut yield [5 6] The influence of seasonalvariations on gas exchange characteristics and biochemicalconstituents of coconut palms in a particular area havealso been reported in earlier studies [7ndash10] Weather factorsare known to influence crop production especially underrainfall condition and of all the climatic factors rainfall hasmaximum influence on the seasonal variation in yield [11]Variations in environmental factors usually cause genotypesto respond differently from one environment to anotherresulting in genotype environmental interactions

The understanding of the distribution of a particularspecies is also dependent on knowledge of the interrelation-ship of particular species to their environmentThere arewidevariations in the crop and cultivation method in differentregions

Hindawi Publishing CorporationInternational Journal of BiodiversityVolume 2014 Article ID 260895 7 pageshttpdxdoiorg1011552014260895

2 International Journal of Biodiversity

Ecotypes are cultivars which are grown for a long periodto be superior to other local cultivars by the farmers Widemorphological variability has been observed in these nativepopulations of coconut in various coconut growing countriesof the world Studies have indicated high genetic variabilityand diversity forwhole nutweight husked nutsweight kernelweight copra weight copra and oil yield of the palms [12] InIndia coconut is generally considered to be a crop of coastalregion even though it is found to be grown well in inlandslike Assam State of India [13]

Genetic diversity is thought of as the amount of geneticvariability among individuals of a variety or population of aspecies [14] Assessment of genetic diversity of a populationprovides valuable information that can decide its proper uti-lization sustainablemanagement and design of conservationstrategies There are different techniques available to assessgenetic diversity Among these molecular markers have thepotential to significantly increase the efficiency of coconutgenetic improvement specifically in the areas of germplasmmanagement genotype identification and marker-assistedselection of economically important traits [15] Microsatel-lites or simple sequence repeats (SSRs) are tandemly repeatedmotifs of 1ndash6 bases found in all prokaryotic and eukaryoticgenomes analyzed to date They are present in both codingand noncoding regions and are usually characterized by ahigh degree of length polymorphismThe origin of such poly-morphism is still under debate though it appears most likelyto be due to slippage events during DNA replication [16]Theincreased number of SSR markers has greatly improved theknowledge about the genetic diversityrelationships betweencoconut varietiespopulations [17ndash20]

One of the major coconut growing states in India isKerala where the most popular variety grown by the farmersis theWest Coast Tall (WCT) which occupies over 95 percentof the area under coconut The WCT palm grows well in alltypes of soil and is relatively tolerant to moisture stress It isrecommended for large scale cultivation in the coastal regionsof Kerala andKarnataka states of India [21]WCT cultivar hasspread inwards from the coastal regions and is now foundcultivated even in high ranges In the process the cultivardiverged into different ecotypes known by the location wherethey are cultivated some of them being Annur BedakamKuttiyadi Attingal and Kanjirappally These diverse coconutecotypes have been reported to exhibit morphological orphysiological phenotypic differences The objective of thisstudy was to decipher the genetic diversity among Annur(ANR) and Bedakam (BDK) ecotypes of coconut fromKeralaState India and compare them with WCT populationsfrom which they are presumed to have been derived usingmolecular markers which might throw light on the croprsquosevolutionary diversification

2 Materials and Methods

21 Plant Materials and DNA Extraction The plant mate-rial for this study consisted of 50 leaf samples collectedfrom the two different ecotypes namely ANR (17 palms)from Kannur district and BDK (16 palms) from Kasaragod

district both in Kerala State of India and WCT cultivar(17 palms) from CPCRI Kasaragod Kerala State GenomicDNA was extracted from spindle leaves of palms followingthe standardized protocol [22] The DNA was quantifiedspectrophotometrically and the bands were checked on 08agarose gel electrophoresis

22 Molecular Analysis A total of 17 SSR primer pairsspecific to coconut were used in the present study to assessthe genetic diversity of the respective coconut collections(Table 1) The PCR reactions were carried out in 20 120583Lvolume with standardized components 20 ng genomic DNA02 120583M each of forward and reverse primers 10120583M dNTPs(Ms Bangalore Genei Pvt Ltd) 10x buffer (10mM Tris-Hcl (pH 83) 50mM KCl 15mM MgCl

2) and 3 units of

Taq DNA polymerase (Ms Bangalore Genei Pvt Ltd) Afteramplification a volume of 3 120583L of loading buffer was addedto each of the amplified products The amplified productswere run on 30 high resolution agarose gel stained withethidium bromide following the protocol of Sambrook et al[23] and were visualized in a gel documentation system

23 Data Analysis Data analysis was done by scoring ofbands The alleles were scored individually based on com-parison in the molecular ladder The size of the ampliconswas compared using a 100 bp ladder Each band generatedby SSR primers was considered as an independent locusClearly resolved unambiguous bands were scored visually fortheir presence or absence with each primer The scores wereobtained in the form of a matrix with ldquo1rdquo and ldquo0rdquo indicatingthe presence and absence of bands respectively Based on thenumber of polymorphic bands percentage polymorphismwas calculated for each primer

The genetic associations between varieties were evaluatedby calculating Dicersquos similarity coefficient for pairwise com-parisons based on the proportions of shared bands producedby the primers [24] Similarity matrix was generated usingthe NTSYS-PC software version 20 [25] The similaritycoefficients were used for cluster analysis and dendrogramwas constructed by the Unweighted Pair-Group method(UPGMA) [26] Shannonrsquos Information Index expected andobserved heterozygosity unbiased expected heterozygosityfixation index principal component analysis (PCA) andanalysis of molecular variance (AMOVA) were worked outfor the coconut populations using the software GenAlEx65 [27] For PCA genetic distance was calculated from theallele data and the genetic distance was plotted as PCA usingGenAlEx

3 Results

In the present study phylogenetic analysis was carried outusing 50 palms that belong to three distinct coconut pop-ulations one a cultivar (WCT) and two ecotypes namelyANR and BDK The 17 SSR primers employed for the studygave clear unambiguous bands and the data derived wereused for further analysis The details of banding patternsproduced in the accessions are given in Table 1 A total of

International Journal of Biodiversity 3

Table 1 SSR primers their sequences banding patterns and percent polymorphism

Sl no Primer Primer sequence (51015840ndash31015840) Number of bands Number of polymorphic bands Polymorphism ()

1 CAC2 AGCTTTTTCATTGCTGGAATCCCCTCCAATACATTTTTCC 4 4 100

2 CAC3 GGCTCTCCAGCAGAGGCTTACGGGACACCAGAAAAAGCC 3 3 100

3 CAC4 CCCCTATGCATCAAAACAAGCTCAGTGTCCGTCTTTGTCC 4 4 100

4 CAC6 TGTACATGTTTTTTGCCCAACGATGTAGCTACCTTCCCC 3 3 100

5 CAC8 ATCACCCCAATACAAGGACAAATTCTATGGTCCACCCACA 3 3 100

6 CAC10 GGAACCTCTTTTGGGTCATTGATGGAAGGTGGTAATGCTG 3 3 100

7 CAC13 GGGTTTTTTAGATCTTCGGCCTCAACAATCTGAAGCATCG 4 4 100

8 CNZ1 ATGATGATCTCTGGTTAGGCTAAATGAGGGTTTGGAAGGATT 4 4 100

9 CNZ2 CTCTTCCCATCATATACCAGCACTGGGGGGATCTTATCTCTG 4 4 100

10 CNZ3 CATCTTTCATCATTTAGCTCTAAACCAAAAGCAAGGAGAAGT 4 4 100

11 CNZ4 TATATGGGATGCTTTAGTGGACAAATCGACAGACATCCTAAA 4 4 100

12 CNZ5 CTTATCCAAATCGTCACAGAGAGGAGAAGCCAGGAAAGATTT 4 4 100

13 CNZ6 ATACTCATCATCATACGACGCCTCCCACAAAATCATGTTATT 4 4 100

14 CNZ10 CCTATTGCACCTAAGCAATTAAATGATTTTCGAAGAGAGGTC 4 4 100

15 CnCir56 AACCAGAACTTAAATGTCGTTTGAACTCTTCTATTGGG 4 4 100

16 CnCirH9 CACAATCCTTACATCAAATCTCAAGTTCTTACAGCAGT 3 3 100

17 CnCirG4 AGTATAGTCACGCCAGAAAAAAACCCATAACCAGCAAG 4 4 100

Total 63 63Average 370 370

63 bands were produced by 17 primers with an average of370 bandsprimer Polymorphism was calculated for all the17 primers after scoring the bands All the 17 primers showed100 polymorphism

The similarity index based on Dicersquos coefficient wasobtained after pair wise comparison of the three coconutpopulations The percentage similarity varied between thepalms Maximum similarity was seen between ANR6 andANR5 (097) palms and minimum similarity was seen inBDK16 and ANR1 (030) (data not shown) Cluster analysisbased on UPGMA was performed using NTSYS software inorder to obtain a dendrogram On clustering it was foundthat all the three populations formed two major clustersmdashone containing all WCT and a few BDK palms while thesecond cluster exclusively contained BDK palms (Figure 1)In general palms of ANR BDK andWCT grouped togetheraccording to the population however a few palms did showintergroup affinity Two palms (ANR1 and WCT8) stood

outside their respective clusters A group of five palms ofAnnur ecotype clustered separately and this group showedmore affinity towards WCT The palms of BDK ecotype wereall clustered together except for one palm that aligned withAnnur groupWCT palms weremostly clustered together butone palm aligned with BDK and three palms with ANR eco-type Among palms studied from BDK four palms showedaffinity towards ANR and WCT palms Remaining palmsof BDK were clustered in a different group However oneWCT palm (WCT 8) showed variation from all other WCTpalms and grouped with BDK ecotype Other WCT palmsweremostly clustered together showing affinity towards ANRpalms The intergroup affinity might be due to sharing ofalleles between the three coconut populations studied Theclustering shows that ANR and BDK ecotypes were twoseparate populations with clear distinction with just onepalm of BDK (BDK 1) showing affinity towards ANR Itis also evident from the clustering that ANR ecotype is

4 International Journal of Biodiversity

Coefficient055 066 078 089 100

ANRI ANR2 ANR8 ANR5 ANR6 ANR3 ANR4 ANR7 ANR10 ANR9 ANR11 ANR12 WCT10 BDK1 WCT2 WCT3 ANR13 ANR14 ANR15 ANR16 ANR17 WCT4 WCT6 WCT1 WCT5 WCT7 WCT9 WCT15 WCT11 WCT16 WCT17 WCT12 WCT13 WCT14 BDK2 BDK4 BDK3 BDK5 BDK6 WCT8 BDK7 BDK10 BDK11 BDK9 BDK8 BDK12 BDK13 BDK14 BDK16 BDK15

Figure 1 UPGMA phylogenetic tree constructed based on Dicersquos coefficient showing the genetic relationships among the three coconutpopulations

closer to WCT than BDK ecotype When the populationswere considered individually WCT palms clustered at 61similarity ANR palms at 70 similarity and BDK palms at58 similarity

Population-wise mean Shannonrsquos Information Indexranged from 0513 (ANR) to 0712 (BDK) and the meanobserved heterozygosity from 0257 (ANR) to 0339 (BDK)(Table 2) The mean unbiased expected heterozygosity (uHe)ranged from 0325 (ANR) to 0442 (BDK) Mean fixationindex (119865ST) ranged from 0205 to 0372 (Table 2) Pair-wise population matrix of Neirsquos genetic identity calculatedusing GenAlEx program showed a higher average identitybetween ANR andWCT (092) than betweenWCT and BDK(0869) and ANR and BDK (0783) (Table 3) The AMOVAestimation based on 99 permutations using GenAlEx showeda significant (119875 = 001) within population variation (79)compared to among population variation (21) (Table 4)

For a deeper understanding of the clustering patternof the coconut populations we also carried out geneticdistance-based principal component analysis (PCA) usingGenAlExThe results showed clear segregation of all the threepopulations into different quadrates of the PCA (Figure 2)The first and second axes accounted for 8513 and 1487 ofthe total inertia respectively As shown in Figure 2 the firstaxis separated BDK from the other two populations while thesecond axis separated WCT from the other two populations

4 Discussion

Ecotypes are groups of similar populations within the sameplant species that are adapted to certain climatic and edaphicconditions Coconut has been cultivated for centuries inIndia and the long history of its cultivation along the length

International Journal of Biodiversity 5

Table 2 Shannonrsquos Information Index expected and observedheterozygosity unbiased expected heterozygosity and fixation indexfor the three populations

Population I 119867119900

119867119890

u119867119890

119865ST

ANRMean 0513 0257 0315 0325 0205SE 0066 0060 0041 0043 0110

WCTMean 0708 0339 0427 0440 0244SE 0061 0052 0037 0038 0092

BDKMean 0712 0284 0428 0442 0372SE 0062 0057 0035 0036 0105

I = Shannonrsquos Information Index = minus1 lowast Sum (pi lowast Ln (pi))119867119900 = observed heterozygosity = Number of HetsN119867119890 = expected heterozygosity = 1 minus Sum piand2u119867119890 = unbiased expected heterozygosity = (2N(2N minus 1)) lowast119867119890F = fixation index = (119867119890 minus 119867119900)119867119890 = 1 minus (119867119900119867119890)where pi is the frequency of the ith allele for the population and Sum piand2 isthe sum of the squared population allele frequencies

