333

EurAsian Journal of BioSciences Eurasia J Biosci 13, 333-339 (2019)

Development new multiplex reverse transcription quantitative real time polymerase reaction to detect human norovirus genogroups I and II

Nadira Salman Mohamed 1*, Shaymaa Naji Dahham 2, Mohammed Nadhir Maaroof 3 1 Forensic DNA Center for Research and Training, Al-Nahrain University, IRAQ 2 Department of Biology, College of Education, University Samarra, IRAQ 3 Department of Biology, College of Education for Pure Science, Tikrit University, IRAQ *Corresponding author: nadmohamed2000@yahoo.com

Abstract Norovirus (NV) is considering a highly contagious virus due to the increase in the number of cases of the virus in recent years. Therefore, there is a need to develop rapid, specific and sensitive molecular detection and diagnosis methods. Using the data from the National Center of Bioinformatics Information (NCBI), the sequence of more than 1000 Norovirus genogroupII genome and 39 genome of geno group I were chosen to select a common conserve region for all genotypes within the first group and the second group suitable for the design of primers and probes. The design of the first area of the junction of Open Reading Frame one (ORF) and the open reading frame two (ORF2), and the primers and probes were tested on samples of compared to the primers and using one step reverse transcription real time PCR. The kit designed for multiplex reverse reaction possess no overlap or interaction in the components of primers and probes of the two genogroups, also it is superior on the monoplex mixture of the previous kit, Norovirus being diagnosed in 45% of samples by primers and probes designed in this study, 10% of the samples were belong to the genogroupI and 35% of the samples belong to the genogroupII in comparing with virus results that tested with monoplex previous primers and probes accounted 44% , the genogroupI represented 10% and genogroupII II represented 34% of the tested samples. The use of the multiplex kit contributes to shortening the time and the largest number of samples and reduce amount of the solutions used, more than the monoplex reaction, as it should be performed separately for each genetic group. Keywords: norovirus, genotypes, primer, probe, multiplex RT-Rpcr Mohamed NS, Dahham SN, Maaroof MN (2019) Development new multiplex reverse transcription quantitative real time polymerase reaction to detect human norovirus genogroups I and II. Eurasia J Biosci 13: 333-339. © 2019 Mohamed et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License.

INTRODUCTION The Norovirus were defined as the main cause of

epidemic stomach and duodenum and that is important of infected both of them between individual of all ages in development countries (Class et al. 2009). People may still be infected and even after diarrhea and symptoms disappear. That the infected host can shedding virus in the stool for more than two weeks after healed (Patel et al. 2008). The virus causes 70% of infectious diarrhea episodes in the infant age group (Green et al. 2000). Norovirus belongs to the family of viruses Caliciviridae and consists of a positive single stranded RNA sized about 7.7 k base pair and contains three open reading frames(ORF) encoded virus proteins (Ebrahimi and Rashidinia 2014, Kageyama et al. 2004). The first reading frame encodes a number of non-synthetic proteins responsible for gene multiplication, including the gene responsible for RNA dependent RNA polymerase (Rd-Rp) and nucleotide triphosphate (NTPases) and protease. The framework of the second

and third open reading is encoding to Major Capsid Protein (Vp1) and Miner Capsid protien2 (Vp2), respectively (Al-Esami et al. 2018, Hall et al. 2013). There are 35 different genotypes currently classified into five major gene groups depending on the gene of the enzyme polymerase: The first genetic group (NVGI) comprises 14 genotypes and the second genetic group (NVGII) includes 17 genotypes and includes the third genetic group (NVGIII) has two genotypes. The fourth group (NVGIV) has one genotype and the fifth (NVGV) has one genotype (Huhtia et al. 2014). Most variations in the viral capsid 2 (VP2) zone over time result in new strains of the virus causing acute encephalitis in children (Farkasa et al. 2015). These variations are a major cause of the difficulty in diagnosing the virus at the immune and molecular level, which has led many

Received: September 2018 Accepted: February 2019

Printed: May 2019

EurAsian Journal of BioSciences 13: 333-339 (2019) Mohamed et al.

