Research Article A Two-Tube Multiplex Reverse ...downloads.hindawi.com/journals/bmri/2014/648520.pdfResearch Article A Two-Tube Multiplex Reverse Transcription PCR Assay for Simultaneous

Research ArticleA Two-Tube Multiplex Reverse Transcription PCR Assay forSimultaneous Detection of Viral and Bacterial Pathogens ofInfectious Diarrhea

Ji Wang1 Ziqian Xu1 Peihua Niu1 Chen Zhang1 Jingyun Zhang2 Li Guan1 Biao Kan2

Zhaojun Duan1 and Xuejun Ma1

1 Key Laboratory for Medical Virology Ministry of Health National Institute for Viral Disease Control and PreventionChinese Center for Disease Control and Prevention No 155 Changbai Road Changping District Beijing 102206 China

2National Institute for Infectious Disease Control and Prevention Chinese Center for Disease Control and PreventionBeijing 102206 China

Correspondence should be addressed to Zhaojun Duan zhaojund126com and Xuejun Ma maxjivdcchinacdccn

Received 20 November 2013 Revised 26 January 2014 Accepted 2 February 2014 Published 10 March 2014

Academic Editor Stanley Brul

Copyright copy 2014 Ji Wang et al This is an open access article distributed under the Creative Commons Attribution License whichpermits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Diarrhea caused by viral and bacterial infections is a major health problem in developing countries The purpose of this study is todevelop a two-tubemultiplex PCR assay using automatic electrophoresis for simultaneous detection of 13 diarrhea-causative virusesor bacteria with an intended application in provincial Centers for Diseases Control and Prevention ChinaThe assay was designedto detect rotavirus A norovirus genogroups GI and GII human astrovirus enteric adenoviruses and human bocavirus (tube 1)and Salmonella Vibrio parahaemolyticus diarrheagenic Escherichia coli Campylobacter jejuni Shigella Yersinia andVibrio cholera(tube 2)The analytical specificity was examinedwith positive controls for each pathogenThe analytical sensitivity was evaluated byperforming the assay on serial tenfold dilutions of in vitro transcribed RNA recombinant plasmids or bacterial culture A total of122 stool samples were tested by this two-tube assay and the results were comparedwith those obtained from referencemethodsThetwo-tube assay achieved a sensitivity of 20ndash200 copies for a single virus and 102-103 CFUmL for bacteriaThe clinical performancedemonstrated that the two-tube assay had comparable sensitivity and specificity to those of reference methods In conclusion thetwo-tube assay is a rapid cost-effective sensitive specific and high throughput method for the simultaneous detection of entericbacteria and virus

1 Introduction

Diarrhea caused by viral and bacterial infections is a majorhealth problem in developing countries and the clinicalpresentation of the patients with diarrhea symptoms is notgenerally indicative of a specific virus or bacteria [1 2] InChina the analysis of reported infectious diarrhea conductedbyChinaCentre forDisease Prevention andControl (CCDC)in 2011 showed that the main pathogens of bacterial diar-rheawere SalmonellaVibrio parahaemolyticus diarrheagenicEscherichia coli and Campylobacter jejuni accounting for4843 (15703242) 3220 (10443242) 857 (2783242)and 241 (783242) respectively Rotavirus cases had thehighest proportion of viral cases with 9735 (5518556687)

followed by enteric adenovirus norovirus and human astro-virus accounting for 260 (147656687) 004 (2556687)and 001 (156687) respectively In total these pathogenscaused 9955 cases of infectious diarrhea in China in 2011[3] Shigella and Vibrio cholera were not counted in thisreport but they can also cause diarrhea [4] The existingstudies indicated that humanbocavirus andYersiniawere alsoassociated with acute gastroenteritis [5 6]

Conventional diagnostic methods for routine detectionof enteric pathogens within the clinical microbiology settingrely on microscopy culture and enzyme immunoassays[7] However these procedures are either laborious or havelimited sensitivity and specificity Molecular methodologiesbased on polymerase chain reaction (PCR) and reverse

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014 Article ID 648520 9 pageshttpdxdoiorg1011552014648520

2 BioMed Research International

transcription (RT-PCR) provide powerful tools [8] whichhave markedly improved the detection of enteric pathogens[9] In the last few years the multiplex real-time polymerasechain reaction (RT-PCR) has been successfully performed toidentify different enteric pathogens simultaneously [1 10ndash12]However these methods are either low throughput (4 patho-genstube at most) or expensive (fluorescence probe) whichdoes not allow rapid screening of large numbers of stool sam-ples Furthermore almost all of the reported multiplex PCRmethods are able to detect either viral pathogens [13ndash15] orbacterial pathogens [16] but few studies reported the simul-taneous detection of viral and bacterial pathogens within thesame sample which is essential to elucidate the potential syn-ergy between enteric virus and bacteria and reveal the clinicalrelevance between viral and bacterial infections Althoughseveral multiplex molecular assays such as Luminex GPPand Seegene Diarrhea ACE are commercially available theextremely high price made them unaffordable methods forroutine use in provincial Centers for Diseases Control andPrevention China Therefore a rapid sensitive specific andcost-effective diagnosticmethodwhich detects virus and bac-teria simultaneously would be highly preferred for routinelaboratory testing

Here we describe the development of a one-step multi-plex PCR assays (two-tube assay) for the simultaneous detec-tion of 13 most commonly found diarrhea-causative virusesor bacteria Tube 1 is used for the detection of 6 diarrhea-associated viruses including rotavirus A (RVA) noroviruses(NoVs) genogroups GI and GII human astrovirus (HAstV)enteric adenoviruses (EAds) and human bocavirus (HBoV)(Qiaxcel-V assay) and tube 2 is used for the detection of7 diarrhea-associated bacteria including Salmonella Vibrioparahaemolyticus diarrheagenic Escherichia coli Campy-lobacter jejuni Shigella Yersinia and Vibrio cholera (Qiaxcel-B assay) using the same samples from patients with gas-troenteritis The analytical specificity and sensitivity wereexamined and the clinical performance of the two-tube assaywas evaluated by comparing the results with those obtainedfrom reported PCR assay or commercial kits