Table 3 Pairwise population matrix of Neirsquos genetic identity

ANR WCT BDK1000 ANR0920 1000 WCT0783 0869 1000 BDK

Table 4 Analysis of molecular variance in the coconut populations

Source df SS MS Est Var Among pops 2 176652 88326 4330 21Within pops 47 760768 16187 16187 79Total 49 937420 20517 100

and breadth of the country has resulted in developmentof many ecotypes which are generally named or knownby the location where they are grown These ecotypes arelikely to have developed certain adaptation to the particularenvironment conditions in which they have been growing fora long time and possess a rich source of valuable genes forcoconut breeding It is important to identify and conservethese ecotypes which could withstand the vagaries of natureand still perform better in terms of growth and yield

West Coast Tall (WCT) coconut population developed onthe West coast of India and came to be known by the regionwhere it was cultivated Though the origin of WCT is nottraceable to any area from where it spread it is obvious thatsea journey by nuts was involved in its spread The cultivarover the yearsmoved from coastal region to the interior areaswhich also resulted in further adaptation and diversity in thecultivar Such adapted WCT populations in certain localitiesare designated with local names by farmers to differentiateit from other WCT populations Annur Bedakam KuttiyadiAttingal and Kanjirappally are some of these The variabilityshown byWCTand ecotypes derived from itmight be geneticor due to physiological factors such as climatic change

Principal coordinates

West CoastTall

Annur Bedakam

Coord 1

Coo

rd 2

Figure 2 Diagram of PCA based on Neirsquos genetic distance

pH of the soil annual rainfall or any other environmentalfactors or even human involvement These coconut ecotypesmay possess higher variability which might be an importantsource for plant breeding in comparison to the presentday cultivars which have been specifically chosen for theirgrowth performance under certain specific environment

Molecularmarkers play an important role in conservationand use of plant genetic resources Molecular markers arerelatively independent of environment DNA-based markersare a way of exploring the genetic relations between pop-ulations and these markers have acted as versatile tools invarious fields Among the various molecular markers cur-rently available microsatellite markers are the most popularbecause they are reproducible enabling their parallel analysisin different laboratories and exchange of the resulting data[28] Also microsatellites form an ideal marker system cre-ating complex banding patterns by simultaneously detectingmultiple DNA loci They have been used successfully bymany researchers to characterize the genetic diversity of thecoconut population [18 21]

With the objective of deciphering the diversity amongand within WCT populations from Kerala region in thepresent study Annur and ecotypes were comparedwithWCTpopulations using SSRs On clustering it was found that thetwo ecotypes and WCT formed two major clusters AnnurBedakam and WCT grouped separately in general with afew palms showing intergroup affinity However most of theBedakampalmswere grouped in separate cluster proving thatAnnur andBedakamecotypeswere two separate populationsIt is also evident from the clustering that Annur ecotypewas closer to WCT than to Bedakam ecotype Pair-wisepopulation matrix of Neirsquos genetic identity also revealeda higher average identity between ANR and WCT thanbetween WCT and BDK and ANR and BDK

The comparison of average observed and expected het-erozygosity values did not show great differences between thethree coconut populations studied All the three populationsdisplayed smaller observed than expected heterozygosities-inbreeding may be a factor contributing to this Among thethree populations palms of ANR ecotype displayed moregenetic similarity amongst themselves with lower observedheterozygosity and fixation index (119865ST) compared to the othertwo populations

The values of heterozygosities obtained in this studyconfirm that the coconut ecotypes represent an importantreservoir of genetic diversity The three populations showed

6 International Journal of Biodiversity

significant genetic differentiation as indicated by 119865ST valuesindicating that a high level of differentiation for the alleleshas occurred in members of the subpopulation comparedto the total population and therefore members of thesubpopulation tend to carry unique alleles compared tothe total population The among population variation wasmore than within population variation based on AMOVAcalculations suggesting very rare genetic exchange betweenthe populations at least in recent history

Diversity in the original WCT population allowed itto spread in to different ecoregions resulting in the evo-lution of ecotypes suitable for the local environment andits subsequent adaptation The result of molecular charac-terization revealed significant differences in midland andcoastal growing palms The WCT and ecotypes might havediffered due to genetic factors or adaptation resulting fromenvironmental variations like climatic change pH of the soilannual rainfall or any other environmental factors or evenhuman interventions

One of the important prerequisites for evolutionarychange is genetic variation as in its absence populationslack the capacity to evolve Within a single species naturalselection coupled with heterogeneity in its habitat mightresult in multiple ecotypes which are genetically distinct[29] The total genetic variation of a species is likely to bedistributed among populations as the impact and directionof natural selection varies from one to another due toenvironmental variation and genetic drift [30] Thereforewith germplasm conservation programmes it is imperativeto accurately measure the amount of genetic diversity and itsdistribution within and between populations To these endsmolecularmarkers provide an efficient and unbiased estimateof these statistics free of environment effects Molecularcharacterization of genetic diversity provides base informa-tion which could be utilized in selection of a promisingrange of accessions for different breeding programs Themicrosatellites used in this study appeared to possess asignificant potential in this respect This is one of the firststudies to probe the diversity of coconut ecotypes usingmolecular markers The results of this study may be used indeveloping a strategy for conservation of these ecotypes andtheir utilization in future coconut breeding programmes

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Director CPCRI Kasaragod for hisguidance and facilities provided The authors also thank thefarmers and extension personnel from Annur and Bedakamfor their cooperation

References

[1] L H Jones ldquoPerennial vegetable oil cropsrdquo in AgriculturalBiotechnology Opportunities for International Development pp213ndash224 CAB International Wallingford UK 1990

[2] J G Ohler ldquoCoconut a tree of liferdquo Plant Production andProtection Paper 1984

[3] D V Liyanage ldquoPreliminary studies on the floral biology of thecoconut palmrdquo Tropical Agriculture vol 105 pp 171ndash175 1949

[4] K Satyabalan ldquoYield variation in west coast tall coconut palmsyield attributes which cause variation in annual yield of nuts inthe palms of different yield groupsrdquo Indian Coconut Journal vol1 pp 5ndash8 1993

[5] P Coomans ldquoInfluence of climate factors on seasonal fluctua-tions of coconut productionrdquoOleagineux vol 30 no 4 pp 153ndash157 1975

[6] D B Murray ldquoCoconut palmrdquo in Ecophysiology of TropicalCrops P T Alvin and T T Kozlowski Eds pp 24ndash27 AcademicPress New York NY USA 1977

[7] K V Kasturi Bai and A Ramadasan ldquoChanges in the levelsof carbohydrates as a function of environmental variablesin hybrids and tall coconut palmrdquo in Coconut Research andDevelopment N M Nair Ed pp 203ndash209 Wiley Eastern NewDelhi India 1983

[8] V Rajagopal A Ramadasan K V Kasturi Bai and D Bal-asimha ldquoInfluence of irrigation on leaf water relations and drymatter production in coconut palmsrdquo Irrigation Science vol 10no 1 pp 73ndash81 1989

[9] K V Kasturi Bai V Rajagopal C D Prabha M J Ratnambaland M V George ldquoEvaluation of coconut cutivars and hybridsfor dry matter productionrdquo Journal of Plantation Crops vol 24pp 23ndash28 1996

[10] C Jayasekara N P A D Nainanayake and K S JayasekaraldquoPhotosythetic characteristic and productivity of coconutpalmrdquo Journal of Plantation Crops vol 24 pp 538ndash547 1996

[11] K N Krishna Kumar Coconut phenology and yield response toclimate variability and change [PhD thesis] Cochin Universityof Science and Technology Kerala India 2011

[12] K Ganesamurthy C Natarajan and M JayaramachandranldquoGenetic diversity and its exploitation in coconut improve-mentrdquo in Proceedings of the National Conference on Agro-Biodiversity Conducted by National Biodiversity AuthorityChennai February 2006

[13] U Parthasarathy A comparative study of coconut cultivation incoastal and inland River Plain Ecosystem of Kasaragod Districtof Kerala and Kamrup District of Assam [PhD thesis] GauhatiUniversity Assam India 2004

[14] A H D Brown ldquoIsozymes plant population genetic structureand genetic conservationrdquoTheoretical and Applied Genetics vol52 no 4 pp 145ndash157 1978

[15] G R Ashburner W K Thompson G M Halloran and M AFoale ldquoFruit component analysis of south pacific coconut palmpopulationsrdquo Genetic Resources and Crop Evolution vol 44 no4 pp 327ndash335 1997

[16] C Schlotterer and D Tautz ldquoSlippage synthesis of simplesequence DNArdquo Nucleic Acids Research vol 20 no 2 pp 211ndash215 1992

[17] R Rivera K J Edwards J H A Barker et al ldquoIsolationand characterization of polymorphic microsatellites in Cocosnucifera Lrdquo Genome vol 42 no 4 pp 668ndash675 1999

International Journal of Biodiversity 7

[18] B Teulat C Aldam R Trehin et al ldquoAn analysis of geneticdiversity in coconut (Cocos nucifera) populations from acrossthe geographic range using sequence-tagged microsatellites(SSRs) and AFLPsrdquo Theoretical and Applied Genetics vol 100no 5 pp 764ndash771 2000

[19] L Perera J R Russell J Provan and W Powell ldquoUse ofmicrosatellite DNA markers to investigate the level of geneticdiversity and population genetic structure of coconut (Cocosnucifera L)rdquo Genome vol 43 no 1 pp 15ndash21 2000

[20] M K Rajesh P Nagarajan B A Jerard V Arunachalam andR Dhanapal ldquoMicrosatellite variability of coconut accessions(Cocos nucifera L) from Andaman and Nicobar Islandsrdquo Cur-rent Science vol 94 no 12 pp 1627ndash1631 2008

[21] C Remany Cataloging and categorization of unexploited eco-types of coconut grown in Kerala [PhD thesis] MahatmaGandhi University Kerala India 2003

[22] M K Rajesh B A Jerard P Preethi et al ldquoDevelopment ofa RAPD-derived SCAR marker associated with tall-type palmtrait in coconutrdquo Scientia Horticulturae vol 150 no 4 pp 312ndash316 2013

[23] J Sambrook E F Fritsch and T Maniatis Cloning A Labora-tory Manual Cold Spring Harbor laboratory 1989

[24] L Dice ldquoMeasures of the amount of ecologic associationbetween speciesrdquo Ecology vol 26 pp 297ndash302 1945

[25] F J Rohlf ldquoNTSYS-pc numerical taxonomy and multivariateanalysis system version 20 owner manualrdquo 1997

[26] P H A Sneath and R R SokalNumerical TaxonomyThe Prin-ciples and Practice of Numerical Classification W H FreemanSan Francisco Calif USA 1973

[27] R Peakall and P E Smouse ldquoGenAlEx 65 genetic analysis inexcel Population genetic software for teaching and research-anupdaterdquo Bioinformatics vol 28 pp 2537ndash2539 2012

[28] P K Gupta H S Balyan P C Sharma and B RameshldquoMicrosatellites in plants a new class of molecular markersrdquoCurrent Science vol 70 no 1 pp 45ndash54 1996

[29] Y B Linhart and M C Grant ldquoEvolutionary significance oflocal genetic differentiation in plantsrdquoAnnual Review of Ecologyand Systematics vol 27 pp 237ndash277 1996

[30] M J Lawrence and N Rajanaidu ldquoThe genetic structure ofnatural populations and sampling strategyrdquo in Proceedings of theInternationalWorkshop onOil PalmGermplasm andUtilizationpp 15ndash26 Selangor Malaysia 1985

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

2 International Journal of Biodiversity

Ecotypes are cultivars which are grown for a long periodto be superior to other local cultivars by the farmers Widemorphological variability has been observed in these nativepopulations of coconut in various coconut growing countriesof the world Studies have indicated high genetic variabilityand diversity forwhole nutweight husked nutsweight kernelweight copra weight copra and oil yield of the palms [12] InIndia coconut is generally considered to be a crop of coastalregion even though it is found to be grown well in inlandslike Assam State of India [13]

Genetic diversity is thought of as the amount of geneticvariability among individuals of a variety or population of aspecies [14] Assessment of genetic diversity of a populationprovides valuable information that can decide its proper uti-lization sustainablemanagement and design of conservationstrategies There are different techniques available to assessgenetic diversity Among these molecular markers have thepotential to significantly increase the efficiency of coconutgenetic improvement specifically in the areas of germplasmmanagement genotype identification and marker-assistedselection of economically important traits [15] Microsatel-lites or simple sequence repeats (SSRs) are tandemly repeatedmotifs of 1ndash6 bases found in all prokaryotic and eukaryoticgenomes analyzed to date They are present in both codingand noncoding regions and are usually characterized by ahigh degree of length polymorphismThe origin of such poly-morphism is still under debate though it appears most likelyto be due to slippage events during DNA replication [16]Theincreased number of SSR markers has greatly improved theknowledge about the genetic diversityrelationships betweencoconut varietiespopulations [17ndash20]