334

researchers to seek to develop a number of laboratory or mono-multiple to detect the genotypes of the virus (Niwa et al. 2014).

To develop a number of laboratory can detect all viral patterns and effectively and quickly to facilitate the identification of the disease and determine the appropriate treatment for short time and effort and reduce the suffering of the patient and waste in medicines and treatments may not need if diagnosed with accurate diagnosis we sought this study (Tak and Ehi 2018).

MATERIALS AND METHODS One thousands sequences of NVG II genome and 39

genome of NVGI were chosen to select a common conserve region of all genotypes targeting the junction of ORF1 and ORF2 within the first group and the second group suitable for primers and probes Insilco design using CLC work bench genome software, BioEdit program, Primer 3 plus program and NCBI primer blast. All interference cases between the probes and probes were examined and the autodimer and heterodimer were excluded the best sets of primers were chosen according to the optimal criteria for selecting the primers. The final designed primers, probes, the internal control probe 16 sRNA, and the positive control of the targeted

flanked region area were sent to Integrated DNA Technologies (IDNAT) for synthesis Table 1.

Preparation of positive control the capsid gene (654 bp for NVGI; 565 bp for NVGII Fig. 2 was amplified by conventional PCR using the primers sets mention in

Fig. 1. Genome structure of Norovirus

Table 1. The designed primers and probes that used to detect NVGI, II by RT-rPCR Primer characters

Position Nucleotide sequences of primers Geno-group Size

Amplicon GC% Melting temperature.

Primer length

58.82 62.61 17 5074-5090 NG2f1: TCGCAATCTGGCTCCCA NVGII 60 bp 58.82 60.18 17 5019-5038 NG2r1a: ATCAGATGGGCTGGCGT 60 bp 52.63 62.50 19 5019-5038 NG2r1b: ATCAGATGGGTTGGCGTCA 62 bp 58.82 60.04 17 5019-5038 NG2r1c: TAGATGGAGCGGCGTCA

50.00 63.18 20 5096-5114 NG2pr: FAM- TGTGAATGAAGATGGCGTCG-BHQ 55.56 58.19 18 5358-5376 NG1F1: TTGTGGACAGGAGATCGC NVGI

102 bp 57.89 59.05 19 5441-5459 NG1R1a: AACTGACCAGCGCCACTAG 117 bp 55.56 59.09 18 5457-5474 NG1R1b:TTAACCTCCGGCACCAGT 120 bp 52.38 59.12 21 5458-5478 NG1R1c: TGTATTAGCCTCCGGTACCAG

55.00 62.46 20 5401-5420 NG1Pr :VIC ATGATGGCGTCTAAGGACGC-BHQ BHQ= black hole quencher; FAM= 6‐carboxyfluorescein; HEX, hexachloro‐6‐carboxy‐fluorescein

Table 2. Designed primers that used to amplified the flanking region Primer characters

Nucleotide sequences of primer Genogroup Amplicon size GC% Melting temp. Primer

length

565 bp 52.63 58.01 19 NVG2F: ACTTTCCTGCGGAGAACTG NVGII 50.00 59.66 20 NVG2R: TGGAGCGTTTCTAGGGGATA

654 bp 47.62 58.20 21 NVG1F: GGTTCCAAGGCAGGTTAGATA NVGI 41.76 57.82 24 NVG1R: AGCTAGCATAATCCTGACTCTCAT

Fig. 2. The NVGI, II flanking region sequences

EurAsian Journal of BioSciences 13: 333-339 (2019) Mohamed et al.