2 Materials and Methods

21 Virus Strains and Clinical Samples Two test panels ofviral and bacterial samples used in this study are listed inTables 1 and 2 The virus test panel consisted of 47 clinicalsamples previously determined by PCR and sequencingconducted by the Diarrhea Department National Institutefor Viral Disease Control and Prevention (DD-IVDC) Thebacterial test panel consisted of 27 preserved strains or clini-cal isolates previously determined by cultural and molecularidentification by the Diarrhea Department National Institutefor Infectious Disease Control and Prevention (DD-ICDC)A total of additional 122 fecal samples were selected from thecollection obtained during routine virus and bacteria surveil-lance conducted byDD-IVDC All of the fecal specimens andclinical data were collected from January 2012 to December2012 from hospitalized children under 5 years old diagnosedof acute diarrhea All aspects of the study were performed inaccordance with national ethics regulations and approved by

the Institutional Review Boards of CCDC Childrenrsquos parentswere apprised of the studyrsquos purpose and of their right to keepinformation confidentialWritten consent was obtained fromchildrenrsquos parents RVA was identified using a commercialProSpecT rotavirus ELISA kit (Oxoid Hants UK) Norovirusand enteric adenovirus were identified using reported multi-plex PCR assay while the HAstV and HBoV were identifiedusing monoplex PCR followed by sequencing [13 17ndash19]at DD-IVDC All specimens were processed by routineisolationculture to identify different enteropathogenic bac-teria at DD-ICDC The diarrheagenic Escherichia coli wereidentified using multiplex real-time PCR assay [20] In orderto facilitate the presentation these methods are defined asldquoreference methodsrdquo in the following text and the test resultsof reference methods are called ldquoreference resultsrdquo

22 Primers Primers for Vibrio cholera Eads and HBoVwere designed from conserved regions of the viral andbacterial genomes using Primer-Premier software version50 For all primer sequences BLAST analysis was performedto ensure specificity and no sequence cross-reactivity wasobserved Primers for other targeted virus and bacteria wereadapted or modified from previous references In total 14pairs of chimeric primers sequences the target genes andthe amplicon sizes are listed in Table 3 One pair of universalprimers was adapted from our previous studies [21] Thechimeric primers consisted of a gene-specific sequence fusedat the 51015840 end to the universal sequence thus all of thechimeric primers are with similar annealing temperatures toassure the approximate amplification efficiency

23 Nucleic Acid Extraction Total nucleic acid was extractedfrom 200120583L of a 10 fecal suspension prepared in normalsaline using theMasterPure Complete DNA and RNA purifi-cation kit (Epicenter Technologies Madison WI) accordingto the manufacturerrsquos instructions The extracts were elutedin 50120583L of DNase- and RNase-free water and stored atminus80∘C

24 Multiplex PCR Two multiplex PCR assays were devel-oped in this study Six enteric viruses were detected byQiaxcel-V assay in tube 1 while the 7 enteric bacteria weredetected by Qiaxcel-B assay in tube 2 simultaneously

For the Qiaxcel-V assay the multiplex RT-PCR wasperformed with a One-Step RT-PCR kit (Qiagen HildenGermany) in a 25120583L volume containing 125 pmol each ofthe forward and reverse viral chimeric primer mix 125 pmoleach of the forward and reverse universal primer mix 4 120583Lof template nucleic acid and 01 120583L of ribonuclease inhibitor(Takara Dalian China) and RNase-free water The RT-PCR mixture was subjected to the following amplificationconditions 50∘C for 30min and 95∘C for 15min followed by10 cycles of 95∘C for 30 s 56∘C for 30 s and 72∘C for 60 s 10cycles of 95∘C for 30 s 68∘C for 30 s and 72∘C for 60 s 20cycles of 95∘C for 30 s 50∘C for 30 s and 72∘C for 60 s anda final incubation of 72∘C for 3min For the Qiaxcel-B assaythe multiplex PCR was performed with a Multiplex PCR kit(Qiagen Hilden Germany) in a 25 120583L volume containing125 pmol each of the forward and reverse bacterial chimeric

BioMed Research International 3

Table 1 Virus test panel for the evaluation of specificity of PCR primers

Isolates Number of the isolatesb Targeted gene loci of virusVP6 RDRPa RDRP ORF1a Hexon VP1

Rotavirus A 9 + minus minus minus minus minus

Noroviruses G1 1 minus + minus minus minus minus

Noroviruses G2 6 minus minus + minus minus minus

Astrovirus 2 minus minus minus + minus minus

Adenovirus 10 minus minus minus minus + minus

Human bocavirus 6 minus minus minus minus minus +Coxsackie virus 16 2 minus minus minus minus minus minus

Enterovirus 71 4 minus minus minus minus minus minus

Influenza virus B 3 minus minus minus minus minus minus

Influenza virus A 4 minus minus minus minus minus minus

aRDRP RNA-dependent RNA polymerase ball the isolates in this panel were clinical samples

Table 2 Bacterial test panel for the evaluation of specificity of PCR primers

Isolates Number of the isolatesd Targeted gene loci of bacteriaipaH tlh eaeA invA ail ctxA mapA

Salmonella enteritidis CMCCa 50041 minus minus minus + minus minus minus

Shigella flexneri CMCC 51537 + minus minus minus minus minus minus

Shigella sonnei 2 + minus minus minus minus minus minus

EIEC 1 + minus minus minus minus minus minus

EHEC 3 minus minus + minus minus minus minus

EPEC 2 minus minus + minus minus minus minus

Vibrio parahaemolyticus CICCb 21617 minus + minus minus minus minus minus

Vibrio cholera O1 2 minus minus minus minus minus + minus


Yersinia enterocolitica 3 minus minus minus minus + minus minus

Campylobacter jejuni 4 minus minus minus minus minus minus +Vibrio mimicus CICC 21613 minus minus minus minus minus minus minus

Vibrio fluvialis 3 minus minus minus minus minus minus minus

Staphylococcus aureus ATCCc 29213 minus minus minus minus minus minus minus

Listeria monocytogenes CMCC 54004 minus minus minus minus minus minus minus

aCMCC National Center for Medical Culture Collection bCICC China Center of Industrial Culture Collection cATCC American Type Culture Collectiondthe isolates in this panel consisted of clinical isolates and preserved standard strain

primer mix 125 pmol each of the forward and reverseuniversal primer mix and 3 120583L of template nucleic acid Themultiplex PCRmixture was subjected to the following ampli-fication conditions 95∘C for 15min followed by 10 cycles of95∘C for 30 s 65∘C for 90 s and 72∘C for 60 s 25 cycles of 95∘Cfor 30 s 70∘C for 90 s and 72∘C for 60 s and a final incubationof 72∘C for 3min The thermal cycling was performed usingPCRAmplifier (ThermoElectronCorp Vantaa Finland) fol-lowed by the detection of amplifiedDNAproducts by agarosegel (30) or capillary electrophoresis using QIAXCEL andDNA Screening kit (Qiagen Hilden Germany)