One of the major coconut growing states in India isKerala where the most popular variety grown by the farmersis theWest Coast Tall (WCT) which occupies over 95 percentof the area under coconut The WCT palm grows well in alltypes of soil and is relatively tolerant to moisture stress It isrecommended for large scale cultivation in the coastal regionsof Kerala andKarnataka states of India [21]WCT cultivar hasspread inwards from the coastal regions and is now foundcultivated even in high ranges In the process the cultivardiverged into different ecotypes known by the location wherethey are cultivated some of them being Annur BedakamKuttiyadi Attingal and Kanjirappally These diverse coconutecotypes have been reported to exhibit morphological orphysiological phenotypic differences The objective of thisstudy was to decipher the genetic diversity among Annur(ANR) and Bedakam (BDK) ecotypes of coconut fromKeralaState India and compare them with WCT populationsfrom which they are presumed to have been derived usingmolecular markers which might throw light on the croprsquosevolutionary diversification

2 Materials and Methods

21 Plant Materials and DNA Extraction The plant mate-rial for this study consisted of 50 leaf samples collectedfrom the two different ecotypes namely ANR (17 palms)from Kannur district and BDK (16 palms) from Kasaragod

district both in Kerala State of India and WCT cultivar(17 palms) from CPCRI Kasaragod Kerala State GenomicDNA was extracted from spindle leaves of palms followingthe standardized protocol [22] The DNA was quantifiedspectrophotometrically and the bands were checked on 08agarose gel electrophoresis

22 Molecular Analysis A total of 17 SSR primer pairsspecific to coconut were used in the present study to assessthe genetic diversity of the respective coconut collections(Table 1) The PCR reactions were carried out in 20 120583Lvolume with standardized components 20 ng genomic DNA02 120583M each of forward and reverse primers 10120583M dNTPs(Ms Bangalore Genei Pvt Ltd) 10x buffer (10mM Tris-Hcl (pH 83) 50mM KCl 15mM MgCl

2) and 3 units of

Taq DNA polymerase (Ms Bangalore Genei Pvt Ltd) Afteramplification a volume of 3 120583L of loading buffer was addedto each of the amplified products The amplified productswere run on 30 high resolution agarose gel stained withethidium bromide following the protocol of Sambrook et al[23] and were visualized in a gel documentation system

23 Data Analysis Data analysis was done by scoring ofbands The alleles were scored individually based on com-parison in the molecular ladder The size of the ampliconswas compared using a 100 bp ladder Each band generatedby SSR primers was considered as an independent locusClearly resolved unambiguous bands were scored visually fortheir presence or absence with each primer The scores wereobtained in the form of a matrix with ldquo1rdquo and ldquo0rdquo indicatingthe presence and absence of bands respectively Based on thenumber of polymorphic bands percentage polymorphismwas calculated for each primer

The genetic associations between varieties were evaluatedby calculating Dicersquos similarity coefficient for pairwise com-parisons based on the proportions of shared bands producedby the primers [24] Similarity matrix was generated usingthe NTSYS-PC software version 20 [25] The similaritycoefficients were used for cluster analysis and dendrogramwas constructed by the Unweighted Pair-Group method(UPGMA) [26] Shannonrsquos Information Index expected andobserved heterozygosity unbiased expected heterozygosityfixation index principal component analysis (PCA) andanalysis of molecular variance (AMOVA) were worked outfor the coconut populations using the software GenAlEx65 [27] For PCA genetic distance was calculated from theallele data and the genetic distance was plotted as PCA usingGenAlEx

3 Results

In the present study phylogenetic analysis was carried outusing 50 palms that belong to three distinct coconut pop-ulations one a cultivar (WCT) and two ecotypes namelyANR and BDK The 17 SSR primers employed for the studygave clear unambiguous bands and the data derived wereused for further analysis The details of banding patternsproduced in the accessions are given in Table 1 A total of

International Journal of Biodiversity 3

Table 1 SSR primers their sequences banding patterns and percent polymorphism

Sl no Primer Primer sequence (51015840ndash31015840) Number of bands Number of polymorphic bands Polymorphism ()

1 CAC2 AGCTTTTTCATTGCTGGAATCCCCTCCAATACATTTTTCC 4 4 100

2 CAC3 GGCTCTCCAGCAGAGGCTTACGGGACACCAGAAAAAGCC 3 3 100

3 CAC4 CCCCTATGCATCAAAACAAGCTCAGTGTCCGTCTTTGTCC 4 4 100

4 CAC6 TGTACATGTTTTTTGCCCAACGATGTAGCTACCTTCCCC 3 3 100

5 CAC8 ATCACCCCAATACAAGGACAAATTCTATGGTCCACCCACA 3 3 100

6 CAC10 GGAACCTCTTTTGGGTCATTGATGGAAGGTGGTAATGCTG 3 3 100

7 CAC13 GGGTTTTTTAGATCTTCGGCCTCAACAATCTGAAGCATCG 4 4 100

8 CNZ1 ATGATGATCTCTGGTTAGGCTAAATGAGGGTTTGGAAGGATT 4 4 100

9 CNZ2 CTCTTCCCATCATATACCAGCACTGGGGGGATCTTATCTCTG 4 4 100

10 CNZ3 CATCTTTCATCATTTAGCTCTAAACCAAAAGCAAGGAGAAGT 4 4 100

11 CNZ4 TATATGGGATGCTTTAGTGGACAAATCGACAGACATCCTAAA 4 4 100

12 CNZ5 CTTATCCAAATCGTCACAGAGAGGAGAAGCCAGGAAAGATTT 4 4 100

13 CNZ6 ATACTCATCATCATACGACGCCTCCCACAAAATCATGTTATT 4 4 100

14 CNZ10 CCTATTGCACCTAAGCAATTAAATGATTTTCGAAGAGAGGTC 4 4 100

15 CnCir56 AACCAGAACTTAAATGTCGTTTGAACTCTTCTATTGGG 4 4 100

16 CnCirH9 CACAATCCTTACATCAAATCTCAAGTTCTTACAGCAGT 3 3 100

17 CnCirG4 AGTATAGTCACGCCAGAAAAAAACCCATAACCAGCAAG 4 4 100

Total 63 63Average 370 370

63 bands were produced by 17 primers with an average of370 bandsprimer Polymorphism was calculated for all the17 primers after scoring the bands All the 17 primers showed100 polymorphism

The similarity index based on Dicersquos coefficient wasobtained after pair wise comparison of the three coconutpopulations The percentage similarity varied between thepalms Maximum similarity was seen between ANR6 andANR5 (097) palms and minimum similarity was seen inBDK16 and ANR1 (030) (data not shown) Cluster analysisbased on UPGMA was performed using NTSYS software inorder to obtain a dendrogram On clustering it was foundthat all the three populations formed two major clustersmdashone containing all WCT and a few BDK palms while thesecond cluster exclusively contained BDK palms (Figure 1)In general palms of ANR BDK andWCT grouped togetheraccording to the population however a few palms did showintergroup affinity Two palms (ANR1 and WCT8) stood

outside their respective clusters A group of five palms ofAnnur ecotype clustered separately and this group showedmore affinity towards WCT The palms of BDK ecotype wereall clustered together except for one palm that aligned withAnnur groupWCT palms weremostly clustered together butone palm aligned with BDK and three palms with ANR eco-type Among palms studied from BDK four palms showedaffinity towards ANR and WCT palms Remaining palmsof BDK were clustered in a different group However oneWCT palm (WCT 8) showed variation from all other WCTpalms and grouped with BDK ecotype Other WCT palmsweremostly clustered together showing affinity towards ANRpalms The intergroup affinity might be due to sharing ofalleles between the three coconut populations studied Theclustering shows that ANR and BDK ecotypes were twoseparate populations with clear distinction with just onepalm of BDK (BDK 1) showing affinity towards ANR Itis also evident from the clustering that ANR ecotype is

4 International Journal of Biodiversity

Coefficient055 066 078 089 100

ANRI ANR2 ANR8 ANR5 ANR6 ANR3 ANR4 ANR7 ANR10 ANR9 ANR11 ANR12 WCT10 BDK1 WCT2 WCT3 ANR13 ANR14 ANR15 ANR16 ANR17 WCT4 WCT6 WCT1 WCT5 WCT7 WCT9 WCT15 WCT11 WCT16 WCT17 WCT12 WCT13 WCT14 BDK2 BDK4 BDK3 BDK5 BDK6 WCT8 BDK7 BDK10 BDK11 BDK9 BDK8 BDK12 BDK13 BDK14 BDK16 BDK15

Figure 1 UPGMA phylogenetic tree constructed based on Dicersquos coefficient showing the genetic relationships among the three coconutpopulations

closer to WCT than BDK ecotype When the populationswere considered individually WCT palms clustered at 61similarity ANR palms at 70 similarity and BDK palms at58 similarity

Population-wise mean Shannonrsquos Information Indexranged from 0513 (ANR) to 0712 (BDK) and the meanobserved heterozygosity from 0257 (ANR) to 0339 (BDK)(Table 2) The mean unbiased expected heterozygosity (uHe)ranged from 0325 (ANR) to 0442 (BDK) Mean fixationindex (119865ST) ranged from 0205 to 0372 (Table 2) Pair-wise population matrix of Neirsquos genetic identity calculatedusing GenAlEx program showed a higher average identitybetween ANR andWCT (092) than betweenWCT and BDK(0869) and ANR and BDK (0783) (Table 3) The AMOVAestimation based on 99 permutations using GenAlEx showeda significant (119875 = 001) within population variation (79)compared to among population variation (21) (Table 4)

For a deeper understanding of the clustering patternof the coconut populations we also carried out geneticdistance-based principal component analysis (PCA) usingGenAlExThe results showed clear segregation of all the threepopulations into different quadrates of the PCA (Figure 2)The first and second axes accounted for 8513 and 1487 ofthe total inertia respectively As shown in Figure 2 the firstaxis separated BDK from the other two populations while thesecond axis separated WCT from the other two populations

4 Discussion

Ecotypes are groups of similar populations within the sameplant species that are adapted to certain climatic and edaphicconditions Coconut has been cultivated for centuries inIndia and the long history of its cultivation along the length

International Journal of Biodiversity 5

Table 2 Shannonrsquos Information Index expected and observedheterozygosity unbiased expected heterozygosity and fixation indexfor the three populations

Population I 119867119900

119867119890

u119867119890

119865ST

ANRMean 0513 0257 0315 0325 0205SE 0066 0060 0041 0043 0110

WCTMean 0708 0339 0427 0440 0244SE 0061 0052 0037 0038 0092

BDKMean 0712 0284 0428 0442 0372SE 0062 0057 0035 0036 0105

I = Shannonrsquos Information Index = minus1 lowast Sum (pi lowast Ln (pi))119867119900 = observed heterozygosity = Number of HetsN119867119890 = expected heterozygosity = 1 minus Sum piand2u119867119890 = unbiased expected heterozygosity = (2N(2N minus 1)) lowast119867119890F = fixation index = (119867119890 minus 119867119900)119867119890 = 1 minus (119867119900119867119890)where pi is the frequency of the ith allele for the population and Sum piand2 isthe sum of the squared population allele frequencies

Table 3 Pairwise population matrix of Neirsquos genetic identity

ANR WCT BDK1000 ANR0920 1000 WCT0783 0869 1000 BDK

Table 4 Analysis of molecular variance in the coconut populations

Source df SS MS Est Var Among pops 2 176652 88326 4330 21Within pops 47 760768 16187 16187 79Total 49 937420 20517 100

and breadth of the country has resulted in developmentof many ecotypes which are generally named or knownby the location where they are grown These ecotypes arelikely to have developed certain adaptation to the particularenvironment conditions in which they have been growing fora long time and possess a rich source of valuable genes forcoconut breeding It is important to identify and conservethese ecotypes which could withstand the vagaries of natureand still perform better in terms of growth and yield

West Coast Tall (WCT) coconut population developed onthe West coast of India and came to be known by the regionwhere it was cultivated Though the origin of WCT is nottraceable to any area from where it spread it is obvious thatsea journey by nuts was involved in its spread The cultivarover the yearsmoved from coastal region to the interior areaswhich also resulted in further adaptation and diversity in thecultivar Such adapted WCT populations in certain localitiesare designated with local names by farmers to differentiateit from other WCT populations Annur Bedakam KuttiyadiAttingal and Kanjirappally are some of these The variabilityshown byWCTand ecotypes derived from itmight be geneticor due to physiological factors such as climatic change

Principal coordinates

West CoastTall

Annur Bedakam

Coord 1

Coo

rd 2

Figure 2 Diagram of PCA based on Neirsquos genetic distance

pH of the soil annual rainfall or any other environmentalfactors or even human involvement These coconut ecotypesmay possess higher variability which might be an importantsource for plant breeding in comparison to the presentday cultivars which have been specifically chosen for theirgrowth performance under certain specific environment

Molecularmarkers play an important role in conservationand use of plant genetic resources Molecular markers arerelatively independent of environment DNA-based markersare a way of exploring the genetic relations between pop-ulations and these markers have acted as versatile tools invarious fields Among the various molecular markers cur-rently available microsatellite markers are the most popularbecause they are reproducible enabling their parallel analysisin different laboratories and exchange of the resulting data[28] Also microsatellites form an ideal marker system cre-ating complex banding patterns by simultaneously detectingmultiple DNA loci They have been used successfully bymany researchers to characterize the genetic diversity of thecoconut population [18 21]