335

Table 2. Cloning enclosed area was done in the PUC57 vector and mixed the materials as in Table 3 to prepare Topo® Cloning Reaction and incubated at room temperature 22-25 ° C for 5 minutes and placed on ice, transformed of the carrier into the competent cells of the qualified bacteria using the TOP10 kit (Invitrogen, Carlsbad, CA, USA) and cloning vector purified with plasmid isolation kit (QIA prep® spin miniprep kit from Qiagen) according to the manufacturer’s instructions.

The concentration and purity of the coupling bus was measured by the Nanodrop device. The Standard Curve was performed for both genogroups to be used to identify the gene exacting copies in the reaction with a range of 1 × 102 to 2 × 1011 genome for each test using the iQ-Mutiplex power components with the designed primers, probes and positive control. A 10‐fold serial dilution of standard cDNA plasmids was used as a standard curve assay for quantification of copies, DNA concentration started from 50 ng/μl for the two genogroups and in three replica according to the reaction mixture shown in Table 4 and optimal reaction conditions in the RT-qPCR device reached after several attempts, as following conditions: One cycle at 95°C for 10 min , 45 cycles second denaturation at 95°C for 10 s, annealing and extension at 60°C for 40s using iQ Multiplex Powermix from Bio-Rad, and the amplification data were collected and analyzed with Bio-Rad CFX96 machine (USA).

Clinical Specimen Assessment About 100 stool specimens 50 samples previously

tested against Norovirus showed 40 samples were positive to NVGII and 10 samples were positive to NVGI and 50 samples were negative to NVG infection, identified by our (Mohamed et al. 2013) the monoplex RT-rPCR was described by the Lazaro (2010) study. The viral RNA was extracted from preserved stool specimens in -70C using QIAamp™ Viral RNA Mini Kit (QIAGEN, Hilden, Germany). The target genes were detected using Path-ID™ Multiplex One-Step RT-PCR Kit (USA) according to the manufacturing instruction The program including: One cycle at 48°C for 10 min and 95°C for 10 min , 45 cycles second denaturation at 95°C for 10 s, and annealing and extension at 60°C for 40s.

Statistical analysis with program was performed using SPSS version 12.0 (SPSS, Chicago, IL, USA). Values of P<0.05 were considered significant.

RESULTS The multi-reverse design kit has outperformed the

previous kit to ensure the active detection of a broad range of NVGI, II genotypes because of the various genetic clusters, the percentage of the virus detected was 100% (50/50), the first group was 20% (10/50), and the second group was represented 80% (40/50) on the other hand the 10% (5/50) of negative group were found positive to NVGII and 2% (1/50) were found positive to NVGI of the total tested specimens in compared with previous results of monoplex detection that mention by

Table 3. Components of the cloning reaction Reagent Volume 1 Fresh PCR product 2 µl 2 Salt Solution 1 µl 3 Water 2 µl 4 Topo Vector 1 µl 5 Final Volume 6 µl

Table 4. The reaction mixture of RT-rPCR Components Per rxn (μl) 1 iQ-Mutiplex power Mix 2x 10 µl 2 Primer NVG1mix (10 µM each) 1 µl 3 Primer NVG2mix (10 µM each) 1 µl 4 Probe NVG1 (10 µM) 1 µl 5 Probe VNG2 1 µl 6 Positive control 12و 4 µl 7 ddH2O 2µl Total 20 µl

Table 5. Components of the main reaction mixture of multiplex RT-rPCR

Components Per rxn (μl) 24Samples 1 iQ-Mutiplex power Mix 2x 10 µl 240 µl

2 Primer NVG1mix (10 µM each) 1 µl 24 µl

3 Primer NVG2mix (10 µM each) 1 µl 24 µl

4 Probe NVG1 (10 µM) 1 µl 24 µl 5 IC Probe 1 µl 24 µl 6 IC primer mix 1 µl 24 µl 7 Positive control 12و 4 µl 96 µl 8 ddH2O 2µl 24 µl Total 20 µl 480 µl

Table 6. Standard curve coefficients and multiplication cycles for each concentration of the NVGII