25 Analytical Specificity and Sensitivity Theanalytical speci-ficity of the two-tube assay was determined by the testing oftwo test panels individually DNA RNA or bacterial culturewith a known concentration was prepared to evaluate theanalytical sensitivity of the two-tube assay

For the Qiaxcel-V assay the analytical sensitivity for eachvirus was examined using serial tenfold dilutions rangingfrom 2 times 101 to 2 times 105 copies of recombinant plasmids forDNA virus and in vitro transcribed RNA for all RNA virusesThe target genes of 6 viruses were amplified with specificprimers using the virus test panel (Table 1)Then the productswere purified and ligated to pGEM-T vector (PromegaMadison WI) to construct recombinant plasmids For RNAviruses the plasmids amplified by E coliwere linearized withSpe I and in vitro transcribed from the T7 promoter usingRibo-MAX large scale RNAProduction SystemT7 (PromegaMadison WI) The RNA copy number was calculated aftermeasuring the purified RNA concentration by spectropho-tometry using Eppendorf Biophotometer (Eppendorf AGHamburg Germany) For DNA viruses the copy numberof plasmids was calculated after measuring the plasmidconcentration using Eppendorf Biophotometer (Eppendorf


Table 3 Primer sequences and product sizes used in this study

Pathogen Target Sequence 51015840-31015840 Size References

Shigella and EIEC ipaH AGGTGACACTATAGAATAaACCATGCTCGCAGAGAAACT 213 [10]GTACGACTCACTATAGGGAbTCAGTACAGCATGCCATGGT

Vibrio parahaemolyticus tlh AGGTGACACTATAGAATAACTCAACACAAGAAGAGATCGACAA 246 [30]GTACGACTCACTATAGGGAGATGAGCGGTTGATGTCCAA

EHEC and EPEC eaeA AGGTGACACTATAGAATAAGGTCGTCGTGTCTGCTA 293 [31]GTACGACTCACTATAGGGACCGTGGTTGCTTGCGTTTG

Salmonella invA AGGTGACACTATAGAATAGTGAAATTATCGCCACGTTCGGGCAA 323 [32]GTACGACTCACTATAGGGATCATCGCACCGTCAAAGGAACC

Yersinia ail AGGTGACACTATAGAATATAATGTGTACGCTGCGAG 389 [5]GTACGACTCACTATAGGGAGACGTCTTACTTGCACTG

Vibrio cholerae ctx AGGTGACACTATAGAATAACAGTAACTTAGATATTGCTCCAG 507 This studyGTACGACTCACTATAGGGAACCATTCTTAAAAGTAATGATAGCCA

Campylobacter jejuni mapA AGGTGACACTATAGAATACTATTTTATTTTTGAGTGCTTGTG 627 [33]GTACGACTCACTATAGGGAGCTTTATTTGCCATTTGTTTTATTA

Noroviruses GI RDRP AGGTGACACTATAGAATACGCTGGATGCGCTTCCATGA 162 [21]GTACGACTCACTATAGGGAGCAAGAGGGTCAGAAGCATT

Rotavirus VP6 AGGTGACACTATAGAATAAAGTCTTCCACATGGAGGT 210 Modified [21]GTACGACTCACTATAGGGAARRTTICCAATTCCTCCAGT

Norovirus GII RDRP AGGTGACACTATAGAATACAGACAAGAGCCAATGTTCA 279 Modified [21]GTACGACTCACTATAGGGATTTCTAATCCAGGGGTCAATT

Human astrovirus ORF1a AGGTGACACTATAGAATACGTCATTATTTGTTGTCATA 326 [21]GTACGACTCACTATAGGGACATGTGCTGCTGTTACTATG

Enteric adenovirus Hexon AGGTGACACTATAGAATATGTACAAGCCAGNTGTAGCTC 388 This studyGTACGACTCACTATAGGGAAAGCAGTAATTTGGCANTTCGT

Human bocavirus 1c VP1 AGGTGACACTATAGAATAAAACCCATCACTCTCAATGCTT 412 This studyGTACGACTCACTATAGGGACAGTATGTCTTCTTTCTGGACG

Human bocavirus 2 VP1 AGGTGACACTATAGAATAAAATCCACCACTATCCATGCTC 412 This studyGTACGACTCACTATAGGGACGGTGTGTCTTCTTTCTGGTCT

aUniversal primers-F AGGTGACACTATAGAATA buniversal primers-R GTACGACTCACTATAGGGA cthe primers for HBoV1 and HBoV2 are equallymixed the amplicon sizes of both PCR products are exactly the same and the primers are located at the same position in the corresponding viral genome thismethod is able to identify the presence of HBoV1 and HBoV2 but cannot classify the subtypes

AG Hamburg Germany) Tenfold serial dilutions of theseRNADNA templates with known copy numbers (2 times 101to 2 times 105 copiesmL) were used to evaluate the analyticalsensitivity of the Qiaxcel-V assay

For the Qiaxcel-B assay each reference strain of bacterialtest panel (Table 2) except for Vibrio cholera was seriallydiluted 10-fold with 09 NaCl in the logarithmic phase ofgrowth The bacterial dilutions were plated onto agar platesand incubated Thereafter the colony-forming units (CFU)were counted in duplicate and the DNA in the bacterial dilu-tions was extracted with MasterPure Complete DNA andRNA purification kit (Epicenter Technologies Madison WI)according to the manufacturerrsquos instructions The DNA tem-plates were used to evaluate the analytical sensitivity of theQiaxcel-B assay The analytical sensitivity for Vibrio cholerawas tested in the sameway ofDNAvirus (quantitative recom-binant plasmids) due to the unavailability of live Vibriocholera

The analytical sensitivity of Qiaxcel-V assay and Qiaxcel-B assay was examined respectively by using quantitativepremixed templates To confirm the reproducibility of thismethod intra-assay (each sample tested three times withinan experiment) and interassay (each sample tested one timein three different experiments) precision were evaluated

26 Diagnostic Specificity and Sensitivity A total of 122samples were tested by two-tube assay (Qiaxcel-V assay andQiaxcel-B assay) The diagnostic specificity and sensitivitywere determined in comparison to the reference results(Table 4) The discordant results between the two-tube assayand the reference method were resolved by a third monoplexPCR and sequencing [14 22]