With the objective of deciphering the diversity amongand within WCT populations from Kerala region in thepresent study Annur and ecotypes were comparedwithWCTpopulations using SSRs On clustering it was found that thetwo ecotypes and WCT formed two major clusters AnnurBedakam and WCT grouped separately in general with afew palms showing intergroup affinity However most of theBedakampalmswere grouped in separate cluster proving thatAnnur andBedakamecotypeswere two separate populationsIt is also evident from the clustering that Annur ecotypewas closer to WCT than to Bedakam ecotype Pair-wisepopulation matrix of Neirsquos genetic identity also revealeda higher average identity between ANR and WCT thanbetween WCT and BDK and ANR and BDK

The comparison of average observed and expected het-erozygosity values did not show great differences between thethree coconut populations studied All the three populationsdisplayed smaller observed than expected heterozygosities-inbreeding may be a factor contributing to this Among thethree populations palms of ANR ecotype displayed moregenetic similarity amongst themselves with lower observedheterozygosity and fixation index (119865ST) compared to the othertwo populations

The values of heterozygosities obtained in this studyconfirm that the coconut ecotypes represent an importantreservoir of genetic diversity The three populations showed

6 International Journal of Biodiversity

significant genetic differentiation as indicated by 119865ST valuesindicating that a high level of differentiation for the alleleshas occurred in members of the subpopulation comparedto the total population and therefore members of thesubpopulation tend to carry unique alleles compared tothe total population The among population variation wasmore than within population variation based on AMOVAcalculations suggesting very rare genetic exchange betweenthe populations at least in recent history

Diversity in the original WCT population allowed itto spread in to different ecoregions resulting in the evo-lution of ecotypes suitable for the local environment andits subsequent adaptation The result of molecular charac-terization revealed significant differences in midland andcoastal growing palms The WCT and ecotypes might havediffered due to genetic factors or adaptation resulting fromenvironmental variations like climatic change pH of the soilannual rainfall or any other environmental factors or evenhuman interventions

One of the important prerequisites for evolutionarychange is genetic variation as in its absence populationslack the capacity to evolve Within a single species naturalselection coupled with heterogeneity in its habitat mightresult in multiple ecotypes which are genetically distinct[29] The total genetic variation of a species is likely to bedistributed among populations as the impact and directionof natural selection varies from one to another due toenvironmental variation and genetic drift [30] Thereforewith germplasm conservation programmes it is imperativeto accurately measure the amount of genetic diversity and itsdistribution within and between populations To these endsmolecularmarkers provide an efficient and unbiased estimateof these statistics free of environment effects Molecularcharacterization of genetic diversity provides base informa-tion which could be utilized in selection of a promisingrange of accessions for different breeding programs Themicrosatellites used in this study appeared to possess asignificant potential in this respect This is one of the firststudies to probe the diversity of coconut ecotypes usingmolecular markers The results of this study may be used indeveloping a strategy for conservation of these ecotypes andtheir utilization in future coconut breeding programmes

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Director CPCRI Kasaragod for hisguidance and facilities provided The authors also thank thefarmers and extension personnel from Annur and Bedakamfor their cooperation

References

[1] L H Jones ldquoPerennial vegetable oil cropsrdquo in AgriculturalBiotechnology Opportunities for International Development pp213ndash224 CAB International Wallingford UK 1990

[2] J G Ohler ldquoCoconut a tree of liferdquo Plant Production andProtection Paper 1984

[3] D V Liyanage ldquoPreliminary studies on the floral biology of thecoconut palmrdquo Tropical Agriculture vol 105 pp 171ndash175 1949

[4] K Satyabalan ldquoYield variation in west coast tall coconut palmsyield attributes which cause variation in annual yield of nuts inthe palms of different yield groupsrdquo Indian Coconut Journal vol1 pp 5ndash8 1993

[5] P Coomans ldquoInfluence of climate factors on seasonal fluctua-tions of coconut productionrdquoOleagineux vol 30 no 4 pp 153ndash157 1975

[6] D B Murray ldquoCoconut palmrdquo in Ecophysiology of TropicalCrops P T Alvin and T T Kozlowski Eds pp 24ndash27 AcademicPress New York NY USA 1977

[7] K V Kasturi Bai and A Ramadasan ldquoChanges in the levelsof carbohydrates as a function of environmental variablesin hybrids and tall coconut palmrdquo in Coconut Research andDevelopment N M Nair Ed pp 203ndash209 Wiley Eastern NewDelhi India 1983

[8] V Rajagopal A Ramadasan K V Kasturi Bai and D Bal-asimha ldquoInfluence of irrigation on leaf water relations and drymatter production in coconut palmsrdquo Irrigation Science vol 10no 1 pp 73ndash81 1989

[9] K V Kasturi Bai V Rajagopal C D Prabha M J Ratnambaland M V George ldquoEvaluation of coconut cutivars and hybridsfor dry matter productionrdquo Journal of Plantation Crops vol 24pp 23ndash28 1996

[10] C Jayasekara N P A D Nainanayake and K S JayasekaraldquoPhotosythetic characteristic and productivity of coconutpalmrdquo Journal of Plantation Crops vol 24 pp 538ndash547 1996

[11] K N Krishna Kumar Coconut phenology and yield response toclimate variability and change [PhD thesis] Cochin Universityof Science and Technology Kerala India 2011

[12] K Ganesamurthy C Natarajan and M JayaramachandranldquoGenetic diversity and its exploitation in coconut improve-mentrdquo in Proceedings of the National Conference on Agro-Biodiversity Conducted by National Biodiversity AuthorityChennai February 2006

[13] U Parthasarathy A comparative study of coconut cultivation incoastal and inland River Plain Ecosystem of Kasaragod Districtof Kerala and Kamrup District of Assam [PhD thesis] GauhatiUniversity Assam India 2004

[14] A H D Brown ldquoIsozymes plant population genetic structureand genetic conservationrdquoTheoretical and Applied Genetics vol52 no 4 pp 145ndash157 1978

[15] G R Ashburner W K Thompson G M Halloran and M AFoale ldquoFruit component analysis of south pacific coconut palmpopulationsrdquo Genetic Resources and Crop Evolution vol 44 no4 pp 327ndash335 1997

[16] C Schlotterer and D Tautz ldquoSlippage synthesis of simplesequence DNArdquo Nucleic Acids Research vol 20 no 2 pp 211ndash215 1992

[17] R Rivera K J Edwards J H A Barker et al ldquoIsolationand characterization of polymorphic microsatellites in Cocosnucifera Lrdquo Genome vol 42 no 4 pp 668ndash675 1999

International Journal of Biodiversity 7

[18] B Teulat C Aldam R Trehin et al ldquoAn analysis of geneticdiversity in coconut (Cocos nucifera) populations from acrossthe geographic range using sequence-tagged microsatellites(SSRs) and AFLPsrdquo Theoretical and Applied Genetics vol 100no 5 pp 764ndash771 2000

[19] L Perera J R Russell J Provan and W Powell ldquoUse ofmicrosatellite DNA markers to investigate the level of geneticdiversity and population genetic structure of coconut (Cocosnucifera L)rdquo Genome vol 43 no 1 pp 15ndash21 2000

[20] M K Rajesh P Nagarajan B A Jerard V Arunachalam andR Dhanapal ldquoMicrosatellite variability of coconut accessions(Cocos nucifera L) from Andaman and Nicobar Islandsrdquo Cur-rent Science vol 94 no 12 pp 1627ndash1631 2008

[21] C Remany Cataloging and categorization of unexploited eco-types of coconut grown in Kerala [PhD thesis] MahatmaGandhi University Kerala India 2003

[22] M K Rajesh B A Jerard P Preethi et al ldquoDevelopment ofa RAPD-derived SCAR marker associated with tall-type palmtrait in coconutrdquo Scientia Horticulturae vol 150 no 4 pp 312ndash316 2013

[23] J Sambrook E F Fritsch and T Maniatis Cloning A Labora-tory Manual Cold Spring Harbor laboratory 1989

[24] L Dice ldquoMeasures of the amount of ecologic associationbetween speciesrdquo Ecology vol 26 pp 297ndash302 1945

[25] F J Rohlf ldquoNTSYS-pc numerical taxonomy and multivariateanalysis system version 20 owner manualrdquo 1997

[26] P H A Sneath and R R SokalNumerical TaxonomyThe Prin-ciples and Practice of Numerical Classification W H FreemanSan Francisco Calif USA 1973

[27] R Peakall and P E Smouse ldquoGenAlEx 65 genetic analysis inexcel Population genetic software for teaching and research-anupdaterdquo Bioinformatics vol 28 pp 2537ndash2539 2012

[28] P K Gupta H S Balyan P C Sharma and B RameshldquoMicrosatellites in plants a new class of molecular markersrdquoCurrent Science vol 70 no 1 pp 45ndash54 1996

[29] Y B Linhart and M C Grant ldquoEvolutionary significance oflocal genetic differentiation in plantsrdquoAnnual Review of Ecologyand Systematics vol 27 pp 237ndash277 1996

[30] M J Lawrence and N Rajanaidu ldquoThe genetic structure ofnatural populations and sampling strategyrdquo in Proceedings of theInternationalWorkshop onOil PalmGermplasm andUtilizationpp 15ndash26 Selangor Malaysia 1985

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

International Journal of Biodiversity 3

Table 1 SSR primers their sequences banding patterns and percent polymorphism

Sl no Primer Primer sequence (51015840ndash31015840) Number of bands Number of polymorphic bands Polymorphism ()

1 CAC2 AGCTTTTTCATTGCTGGAATCCCCTCCAATACATTTTTCC 4 4 100

2 CAC3 GGCTCTCCAGCAGAGGCTTACGGGACACCAGAAAAAGCC 3 3 100

3 CAC4 CCCCTATGCATCAAAACAAGCTCAGTGTCCGTCTTTGTCC 4 4 100

4 CAC6 TGTACATGTTTTTTGCCCAACGATGTAGCTACCTTCCCC 3 3 100

5 CAC8 ATCACCCCAATACAAGGACAAATTCTATGGTCCACCCACA 3 3 100

6 CAC10 GGAACCTCTTTTGGGTCATTGATGGAAGGTGGTAATGCTG 3 3 100

7 CAC13 GGGTTTTTTAGATCTTCGGCCTCAACAATCTGAAGCATCG 4 4 100

8 CNZ1 ATGATGATCTCTGGTTAGGCTAAATGAGGGTTTGGAAGGATT 4 4 100

9 CNZ2 CTCTTCCCATCATATACCAGCACTGGGGGGATCTTATCTCTG 4 4 100

10 CNZ3 CATCTTTCATCATTTAGCTCTAAACCAAAAGCAAGGAGAAGT 4 4 100

11 CNZ4 TATATGGGATGCTTTAGTGGACAAATCGACAGACATCCTAAA 4 4 100

12 CNZ5 CTTATCCAAATCGTCACAGAGAGGAGAAGCCAGGAAAGATTT 4 4 100

13 CNZ6 ATACTCATCATCATACGACGCCTCCCACAAAATCATGTTATT 4 4 100

14 CNZ10 CCTATTGCACCTAAGCAATTAAATGATTTTCGAAGAGAGGTC 4 4 100

15 CnCir56 AACCAGAACTTAAATGTCGTTTGAACTCTTCTATTGGG 4 4 100

16 CnCirH9 CACAATCCTTACATCAAATCTCAAGTTCTTACAGCAGT 3 3 100

17 CnCirG4 AGTATAGTCACGCCAGAAAAAAACCCATAACCAGCAAG 4 4 100

Total 63 63Average 370 370

63 bands were produced by 17 primers with an average of370 bandsprimer Polymorphism was calculated for all the17 primers after scoring the bands All the 17 primers showed100 polymorphism

The similarity index based on Dicersquos coefficient wasobtained after pair wise comparison of the three coconutpopulations The percentage similarity varied between thepalms Maximum similarity was seen between ANR6 andANR5 (097) palms and minimum similarity was seen inBDK16 and ANR1 (030) (data not shown) Cluster analysisbased on UPGMA was performed using NTSYS software inorder to obtain a dendrogram On clustering it was foundthat all the three populations formed two major clustersmdashone containing all WCT and a few BDK palms while thesecond cluster exclusively contained BDK palms (Figure 1)In general palms of ANR BDK andWCT grouped togetheraccording to the population however a few palms did showintergroup affinity Two palms (ANR1 and WCT8) stood

outside their respective clusters A group of five palms ofAnnur ecotype clustered separately and this group showedmore affinity towards WCT The palms of BDK ecotype wereall clustered together except for one palm that aligned withAnnur groupWCT palms weremostly clustered together butone palm aligned with BDK and three palms with ANR eco-type Among palms studied from BDK four palms showedaffinity towards ANR and WCT palms Remaining palmsof BDK were clustered in a different group However oneWCT palm (WCT 8) showed variation from all other WCTpalms and grouped with BDK ecotype Other WCT palmsweremostly clustered together showing affinity towards ANRpalms The intergroup affinity might be due to sharing ofalleles between the three coconut populations studied Theclustering shows that ANR and BDK ecotypes were twoseparate populations with clear distinction with just onepalm of BDK (BDK 1) showing affinity towards ANR Itis also evident from the clustering that ANR ecotype is