Well Fluor Content Cq SQ D01 FAM Std-01 16.37 1000000.00000 D02 FAM Std-02 19.74 100000.00000 D03 FAM Std-03 23.16 10000.00000 D04 FAM Std-04 26.69 1000.00000 D05 FAM Std-05 30.66 100.00000 D06 FAM Std-06 33.38 10.00000 D08 FAM Std-08 0.10000 D09 FAM Std-09 0.01000 D10 FAM Std-10 38.03 0.00100 E01 FAM Std-01 16.32 1000000.00000 E02 FAM Std-02 19.78 100000.00000 E03 FAM Std-03 23.11 10000.00000 E04 FAM Std-04 1000.00000 E05 FAM Std-05 27.03 100.00000 E06 FAM Std-06 33.74 10.00000 E08 FAM Std-08 0.10000 E09 FAM Std-09 0.01000 E10 FAM Std-10 0.00100 F01 FAM Std-01 16.32 1000000.00000 F02 FAM Std-02 19.60 100000.00000 F03 FAM Std-03 23.18 10000.00000 F04 FAM Std-04 26.49 1000.00000 F05 FAM Std-05 30.23 100.00000 F06 FAM Std-06 33.54 10.00000 F08 FAM Std-08 0.10000 F09 FAM Std-09 38.59 0.01000 F10 FAM Std-10 0.00100

*(Cq) quantification cycle: Is the cycle in which the amplification curve is at its maximum bend (Ct)Cycle threshold*: Is the intersection point between the amplification line and the threshold line which is relatively indicative of concentration.

EurAsian Journal of BioSciences 13: 333-339 (2019) Mohamed et al.

336

Mohamed et al 2013. The sensitivity for NVGI, NVGII were found 100%, and 100%, and the specificity 90%, and 91% respectively. The greater genetic variability and the viral patterns in the second genotype are more. Detection therefore requires the improvement and redesign of a continuously efficient laboratory number that accommodates all possible variations. The Norovirus assay by RT-PCR has been tedious because of the need for multiple primer sets to identify viruses from the different genotypes. The use of the multiplex kit contributes to shortening the time and the largest number of samples. Half of the interaction is single and must be performed separately for each genetic group. As increasingly numbers of the dynamic range of our designed multiplex real-time RT-PCR was determined by using a 10-fold serial dilution of a NVGI and a NVGII plasmid DNA standard containing the appropriate flanking region fragment as described previously. The concentration, the number of copies of the gene used, and the Ct thresholds were showed in Tables 6, 7 and 8. The standard curves for GI and GII showed linearity between 1 × 102 to 1 × 10-11 genome equivalents per assay with a slope of -3.247, the correlation coefficients of R ^ 2 =0.998 indicate a strong linear relationship with efficiency of E = 103.2% and Y-intercept (Y-int) =34.05 Fig. 3. The standard curve of the second group of genes showed the linear relationship of the equivalent 1 × 10-2

-1 × 10-11 with efficiency of E =131.3% with a slop= 2.74, correlation coefficient of R ^ 2 =0.946 and Y-int= 34.05 Fig. 4. No cross-reactivity between GI, GII, and IC using the three different dye-layers of FAM, VIC, and Texas red were observed. The standard curves showed linearity between 1 × 10-5 to 1 × 10-11 genome equivalents per assay. Multiplex standard curve showed an efficient linear relationship E = 81.7, 64.7, 71.7 and a strong correlation coefficient R ^ 2 = 0.998, 0.988, 0.988 and a slope of -3.854, -0.4.613, -4.258, Y-int= 45.91,

51.26, 44.10 with no overlap of the interaction components between the first group and the second. Internal control was added to the multivariate as a final step to complete the diagnostic kit using the two sets of sensors with the internal control and the Texas red probe, shown in Fig. 6. A slight overlap of the reaction components of the first and second genotypes with internal control was observed.