27 Statistical Analysis All statistical analyses were per-formed using Statistical Package for Social Sciences (SPSS)software (version 130) for Windows The 1205942-test and


Table 4 Detection of 13 enteric agents in 122 specimens

Pathogen Qiaxcel+b

referencea+Qiaxcel+referenceminus

Qiaxcelminusreference+

Qiaxcelminusreferenceminus Sensitivity Specificity Agreement Kappa value

Norovirus GI 5 0 1 116 8333 100 9918 09048Rotavirus 30 5 0 87 100 9457 959 08954Norovirus GII 40 0 5 77 8898 100 959 09099Human astrovirus 13 0 0 109 100 100 100 1Enteric adenovirus 13 2 0 107 100 9817 9836 09194Human bocavirus 5 0 0 117 100 100 100 1Shigellac 4 0 1 117 80 100 9918 08847Vibrio parahaemolyticus 0 0 0 122EHEC and EPEC 1 0 0 121 100 100 100 1Salmonella 3 0 0 119 100 100 100 1Yersinia 0 0 0 122Vibrio cholerae 0 0 0 122Campylobacter jejuni 0 0 0 122aThe definition of ldquoreference resultsrdquo was described in ldquoVirus Strains and Clinical Samplesrdquo Virus was identified using a commercial ELISA kit reportedmultiplex PCR assay and monoplex PCR followed by sequencing at DD-IVDC [13ndash16] All specimens were processed by routine isolationculture to identifydifferent enteropathogenic bacteria at DD-ICDC The diarrheagenic Escherichia coli were identified using multiplex real-time PCR assay [17]bThe numbers of positive and negative specimens detected by the two-tube assay were indicated asQiaxcel+ andQiaxcelminus respectivelyThe numbers of positiveand negative specimens detected by the reference assay were indicated as reference+ and referenceminus respectivelycThe two-tube assay was not able to distinguish Shigella from EIEC so Shigella positive detected by the two-tube assay could be Shigella or EIEC These 5samples (reference+) were confirmed by sequencing

McNemarrsquos test were conducted to measure the sensitivityspecificity and the detection agreement of two-tube assaywith the reference results

3 Results

31 Analytical Specificity and Sensitivity Theanalytical speci-ficity result was shown in Tables 1 and 2 the result of inclu-sivity and exclusivity experiments demonstrated no cross-reactivity among the target organisms closely related organ-isms or commonly encountered organisms The amplifiedDNA products were detected both on capillary electrophore-sis Qiaxcel (Figure 1) and 30 agarose gel (Figure 2) Theresults revealed that the expected size of each pathogen-specific amplicon was observed and separated clearly fromthe other targets No mispriming (primer dimer) or otheramplification was observed in either tube

The analytical sensitivity for norovirus GII RVAand enteric adenovirus was 20 copiesreaction and 200copiesreaction for the other 3 viruses The sensitivity of thesix premixed viral templates was 2000 copiesreaction (forsimultaneous detection of six targets) in the Qiaxcel-V assay(data not shown) For the Qiaxcel-B assay the individualsensitivity for bacterial dilutions was 426 times 103 CFUmL forSalmonella 322 times 102 CFUmL for Vibrio parahaemolyticus517 times 10

3 CFUmL for Escherichia coli 431 times 103 CFUmLfor Campylobacter jejuni 288 times 103 CFUmL for Shigella564 times 10

2 CFUmL for Yersinia and 20 copiesreaction forVibrio cholera The analytical sensitivity of simultaneousdetection of the seven premixed bacterial templates wasabout one order of magnitude higher than that of individual

target The coefficient of variation (CV) for interassay andintra-assay ranged from 325 to 798 (data not shown)

32 Diagnostic Specificity and Sensitivity The clinical per-formance of the two-tube assay was evaluated using a panelof 122 archived clinical specimens In comparing the resultsof the novel two-tube assay with the reference results nosignificant difference was found between the detection ratesin the clinical evaluation (Table 4) Five norovirus GII-positive samples one norovirus GI-positive sample and oneShigella-positive sample by reference method were nega-tive by the two-tube assay Five rotavirus-negative samplesand two enteric adenovirus-negative samples identified byreference method were positive by the two-tube assay Inaddition 21 samples identified as coinfection were detected(Table 5) Of the 122 clinical samples tested the sensitivitiesof detection of the different pathogens were 100 (RVA)8333 (NoV GI) 8898 (NoV GII) 100 (HAstV) 100(EAds) 100 (HBoV) 80 (Shigella) 100 (Salmonella)and 100 (Escherichia coli) and the specificities were 9457100 100 100 9817 100 100 100 and 100respectively The positive samples detected only by two-tubeassay (5 for RVA and 2 for EAds) were retested and con-firmed by sequencing as true positives using other reportedprimers [14 22] Compared with the confirmed result thespecificities of RVA and EAds were both 100 The agree-ment was gt90 for all of the identified pathogens (exceptfor Vibrio parahaemolyticus Campylobacter jejuni Yersiniaand Vibrio cholera where no positive case was found)and the kappa correlation between the two methods wasgt075


1 2 3 4 5 6 7

1000 bp

412bp388bp326bp279bp

210 bp

162bp

15bp

(a)

8 9 10 11 12 13 14 15

1000 bp627bp507bp

389bp323bp293bp246bp213 bp

15bp

(b)

Figure 1 Electrophoresis results of the PCR products on automatic electrophoresis All of the targets were identified successfully and nomispriming was observed in either tube Lanes 1 to 6 in part (a) NoV GI (162 bp) RVA (210 bp) NoV GII (279 bp) HAstV (326 bp) EAds(388 bp) and HBoV (412 bp) respectively Lane 7 PCR products of six premixed viral targets in tube 1 (Qiaxcel-V assay) Lanes 8 to 14 in part(b) Shigella (213 bp) Vibrio parahaemolyticus (246 bp) diarrheagenic Escherichia coli (293 bp) Salmonella (323 bp) Yersinia (389 bp) Vibriocholera (507 bp) and Campylobacter jejuni (627 bp) Lane 15 PCR products of seven premixed bacterial targets in tube 2 (Qiaxcel-B assay)

M M1 2 3 4 5 6 7

1000 bp


200 bp

100 bp

(a)

M M8 9 10 11 12 13 14 15

1500bp1000 bp

600bp500bp400bp300bp200 bp

100 bp

(b)