4 International Journal of Biodiversity

Coefficient055 066 078 089 100

ANRI ANR2 ANR8 ANR5 ANR6 ANR3 ANR4 ANR7 ANR10 ANR9 ANR11 ANR12 WCT10 BDK1 WCT2 WCT3 ANR13 ANR14 ANR15 ANR16 ANR17 WCT4 WCT6 WCT1 WCT5 WCT7 WCT9 WCT15 WCT11 WCT16 WCT17 WCT12 WCT13 WCT14 BDK2 BDK4 BDK3 BDK5 BDK6 WCT8 BDK7 BDK10 BDK11 BDK9 BDK8 BDK12 BDK13 BDK14 BDK16 BDK15

Figure 1 UPGMA phylogenetic tree constructed based on Dicersquos coefficient showing the genetic relationships among the three coconutpopulations

closer to WCT than BDK ecotype When the populationswere considered individually WCT palms clustered at 61similarity ANR palms at 70 similarity and BDK palms at58 similarity

Population-wise mean Shannonrsquos Information Indexranged from 0513 (ANR) to 0712 (BDK) and the meanobserved heterozygosity from 0257 (ANR) to 0339 (BDK)(Table 2) The mean unbiased expected heterozygosity (uHe)ranged from 0325 (ANR) to 0442 (BDK) Mean fixationindex (119865ST) ranged from 0205 to 0372 (Table 2) Pair-wise population matrix of Neirsquos genetic identity calculatedusing GenAlEx program showed a higher average identitybetween ANR andWCT (092) than betweenWCT and BDK(0869) and ANR and BDK (0783) (Table 3) The AMOVAestimation based on 99 permutations using GenAlEx showeda significant (119875 = 001) within population variation (79)compared to among population variation (21) (Table 4)

For a deeper understanding of the clustering patternof the coconut populations we also carried out geneticdistance-based principal component analysis (PCA) usingGenAlExThe results showed clear segregation of all the threepopulations into different quadrates of the PCA (Figure 2)The first and second axes accounted for 8513 and 1487 ofthe total inertia respectively As shown in Figure 2 the firstaxis separated BDK from the other two populations while thesecond axis separated WCT from the other two populations

4 Discussion

Ecotypes are groups of similar populations within the sameplant species that are adapted to certain climatic and edaphicconditions Coconut has been cultivated for centuries inIndia and the long history of its cultivation along the length

International Journal of Biodiversity 5

Table 2 Shannonrsquos Information Index expected and observedheterozygosity unbiased expected heterozygosity and fixation indexfor the three populations

Population I 119867119900

119867119890

u119867119890

119865ST

ANRMean 0513 0257 0315 0325 0205SE 0066 0060 0041 0043 0110

WCTMean 0708 0339 0427 0440 0244SE 0061 0052 0037 0038 0092

BDKMean 0712 0284 0428 0442 0372SE 0062 0057 0035 0036 0105

I = Shannonrsquos Information Index = minus1 lowast Sum (pi lowast Ln (pi))119867119900 = observed heterozygosity = Number of HetsN119867119890 = expected heterozygosity = 1 minus Sum piand2u119867119890 = unbiased expected heterozygosity = (2N(2N minus 1)) lowast119867119890F = fixation index = (119867119890 minus 119867119900)119867119890 = 1 minus (119867119900119867119890)where pi is the frequency of the ith allele for the population and Sum piand2 isthe sum of the squared population allele frequencies

Table 3 Pairwise population matrix of Neirsquos genetic identity

ANR WCT BDK1000 ANR0920 1000 WCT0783 0869 1000 BDK

Table 4 Analysis of molecular variance in the coconut populations

Source df SS MS Est Var Among pops 2 176652 88326 4330 21Within pops 47 760768 16187 16187 79Total 49 937420 20517 100

and breadth of the country has resulted in developmentof many ecotypes which are generally named or knownby the location where they are grown These ecotypes arelikely to have developed certain adaptation to the particularenvironment conditions in which they have been growing fora long time and possess a rich source of valuable genes forcoconut breeding It is important to identify and conservethese ecotypes which could withstand the vagaries of natureand still perform better in terms of growth and yield

West Coast Tall (WCT) coconut population developed onthe West coast of India and came to be known by the regionwhere it was cultivated Though the origin of WCT is nottraceable to any area from where it spread it is obvious thatsea journey by nuts was involved in its spread The cultivarover the yearsmoved from coastal region to the interior areaswhich also resulted in further adaptation and diversity in thecultivar Such adapted WCT populations in certain localitiesare designated with local names by farmers to differentiateit from other WCT populations Annur Bedakam KuttiyadiAttingal and Kanjirappally are some of these The variabilityshown byWCTand ecotypes derived from itmight be geneticor due to physiological factors such as climatic change

Principal coordinates

West CoastTall

Annur Bedakam

Coord 1

Coo

rd 2

Figure 2 Diagram of PCA based on Neirsquos genetic distance

pH of the soil annual rainfall or any other environmentalfactors or even human involvement These coconut ecotypesmay possess higher variability which might be an importantsource for plant breeding in comparison to the presentday cultivars which have been specifically chosen for theirgrowth performance under certain specific environment

Molecularmarkers play an important role in conservationand use of plant genetic resources Molecular markers arerelatively independent of environment DNA-based markersare a way of exploring the genetic relations between pop-ulations and these markers have acted as versatile tools invarious fields Among the various molecular markers cur-rently available microsatellite markers are the most popularbecause they are reproducible enabling their parallel analysisin different laboratories and exchange of the resulting data[28] Also microsatellites form an ideal marker system cre-ating complex banding patterns by simultaneously detectingmultiple DNA loci They have been used successfully bymany researchers to characterize the genetic diversity of thecoconut population [18 21]

With the objective of deciphering the diversity amongand within WCT populations from Kerala region in thepresent study Annur and ecotypes were comparedwithWCTpopulations using SSRs On clustering it was found that thetwo ecotypes and WCT formed two major clusters AnnurBedakam and WCT grouped separately in general with afew palms showing intergroup affinity However most of theBedakampalmswere grouped in separate cluster proving thatAnnur andBedakamecotypeswere two separate populationsIt is also evident from the clustering that Annur ecotypewas closer to WCT than to Bedakam ecotype Pair-wisepopulation matrix of Neirsquos genetic identity also revealeda higher average identity between ANR and WCT thanbetween WCT and BDK and ANR and BDK

The comparison of average observed and expected het-erozygosity values did not show great differences between thethree coconut populations studied All the three populationsdisplayed smaller observed than expected heterozygosities-inbreeding may be a factor contributing to this Among thethree populations palms of ANR ecotype displayed moregenetic similarity amongst themselves with lower observedheterozygosity and fixation index (119865ST) compared to the othertwo populations

The values of heterozygosities obtained in this studyconfirm that the coconut ecotypes represent an importantreservoir of genetic diversity The three populations showed

6 International Journal of Biodiversity

significant genetic differentiation as indicated by 119865ST valuesindicating that a high level of differentiation for the alleleshas occurred in members of the subpopulation comparedto the total population and therefore members of thesubpopulation tend to carry unique alleles compared tothe total population The among population variation wasmore than within population variation based on AMOVAcalculations suggesting very rare genetic exchange betweenthe populations at least in recent history

Diversity in the original WCT population allowed itto spread in to different ecoregions resulting in the evo-lution of ecotypes suitable for the local environment andits subsequent adaptation The result of molecular charac-terization revealed significant differences in midland andcoastal growing palms The WCT and ecotypes might havediffered due to genetic factors or adaptation resulting fromenvironmental variations like climatic change pH of the soilannual rainfall or any other environmental factors or evenhuman interventions

One of the important prerequisites for evolutionarychange is genetic variation as in its absence populationslack the capacity to evolve Within a single species naturalselection coupled with heterogeneity in its habitat mightresult in multiple ecotypes which are genetically distinct[29] The total genetic variation of a species is likely to bedistributed among populations as the impact and directionof natural selection varies from one to another due toenvironmental variation and genetic drift [30] Thereforewith germplasm conservation programmes it is imperativeto accurately measure the amount of genetic diversity and itsdistribution within and between populations To these endsmolecularmarkers provide an efficient and unbiased estimateof these statistics free of environment effects Molecularcharacterization of genetic diversity provides base informa-tion which could be utilized in selection of a promisingrange of accessions for different breeding programs Themicrosatellites used in this study appeared to possess asignificant potential in this respect This is one of the firststudies to probe the diversity of coconut ecotypes usingmolecular markers The results of this study may be used indeveloping a strategy for conservation of these ecotypes andtheir utilization in future coconut breeding programmes

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Director CPCRI Kasaragod for hisguidance and facilities provided The authors also thank thefarmers and extension personnel from Annur and Bedakamfor their cooperation

References

[1] L H Jones ldquoPerennial vegetable oil cropsrdquo in AgriculturalBiotechnology Opportunities for International Development pp213ndash224 CAB International Wallingford UK 1990

[2] J G Ohler ldquoCoconut a tree of liferdquo Plant Production andProtection Paper 1984

[3] D V Liyanage ldquoPreliminary studies on the floral biology of thecoconut palmrdquo Tropical Agriculture vol 105 pp 171ndash175 1949

[4] K Satyabalan ldquoYield variation in west coast tall coconut palmsyield attributes which cause variation in annual yield of nuts inthe palms of different yield groupsrdquo Indian Coconut Journal vol1 pp 5ndash8 1993

[5] P Coomans ldquoInfluence of climate factors on seasonal fluctua-tions of coconut productionrdquoOleagineux vol 30 no 4 pp 153ndash157 1975

[6] D B Murray ldquoCoconut palmrdquo in Ecophysiology of TropicalCrops P T Alvin and T T Kozlowski Eds pp 24ndash27 AcademicPress New York NY USA 1977

[7] K V Kasturi Bai and A Ramadasan ldquoChanges in the levelsof carbohydrates as a function of environmental variablesin hybrids and tall coconut palmrdquo in Coconut Research andDevelopment N M Nair Ed pp 203ndash209 Wiley Eastern NewDelhi India 1983

[8] V Rajagopal A Ramadasan K V Kasturi Bai and D Bal-asimha ldquoInfluence of irrigation on leaf water relations and drymatter production in coconut palmsrdquo Irrigation Science vol 10no 1 pp 73ndash81 1989

[9] K V Kasturi Bai V Rajagopal C D Prabha M J Ratnambaland M V George ldquoEvaluation of coconut cutivars and hybridsfor dry matter productionrdquo Journal of Plantation Crops vol 24pp 23ndash28 1996

[10] C Jayasekara N P A D Nainanayake and K S JayasekaraldquoPhotosythetic characteristic and productivity of coconutpalmrdquo Journal of Plantation Crops vol 24 pp 538ndash547 1996

[11] K N Krishna Kumar Coconut phenology and yield response toclimate variability and change [PhD thesis] Cochin Universityof Science and Technology Kerala India 2011

[12] K Ganesamurthy C Natarajan and M JayaramachandranldquoGenetic diversity and its exploitation in coconut improve-mentrdquo in Proceedings of the National Conference on Agro-Biodiversity Conducted by National Biodiversity AuthorityChennai February 2006

[13] U Parthasarathy A comparative study of coconut cultivation incoastal and inland River Plain Ecosystem of Kasaragod Districtof Kerala and Kamrup District of Assam [PhD thesis] GauhatiUniversity Assam India 2004

[14] A H D Brown ldquoIsozymes plant population genetic structureand genetic conservationrdquoTheoretical and Applied Genetics vol52 no 4 pp 145ndash157 1978

[15] G R Ashburner W K Thompson G M Halloran and M AFoale ldquoFruit component analysis of south pacific coconut palmpopulationsrdquo Genetic Resources and Crop Evolution vol 44 no4 pp 327ndash335 1997

[16] C Schlotterer and D Tautz ldquoSlippage synthesis of simplesequence DNArdquo Nucleic Acids Research vol 20 no 2 pp 211ndash215 1992

[17] R Rivera K J Edwards J H A Barker et al ldquoIsolationand characterization of polymorphic microsatellites in Cocosnucifera Lrdquo Genome vol 42 no 4 pp 668ndash675 1999

International Journal of Biodiversity 7

[18] B Teulat C Aldam R Trehin et al ldquoAn analysis of geneticdiversity in coconut (Cocos nucifera) populations from acrossthe geographic range using sequence-tagged microsatellites(SSRs) and AFLPsrdquo Theoretical and Applied Genetics vol 100no 5 pp 764ndash771 2000

[19] L Perera J R Russell J Provan and W Powell ldquoUse ofmicrosatellite DNA markers to investigate the level of geneticdiversity and population genetic structure of coconut (Cocosnucifera L)rdquo Genome vol 43 no 1 pp 15ndash21 2000

[20] M K Rajesh P Nagarajan B A Jerard V Arunachalam andR Dhanapal ldquoMicrosatellite variability of coconut accessions(Cocos nucifera L) from Andaman and Nicobar Islandsrdquo Cur-rent Science vol 94 no 12 pp 1627ndash1631 2008

[21] C Remany Cataloging and categorization of unexploited eco-types of coconut grown in Kerala [PhD thesis] MahatmaGandhi University Kerala India 2003

[22] M K Rajesh B A Jerard P Preethi et al ldquoDevelopment ofa RAPD-derived SCAR marker associated with tall-type palmtrait in coconutrdquo Scientia Horticulturae vol 150 no 4 pp 312ndash316 2013