DISCUSSION For the fast, accurate Norovirus both gene groups

diagnoses in mass outbreaks that may occurring in the winter seasons the multiple mixture within a single reaction is preferred especially with the kit provides the rest of the reaction components, including the buffer solution and polymerase of any company. Because of the highly genetic diversity of the NV of selected the conserved region is very critical for primers and probes design covering all genotypes. The differences and variation was noticed between NVGI and NVGII sequences are considerable in the ORF1 -ORF2 junction with highly homology inside the same

Table 7. The standard curve coefficients and multiplication cycles for each concentration of the first genetic group

Well Fluor Content Cq SQ A01 VIC Std-1 13.21 1000000.00000 A02 VIC Std-2 16.33 100000.00000 A03 VIC Std-3 18.94 10000.00000 A04 VIC Std-4 22.53 1000.00000 A05 VIC Std-5 25.64 100.00000 A06 VIC Std-6 28.93 10.00000 B01 VIC Std-1 13.02 1000000.00000 B02 VIC Std-2 16.02 100000.00000 B03 VIC Std-3 19.02 10000.00000 B04 VIC Std-4 22.46 1000.00000 B05 VIC Std-5 26.11 100.00000 B06 VIC Std-6 29.10 10.00000 B07 VIC Std-7 32.76 1.00000 B08 VIC Std-8 35.29 0.10000 C01 VIC Std-01 12.58 1000000.00000 C02 VIC Std-02 16.17 100000.00000 C03 VIC Std-03 19.06 10000.00000 C04 VIC Std-04 22.48 1000.00000 C05 VIC Std-05 26.10 100.00000 C06 VIC Std-06 28.79 10.00000 C07 VIC Std-07 32.63 1.00000 C08 VIC Std-08 0.10000

Table 8. The standard curve coefficients and multiplication cycles for each concentration of the NVGII

Well Fluor Content Cq SQ A01 FAM Std-1 12.74 1000000.00000 A02 FAM Std-2 16.02 100000.00000 A03 FAM Std-3 19.05 10000.00000 A04 FAM Std-4 22.69 1000.00000 A05 FAM Std-5 25.94 100.00000 A06 FAM Std-6 29.36 10.00000 A07 FAM Std-7 33.38 1.00000 B01 FAM Std-1 12.62 1000000.00000 B02 FAM Std-2 15.73 100000.00000 B03 FAM Std-3 19.17 10000.00000 B04 FAM Std-4 22.41 1000.00000 B05 FAM Std-5 26.01 100.00000 B06 FAM Std-6 29.24 10.00000 B07 FAM Std-7 33.31 1.00000 C01 FAM Std-1 12.59 1000000.00000 C02 FAM Std-2 15.88 100000.00000 C03 FAM Std-3 19.00 10000.00000 C04 FAM Std-4 22.54 1000.00000 C05 FAM Std-5 25.98 100.00000 C06 FAM Std-6 29.54 10.00000 C07 FAM Std-7 32.98 1.00000 A01 VIC Std-1 18.03 1000000.00000 A02 VIC Std-2 21.59 100000.00000 A03 VIC Std-3 23.78 10000.00000 A04 VIC Std-4 27.76 1000.00000 A05 VIC Std-5 30.48 100.00000 A06 VIC Std-6 34.20 10.00000 A07 VIC Std-7 37.90 1.00000 B01 VIC Std-1 18.01 1000000.00000 B02 VIC Std-2 20.61 100000.00000 B03 VIC Std-3 24.19 10000.00000 B04 VIC Std-4 27.20 1000.00000 B05 VIC Std-5 30.76 100.00000 B06 VIC Std-6 33.95 10.00000 B07 VIC Std-7 38.28 1.00000 C01 VIC Std-1 17.44 1000000.00000 C02 VIC Std-2 20.67 100000.00000 C03 VIC Std-3 23.62 10000.00000 C04 VIC Std-4 27.26 1000.00000 C05 VIC Std-5 30.56 100.00000 C06 VIC Std-6 33.95 10.00000 C07 VIC Std-7 37.72 1.00000

EurAsian Journal of BioSciences 13: 333-339 (2019) Mohamed et al.