Figure 2 Electrophoresis results of the PCR products on 3 agarose gel Agarose gel electrophoresis demonstrated the expected PCR productsizes of 6 viruses and 7 bacteria by the novel two-tube multiplex PCR method The results shown in lanes 1 to 14 were in the same order as inFigure 1 M standard 100 bp DNA ladder marker

4 Discussion

In our previous study a multiplexed Luminex-based assay[23] to detect seven enteric viruses associated with acutegastroenteritis was developed However this method is notlikely to be widely adopted in common laboratories due tothe limited availability of Luminex equipment In this studya novel two-tube assay using automatic electrophoresis wasdeveloped and evaluated for the simultaneous detection of6 viruses and 7 bacteria with an intended application inprovincial Centers for Diseases Control and Prevention

A multiplex PCR based on the chimeric primer andtemperature switch PCR (TSP) strategy has been developedin our laboratory and shown to be effective for the detectionof pandemic influenza A H1N1 virus [24] nine serotypes ofenteroviruses associated with hand foot and mouth disease[25] and sixteen different respiratory virus typessubtypes ina single tube [26]This strategy was also applied in this studyIn addition two sets of primers (RVA and norovirus GII)were modified from our previous study [23] to achieve betteranalytical sensitivity The analytical result indicated that this

assayrsquos ability to detect a low concentration of RVA andnorovirus GII in biological samples was improved comparedto our previous study [23] The specificity and the sensitivityof the two-tube assay for each viral and bacterial pathogenwere comparable to those of previous reports [23 27 28]

Viral and bacterial targets were amplified in the same tubein our preliminary experiments but the bacterial PCR signi-ficantly inhibited the amplification of viral targets likelybecause of the competition of reagent (data not shown)Therefore the novel assay was composed by two tubes(Qiaxcel-V and Qiaxcel-B) to minimize the decrease in theanalytical sensitivity To optimize the PCR condition severalcommercial PCR kits or one-step RT-PCR kit from differentcompanies (Promega Qiagen Takara and Invitrogen) wastested in our preliminary experimentsThemultiplex PCR kitand the one-step RT-PCR kit from Qiagen revealed the bestamplification efficiency under our current protocol

Of 122 clinical samples tested positive samples accountedfor 7787 (95122) of all the samples including 842 (895)bacterial-positive samples and 9580 (9195) virus-positivesamples


Table 5 Multiple enteric pathogens detected in clinical samples bynovel two-tube assay

Pathogen Numbers of coinfectionNorovirus G2 and astrovirus 4Adenovirus and astrovirus 3Rotavirus and Salmonella 3Rotavirus astrovirus and norovirus G2 3Rotavirus astrovirus and adenovirus 2Norovirus G2 and adenovirus 2Rotavirus and astrovirus 1Rotavirus and adenovirus 1Rotavirus and Shigella 1Rotavirus and norovirus G2 1Total 21

Compared with bacteria virus causes more gastroenteri-tis cases which is consistent with the previous studies [1 315] RVA is the principal pathogen causing infectious diarrhea[3] but in our study norovirus GII took the highest propor-tion of viral positive samples with a detection rate of 4396(4091) followed by RVA with 3297 (3091) The reasonfor this is that among all the norovirus GII-positive samplessome of them were collected from local outbreaks while allof the RVA samples were collected from the sporadic cases ofgastroenteritisThe bacteria detected from clinical specimenswere Shigella Salmonella and Escherichia coli accounting for4444 (49) 3333 (39) and 1111 (19) respectively Itshould be noted that no sample tested positive for Vibrioparahaemolyticus Campylobacter jejuni Yersinia and Vibriocholera with limited specimens No pathogens were detectedin 27 (2213) diarrheal stool samples in this study Thiscould be due to the infection of other causative pathogens notincluded in this diagnostic panel such as parasite sapovirusStaphylococcus aureus and other serotypes of E coli

As shown in Table 5 twenty-one coinfections wereobserved Among all pathogens RVA is the most frequentlyidentified in coinfection with other pathogens (1221) Inaddition all of viral-bacterial coinfections are identifiedinvolving RVA and the ages of these children are olderthan 12 months Two reasons may lead to this phenomenonFirst RVA infection is thought to be the reason of ente-rocyte destruction from the top of intestinal villus [29]which properly increases the risk of opportunistic pathogeninfection Second the children older than 12 months havethe ability of walking and prefer to grab or bite things Thisbehavior increases the probability of touching the food toysand baby stuff which are contaminated by bacteria such asSalmonella

Due to the limited specimens available at this time onlypreliminary findings were reported in this study The associ-ations between mixed infections and severity of diarrhea andthe information about the seasonal prevalence of awide rangeof viral and bacterial pathogens are not able to be addressedIn addition clinical data provide no information about theuse of antibiotics which may influence the detection resultof bacterial infections Future study is therefore needed to

include larger sample size to further evaluate the clinicalperformance of this two-tube assay

The two-tube assay has acceptable turnaround time(TAT) for high throughput analysis of 96 samples The wholePCR process in two tubes is completed within 25 hoursfollowed by capillary electrophoresis separation (10min12wells) The average turnaround time for processing 96 sam-ples targeting 13 pathogens in one run is less than 5 hours(apart from the nucleic acid extraction step) Additionallythe PCR product of the two-tube assay could be identifiedand separated in agarose gel (30) clearly thus the minimalrequirement for the assayrsquos implementation only includesrefrigerator PCR amplifier agarose gel electrophoresis sys-tem andUVdetector for which the two-tube assay is likely tobe widely adopted in the laboratories that equip no capillaryelectrophoresis such as Qiaxcel

Though the test panel of the commercial kits (16 patho-gens for Luminex xTAG GPP and 15 pathogens for SeegeneDiarrhea ACE) is more comprehensive than two-tube assay(13 pathogens) the pathogen compositions of two-tube assayare reasonable enough as the pathogen panel was selectedaccording to the report of routine surveillance program oninfectious diarrhea China CDC [3] Compared to the existingcommercial Seeplex Diarrhea ACE Detection kit (SeegeneSeoul Korea) the reagent cost (the PCR kit and the con-sumables ofQiaxcel capillary electrophoresis) of the two-tubeassay is approximately $8test versus $120test in three tubesusing Seeplex kit It is not fair though to compare thematerialcost to market price it is a fact that the commercial kit isunaffordable for the use in the routine surveillance of entericpathogens Therefore the two-tube assay demonstrates theadvantage of practicability of the potentially wide applica-tion