[23] J Sambrook E F Fritsch and T Maniatis Cloning A Labora-tory Manual Cold Spring Harbor laboratory 1989

[24] L Dice ldquoMeasures of the amount of ecologic associationbetween speciesrdquo Ecology vol 26 pp 297ndash302 1945

[25] F J Rohlf ldquoNTSYS-pc numerical taxonomy and multivariateanalysis system version 20 owner manualrdquo 1997

[26] P H A Sneath and R R SokalNumerical TaxonomyThe Prin-ciples and Practice of Numerical Classification W H FreemanSan Francisco Calif USA 1973

[27] R Peakall and P E Smouse ldquoGenAlEx 65 genetic analysis inexcel Population genetic software for teaching and research-anupdaterdquo Bioinformatics vol 28 pp 2537ndash2539 2012

[28] P K Gupta H S Balyan P C Sharma and B RameshldquoMicrosatellites in plants a new class of molecular markersrdquoCurrent Science vol 70 no 1 pp 45ndash54 1996

[29] Y B Linhart and M C Grant ldquoEvolutionary significance oflocal genetic differentiation in plantsrdquoAnnual Review of Ecologyand Systematics vol 27 pp 237ndash277 1996

[30] M J Lawrence and N Rajanaidu ldquoThe genetic structure ofnatural populations and sampling strategyrdquo in Proceedings of theInternationalWorkshop onOil PalmGermplasm andUtilizationpp 15ndash26 Selangor Malaysia 1985

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

4 International Journal of Biodiversity

Coefficient055 066 078 089 100

ANRI ANR2 ANR8 ANR5 ANR6 ANR3 ANR4 ANR7 ANR10 ANR9 ANR11 ANR12 WCT10 BDK1 WCT2 WCT3 ANR13 ANR14 ANR15 ANR16 ANR17 WCT4 WCT6 WCT1 WCT5 WCT7 WCT9 WCT15 WCT11 WCT16 WCT17 WCT12 WCT13 WCT14 BDK2 BDK4 BDK3 BDK5 BDK6 WCT8 BDK7 BDK10 BDK11 BDK9 BDK8 BDK12 BDK13 BDK14 BDK16 BDK15

Figure 1 UPGMA phylogenetic tree constructed based on Dicersquos coefficient showing the genetic relationships among the three coconutpopulations

closer to WCT than BDK ecotype When the populationswere considered individually WCT palms clustered at 61similarity ANR palms at 70 similarity and BDK palms at58 similarity

Population-wise mean Shannonrsquos Information Indexranged from 0513 (ANR) to 0712 (BDK) and the meanobserved heterozygosity from 0257 (ANR) to 0339 (BDK)(Table 2) The mean unbiased expected heterozygosity (uHe)ranged from 0325 (ANR) to 0442 (BDK) Mean fixationindex (119865ST) ranged from 0205 to 0372 (Table 2) Pair-wise population matrix of Neirsquos genetic identity calculatedusing GenAlEx program showed a higher average identitybetween ANR andWCT (092) than betweenWCT and BDK(0869) and ANR and BDK (0783) (Table 3) The AMOVAestimation based on 99 permutations using GenAlEx showeda significant (119875 = 001) within population variation (79)compared to among population variation (21) (Table 4)

For a deeper understanding of the clustering patternof the coconut populations we also carried out geneticdistance-based principal component analysis (PCA) usingGenAlExThe results showed clear segregation of all the threepopulations into different quadrates of the PCA (Figure 2)The first and second axes accounted for 8513 and 1487 ofthe total inertia respectively As shown in Figure 2 the firstaxis separated BDK from the other two populations while thesecond axis separated WCT from the other two populations

4 Discussion

Ecotypes are groups of similar populations within the sameplant species that are adapted to certain climatic and edaphicconditions Coconut has been cultivated for centuries inIndia and the long history of its cultivation along the length

International Journal of Biodiversity 5

Table 2 Shannonrsquos Information Index expected and observedheterozygosity unbiased expected heterozygosity and fixation indexfor the three populations

Population I 119867119900

119867119890

u119867119890

119865ST

ANRMean 0513 0257 0315 0325 0205SE 0066 0060 0041 0043 0110

WCTMean 0708 0339 0427 0440 0244SE 0061 0052 0037 0038 0092

BDKMean 0712 0284 0428 0442 0372SE 0062 0057 0035 0036 0105

I = Shannonrsquos Information Index = minus1 lowast Sum (pi lowast Ln (pi))119867119900 = observed heterozygosity = Number of HetsN119867119890 = expected heterozygosity = 1 minus Sum piand2u119867119890 = unbiased expected heterozygosity = (2N(2N minus 1)) lowast119867119890F = fixation index = (119867119890 minus 119867119900)119867119890 = 1 minus (119867119900119867119890)where pi is the frequency of the ith allele for the population and Sum piand2 isthe sum of the squared population allele frequencies

Table 3 Pairwise population matrix of Neirsquos genetic identity

ANR WCT BDK1000 ANR0920 1000 WCT0783 0869 1000 BDK

Table 4 Analysis of molecular variance in the coconut populations

Source df SS MS Est Var Among pops 2 176652 88326 4330 21Within pops 47 760768 16187 16187 79Total 49 937420 20517 100

and breadth of the country has resulted in developmentof many ecotypes which are generally named or knownby the location where they are grown These ecotypes arelikely to have developed certain adaptation to the particularenvironment conditions in which they have been growing fora long time and possess a rich source of valuable genes forcoconut breeding It is important to identify and conservethese ecotypes which could withstand the vagaries of natureand still perform better in terms of growth and yield

West Coast Tall (WCT) coconut population developed onthe West coast of India and came to be known by the regionwhere it was cultivated Though the origin of WCT is nottraceable to any area from where it spread it is obvious thatsea journey by nuts was involved in its spread The cultivarover the yearsmoved from coastal region to the interior areaswhich also resulted in further adaptation and diversity in thecultivar Such adapted WCT populations in certain localitiesare designated with local names by farmers to differentiateit from other WCT populations Annur Bedakam KuttiyadiAttingal and Kanjirappally are some of these The variabilityshown byWCTand ecotypes derived from itmight be geneticor due to physiological factors such as climatic change

Principal coordinates

West CoastTall

Annur Bedakam

Coord 1

Coo

rd 2

Figure 2 Diagram of PCA based on Neirsquos genetic distance

pH of the soil annual rainfall or any other environmentalfactors or even human involvement These coconut ecotypesmay possess higher variability which might be an importantsource for plant breeding in comparison to the presentday cultivars which have been specifically chosen for theirgrowth performance under certain specific environment

Molecularmarkers play an important role in conservationand use of plant genetic resources Molecular markers arerelatively independent of environment DNA-based markersare a way of exploring the genetic relations between pop-ulations and these markers have acted as versatile tools invarious fields Among the various molecular markers cur-rently available microsatellite markers are the most popularbecause they are reproducible enabling their parallel analysisin different laboratories and exchange of the resulting data[28] Also microsatellites form an ideal marker system cre-ating complex banding patterns by simultaneously detectingmultiple DNA loci They have been used successfully bymany researchers to characterize the genetic diversity of thecoconut population [18 21]

With the objective of deciphering the diversity amongand within WCT populations from Kerala region in thepresent study Annur and ecotypes were comparedwithWCTpopulations using SSRs On clustering it was found that thetwo ecotypes and WCT formed two major clusters AnnurBedakam and WCT grouped separately in general with afew palms showing intergroup affinity However most of theBedakampalmswere grouped in separate cluster proving thatAnnur andBedakamecotypeswere two separate populationsIt is also evident from the clustering that Annur ecotypewas closer to WCT than to Bedakam ecotype Pair-wisepopulation matrix of Neirsquos genetic identity also revealeda higher average identity between ANR and WCT thanbetween WCT and BDK and ANR and BDK

The comparison of average observed and expected het-erozygosity values did not show great differences between thethree coconut populations studied All the three populationsdisplayed smaller observed than expected heterozygosities-inbreeding may be a factor contributing to this Among thethree populations palms of ANR ecotype displayed moregenetic similarity amongst themselves with lower observedheterozygosity and fixation index (119865ST) compared to the othertwo populations

The values of heterozygosities obtained in this studyconfirm that the coconut ecotypes represent an importantreservoir of genetic diversity The three populations showed

6 International Journal of Biodiversity

significant genetic differentiation as indicated by 119865ST valuesindicating that a high level of differentiation for the alleleshas occurred in members of the subpopulation comparedto the total population and therefore members of thesubpopulation tend to carry unique alleles compared tothe total population The among population variation wasmore than within population variation based on AMOVAcalculations suggesting very rare genetic exchange betweenthe populations at least in recent history

Diversity in the original WCT population allowed itto spread in to different ecoregions resulting in the evo-lution of ecotypes suitable for the local environment andits subsequent adaptation The result of molecular charac-terization revealed significant differences in midland andcoastal growing palms The WCT and ecotypes might havediffered due to genetic factors or adaptation resulting fromenvironmental variations like climatic change pH of the soilannual rainfall or any other environmental factors or evenhuman interventions

One of the important prerequisites for evolutionarychange is genetic variation as in its absence populationslack the capacity to evolve Within a single species naturalselection coupled with heterogeneity in its habitat mightresult in multiple ecotypes which are genetically distinct[29] The total genetic variation of a species is likely to bedistributed among populations as the impact and directionof natural selection varies from one to another due toenvironmental variation and genetic drift [30] Thereforewith germplasm conservation programmes it is imperativeto accurately measure the amount of genetic diversity and itsdistribution within and between populations To these endsmolecularmarkers provide an efficient and unbiased estimateof these statistics free of environment effects Molecularcharacterization of genetic diversity provides base informa-tion which could be utilized in selection of a promisingrange of accessions for different breeding programs Themicrosatellites used in this study appeared to possess asignificant potential in this respect This is one of the firststudies to probe the diversity of coconut ecotypes usingmolecular markers The results of this study may be used indeveloping a strategy for conservation of these ecotypes andtheir utilization in future coconut breeding programmes

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Director CPCRI Kasaragod for hisguidance and facilities provided The authors also thank thefarmers and extension personnel from Annur and Bedakamfor their cooperation

References

[1] L H Jones ldquoPerennial vegetable oil cropsrdquo in AgriculturalBiotechnology Opportunities for International Development pp213ndash224 CAB International Wallingford UK 1990

[2] J G Ohler ldquoCoconut a tree of liferdquo Plant Production andProtection Paper 1984

[3] D V Liyanage ldquoPreliminary studies on the floral biology of thecoconut palmrdquo Tropical Agriculture vol 105 pp 171ndash175 1949

[4] K Satyabalan ldquoYield variation in west coast tall coconut palmsyield attributes which cause variation in annual yield of nuts inthe palms of different yield groupsrdquo Indian Coconut Journal vol1 pp 5ndash8 1993

[5] P Coomans ldquoInfluence of climate factors on seasonal fluctua-tions of coconut productionrdquoOleagineux vol 30 no 4 pp 153ndash157 1975

[6] D B Murray ldquoCoconut palmrdquo in Ecophysiology of TropicalCrops P T Alvin and T T Kozlowski Eds pp 24ndash27 AcademicPress New York NY USA 1977

[7] K V Kasturi Bai and A Ramadasan ldquoChanges in the levelsof carbohydrates as a function of environmental variablesin hybrids and tall coconut palmrdquo in Coconut Research andDevelopment N M Nair Ed pp 203ndash209 Wiley Eastern NewDelhi India 1983

[8] V Rajagopal A Ramadasan K V Kasturi Bai and D Bal-asimha ldquoInfluence of irrigation on leaf water relations and drymatter production in coconut palmsrdquo Irrigation Science vol 10no 1 pp 73ndash81 1989

[9] K V Kasturi Bai V Rajagopal C D Prabha M J Ratnambaland M V George ldquoEvaluation of coconut cutivars and hybridsfor dry matter productionrdquo Journal of Plantation Crops vol 24pp 23ndash28 1996

[10] C Jayasekara N P A D Nainanayake and K S JayasekaraldquoPhotosythetic characteristic and productivity of coconutpalmrdquo Journal of Plantation Crops vol 24 pp 538ndash547 1996

[11] K N Krishna Kumar Coconut phenology and yield response toclimate variability and change [PhD thesis] Cochin Universityof Science and Technology Kerala India 2011

[12] K Ganesamurthy C Natarajan and M JayaramachandranldquoGenetic diversity and its exploitation in coconut improve-mentrdquo in Proceedings of the National Conference on Agro-Biodiversity Conducted by National Biodiversity AuthorityChennai February 2006

[13] U Parthasarathy A comparative study of coconut cultivation incoastal and inland River Plain Ecosystem of Kasaragod Districtof Kerala and Kamrup District of Assam [PhD thesis] GauhatiUniversity Assam India 2004

[14] A H D Brown ldquoIsozymes plant population genetic structureand genetic conservationrdquoTheoretical and Applied Genetics vol52 no 4 pp 145ndash157 1978

[15] G R Ashburner W K Thompson G M Halloran and M AFoale ldquoFruit component analysis of south pacific coconut palmpopulationsrdquo Genetic Resources and Crop Evolution vol 44 no4 pp 327ndash335 1997