337

genogroup as mention by Kageyama et al. (2003) Hoehne and Schreier (2006). The designed primers/probes were free from modified bases and two sets including one probe and three revers primers and one forward primer being high broadly reactive for both

genogroups that consistent with several author’s (Kageyama et al. 2003, Pusch et al. 2005). The slope is a measure of the reaction efficiency. The efficiency should be more close to 100% as possible as, which may be equivalent to a slope of -3.32 as refers by Yuan et al. (2006), so that the slope depends on the dilution factors and the efficiency indicated slopes for Ct and logarithm transformed concentrations for two groups

were not significantly different from -1 a simple linear relationship was observed between the Ct number and logarithm transformed concentration. The y-intercept is gives some augury of the sensitivity of the assay but less repeatable than the slope. Due to the slight overlap in the three tinctures, the slope values were slightly reduced in multiplex amplification plots. Correlation coefficient (R2): The correlation coefficient defined as the square of a correlation coefficient of receding reverberate the linearity of the standard curve, it may indicate how especially the line fits the data. The R2 in RT-qPCR analysis should be > 0.99, our finding about R2 in multiplex reaction (0.998, 0.988) showed that the

Fig. 3. The standard amplification plot monoplex curve of the positive control of the NVGII

Fig. 4. The standard curve of amplification plot monoplex of the positive control of NVGI

Fig. 5. The standard curve of the amplification plot multiplex diagnostic mixture for Norovirus I,II genotypes

EurAsian Journal of BioSciences 13: 333-339 (2019) Mohamed et al.

338

standard curve was constructed precisely. We conclude that the one-step RT-qPCR assay enables sensitive, specific, and rapid detection of the major Acute Norovirus viral gastroenteritis, the quantitation information yielded by the assay are very useful for clinical research especially in the context of mixed infections which consistent with Liu et al. (2011).

CONCLUSION The designed one-step RT-qPCR multiplex has the

ability to diagnose both gene groups in a multiple mixture within a single reaction rather than two separate reactions of the single gene. It can be provides the rest of the reaction components, including the buffer solution and polymerase of any company.

REFERENCES Al-Esami HH, AL-Ramadhan Z, Ahmed AS, Shihab Z, Farhan FK (2018) Improve the surface hardness of the blend

PMMA/n-MgTiO3 to resist caries and bacteria. Electronic Journal of General Medicine, 15(6): em91. https://doi.org/10.29333/ejgm/94043

Class RI, Parashar UD, Estes MK (2009) Norovirus gastroenteritis. New England Journal of Medicine, 361: 1776-85. https://doi.org/10.1056/NEJMra0804575

Ebrahimi N, Rashidinia J (2014) Spline Collocation for Volterra-Fredholm Integro-Differential Equations. UCT Journal of Research in Science, Engineering and Technology, 2(1).

Farkasa T, Singha A, Françoise S, Guyaderb L, Rosac LG, Saifd L, McNeala M (2015) Multiplex real-time RT-PCR for the simultaneous detection and quantification of GI, GII and GIV noroviruses, Journal of Virological Methods, 223: 109-14. https://doi.org/10.1016/j.jviromet.2015.07.020

Green KY, Ando T, Balayan MS, Berke T, Clarke IN, Estes MK, Maston DO, Nakata S, Neill JD, Studdert MJ, Thiel HJ (2000) Taxonomy of the caliciviruses. J Infect, 181: 322-30. https://doi.org/10.1086/315591

Hall AJ, Lopman BA, Payne DC, Patel MM, Gastañaduy PA, Vinjé J, Parasha UD (2013) Norovirus Disease in the United States. J. Emerging. Infect. Dis., 19(8): 1198-1205. https://doi.org/10.3201/eid1908.130465