In conclusion we present a rapid and high throughputmultiplex PCR with high specificity and sensitivity Moreimportantly this assay is affordable and convenient for theroutine use in primary testing laboratories As the two-tubeassay uses the QIAxcel automated electrophoresis systemwhich is accessible in most of provincial Centers for DiseaseControl and Prevention in China the proposed assay isdemonstrated to have great potential for routine surveillanceof enteric viral and bacterial infection in China and toimprove the capacity for emergency management

Disclaimer

Theviews expressed in this paper are those of the authors anddo not necessarily represent the views of the Chinese Centersfor Disease Control and Prevention

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

The first three authors contributed equally to the study


Acknowledgment

This work was supported by the China Mega-Projectfor Infectious Disease (2013ZX10004-001 2012ZX10004-2152013ZX10004-202 and 2014ZX10004002-004)

References

[1] N M van Maarseveen E Wessels C S de Brouwer A CT M Vossen and E C J Claas ldquoDiagnosis of viral gastro-enteritis by simultaneous detection of Adenovirus group FAstrovirus Rotavirus group A Norovirus genogroups I and IIand Sapovirus in two internally controlled multiplex real-timePCR assaysrdquo Journal of Clinical Virology vol 49 no 3 pp 205ndash210 2010

[2] J A Platts-Mills D J Operario and E R Houpt ldquoMoleculardiagnosis of diarrhea current status and future potentialrdquoCurrent Infectious Disease Reports vol 14 no 1 pp 41ndash46 2012

[3] H-X Liu and J Zhang ldquoAnalysis of reported infectious diarrhea(other than cholera dysentery typhoid and paratyphoid) inChina in 2011rdquo Chinese Journal of Preventive Medicine vol 47no 4 pp 328ndash332 2013

[4] S Huilan L G Zhen M M Mathan et al ldquoEtiology of acutediarrhoea among children in developing countries a multi-centre study in five countriesrdquo Bulletin of the World Health Org-anization vol 69 no 5 pp 549ndash555 1991

[5] P Thoerner C I B Kingombe K Bogli-Stuber et al ldquoPCRdetection of virulence genes in Yersinia enterocolitica andYersinia pseudotuberculosis and investigation of virulence genedistributionrdquo Applied and Environmental Microbiology vol 69no 3 pp 1810ndash1816 2003

[6] P Bharaj W M Sullender S K Kabra and S Broor ldquoHumanbocavirus infection in children with acute respiratory tractinfection in Indiardquo Journal of Medical Virology vol 82 no 5pp 812ndash816 2010

[7] L J Coupland I McElarney E Meader et al ldquoSimultaneousdetection of viral and bacterial enteric pathogens using theSeeplex(R) Diarrhea ACE detection systemrdquo Epidemiology andInfection vol 141 no 10 pp 2111ndash2121 2013

[8] C F Amar C L East J Gray M Iturriza-Gomara E AMaclure and J McLauchlin ldquoDetection by PCR of eight groupsof enteric pathogens in 4627 faecal samples re-examinationof the English case-control Infectious Intestinal Disease Study(1993ndash1996)rdquo European Journal of Clinical Microbiology andInfectious Diseases vol 26 no 5 pp 311ndash323 2007

[9] R F de Boer A Ott B Kesztyus and A M D Kooistra-SmidldquoImproved detection of five major gastrointestinal pathogensby use of a molecular screening approachrdquo Journal of ClinicalMicrobiology vol 48 no 11 pp 4140ndash4146 2010

[10] D M Deer and K A Lampel ldquoDevelopment of a multiplexreal-time PCR assay with internal amplification control for thedetection of Shigella species and enteroinvasiveEscherichia colirdquoJournal of Food Protection vol 73 no 9 pp 1618ndash1625 2010

[11] F Barletta T J Ochoa and T G Cleary ldquoMultiplex real-timePCR (MRT-PCR) for diarrheagenicrdquoMethods inMolecular Bio-logy vol 943 pp 307ndash314 2013

[12] J T Nazeer K El SayedKhalifa H vonThien et al ldquoUse ofmul-tiplex real-time PCR for detection of common diarrhea caus-ing protozoan parasites in EgyptrdquoParasitology Research vol 112no 2 pp 595ndash601 2013

[13] H Yan F Yagyu S Okitsu O Nishio and H Ushijima ldquoDetec-tion of norovirus (GI GII) Sapovirus and astrovirus in fecal

samples using reverse transcription single-round multiplexPCRrdquo Journal of Virological Methods vol 114 no 1 pp 37ndash442003

[14] J Rohayem S Berger T Juretzek et al ldquoA simple and rapidsingle-step multiplex RT-PCR to detect Norovirus Astrovirusand Adenovirus in clinical stool samplesrdquo Journal of VirologicalMethods vol 118 no 1 pp 49ndash59 2004

[15] P Khamrin M Okame AThongprachum et al ldquoA single-tubemultiplex PCR for rapid detection in feces of 10 viruses causingdiarrheardquo Journal of VirologicalMethods vol 173 no 2 pp 390ndash393 2011

[16] O G Gomez-Duarte J Bai and E Newell ldquoDetection ofEscherichia coli Salmonella spp Shigella sppYersinia enteroco-liticaVibrio cholerae and Campylobacter spp enteropathogensby 3-reaction multiplex polymerase chain reactionrdquo DiagnosticMicrobiology and Infectious Disease vol 63 no 1 pp 1ndash9 2009

[17] J S Noel T W Lee J B Kurtz R I Glass and S S MonroeldquoTyping of human astroviruses from clinical isolates by enzymeimmunoassay and nucleotide sequencingrdquo Journal of ClinicalMicrobiology vol 33 no 4 pp 797ndash801 1995

[18] A Kapoor E Slikas P Simmonds et al ldquoA newly identifiedbocavirus species in human stoolrdquo Journal of Infectious Diseasesvol 199 no 2 pp 196ndash200 2009

[19] H Yan T A Nguyen T G Phan S Okitsu Y Li and HUshijima ldquoDevelopment of RT-multiplex PCR assay for detec-tion of adenovirus and group A and C rotaviruses in diarrhealfecal specimens from children in Chinardquo The Journal of theJapanese Association for Infectious Diseases vol 78 no 8 pp699ndash709 2004

[20] A Hidaka T Hokyo K Arikawa et al ldquoMultiplex real-timePCR for exhaustive detection of diarrhoeagenic Escherichiacolirdquo Journal of Applied Microbiology vol 106 no 2 pp 410ndash420 2009