[16] C Schlotterer and D Tautz ldquoSlippage synthesis of simplesequence DNArdquo Nucleic Acids Research vol 20 no 2 pp 211ndash215 1992

[17] R Rivera K J Edwards J H A Barker et al ldquoIsolationand characterization of polymorphic microsatellites in Cocosnucifera Lrdquo Genome vol 42 no 4 pp 668ndash675 1999

International Journal of Biodiversity 7

[18] B Teulat C Aldam R Trehin et al ldquoAn analysis of geneticdiversity in coconut (Cocos nucifera) populations from acrossthe geographic range using sequence-tagged microsatellites(SSRs) and AFLPsrdquo Theoretical and Applied Genetics vol 100no 5 pp 764ndash771 2000

[19] L Perera J R Russell J Provan and W Powell ldquoUse ofmicrosatellite DNA markers to investigate the level of geneticdiversity and population genetic structure of coconut (Cocosnucifera L)rdquo Genome vol 43 no 1 pp 15ndash21 2000

[20] M K Rajesh P Nagarajan B A Jerard V Arunachalam andR Dhanapal ldquoMicrosatellite variability of coconut accessions(Cocos nucifera L) from Andaman and Nicobar Islandsrdquo Cur-rent Science vol 94 no 12 pp 1627ndash1631 2008

[21] C Remany Cataloging and categorization of unexploited eco-types of coconut grown in Kerala [PhD thesis] MahatmaGandhi University Kerala India 2003

[22] M K Rajesh B A Jerard P Preethi et al ldquoDevelopment ofa RAPD-derived SCAR marker associated with tall-type palmtrait in coconutrdquo Scientia Horticulturae vol 150 no 4 pp 312ndash316 2013

[23] J Sambrook E F Fritsch and T Maniatis Cloning A Labora-tory Manual Cold Spring Harbor laboratory 1989

[24] L Dice ldquoMeasures of the amount of ecologic associationbetween speciesrdquo Ecology vol 26 pp 297ndash302 1945

[25] F J Rohlf ldquoNTSYS-pc numerical taxonomy and multivariateanalysis system version 20 owner manualrdquo 1997

[26] P H A Sneath and R R SokalNumerical TaxonomyThe Prin-ciples and Practice of Numerical Classification W H FreemanSan Francisco Calif USA 1973

[27] R Peakall and P E Smouse ldquoGenAlEx 65 genetic analysis inexcel Population genetic software for teaching and research-anupdaterdquo Bioinformatics vol 28 pp 2537ndash2539 2012

[28] P K Gupta H S Balyan P C Sharma and B RameshldquoMicrosatellites in plants a new class of molecular markersrdquoCurrent Science vol 70 no 1 pp 45ndash54 1996

[29] Y B Linhart and M C Grant ldquoEvolutionary significance oflocal genetic differentiation in plantsrdquoAnnual Review of Ecologyand Systematics vol 27 pp 237ndash277 1996

[30] M J Lawrence and N Rajanaidu ldquoThe genetic structure ofnatural populations and sampling strategyrdquo in Proceedings of theInternationalWorkshop onOil PalmGermplasm andUtilizationpp 15ndash26 Selangor Malaysia 1985

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

International Journal of Biodiversity 5

Table 2 Shannonrsquos Information Index expected and observedheterozygosity unbiased expected heterozygosity and fixation indexfor the three populations

Population I 119867119900

119867119890

u119867119890

119865ST

ANRMean 0513 0257 0315 0325 0205SE 0066 0060 0041 0043 0110

WCTMean 0708 0339 0427 0440 0244SE 0061 0052 0037 0038 0092

BDKMean 0712 0284 0428 0442 0372SE 0062 0057 0035 0036 0105

I = Shannonrsquos Information Index = minus1 lowast Sum (pi lowast Ln (pi))119867119900 = observed heterozygosity = Number of HetsN119867119890 = expected heterozygosity = 1 minus Sum piand2u119867119890 = unbiased expected heterozygosity = (2N(2N minus 1)) lowast119867119890F = fixation index = (119867119890 minus 119867119900)119867119890 = 1 minus (119867119900119867119890)where pi is the frequency of the ith allele for the population and Sum piand2 isthe sum of the squared population allele frequencies

Table 3 Pairwise population matrix of Neirsquos genetic identity

ANR WCT BDK1000 ANR0920 1000 WCT0783 0869 1000 BDK

Table 4 Analysis of molecular variance in the coconut populations

Source df SS MS Est Var Among pops 2 176652 88326 4330 21Within pops 47 760768 16187 16187 79Total 49 937420 20517 100

and breadth of the country has resulted in developmentof many ecotypes which are generally named or knownby the location where they are grown These ecotypes arelikely to have developed certain adaptation to the particularenvironment conditions in which they have been growing fora long time and possess a rich source of valuable genes forcoconut breeding It is important to identify and conservethese ecotypes which could withstand the vagaries of natureand still perform better in terms of growth and yield

West Coast Tall (WCT) coconut population developed onthe West coast of India and came to be known by the regionwhere it was cultivated Though the origin of WCT is nottraceable to any area from where it spread it is obvious thatsea journey by nuts was involved in its spread The cultivarover the yearsmoved from coastal region to the interior areaswhich also resulted in further adaptation and diversity in thecultivar Such adapted WCT populations in certain localitiesare designated with local names by farmers to differentiateit from other WCT populations Annur Bedakam KuttiyadiAttingal and Kanjirappally are some of these The variabilityshown byWCTand ecotypes derived from itmight be geneticor due to physiological factors such as climatic change

Principal coordinates

West CoastTall

Annur Bedakam

Coord 1

Coo

rd 2

Figure 2 Diagram of PCA based on Neirsquos genetic distance

pH of the soil annual rainfall or any other environmentalfactors or even human involvement These coconut ecotypesmay possess higher variability which might be an importantsource for plant breeding in comparison to the presentday cultivars which have been specifically chosen for theirgrowth performance under certain specific environment

Molecularmarkers play an important role in conservationand use of plant genetic resources Molecular markers arerelatively independent of environment DNA-based markersare a way of exploring the genetic relations between pop-ulations and these markers have acted as versatile tools invarious fields Among the various molecular markers cur-rently available microsatellite markers are the most popularbecause they are reproducible enabling their parallel analysisin different laboratories and exchange of the resulting data[28] Also microsatellites form an ideal marker system cre-ating complex banding patterns by simultaneously detectingmultiple DNA loci They have been used successfully bymany researchers to characterize the genetic diversity of thecoconut population [18 21]

With the objective of deciphering the diversity amongand within WCT populations from Kerala region in thepresent study Annur and ecotypes were comparedwithWCTpopulations using SSRs On clustering it was found that thetwo ecotypes and WCT formed two major clusters AnnurBedakam and WCT grouped separately in general with afew palms showing intergroup affinity However most of theBedakampalmswere grouped in separate cluster proving thatAnnur andBedakamecotypeswere two separate populationsIt is also evident from the clustering that Annur ecotypewas closer to WCT than to Bedakam ecotype Pair-wisepopulation matrix of Neirsquos genetic identity also revealeda higher average identity between ANR and WCT thanbetween WCT and BDK and ANR and BDK

The comparison of average observed and expected het-erozygosity values did not show great differences between thethree coconut populations studied All the three populationsdisplayed smaller observed than expected heterozygosities-inbreeding may be a factor contributing to this Among thethree populations palms of ANR ecotype displayed moregenetic similarity amongst themselves with lower observedheterozygosity and fixation index (119865ST) compared to the othertwo populations

The values of heterozygosities obtained in this studyconfirm that the coconut ecotypes represent an importantreservoir of genetic diversity The three populations showed

6 International Journal of Biodiversity

significant genetic differentiation as indicated by 119865ST valuesindicating that a high level of differentiation for the alleleshas occurred in members of the subpopulation comparedto the total population and therefore members of thesubpopulation tend to carry unique alleles compared tothe total population The among population variation wasmore than within population variation based on AMOVAcalculations suggesting very rare genetic exchange betweenthe populations at least in recent history

Diversity in the original WCT population allowed itto spread in to different ecoregions resulting in the evo-lution of ecotypes suitable for the local environment andits subsequent adaptation The result of molecular charac-terization revealed significant differences in midland andcoastal growing palms The WCT and ecotypes might havediffered due to genetic factors or adaptation resulting fromenvironmental variations like climatic change pH of the soilannual rainfall or any other environmental factors or evenhuman interventions

One of the important prerequisites for evolutionarychange is genetic variation as in its absence populationslack the capacity to evolve Within a single species naturalselection coupled with heterogeneity in its habitat mightresult in multiple ecotypes which are genetically distinct[29] The total genetic variation of a species is likely to bedistributed among populations as the impact and directionof natural selection varies from one to another due toenvironmental variation and genetic drift [30] Thereforewith germplasm conservation programmes it is imperativeto accurately measure the amount of genetic diversity and itsdistribution within and between populations To these endsmolecularmarkers provide an efficient and unbiased estimateof these statistics free of environment effects Molecularcharacterization of genetic diversity provides base informa-tion which could be utilized in selection of a promisingrange of accessions for different breeding programs Themicrosatellites used in this study appeared to possess asignificant potential in this respect This is one of the firststudies to probe the diversity of coconut ecotypes usingmolecular markers The results of this study may be used indeveloping a strategy for conservation of these ecotypes andtheir utilization in future coconut breeding programmes

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Director CPCRI Kasaragod for hisguidance and facilities provided The authors also thank thefarmers and extension personnel from Annur and Bedakamfor their cooperation

References

[1] L H Jones ldquoPerennial vegetable oil cropsrdquo in AgriculturalBiotechnology Opportunities for International Development pp213ndash224 CAB International Wallingford UK 1990

[2] J G Ohler ldquoCoconut a tree of liferdquo Plant Production andProtection Paper 1984

[3] D V Liyanage ldquoPreliminary studies on the floral biology of thecoconut palmrdquo Tropical Agriculture vol 105 pp 171ndash175 1949

[4] K Satyabalan ldquoYield variation in west coast tall coconut palmsyield attributes which cause variation in annual yield of nuts inthe palms of different yield groupsrdquo Indian Coconut Journal vol1 pp 5ndash8 1993

[5] P Coomans ldquoInfluence of climate factors on seasonal fluctua-tions of coconut productionrdquoOleagineux vol 30 no 4 pp 153ndash157 1975

[6] D B Murray ldquoCoconut palmrdquo in Ecophysiology of TropicalCrops P T Alvin and T T Kozlowski Eds pp 24ndash27 AcademicPress New York NY USA 1977

[7] K V Kasturi Bai and A Ramadasan ldquoChanges in the levelsof carbohydrates as a function of environmental variablesin hybrids and tall coconut palmrdquo in Coconut Research andDevelopment N M Nair Ed pp 203ndash209 Wiley Eastern NewDelhi India 1983

[8] V Rajagopal A Ramadasan K V Kasturi Bai and D Bal-asimha ldquoInfluence of irrigation on leaf water relations and drymatter production in coconut palmsrdquo Irrigation Science vol 10no 1 pp 73ndash81 1989

[9] K V Kasturi Bai V Rajagopal C D Prabha M J Ratnambaland M V George ldquoEvaluation of coconut cutivars and hybridsfor dry matter productionrdquo Journal of Plantation Crops vol 24pp 23ndash28 1996

[10] C Jayasekara N P A D Nainanayake and K S JayasekaraldquoPhotosythetic characteristic and productivity of coconutpalmrdquo Journal of Plantation Crops vol 24 pp 538ndash547 1996

[11] K N Krishna Kumar Coconut phenology and yield response toclimate variability and change [PhD thesis] Cochin Universityof Science and Technology Kerala India 2011

[12] K Ganesamurthy C Natarajan and M JayaramachandranldquoGenetic diversity and its exploitation in coconut improve-mentrdquo in Proceedings of the National Conference on Agro-Biodiversity Conducted by National Biodiversity AuthorityChennai February 2006

[13] U Parthasarathy A comparative study of coconut cultivation incoastal and inland River Plain Ecosystem of Kasaragod Districtof Kerala and Kamrup District of Assam [PhD thesis] GauhatiUniversity Assam India 2004

[14] A H D Brown ldquoIsozymes plant population genetic structureand genetic conservationrdquoTheoretical and Applied Genetics vol52 no 4 pp 145ndash157 1978

[15] G R Ashburner W K Thompson G M Halloran and M AFoale ldquoFruit component analysis of south pacific coconut palmpopulationsrdquo Genetic Resources and Crop Evolution vol 44 no4 pp 327ndash335 1997

[16] C Schlotterer and D Tautz ldquoSlippage synthesis of simplesequence DNArdquo Nucleic Acids Research vol 20 no 2 pp 211ndash215 1992

[17] R Rivera K J Edwards J H A Barker et al ldquoIsolationand characterization of polymorphic microsatellites in Cocosnucifera Lrdquo Genome vol 42 no 4 pp 668ndash675 1999

International Journal of Biodiversity 7

[18] B Teulat C Aldam R Trehin et al ldquoAn analysis of geneticdiversity in coconut (Cocos nucifera) populations from acrossthe geographic range using sequence-tagged microsatellites(SSRs) and AFLPsrdquo Theoretical and Applied Genetics vol 100no 5 pp 764ndash771 2000