Hoehne M, Schreier E (2006) Detection of Norovirus genogroup I and II by multiplex real-time RT-PCR using a 3’-minor groove binder-DNA probe. BMC infectious diseases, 6(1): 69. https://doi.org/10.1186/1471-2334-6-69

Huhtia L, Blazevica V, Puustinenb L, Hemminga M, Salminena M, Vesikaria T (2014) Genetic analyses of norovirus GII.4 variants in Finnish children from 1998 to 2013 Author links open overlay Infection, Genetics and Evolution, 26: 65-71. https://doi.org/10.1016/j.meegid.2014.05.003

Kageyama T, Kojima S, Shinohara M, Uchida K, Fukushi S, Hoshino FB, Takeda N, Katayama K (2003) Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J Clin Microbiol, 41: 1548-57. https://doi.org/10.1128/JCM.41.4.1548-1557.2003

Kageyama TM, Shinohara K, Uchida S, Fukushi FB, Hoshino S, Kojima R, Takai T, Oka N, Takeda and Katayama K (2004) Coexistence of multiple genotypes, including newly identified genotypes, in outbreaks of gastroenteritis due to Norovirus in Japan. J. Clin. Microbiol., 42: 2988-95. https://doi.org/10.1128/JCM.42.7.2988-2995.2004

Kinzelman J, Leittl M (2012) Validity of Composite Sampling for Enumerating E. coli from Recreational Waters by Molecular Methods (qPCR) (In) Significance of Faecal Indicators in Water – A Global Perspective, Kay and Fricker (Eds). Royal Society of Chemistry, London. 188p.

Lazaro DR (2010) Detection and quantification of Norovirus by real time PCR. SOP Vita l018.

Fig. 6. The standard curve of multiple NUO diagnostic mixture for positive control of the NVGI, and NVGII of labeled with FAM and VIC respectively, and the internal control labeled with Texas red

EurAsian Journal of BioSciences 13: 333-339 (2019) Mohamed et al.

339

Liu J, Kibiki G, Maro V, Maro A, Kumburu H, Swai N, Taniuchi M, Gratz J, Toney D, Kang G, Houpt E (2011) Multiplex reverse transcription PCR Luminex assay for detection and quantitation of viral agents of gastroenteritis. J Clin Virol., 50(4): 308-13. https://doi.org/10.1016/j.jcv.2010.12.009

Mohamed NS, Habeb KA, Nasser FG, Ahmed MA, Ali KL, Najim AT (2013) The incidence of Norovirus compared with Rotavirus in Baghdad City. IJAR, 1: 855-863.

Niwa S, Tsukagoshi H, Ishioka T, Sasaki Y, Yoshizumi M, Morita Y, Kimura H, Kozawa K (2014) Triplex real‐time polymerase chain reaction assay for detection and quantification of norovirus (GI and GII) and sapovirus. Microbiol Immunol., 58: 68-71. https://doi.org/10.1111/1348-0421.12107

Patel MM, Widdowson M, Glass GI, Akazawa K, Vinjé J, Parashar UD (2008) Systematic Literature Review of Role of Noroviruses in Sporadic Gastroenteritis. Emerg Infect Dis., 14(8): 1224–31. https://doi.org/10.3201/eid1408.071114

Pusch D, Oh DY, Wolf S, Dumke R, Schröter-Bobsin U, Höhne M, Röske I, Schreier E (2005) Detection of enteric viruses and bacterial indicators in German environmental waters. Archives of virology, 150(5): 929-47. https://doi.org/10.1007/s00705-004-0467-8

Tak AZA, Ehi Y (2018) Assessment of Neurological Diagnoses in Patients Applying to the Health Board. J Clin Exp Invest., 9(3): 126-30. https://doi.org/10.5799/jcei.458760

Yuan JS, Reed A, Chen F, Stewart NC (2006) Statistical analysis of real-time PCR data. BMC Bioinformatics, 7: 85. https://doi.org/10.1186/1471-2105-7-85

www.ejobios.org