[21] J Li N Y Mao C Zhang et al ldquoThe development of a GeXP-based multiplex reverse transcriptionminusPCR assay for simul-taneous detection of sixteen human respiratory virus typessub-typesrdquo BMC Infectious Diseases vol 12 p 189 2012

[22] M I Gomara D Cubitt U Desselberger and J Gray ldquoAminoacid substitution within the VP7 protein of G2 rotavirus strainsassociated with failure to serotyperdquo Journal of Clinical Micro-biology vol 39 no 10 pp 3796ndash3798 2001

[23] Y Liu Z Q Xu Q Zhang et al ldquoSimultaneous detection ofseven enteric viruses associated with acute gastroenteritis bya multiplexed Luminex-based assayrdquo Journal of Clinical Micro-biology vol 50 no 7 pp 2384ndash2389 2012

[24] M Qin D Wang F Huang et al ldquoDetection of pandemicinfluenza AH1N1 virus by multiplex reverse transcription-PCRwith a GeXP analyzerrdquo Journal of Virological Methods vol 168no 1-2 pp 255ndash258 2010

[25] X Hu Y Zhang X Zhou et al ldquoSimultaneously typing nineserotypes of enteroviruses associated with hand foot andmouth disease by a GeXP analyzer-based multiplex reversetranscription-PCR assayrdquo Journal of Clinical Microbiology vol50 no 2 pp 288ndash293 2012

[26] J Li N Y Mao C Zhang et al ldquoThe development of a GeXP-based multiplex reverse transcription-PCR assay for simulta-neous detection of sixteen human respiratory virus typessub-typesrdquo BMC Infectious Diseases vol 12 no 1 p 189 2012

[27] T T Dung V V Phat T V Nga et al ldquoThe validation and utilityof a quantitative one-stepmultiplex RT real-time PCR targetingrotavirus A and norovirusrdquo Journal of Virological Methods vol187 no 1 pp 138ndash143 2013


[28] D Wiemer U Loderstaedt H von Wulffen et al ldquoReal-timemultiplex PCR for simultaneous detection of Campylobacterjejuni Salmonella Shigella andYersinia species in fecal samplesrdquoInternational Journal of Medical Microbiology vol 301 no 7 pp577ndash584 2011

[29] N Jourdan J P Brunet C Sapin et al ldquoRotavirus infectionreduces sucrase-isomaltase expression in human intestinal epi-thelial cells by perturbing protein targeting and organization ofmicrovillar cytoskeletonrdquo Journal of Virology vol 72 no 9 pp7228ndash7236 1998

[30] J L Nordstrom M C L Vickery G M Blackstone S LMurray andADePaola ldquoDevelopment of amultiplex real-timePCR assay with an internal amplification control for the detec-tion of total and pathogenicVibrio parahaemolyticus bacteria inoystersrdquoApplied andEnvironmentalMicrobiology vol 73 no 18pp 5840ndash5847 2007

[31] J Chen J Tang J Liu Z Cai andX Bai ldquoDevelopment and eva-luation of a multiplex PCR for simultaneous detection of fivefoodborne pathogensrdquo Journal of Applied Microbiology vol 112no 4 pp 823ndash830 2012

[32] B Malorny J Hoorfar C Bunge and R Helmuth ldquoMulticentervalidation of the analytical accuracy of SalmonellaPCR towardsan international standardrdquoApplied and Environmental Microbi-ology vol 69 no 1 pp 290ndash296 2003

[33] M Zhang Y Gu L Ran and J Zhang ldquoMulti-PCR identifi-cation and virulence genes detection of Campylobacter jejuniisolated from Chinardquo Zhonghua liuxingbingxue zazhi vol 28no 4 pp 377ndash380 2007

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


transcription (RT-PCR) provide powerful tools [8] whichhave markedly improved the detection of enteric pathogens[9] In the last few years the multiplex real-time polymerasechain reaction (RT-PCR) has been successfully performed toidentify different enteric pathogens simultaneously [1 10ndash12]However these methods are either low throughput (4 patho-genstube at most) or expensive (fluorescence probe) whichdoes not allow rapid screening of large numbers of stool sam-ples Furthermore almost all of the reported multiplex PCRmethods are able to detect either viral pathogens [13ndash15] orbacterial pathogens [16] but few studies reported the simul-taneous detection of viral and bacterial pathogens within thesame sample which is essential to elucidate the potential syn-ergy between enteric virus and bacteria and reveal the clinicalrelevance between viral and bacterial infections Althoughseveral multiplex molecular assays such as Luminex GPPand Seegene Diarrhea ACE are commercially available theextremely high price made them unaffordable methods forroutine use in provincial Centers for Diseases Control andPrevention China Therefore a rapid sensitive specific andcost-effective diagnosticmethodwhich detects virus and bac-teria simultaneously would be highly preferred for routinelaboratory testing

Here we describe the development of a one-step multi-plex PCR assays (two-tube assay) for the simultaneous detec-tion of 13 most commonly found diarrhea-causative virusesor bacteria Tube 1 is used for the detection of 6 diarrhea-associated viruses including rotavirus A (RVA) noroviruses(NoVs) genogroups GI and GII human astrovirus (HAstV)enteric adenoviruses (EAds) and human bocavirus (HBoV)(Qiaxcel-V assay) and tube 2 is used for the detection of7 diarrhea-associated bacteria including Salmonella Vibrioparahaemolyticus diarrheagenic Escherichia coli Campy-lobacter jejuni Shigella Yersinia and Vibrio cholera (Qiaxcel-B assay) using the same samples from patients with gas-troenteritis The analytical specificity and sensitivity wereexamined and the clinical performance of the two-tube assaywas evaluated by comparing the results with those obtainedfrom reported PCR assay or commercial kits

2 Materials and Methods

21 Virus Strains and Clinical Samples Two test panels ofviral and bacterial samples used in this study are listed inTables 1 and 2 The virus test panel consisted of 47 clinicalsamples previously determined by PCR and sequencingconducted by the Diarrhea Department National Institutefor Viral Disease Control and Prevention (DD-IVDC) Thebacterial test panel consisted of 27 preserved strains or clini-cal isolates previously determined by cultural and molecularidentification by the Diarrhea Department National Institutefor Infectious Disease Control and Prevention (DD-ICDC)A total of additional 122 fecal samples were selected from thecollection obtained during routine virus and bacteria surveil-lance conducted byDD-IVDC All of the fecal specimens andclinical data were collected from January 2012 to December2012 from hospitalized children under 5 years old diagnosedof acute diarrhea All aspects of the study were performed inaccordance with national ethics regulations and approved by

the Institutional Review Boards of CCDC Childrenrsquos parentswere apprised of the studyrsquos purpose and of their right to keepinformation confidentialWritten consent was obtained fromchildrenrsquos parents RVA was identified using a commercialProSpecT rotavirus ELISA kit (Oxoid Hants UK) Norovirusand enteric adenovirus were identified using reported multi-plex PCR assay while the HAstV and HBoV were identifiedusing monoplex PCR followed by sequencing [13 17ndash19]at DD-IVDC All specimens were processed by routineisolationculture to identify different enteropathogenic bac-teria at DD-ICDC The diarrheagenic Escherichia coli wereidentified using multiplex real-time PCR assay [20] In orderto facilitate the presentation these methods are defined asldquoreference methodsrdquo in the following text and the test resultsof reference methods are called ldquoreference resultsrdquo

22 Primers Primers for Vibrio cholera Eads and HBoVwere designed from conserved regions of the viral andbacterial genomes using Primer-Premier software version50 For all primer sequences BLAST analysis was performedto ensure specificity and no sequence cross-reactivity wasobserved Primers for other targeted virus and bacteria wereadapted or modified from previous references In total 14pairs of chimeric primers sequences the target genes andthe amplicon sizes are listed in Table 3 One pair of universalprimers was adapted from our previous studies [21] Thechimeric primers consisted of a gene-specific sequence fusedat the 51015840 end to the universal sequence thus all of thechimeric primers are with similar annealing temperatures toassure the approximate amplification efficiency

23 Nucleic Acid Extraction Total nucleic acid was extractedfrom 200120583L of a 10 fecal suspension prepared in normalsaline using theMasterPure Complete DNA and RNA purifi-cation kit (Epicenter Technologies Madison WI) accordingto the manufacturerrsquos instructions The extracts were elutedin 50120583L of DNase- and RNase-free water and stored atminus80∘C

24 Multiplex PCR Two multiplex PCR assays were devel-oped in this study Six enteric viruses were detected byQiaxcel-V assay in tube 1 while the 7 enteric bacteria weredetected by Qiaxcel-B assay in tube 2 simultaneously

For the Qiaxcel-V assay the multiplex RT-PCR wasperformed with a One-Step RT-PCR kit (Qiagen HildenGermany) in a 25120583L volume containing 125 pmol each ofthe forward and reverse viral chimeric primer mix 125 pmoleach of the forward and reverse universal primer mix 4 120583Lof template nucleic acid and 01 120583L of ribonuclease inhibitor(Takara Dalian China) and RNase-free water The RT-PCR mixture was subjected to the following amplificationconditions 50∘C for 30min and 95∘C for 15min followed by10 cycles of 95∘C for 30 s 56∘C for 30 s and 72∘C for 60 s 10cycles of 95∘C for 30 s 68∘C for 30 s and 72∘C for 60 s 20cycles of 95∘C for 30 s 50∘C for 30 s and 72∘C for 60 s anda final incubation of 72∘C for 3min For the Qiaxcel-B assaythe multiplex PCR was performed with a Multiplex PCR kit(Qiagen Hilden Germany) in a 25 120583L volume containing125 pmol each of the forward and reverse bacterial chimeric



























































Pathogen Qiaxcel+b






3 Results








1 2 3 4 5 6 7

1000 bp


210 bp

162bp

15bp

(a)

8 9 10 11 12 13 14 15

1000 bp627bp507bp

389bp323bp293bp246bp213 bp

15bp

(b)


M M1 2 3 4 5 6 7

1000 bp


200 bp

100 bp

(a)

M M8 9 10 11 12 13 14 15

1500bp1000 bp

600bp500bp400bp300bp200 bp

100 bp

(b)


4 Discussion
















Disclaimer







Acknowledgment


References









































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of










































































Pathogen Qiaxcel+b






3 Results








1 2 3 4 5 6 7

1000 bp


210 bp

162bp

15bp

(a)

8 9 10 11 12 13 14 15

1000 bp627bp507bp

389bp323bp293bp246bp213 bp

15bp

(b)


M M1 2 3 4 5 6 7

1000 bp


200 bp

100 bp

(a)

M M8 9 10 11 12 13 14 15

1500bp1000 bp

600bp500bp400bp300bp200 bp

100 bp

(b)


4 Discussion
















Disclaimer







Acknowledgment


References









































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of









































Pathogen Qiaxcel+b






3 Results








1 2 3 4 5 6 7

1000 bp


210 bp

162bp

15bp

(a)

8 9 10 11 12 13 14 15

1000 bp627bp507bp

389bp323bp293bp246bp213 bp

15bp

(b)


M M1 2 3 4 5 6 7

1000 bp


200 bp

100 bp

(a)

M M8 9 10 11 12 13 14 15

1500bp1000 bp

600bp500bp400bp300bp200 bp

100 bp

(b)


4 Discussion
















Disclaimer







Acknowledgment


References









































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of


















Pathogen Qiaxcel+b






3 Results








1 2 3 4 5 6 7

1000 bp


210 bp

162bp

15bp

(a)

8 9 10 11 12 13 14 15

1000 bp627bp507bp

389bp323bp293bp246bp213 bp

15bp

(b)


M M1 2 3 4 5 6 7

1000 bp


200 bp

100 bp

(a)

M M8 9 10 11 12 13 14 15

1500bp1000 bp

600bp500bp400bp300bp200 bp

100 bp

(b)


4 Discussion
















Disclaimer







Acknowledgment


References









































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















1 2 3 4 5 6 7

1000 bp


210 bp

162bp

15bp

(a)

8 9 10 11 12 13 14 15

1000 bp627bp507bp

389bp323bp293bp246bp213 bp

15bp

(b)


M M1 2 3 4 5 6 7

1000 bp


200 bp

100 bp

(a)

M M8 9 10 11 12 13 14 15

1500bp1000 bp

600bp500bp400bp300bp200 bp

100 bp

(b)


4 Discussion
















Disclaimer







Acknowledgment


References









































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of


























Disclaimer







Acknowledgment


References









































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















Acknowledgment


References









































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of




























of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of





















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















Documents

Research Article A Two-Tube Multiplex Reverse ...downloads.hindawi.com/journals/bmri/2014/648520.pdfResearch Article A Two-Tube Multiplex Reverse Transcription PCR Assay for Simultaneous