[19] L Perera J R Russell J Provan and W Powell ldquoUse ofmicrosatellite DNA markers to investigate the level of geneticdiversity and population genetic structure of coconut (Cocosnucifera L)rdquo Genome vol 43 no 1 pp 15ndash21 2000

[20] M K Rajesh P Nagarajan B A Jerard V Arunachalam andR Dhanapal ldquoMicrosatellite variability of coconut accessions(Cocos nucifera L) from Andaman and Nicobar Islandsrdquo Cur-rent Science vol 94 no 12 pp 1627ndash1631 2008

[21] C Remany Cataloging and categorization of unexploited eco-types of coconut grown in Kerala [PhD thesis] MahatmaGandhi University Kerala India 2003

[22] M K Rajesh B A Jerard P Preethi et al ldquoDevelopment ofa RAPD-derived SCAR marker associated with tall-type palmtrait in coconutrdquo Scientia Horticulturae vol 150 no 4 pp 312ndash316 2013

[23] J Sambrook E F Fritsch and T Maniatis Cloning A Labora-tory Manual Cold Spring Harbor laboratory 1989

[24] L Dice ldquoMeasures of the amount of ecologic associationbetween speciesrdquo Ecology vol 26 pp 297ndash302 1945

[25] F J Rohlf ldquoNTSYS-pc numerical taxonomy and multivariateanalysis system version 20 owner manualrdquo 1997

[26] P H A Sneath and R R SokalNumerical TaxonomyThe Prin-ciples and Practice of Numerical Classification W H FreemanSan Francisco Calif USA 1973

[27] R Peakall and P E Smouse ldquoGenAlEx 65 genetic analysis inexcel Population genetic software for teaching and research-anupdaterdquo Bioinformatics vol 28 pp 2537ndash2539 2012

[28] P K Gupta H S Balyan P C Sharma and B RameshldquoMicrosatellites in plants a new class of molecular markersrdquoCurrent Science vol 70 no 1 pp 45ndash54 1996

[29] Y B Linhart and M C Grant ldquoEvolutionary significance oflocal genetic differentiation in plantsrdquoAnnual Review of Ecologyand Systematics vol 27 pp 237ndash277 1996

[30] M J Lawrence and N Rajanaidu ldquoThe genetic structure ofnatural populations and sampling strategyrdquo in Proceedings of theInternationalWorkshop onOil PalmGermplasm andUtilizationpp 15ndash26 Selangor Malaysia 1985

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

6 International Journal of Biodiversity

significant genetic differentiation as indicated by 119865ST valuesindicating that a high level of differentiation for the alleleshas occurred in members of the subpopulation comparedto the total population and therefore members of thesubpopulation tend to carry unique alleles compared tothe total population The among population variation wasmore than within population variation based on AMOVAcalculations suggesting very rare genetic exchange betweenthe populations at least in recent history

Diversity in the original WCT population allowed itto spread in to different ecoregions resulting in the evo-lution of ecotypes suitable for the local environment andits subsequent adaptation The result of molecular charac-terization revealed significant differences in midland andcoastal growing palms The WCT and ecotypes might havediffered due to genetic factors or adaptation resulting fromenvironmental variations like climatic change pH of the soilannual rainfall or any other environmental factors or evenhuman interventions

One of the important prerequisites for evolutionarychange is genetic variation as in its absence populationslack the capacity to evolve Within a single species naturalselection coupled with heterogeneity in its habitat mightresult in multiple ecotypes which are genetically distinct[29] The total genetic variation of a species is likely to bedistributed among populations as the impact and directionof natural selection varies from one to another due toenvironmental variation and genetic drift [30] Thereforewith germplasm conservation programmes it is imperativeto accurately measure the amount of genetic diversity and itsdistribution within and between populations To these endsmolecularmarkers provide an efficient and unbiased estimateof these statistics free of environment effects Molecularcharacterization of genetic diversity provides base informa-tion which could be utilized in selection of a promisingrange of accessions for different breeding programs Themicrosatellites used in this study appeared to possess asignificant potential in this respect This is one of the firststudies to probe the diversity of coconut ecotypes usingmolecular markers The results of this study may be used indeveloping a strategy for conservation of these ecotypes andtheir utilization in future coconut breeding programmes

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Director CPCRI Kasaragod for hisguidance and facilities provided The authors also thank thefarmers and extension personnel from Annur and Bedakamfor their cooperation

References

[1] L H Jones ldquoPerennial vegetable oil cropsrdquo in AgriculturalBiotechnology Opportunities for International Development pp213ndash224 CAB International Wallingford UK 1990

[2] J G Ohler ldquoCoconut a tree of liferdquo Plant Production andProtection Paper 1984

[3] D V Liyanage ldquoPreliminary studies on the floral biology of thecoconut palmrdquo Tropical Agriculture vol 105 pp 171ndash175 1949

[4] K Satyabalan ldquoYield variation in west coast tall coconut palmsyield attributes which cause variation in annual yield of nuts inthe palms of different yield groupsrdquo Indian Coconut Journal vol1 pp 5ndash8 1993

[5] P Coomans ldquoInfluence of climate factors on seasonal fluctua-tions of coconut productionrdquoOleagineux vol 30 no 4 pp 153ndash157 1975

[6] D B Murray ldquoCoconut palmrdquo in Ecophysiology of TropicalCrops P T Alvin and T T Kozlowski Eds pp 24ndash27 AcademicPress New York NY USA 1977

[7] K V Kasturi Bai and A Ramadasan ldquoChanges in the levelsof carbohydrates as a function of environmental variablesin hybrids and tall coconut palmrdquo in Coconut Research andDevelopment N M Nair Ed pp 203ndash209 Wiley Eastern NewDelhi India 1983

[8] V Rajagopal A Ramadasan K V Kasturi Bai and D Bal-asimha ldquoInfluence of irrigation on leaf water relations and drymatter production in coconut palmsrdquo Irrigation Science vol 10no 1 pp 73ndash81 1989

[9] K V Kasturi Bai V Rajagopal C D Prabha M J Ratnambaland M V George ldquoEvaluation of coconut cutivars and hybridsfor dry matter productionrdquo Journal of Plantation Crops vol 24pp 23ndash28 1996

[10] C Jayasekara N P A D Nainanayake and K S JayasekaraldquoPhotosythetic characteristic and productivity of coconutpalmrdquo Journal of Plantation Crops vol 24 pp 538ndash547 1996

[11] K N Krishna Kumar Coconut phenology and yield response toclimate variability and change [PhD thesis] Cochin Universityof Science and Technology Kerala India 2011

[12] K Ganesamurthy C Natarajan and M JayaramachandranldquoGenetic diversity and its exploitation in coconut improve-mentrdquo in Proceedings of the National Conference on Agro-Biodiversity Conducted by National Biodiversity AuthorityChennai February 2006

[13] U Parthasarathy A comparative study of coconut cultivation incoastal and inland River Plain Ecosystem of Kasaragod Districtof Kerala and Kamrup District of Assam [PhD thesis] GauhatiUniversity Assam India 2004

[14] A H D Brown ldquoIsozymes plant population genetic structureand genetic conservationrdquoTheoretical and Applied Genetics vol52 no 4 pp 145ndash157 1978

[15] G R Ashburner W K Thompson G M Halloran and M AFoale ldquoFruit component analysis of south pacific coconut palmpopulationsrdquo Genetic Resources and Crop Evolution vol 44 no4 pp 327ndash335 1997

[16] C Schlotterer and D Tautz ldquoSlippage synthesis of simplesequence DNArdquo Nucleic Acids Research vol 20 no 2 pp 211ndash215 1992

[17] R Rivera K J Edwards J H A Barker et al ldquoIsolationand characterization of polymorphic microsatellites in Cocosnucifera Lrdquo Genome vol 42 no 4 pp 668ndash675 1999

International Journal of Biodiversity 7

[18] B Teulat C Aldam R Trehin et al ldquoAn analysis of geneticdiversity in coconut (Cocos nucifera) populations from acrossthe geographic range using sequence-tagged microsatellites(SSRs) and AFLPsrdquo Theoretical and Applied Genetics vol 100no 5 pp 764ndash771 2000

[19] L Perera J R Russell J Provan and W Powell ldquoUse ofmicrosatellite DNA markers to investigate the level of geneticdiversity and population genetic structure of coconut (Cocosnucifera L)rdquo Genome vol 43 no 1 pp 15ndash21 2000

[20] M K Rajesh P Nagarajan B A Jerard V Arunachalam andR Dhanapal ldquoMicrosatellite variability of coconut accessions(Cocos nucifera L) from Andaman and Nicobar Islandsrdquo Cur-rent Science vol 94 no 12 pp 1627ndash1631 2008

[21] C Remany Cataloging and categorization of unexploited eco-types of coconut grown in Kerala [PhD thesis] MahatmaGandhi University Kerala India 2003

[22] M K Rajesh B A Jerard P Preethi et al ldquoDevelopment ofa RAPD-derived SCAR marker associated with tall-type palmtrait in coconutrdquo Scientia Horticulturae vol 150 no 4 pp 312ndash316 2013

[23] J Sambrook E F Fritsch and T Maniatis Cloning A Labora-tory Manual Cold Spring Harbor laboratory 1989

[24] L Dice ldquoMeasures of the amount of ecologic associationbetween speciesrdquo Ecology vol 26 pp 297ndash302 1945

[25] F J Rohlf ldquoNTSYS-pc numerical taxonomy and multivariateanalysis system version 20 owner manualrdquo 1997

[26] P H A Sneath and R R SokalNumerical TaxonomyThe Prin-ciples and Practice of Numerical Classification W H FreemanSan Francisco Calif USA 1973

[27] R Peakall and P E Smouse ldquoGenAlEx 65 genetic analysis inexcel Population genetic software for teaching and research-anupdaterdquo Bioinformatics vol 28 pp 2537ndash2539 2012

[28] P K Gupta H S Balyan P C Sharma and B RameshldquoMicrosatellites in plants a new class of molecular markersrdquoCurrent Science vol 70 no 1 pp 45ndash54 1996

[29] Y B Linhart and M C Grant ldquoEvolutionary significance oflocal genetic differentiation in plantsrdquoAnnual Review of Ecologyand Systematics vol 27 pp 237ndash277 1996

[30] M J Lawrence and N Rajanaidu ldquoThe genetic structure ofnatural populations and sampling strategyrdquo in Proceedings of theInternationalWorkshop onOil PalmGermplasm andUtilizationpp 15ndash26 Selangor Malaysia 1985

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

International Journal of Biodiversity 7

[18] B Teulat C Aldam R Trehin et al ldquoAn analysis of geneticdiversity in coconut (Cocos nucifera) populations from acrossthe geographic range using sequence-tagged microsatellites(SSRs) and AFLPsrdquo Theoretical and Applied Genetics vol 100no 5 pp 764ndash771 2000

[19] L Perera J R Russell J Provan and W Powell ldquoUse ofmicrosatellite DNA markers to investigate the level of geneticdiversity and population genetic structure of coconut (Cocosnucifera L)rdquo Genome vol 43 no 1 pp 15ndash21 2000

[20] M K Rajesh P Nagarajan B A Jerard V Arunachalam andR Dhanapal ldquoMicrosatellite variability of coconut accessions(Cocos nucifera L) from Andaman and Nicobar Islandsrdquo Cur-rent Science vol 94 no 12 pp 1627ndash1631 2008

[21] C Remany Cataloging and categorization of unexploited eco-types of coconut grown in Kerala [PhD thesis] MahatmaGandhi University Kerala India 2003

[22] M K Rajesh B A Jerard P Preethi et al ldquoDevelopment ofa RAPD-derived SCAR marker associated with tall-type palmtrait in coconutrdquo Scientia Horticulturae vol 150 no 4 pp 312ndash316 2013

[23] J Sambrook E F Fritsch and T Maniatis Cloning A Labora-tory Manual Cold Spring Harbor laboratory 1989

[24] L Dice ldquoMeasures of the amount of ecologic associationbetween speciesrdquo Ecology vol 26 pp 297ndash302 1945

[25] F J Rohlf ldquoNTSYS-pc numerical taxonomy and multivariateanalysis system version 20 owner manualrdquo 1997

[26] P H A Sneath and R R SokalNumerical TaxonomyThe Prin-ciples and Practice of Numerical Classification W H FreemanSan Francisco Calif USA 1973

[27] R Peakall and P E Smouse ldquoGenAlEx 65 genetic analysis inexcel Population genetic software for teaching and research-anupdaterdquo Bioinformatics vol 28 pp 2537ndash2539 2012

[28] P K Gupta H S Balyan P C Sharma and B RameshldquoMicrosatellites in plants a new class of molecular markersrdquoCurrent Science vol 70 no 1 pp 45ndash54 1996

[29] Y B Linhart and M C Grant ldquoEvolutionary significance oflocal genetic differentiation in plantsrdquoAnnual Review of Ecologyand Systematics vol 27 pp 237ndash277 1996

[30] M J Lawrence and N Rajanaidu ldquoThe genetic structure ofnatural populations and sampling strategyrdquo in Proceedings of theInternationalWorkshop onOil PalmGermplasm andUtilizationpp 15ndash26 Selangor Malaysia 1985

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology