International Immunopharmacology 14 (2012) 558–569

Contents lists available at SciVerse ScienceDirect

International Immunopharmacology

j ourna l homepage: www.e lsev ie r .com/ locate / in t imp

Protosappanin A inhibits oxidative and nitrative stress via interfering the interactionof transmembrane protein CD14 with Toll-like receptor-4 inlipopolysaccharide-induced BV-2 microglia

Ke-Wu Zeng, Ming-Bo Zhao, Zhi-Zhong Ma, Yong Jiang, Peng-Fei Tu ⁎State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Peking University Health Science Center, Beijing 100191, China

Abbreviations: ROS, reactive oxygen species; RNS,nitric oxide; PTA, protosappanin A; TLR4, Toll-like rsynthase; LPS, lipopolysaccharide.⁎ Corresponding author.

E-mail address: pengfeitu@vip.163.com (P.-F. Tu).

1567-5769/$ – see front matter © 2012 Elsevier B.V. Allhttp://dx.doi.org/10.1016/j.intimp.2012.09.004

a b s t r a c t

a r t i c l e i n f o

Article history:Received 2 June 2012Received in revised form 30 August 2012Accepted 10 September 2012Available online 21 September 2012

Keywords:Oxidative stressNitrative stressProtosappanin AToll-like receptor 4CD14

Oxidative and nitrative stresses have been established to play a pivotal role in neuroinflammation. Duringinflammation-mediated neurodegenerative diseases, including Alzheimer's disease and Parkinson's disease,reactive oxygen species (ROS) and nitric oxide (NO) are produced by activated microglia, further inducingincreas.ed neuronal injury in the brain. Protosappanin A (PTA) is a bioactive compound isolated from a tra-ditional Chinese medicine, Caesalpinia sappan L. (Lignum Sappan), showing immunosuppressive effects.However, the molecular mechanisms responsible for the anti-oxidative and nitrative activity of PTA havenot been elucidated, particularly in central nervous system. In this study, we found that PTA significantlyinhibited ROS and NO production by suppression of NADPH oxidase and inducible nitric oxide synthase(iNOS) activity on lipopolysaccharide (LPS)-stimulated BV-2 microglia. Moreover, PTA modulated IKK/IκB/NF-κB inflammation signal pathway to inhibit the activity and expressions of NADPH oxidase and iNOS. A fur-ther study indicated that PTA didn't inhibit LPS interaction with transmembrane protein CD14, which is a re-ceptor for LPS binding. However, PTA interfered with the interaction of CD14 with Toll-like receptor (TLR4),an early cell event of IKK/IκB/NF-κB inflammation signal activation, resulting in a block on LPS translocationfrom CD14 to TLR4. Therefore, CD14/TLR4 interaction may be a potential drug target inneuroinflammation-related oxidative and nitrative stress. Taken together, these results suggest that PTAhas anti-oxidative/nitrative activities on brain immune and neuroinflammation through regulation ofCD14/TLR4-dependent IKK/IκB/NF-κB inflammation signal pathway.

© 2012 Elsevier B.V. All rights reserved.

1. Introduction

The age-related neurodegenerative diseases exemplified byAlzheimer's disease (AD), Parkinson's disease (PD), amyotrophiclateral sclerosis (ALS), and Huntington's disease are characterizedby the excessive neuroinflammation responses in the brains [1–4].During this process, generation of reactive oxygen/nitrogen species(ROS/RNS) may form cytotoxic metabolites, which are capable ofcausing lipid peroxidation and DNA damage [5,6]. It is well docu-mented that gp91 phox containing NADPH oxidase accelerates cere-bral ROS formation and stimulation of NADPH oxidase activity couldtrigger microglia-dependent production of neurotoxic ROS, furtherinducing neuroinflammatory injury [7,8]. In addition, RNS is anotherkey factor in the pathophysiological response of neuroinflammation[9]. Up-regulation of inducible nitric oxide synthase (iNOS) could

reactive nitrogen species; NO,eceptor-4; iNOS, nitric oxide

rights reserved.

promote production of nitric oxide (NO), one of the major RNS, andneuroprotection by selective inhibition of iNOS has been demonstrat-ed by many studies [10,11]. Therefore, pharmacological interferencewith ROS and RNS-triggered brain injury may represent an importanttherapeutic strategy to oxidative and nitrative stress-associatedneuroinflammatory diseases.

Although several factors appear to underlie the pathological oxi-dative and nitrative stress in the brains, the cause of neuronal inflam-mation seems to be a major one [12,13]. Recently, a great number ofstudies indicate that inflammation inhibition would be one of themost important mechanisms in the prevention of oxidative andnitrative damages during the neurodegenerative process [14,15]. Ithas been found that several proinflammatory cytokines and bacteriallipopolysaccharides (LPS) could stimulate ROS and RNS productionsand promote neuronal oxidative/nitrative damages [16–18]. How-ever, the detailed drug target and regulatory signaling pathway incontrolling neuroinflammation-related oxidative and nitrative stressis still unclear.

Toll-like receptor (TLR4)-mediated inflammatory pathway is asso-ciatedwithmany inflammatory neurological disorders [19]. The inter-action of CD14, a glycosylphosphatidylinositol-anchored monocytic

559K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

antigen, with TLR4 is an early event of neuroinflammation signalingactivation [20,21]. Upon LPS binding, CD14 associates with the extra-cellular domain of TLR4. Then, TLR4 intracellular domain-mediatedsignaling complex including MyD88, IRAK and TRAF was formed,further leading to downstream signal transduction through theNF-κB-mediated inflammatory cascades [22,23]. Up to now, nobodyprovides the attempt to elucidate the detailed role of CD14/TLR4 inter-action in initiation of oxidative/nitrative stress in microglia, a majorplayer in inflammation-associated neuroimmune responses. There-fore, how CD14/TLR4-dependent inflammation signaling regulatesNADPH oxidase/reactive oxygen and iNOS/nitrogen species produc-tion in microglia still remains unknown. We attempt to speculatethat ROS and RNS share a unified upstream regulatory mechanismduring neuroinflammation.

Protosappanin A (PTA), a novel biphenyl compound fromCaesalpinia sappan L. (Lignum Sappan), has been shown immunosup-pressive effects on prolonging heart allograft survival by significantlyattenuating acute rejection [24]. In addition, PTA shows inhibitory ac-tion NO production and linoleic acid oxidation on cultured J774.1(macrophage-like) cell line in vitro; this might be due to PTA's sup-pression on iNOS gene expression [25]. More recently, researchershave reported that PTA could act on T cells through significantlyinhibiting NF-κB activation and downstream gene expressions ofIFN-γ and IP10, showing potential effects on T cell-mediated immunedisorders [26]. But themechanisms involved in PTA's immunoregulationand anti-oxidation are still largely uncharacterized. In this study, we in-vestigated the anti-oxidative/nitrative effects of PTA in LPS-inducedBV-2 microglia, and also studied the potential mechanism. We foundthat the interaction of TLR4 with CD14 may represent a candidate drugtarget for inhibition of NF-κB inflammation signal-mediated oxidative/nitrative stress in the brains.

2. Materials and methods

2.1. Chemicals

Protosappanin A (C15H12O5) was obtained from Department ofNatural Medicines, School of Pharmaceutical Sciences, Peking Universi-ty (Beijing, China). The sample was in the form of light yellow granularcrystals, molecular weight 272 and purity over 98% by HPLC analysis.3-[4,5-dimethylthiazol-2-yl]2,5-diphenyltetrazolium bromide (MTT),ammonium pyrrolidine dithiocarbamate (PDTC), nitro blue tetrazolium(NBT), protein A-agarose beads (fast flow), BAY11-7082 and lipopoly-saccharide (LPS from Escherichia coli, serotype 055:B5) were purchasedfrom Sigma Chemical Co. (St Louis, MO, USA). Neurobasal Medium andB-27 Supplement were obtained from Gibco (Grand Island, NY, USA).Alexa Fluor 488-labeled goat anti-rabbit IgG antibody and AlexaFluor488 conjugate LPS were obtained from Invitrogen (Carlsbad, CA,USA). Primary antibodies for TLR4, MyD88, IRAK-1 and TRAF-6 werepurchased fromBioworld Technology (Minneapolis, MN). Other prima-ry antibodies and HRP-conjugated anti-rabbit IgGwere purchased fromCell Signaling Technology (Beverly, MA, USA). Western Chemilumines-cent HRP Substrate was purchased from Millipore (Billerica, MA, USA).

2.2. Cell culture

BV-2 cells were from Peking Union Medical College, Cell Bank(Beijing, China) and grown in DMEM medium (Hyclone,Waltham,MA, USA) supplemented with 10% fetal bovine serum (Hyclone), pen-icillin (100 U/ml), and streptomycin (100 μg/ml) in a humidified in-cubator containing 95% air and 5% CO2 at 37 °C.

2.3. Microglia-neuron co-cultures

Primary cortical neurons were isolated from embryonic (E17–18 days) Sprague–Dawley rat fetuses and primary microglia were

isolated from the cortices of 1 to 3 day-old Sprague–Dawley ratpups. Neurons were seeded on poly-D-lysine-coated 12 mm diameterglass cover slips. In order to avoid direct neuron–microglia interactions,the neuron-seeded cover slip was previously placed on three equallyspaced small paraffin holders (1 mm high). Microglia were seeded in12-well culture plates for 24 h, and the neuron-containing cover slipswere subsequently moved into the microglia-seeded well, letting neu-rons and microglia share the same culture medium, but without directcontact (for detail, see below Results subsection 3.6).

2.4. Viability assay

Viability was detected by MTT assay. Cells were seeded into96-well culture plates. After treatment, culture supernatants were ex-changed with medium containing 0.5 mg/ml MTT and incubated for4 h at 37 °C in darkness. Subsequently, the medium was removed and100 μl dimethyl sulfoxide was added. The absorbance at 550 nm wasdetected and data were expressed as the mean percentage of absor-bance in treated vs. control cells. The value of the control was set at100%.

2.5. Nitric oxide (NO) assay

The productions of NO were determined by detecting cell culturesupernatants for nitrite, a major stable product of NO, by Griess re-agent. Briefly, cell culture supernatants (100 μl) reacted with 100 μlof Griess reagent (1% sulfanilamide/0.1% naphthylethylene diaminedihydrochloride/2% phosphoric acid) in a 96-well plate. After incuba-tion for 10 min at room temperature, the optical density was mea-sured at 540 nm using a microplate reader. Sodium nitrite was usedas a standard curve in the assay.

2.6. iNOS activity assay

The activity of iNOS was detected by catalyzing L-Arg to form NO.Briefly, cells were lysed with 1% Triton X 100 (in PBS), and centrifugedat 16,000 rpm, 4 °C for 20 min. Then, supernatants (50 μl) were collect-ed and reacted with 50 μl of L-Arg solution (provided by iNOS activitykit from Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu,China) for 15 min at 37 °C. The optical density was measured at530 nm using a microplate reader. In addition, total protein concentra-tion was detected by BCA assay. The production of 1 nmol NO by 1 mi-crogram protein (within 1 min) was defined as 1 U (iNOS activity).

2.7. Hydrogen peroxide (H2O2) assay

The productions of H2O2 were measured by commercial Hydrogenperoxide assay kit which was purchased from Nanjing JianchengBioengineering Institute (Nanjing, Jiangsu, China). Briefly, cells werelysed with 1% Triton X 100 (in PBS), and centrifuged at 16,000 rpm,4 °C for 20 min. Then, supernatants (50 μl) were collected andreacted with 500 μl of molybdic acid solution (provided by the kit)to form complex for 10 min at 37 °C. The optical density of complexwas measured at 405 nm using a microplate reader. H2O2 was usedas a standard curve in the assay. In addition, total protein concentra-tion was detected by BCA assay. The final H2O2 concentration wasconversed to H2O2 (mmol) per gram protein.

2.8. Hydroxyl radical (OH·) assay

The inhibitory effects on hydroxyl radical (OH·) productions weremeasured by detecting cell lyses by Fenton reaction. Briefly, cells werelysed with 1% Triton X 100 (in PBS), and centrifuged at 16,000 rpm, 4 °Cfor 20 min. Then, supernatants (100 μl) were collected and reacted with1 ml of Fenton solution (provided by Hydroxyl radical assay kit fromKeyGEN company, Nanjing, China) to form complex for 20 min at

560 K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

room temperature. The optical density of complex was measured at550 nm using a microplate reader. H2O2 (0.03%) was used as a standardcurve in the assay. In addition, total protein concentration was detectedby BCA assay. The inhibitory effects on hydroxyl radical (OH·) produc-tions were conversed to OH· (U) per microgram protein. Decrease ofH2O2 concentration for 1 mMwas defined as 1 U.

2.9. Malondialdehyde (MDA) assay

The productions of MDA were measured by reacting withthiobarbituric acid (TBA). Briefly, cells were lysed with 1% Triton X100 (in PBS), and centrifuged at 16,000 rpm, 4 °C for 20 min. Then,supernatants (50 μl) were collected and reacted with 200 μl TBAsolution (provided by MDA assay kit from Nanjing Jiancheng Bioengi-neering Institute, Nanjing, Jiangsu, China) to form red complex for40 min at 95 °C. The optical density of complex was measured at532 nm using a microplate reader. Tetraethoxypropane (10 μM)was used as a standard curve in the assay. In addition, total proteinconcentration was detected by BCA assay. The productions of MDAwere conversed to MDA (nM) per microgram protein.

2.10. Reactive oxygen species (ROS) assay

Intracellular ROS was detected by DCF-DA ROS fluorescenceprobes. Briefly, treated cells were washed with serum-free mediumand incubated with 1 ml of DCF-DA solution (50 μM) in the darknessfor 20 min at 37 °C. Then, cells were washed and resuspended in PBS.The intracellular ROS concentration was detected by flow cytometry(BD FACSCaliburTM, USA). The excitation was at 488 nm, and theemission was measured at 525 nm. A minimum of 10,000 eventswere counted per sample. The values were expressed as the meanfluorescence intensity normalized to the percentage of the controlvalue.

2.11. Electrophoretic mobility shift assay (EMSA)

After treatment, nuclear proteins were extracted by Nuclear Extrac-tion kit which was from KeyGEN Biotech Inc. (Nanjing, Jiangsu, China).Then, NF-κB activity was detected by Non-Radioactive NF-κB EMSA kit(Viagene Biotech Co., Ltd. Ningbo, China) according to themanufacturer'sinstructions. Ds-Bio-NF-κB probe (5′–3′) is Bio-5′-AGTTGAGGGGACTTTCCCAGGC-3′-Bio and Ds-Cold- NF-κB probe is cold 5′-AGTTGAGGGGACTTTCCCAGGC-3′. As for positive control, 50 ng/ml TNF was used totreat SGC7901 cells for 45 min, and then nuclear proteins were extractedand detected for EMSA assay.

2.12. Nitro blue tetrazolium (NBT) assay

NADPH oxidase activity assay was performed by nitro blue tetra-zolium (NBT) assay, which detects reduction of NBT to formazan bysuperoxide oxide. Briefly, cells (seeded in 48-well culture plate)were incubated with 500 μl PBS (containing 0.1% NBT) at 37 °C for60 min. Then, cells were washed and dissolved in 500 μl DMSO anddetected at 570 nm. Data were expressed as the mean percentage ofabsorbance in treated vs. control cells. The value of the control wasset at 100%.

2.13. Lipopolysaccharide (LPS)-binding assay

Cellswere treatedwith Alexa Fluor488 conjugate LPS (0.1 μg/ml) for30 min, then washed with PBS for three times. Cells were measured byflow cytometer (BD FACSCalibur, USA). Excitation was detected at480 nm and emission was detected at 520 nm. A minimum of 10,000events were counted per sample.

2.14. TNF-α and IL-1β assay

After treatment, culture medium (200 μl) were collected andcentrifuged at 16,000 rpm, for 20 min. Then, 100 μl of supernatantswere used for detecting TNF-α and IL-1β levels by TNF-α ELISA kitand IL-1β ELISA kit from Cusabio Biotech (Wuhan, Hubei, China).

2.15. TUNEL assay

Cells were seeded in poly-L-lysine coated glass coverslips in24-well culture plates. After treatment, cells were fixed with cold4% paraformaldehyde for 20 min and permeabilized with 0.2% TritonX-100 (in PBS) for 30 min. After wash with PBS, the cells were coveredwith Equilibration Buffer provided by DeadEndTM Colorimetric TUNELSystem from Promega Co. (Madison, WI, USA), and followed the in-structions as described in the kit. After sealing the coverslips, neuronalapoptosis was detected by light microscope and apoptosis rate wascalculated.

2.16. Reverse transcription PCR (Rt-PCR)

Total RNA was extracted from treated cells by GeneJET RNA Puri-fication Kit (Fermentas, Vilnius, Lithuania) and converted to cDNAby RevertAid First Strand cDNA Synthesis Kit (Fermentas), accordingto the manufacturer's instructions. The transcripts were amplified inone tube containing 1 μg of cDNA and 0.5 μM of each sense and anti-sense primers. The primers are described below.

iNOS

5′–3′ (sense) ACCCCTGTGTTCCACCAGGAGATGTTGAA5′–3′ (antisense) TGAAGCCATGACCTTTCGCATTAGCATGG

gp91 phox

5′–3′ (sense) GTC AAG TGC CCC AAG GTA TCC A5′–3′ (antisense) TTG TAG CTG AGG AAG TTG GC

TLR4

5′–3′ (sense) AGCAGAGGAGAA AGCATCTATGATGC5′–3′ (antisense) GGTTTAGGCCCCAGAGTTTTTCTCC

β-actin

5′–3′(sense) ATCCTGAAAGACCTCTATGC5′–3′(antisense) AACGCAGCTCAGTAACAGTC

PCR reaction conditions were shown as below: 94 °C for 5 minfollowed by 30 cycles of 94 °C for 1.5 min, 55 °C for 1.5 min, 72 °C for1.5 min and a final extension at 72 °C for 20 min. The PCR productswere separated by 1.0% agarose gel and stained with SYBR Green. TheDNA bands were scanned by Digital Imaging System (Gel Logic 2200Pro, Kodak, USA).

2.17. Immunofluorescence assay

The cell-seeded glass cover slips were fixed with cold 4% parafor-maldehyde for 20 min and permeabilized with 0.2% Triton X-100(in PBS) for 30 min. Then, the slips were blocked with 5% BSA (in PBS)for 1 h and incubated with a primary antibody specific to the NF-κBp65 subunit for overnight at 4 °C, followed by a secondary antibody la-beled with Alexa Fluor 488 for 1 h at room temperature. After beingstained with DAPI (5 μg/ml in PBS) for 30 min at 37 °C, the coverslipswere washed and sealed. Images were obtained by fluorescence micro-scope (Leica, Solms, Germany) with excitation/emission wavelengths of490 nm/540 nm for Alexa Fluor-488 and 360 nm/450 nm for DAPI.

2.18. Crystal violet stain

Cells were seeded on sterile glass coverslips placed on 24-well cul-ture plates. After treatment, the coverslips were washed and fixedwith cold 4% paraformaldehyde for 30 min. Then, the coverslipswere incubated with 0.5% cresyl violet solution for 1 h and washedwith PBS. Images were captured with an optical microscope. Five dif-ferent fields were selected for each group while statistic analysis forcellular morphology.

Fig. 1. PTA showed no toxicity in LPS-induced BV-2 microglia. (A) The structure of PTA; (B) MTT assay for PTA cytotoxicity. BV-2 cells were pretreated with PTA (5, 10, 25 and50 μM) for 10 min, then treated with LPS (0.1 μg/ml) for 24 h, after that MTT assay was performed to detect cell viability.

561K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

2.19. Co-immunoprecipitation (Co-IP) assay

After treatment, the cellswere collected and incubatedwithRIPAbuff-er at 4 °C for 10 min. Then, the lyses was centrifuged at 16,000 rpm, 4 °Cfor 20 min. The supernatants (400 μl)weremixedwith primary antibody

Fig. 2. PTA inhibited oxidative stress in LPS-induced BV-2 microglia. BV-2 cells were pretre24 h. (A) Reactive oxygen species (ROS) levels were measured by flow cytometry with DCF-D(B) hydrogen peroxide (H2O2) production was dose-dependently inhibited by PTA treatmenwas dose-dependently promoted by PTA treatment; (D) NADPH oxidase activity was determtein and mRNA expressions of gp91 phox were detected by Western blot and rt-PCR analysidetected by TBA assay and was dose-dependently inhibited by PTA treatment. The data are##pb0.01, ###pb0.001 relative to control group; ⁎pb0.05, ⁎⁎pb0.01, ⁎⁎⁎pb0.001 relative to

of TLR4 (1:100 dilution) and incubated at 4 °C with gentle rockingovernight. Immunocomplexes were incubated with 40 μl proteinA-agarose beads (fast flow) with gentle rocking for 6 h at 4 °C. ProteinA-agarose beads were washed for 5 times and resuspended in 50 μlSDS sample buffer (2×) followed by boiling for 5 min. Finally, samples

ated with PTA (5, 10, 25 and 50 μM) for 10 min, then treated with LPS (0.1 μg/ml) forA staining, mean fluorescence intensity of 10,000 cells for each sample was quantified;t; (C) hydroxyl radical (OH•) scavenging activity was detected by Fenton reaction andined by NBT assay, mean absorbance at 550 nm was detected for each sample; (E) pro-s, β-actin was used as loading control; (F) Malondialdehyde (MDA) concentration wasrepresented as a mean±S.D. from independent experiments performed in triplicate.LPS treatment group.

562 K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

were separated by SDS-PAGE and analyzed using the Western blottingassay.

2.20. Western blotting assay

After treatment, total protein were isolated, separated by SDS‐PAGE and transferred to polyvinylidene fluoride membranes. Then,the membranes were blocked with 5% nonfat milk and incubatedwith primary antibodies overnight at 4 °C. After that, the membraneswere incubated with anti-rabbit IgG (HRP-linked secondary anti-bodies, 1:1000 dilutions) at room temperature for 1 h. Finally, themembranes were washed for three times and visualized withImmobilon Western Chemiluminescent HRP Substrate. The relativeoptical densities were scanned with Kodak Digital Imaging System(Gel Logic 2200Pro, Kodak, USA).

2.21. In vivo assay

ICR mice (male, 20–25 g, 8-week-old) were divided into threegroups. In group one, the animals were administered orally with0.5% sodium carboxymethylcellulose (CMC-Na, 10 ml/kg) for 10 days;in group two, the animals were administered orally with 0.5% CMC-Nafor 7 days, then intraperitoneal injected (i.p.) with LPS (10 mg/kg)once a day for 3 days; and in group three, the animals were adminis-tered orally with 10 mg/kg PTA solution (dissolved in 0.5% CMC-Na)for 7 days, then intraperitoneal injected (i.p.) with LPS (10 mg/kg)once a day for 3 days. After that, animals were anesthetized andsacrificed. The brains were removed and immunohistochemistry (ICH)assay was performed for Iba-1. In addition MDA and nitrotyrosinewere also detected.

Fig. 3. PTA inhibited nitrative stress in LPS-induced BV-2 microglia. BV-2 cells were pretreate(A) Nitric oxide (NO) productionwas significantly inhibited by PTA in LPS-induced BV-2 cells. NOquantified; (B) inducible nitric oxide synthase (iNOS) activitywas significantly suppressed by PTAnitrative stress, was decreased by PTA in LPS-induced BV-2 cells. Nitrotyrosine expression was deexpressions of iNOS in LPS-induced BV-2 cells. The protein and mRNA expressions of iNOS weremean±S.D. from independent experiments performed in triplicate. ###pb0.001 relative to cont

2.22. Statistical analysis

Statistical datawere expressed asmean±S.D. in the text andfigures.Datawere analyzed by one-way analysis of variance (ANOVA). Values ofpb0.05 were considered to be statistically significant.

3. Results

3.1. PTA inhibited oxidative stress in LPS-treated BV-2 microglia

Previous viability assay showed that PTA couldn't induce cell toxicityamong 5–50 μM when treated by LPS. Therefore, we used this concen-tration range in the next experiments (Fig. 1).

To investigate the effects of PTA on LPS-induced oxidative stress inBV-2 microglia, the cells were pretreated with PTA (5, 10, 25 and50 μM) for 10 min and then stimulated with LPS (0.1 μg/ml) for 24 h.Production of total ROS in cells was detected. As shown in Fig. 2A, LPSinduced increases in total ROS in BV-2 cells; however, pretreatmentwith PTA inhibited total ROS production in a dose-dependent manner.Moreover, LPS-induced increases of H2O2 and hydroxyl radical (OH·),two important reactive oxygen intermediates in BV-2 cells were alsosignificantly inhibited by PTA (Fig. 2B and C). These data showed a sig-nificant anti-oxidative stress ability of PTA in LPS-stimulated microglia.Next, we studied the activity of NADPH oxidase, which is responsiblefor increased ROS production in LPS-induced BV-2 cells. We foundthat LPS significantly activated NADPH oxidase, and PTA treatmentdown-regulated NADPH oxidase activity in a dose-dependent manner(Fig. 2D). Furthermore, we detected the protein and gene expressionsof gp91 phox, which is a major subunit of NADPH oxidase for ROS pro-duction. We found that LPS increased the protein and mRNA levelsof gp91 phox, however, treatment with PTA significantly reversed

d with PTA (5, 10, 25 and 50 μM) for 10 min, then treated with LPS (0.1 μg/ml) for 24 h.levels weremeasured by Gerissmethod, mean absorbance at 550 nm for each samplewasin LPS-inducedBV-2cells; (C) nitrotyrosine expression, amarker of peroxynitrite-mediatedtected byWestern blot assay; (D) PTA significantly down-regulated the protein andmRNAdetermined by Western blot and rt-PCR assay, respectively. The data are represented as arol group; ⁎⁎⁎pb0.001 relative to LPS treatment group.

563K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

LPS-induced protein and mRNA increases of gp91 phox, indicating thatPTA may decrease ROS production via inhibition of NADPH oxidasegp91 phox subunit protein and gene expressions (Fig. 2E). Finally, weassessed the level of oxidative stress by detecting malondialdehyde(MDA), a major biomarker for oxidative stress. We found that LPSinduced an obvious increase of MDA level in BV-2 microglia, and PTAtreatment significantly inhibited MDA productions (Fig. 2F).

Fig. 4. PTA inhibited IKK/IκB/NF-κB inflammatory pathway in LPS-treated BV-2 microglia. BVLPS (0.1 μg/ml) for 1 h. (A, B) Nuclear translocation of the NF-κB p65 and p50 subunits weplasmic loading control, respectively; (C) confocal microscope observation of translocated Nconfocal microscope stained for NF-κB p65 subunit (green) and nucleus (blue); (D) PhospLPS-induced BV-2 cells; (E) PTA inhibited LPS-induced DNA binding of NF-κB in BV-2 cellsby electrophoretic mobility shift assay (EMSA); (F) effect of PTA on phosphorylation of IKKprotein expression of IKKα/β following PTA treatment were detected. Moreover, decrease inIκB following PTA treatment were observed. The band densities are expressed as percentagexperiments performed in triplicate. ###pb0.001 relative to control group; ⁎⁎⁎pb0.001 rela

3.2. PTA inhibited nitrative stress in LPS-treated BV-2 microglia

Nitric oxide (NO) is a major reactive nitrogen intermediate, contrib-uting to tissue injury induced by nitrative stress [27]. The BV-2 cellswere pretreated with PTA (5, 10, 25 and 50 μM) for 10 min and thenstimulated with LPS (0.1 μg/ml) for 24 h. Firstly, the production of NOwas detected and we found PTA significantly inhibited LPS-induced

-2 cells were pretreated with PTA (5, 10, 25 and 50 μM) for 10 min, then treated withre effectively inhibited by PTA. HDAC1 and α-tubulin were used as a nuclear and cyto-F-κB p65 subunit into nucleus. Immunofluorescence images were acquired by using ahorylation levels of NF-κB (Ser536 site) were significantly down-regulated by PTA in. Nuclear extracts were prepared and DNA binding activity of NF-κB was determinedα/β and degradation of IκB in LPS-induced BV-2 cells. Decrease in the phosphorylatedthe phosphorylated protein expression and increase in the total protein expression of

e of LPS treatment group. The data are represented as a mean±S.D. from independenttive to LPS treatment group.

564 K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

NO increase in BV-2 microglia (Fig. 3A). In addition, PTA treatmentinhibited the activity of inducible nitric oxide synthase (iNOS), whichis responsible for NO synthesis (Fig. 3B). Nitrotyrosine has been usedas a marker for nitrative stress. Here, we performed Western blotassay and observed that PTA inhibited nitrotyrosine expressions in

Fig. 5. PTA inhibited the interaction of transmembrane protein CD14 with Toll-like receptorchanged by PTA treatment. BV-2 cells were pretreated with PTA (5, 10, 25 and 50 μM) for 1assay); (B) the protein expressions of CD14 and TLR4 adaptor proteins (MyD88, IRAK1 andpretreated with PTA (50 μM) for 10 min, then treated with LPS (0.1 μg/ml) for 24 h; (C) thcells were pretreated with PTA (50 μM) for 10 min, then treated with LPS (0.1 μg/ml) for 1TRAF6; (D) LPA-binding to BV-2 cell surface was not interfered by PTA treatment. BV-2 celljugate LPS (0.1 μg/ml) for 1 h, then mean fluorescence intensity of 10,000 cells for each samTLR4, but not CD14. BV-2 cells were pretreated with PTA (50 μM) for 10 min, then treated wwith TLR4 and CD14; (F) PTA inhibited the interaction of TLR4 with CD14 in LPS-induced BV(0.1 μg/ml) for 1 h. Co-IP assay was performed to detect the interaction of TLR4 with CD14BV-2 cells. BV-2 cells were pretreated with CD14 antibody (40 μg/ml) for 10 min, then treation, and BSA (40 μg/ml) was used as negative control. The data are represented as a meancontrol group; ⁎⁎pb0.01 relative to LPS treatment group.

LPS-induced BV-2 cells (Fig. 3C). In addition, the protein and mRNA ex-pressions of iNOS were also significantly down-regulated by PTA treat-ment in LPS-induced microglia (Fig. 3D), indicating that PTA maypotently suppress iNOS-dependent NO production as well as resultantnitrative stress in LPS-treated BV-2 microglia.

-4 in LPS-induced BV-2 cells. (A) The protein and mRNA expressions of TLR4 were not0 min, then treated with LPS (0.1 μg/ml) for 24 h (Western blot assay) and 6 h (rt-PCRTRAF6) were not changed by PTA treatment in LPS-induced BV-2 cells. BV-2 cells weree interaction of TLR4 with TLR4 adaptor proteins was inhibited by PTA treatment. BV-2h. Co-IP assay was performed to detect the interaction of TLR4 with MyD88, IRAK1 ands were pretreated with PTA (50 μM) for 10 min, then treated with Alexa Fluor488 con-ple was quantified by flow cytometry; (E) PTA suppressed the interaction of LPS withith LPS (0.1 μg/ml) for 1 h. Co-IP assay was performed to detect the interaction of LPS

-2 cells. BV-2 cells were pretreated with PTA (50 μM) for 10 min, then treated with LPS; (G) Blocking CD14 with anti-CD14 antibody decreased NO production in LPS-inducedted with LPS (0.1 μg/ml) for 24 h. Geriss assay was performed to detect NO concentra-±S.D. from independent experiments performed in triplicate. ###pb0.001 relative to

565K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

3.3. PTA inhibited IKK/IκB/NF-κB inflammatory pathway in LPS-treatedBV-2 microglia

NF-κB inflammatory pathway has been reported to regulate ROSand NO productions in inflammatory neuropathology. To address this

question, we investigated the effects of PTA on activation of NF-κB in-flammatory pathway in LPS-induced BV-2 cells. Fig. 4A and B showedthat NF-κB p65 and p50 subunits translocated from cytoplasm to nucle-us in LPS-induced BV-2 cells; however, PTA treatment significantlyinhibited p65 and p50 translocations, showing potential inhibitory effects

566 K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

on NF-κB activation. This conclusion was also supported by confocalimmunofluorescence image analysis that green fluorescence-labeledNF-κB preferred to stay in cytoplasm when PTA was treated, but not innucleus (Fig. 4C). Phosphorylation of NF-κB p65 on serine-536 is animportant step for NF-κB activation. Here, we found that LPS inducedNF-κB p65 phosphorylation on serine-536, which was effectivelysuppressed by PTA treatment in a dose-dependent manner (Fig. 4D).

Next, nuclear NF-κB protein-DNA binding activity was observedby electrophoretic mobility shift assay (EMSA). As shown in Fig. 4E,nuclear extracts were isolated from LPS-treated BV-2 cells and incu-bated with the biotinylated NF-κB probe along with or without thecold probe. This resulted in a NF-κB shift with respect to probe alone.We observed a significant decrease in the NF-κB shift which confirmedthat the NF-κB probe binding increased upon LPS stimulation. In orderto confirm the specificity of NF-κB for the probe sequence, we incubatednuclear extracts in the presence of 100 times cold probe and observed asignificant decrease in the intensity of NF-κB shifted bands, indicatingthat our probe was rather specific. Moreover, the IκB kinase complex(IKKα/β) is necessary for IκB phosphorylation and NF-κB activation.Here, we detected the phosphorylation levels of IKKα/β and IκB byWestern blot assay. Fig. 4E showed that PTA treatment significantlydown-regulated IKKα/β and IκB phosphorylations in LPS-inducedBV-2 cells, indicating inhibitory effects on up-stream signal of NF-κBactivation.

3.4. PTA interfered with the interaction of transmembrane protein CD14with Toll-like receptor-4 in LPS-treated BV-2 microglia

Toll-like receptor (TLR4)-dependent NF-κB signaling plays an impor-tant role in the development of inflammation-related neurodegeneration.On the surface of microglia responding to LPS, transmembrane proteinCD14 binds TLR4 and induces NF-κB signal activation. Based on this cur-rent knowledge, we found that PTA didn't change TLR4 protein andgene expressions (Fig. 5A) in LPS-induced BV-2 microglia. In addition,the expressions of major adaptor proteins in TLR4 signaling pathway(MyD88, IRAK1 and TRAF6) were not affected by PTA treatment(Fig. 5B). Interestingly, coimmunoprecipitation (co-IP) data showedthat the interaction of TLR4 withMyD88, IRAK1 and TRAF6 was signif-icantly enhanced by LPS treatment; however, this pattern was signifi-cantly reversed by PTA treatment (Fig. 5C). This indicated that TLR4activation was blocked by PTA treatment. Interestingly, LPS-bindingassay showed that Alexa Fluor488 conjugate LPS-treated BV-2microglia(red line) emitted more fluoresce than untreated cells (black line);however, PTA treatment didn't affect the fluoresce intensity (greenline) in LPS-induced BV-2 cells, showing that PTA couldn't reverseLPS-binding to the cell surface (Fig. 5D).Here,we addressed the hypoth-esis that PTA might interfere with the subsequent cell events after LPSbinding to cell surface, including CD14 interaction with TLR4 and LPS/CD14/TLR4 complex formation. Since LPS/CD14/TLR4 complex plays avital role in initiating NF-κB signal, co-IP assay was further used andshowed that interaction of LPS with CD14 was not interfered by PTAtreatment, but interaction of LPSwith TLR4was significantly suppressedby PTA treatment, indicating that PTA might inhibit the interaction of

Fig. 6. NF-κB inhibitor inhibited oxidative and nitrative stress in LPS-treated BV-2 microginhibited ROS production in LPS-induced BV-2 cells. BV-2 cells were pretreated with inhibiand BAY11-7082) and NADPH oxidase inhibitor (Apo) inhibited NADPH oxidase activationtreated with LPS (0.1 μg/ml) for 24 h; (C) NF-κB inhibitor (PDTC and BAY11-7082) and iNcells were pretreated with inhibitors for 10 min, then treated with LPS (0.1 μg/ml) for 2phox protein and mRNA expressions in LPS-induced BV-2 cells. BV-2 cells were pretreatedand 6 h (rt-PCR); (E) NF-κB inhibitor (PDTC) and iNOS inhibitor (L-canavanine) inhibited iNwith inhibitors for 10 min, then treated with LPS (0.1 μg/ml) for 24 h (Western blot) andexpressions in LPS-induced BV-2 cells. BV-2 cells were pretreated with BAY11-7082 (1(BAY11-7082) inhibited gp91 phox and iNOS protein expressions in LPS-induced BV-2 cellLPS (0.1 μg/ml) for 24 h. The data are represented as a mean±S.D. from independent e⁎⁎pb0.01, ⁎⁎⁎pb0.001 relative to LPS treatment group.

CD14 with TLR4, thus resulting in a block on LPS translocation fromCD14 to TLR4 (Fig. 5E). This is consistent with our observation thatPTA treatment significantly inhibited interaction of TLR4 with CD14 inLPS-induced BV-2 microglia (Fig. 5F). Finally, we used CD14 antibodyto block CD14, Fig. 5G showed that CD14 antibody effectively inhibitedNO production in LPS-induced BV-2 microglia, but the same concentra-tion of bovine serum albumin (BSA) didn't show any effect. This furtherconformed that CD14/TLR4 interaction may be an important target forinhibition of inflammation-associated oxidative/nitrative stress.

3.5. NF-κB inhibitor suppressed oxidative and nitrative stress inLPS-treated BV-2 microglia

Pyrrolidine dithiocarbamate (PDTC), a NF-κB inhibitor, was usedto investigate the effects of NF-κB signal on ROS and NO productions.Fig. 6A showed that PDTC significantly inhibited ROS production inLPS-induced BV-2 cells, as well as apocynin (APO), a NADPH oxidaseinhibitor. Moreover, PDTC inhibited NADPH oxidase activity, indicatingthat NF-κB signal inhibition might lead to NADPH oxidase-dependentROS production (Fig. 6B). Next, we tested the effects of PDTC onNOpro-duction. Our observation showed that PDTC effectively suppressed NOproduction in LPS-induced BV-2 cells, as well as L-canavanine, an iNOSinhibitor (Fig. 6C). In addition, Western blot and RT-PCR data showedthat PDTC down-regulated gp91 phox and iNOS protein and mRNA ex-pressions, indicating that NF-κB inhibition could decrease NADPHoxidase-dependent ROS and iNOS-dependent NO production (Fig. 6Dand E). Finally, a specific NF-κB inhibitor, BAY11-7082, was used toverify above results [28,29]. We found that BAY11-7082 effectivelyinhibited ROS and NO productions as well as NADPH oxidase activityin LPS-induced BV-2 cells (Fig. 6A, B, and C). Meanwhile, BAY11-7082also significantly decreased the mRNA and protein expressions ofgp91 phox and iNOS in LPS-challenged BV-2 cells (Fig. 6F and G).These results further confirmed the fact that NF-κB is a vital mediatorupstream of gp91 phox and iNOS.

3.6. PTA protected neurons from microglia-mediated neurotoxicity inLPS-treated neuron-microglia co-cultures

To investigate whether PTA could protect neurons formmicroglia-mediated oxidative and nitrative stress, neuron–microglia co-cultureswere established for the evaluation of microglial neurotoxicity(Fig. 7A). We found that LPS decreased neuron viability inco-cultures (MTT assay); however PTA treatment effectively reversedLPS-induced microglial neurotoxicity (Fig. 7B). It is worth pointingout that PTA treatment alone didn't affect neuron viability, indicatingthat PTA protected neurons via inhibition of microglia-mediatedneurotoxicity (Fig. 7C). Moreover, the neuroprotective effects of PTAwere determined by TUNEL assay, Fig. 7D and E demonstratedthat PTA significantly inhibited neuron apoptosis in LPS-inducedneuron–microglia co-cultures. Degenerating neurons in LPS-inducedco-cultures showed extreme chromatin condensation, with a darkand round appearance (marked by arrows); however, there werenot so much apoptotic neurons in PTA treated group compared with

lia. (A) NF-κB inhibitor (PDTC and BAY11-7082) and NADPH oxidase inhibitor (Apo)tors for 10 min, then treated with LPS (0.1 μg/ml) for 24 h; (B) NF-κB inhibitor (PDTCin LPS-induced BV-2 cells. BV-2 cells were pretreated with inhibitors for 10 min, thenOS inhibitor (L-canavanine) inhibited NO production in LPS-induced BV-2 cells. BV-24 h; (D) NF-κB inhibitor (PDTC) and NADPH oxidase inhibitor (Apo) inhibited gp91with inhibitors for 10 min, then treated with LPS (0.1 μg/ml) for 24 h (Western blot)OS protein and mRNA expressions in LPS-induced BV-2 cells. BV-2 cells were pretreated6 h (rt-PCR). (F) NF-κB inhibitor (BAY11-7082) inhibited gp91 phox and iNOS mRNA0 μM) for 10 min, then treated with LPS (0.1 μg/ml) for 6 h. (G) NF-κB inhibitors. BV-2 cells were pretreated with BAY11-7082 (10 μM) for 10 min, then treated withxperiments performed in triplicate. ##pb0.01, ###pb0.001 relative to control group;

Fig. 7. PTA protected neurons from microglia-mediated neurotoxicity in LPS-induced neuron–microglia co-cultures. (A) Schematic diagram of microglia–neuron co-cultures.(B) PTA increased neuron viability in LPS-induced microglia–neuron co-cultures. Microglia–neuron co-cultures were pretreated with PTA (50 μM) for 10 min, then treated withLPS (0.1 μg/ml) for 24 h, MTT assay was performed for neurons. (C) PTA did not change neuron viability in LPS-induced neuron alone cultures. Neuron alone cultures were treatedwith PTA (50 μM) for 24 h, MTT assay was performed for neurons. (D, E) PTA decreased neuron apoptosis ratio in LPS-induced microglia–neuron co-cultures. Microglia–neuronco-cultures were pretreated with PTA (50 μM) for 10 min, then treated with LPS (0.1 μg/ml) for 24 h, TUNEL assay was performed for neuron apoptosis assay. Five randomlyselected fields were used to calculate apoptosis ratio and typical apoptotic neurons were marked by arrows (original magnification 400×). a: control, b: LPS (0.1 μg/ml) treatmentfor 24 h, c. PTA (50 μM)+LPS (0.1 μg/ml) treatment for 24 h. (F, G) PTA protected neural synapse in LPS-induced microglia–neuron co-cultures. Microglia–neuron co-cultures werepretreated with PTA (50 μM) for 10 min, then treated with LPS (0.1 μg/ml) for 24 h, crystal violet stain assay was performed for neural synapse detection. Five randomly selectedfields were used to evaluate neural synapse and three kinds of typical neural synapse (normal, mildly injured, seriously injured) were marked by arrows (original magnification400×). Typical morphological changes of neural synapse were classified into 3 subtypes. a (0+ to 1): neurite length≥2×diameter of cell body representing normal neurons,b (1+ to 2): neurite length≥1×diameter of cell body representing slightly injured neurons, c (2+): neurite lengthb1×diameter of cell body representing seriously injuredneurons. In addition, d: control, e: LPS (0.1 μg/ml) treatment for 24 h, f. PTA (50 μM)+LPS (0.1 μg/ml) treatment for 24 h.

567K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

LPS treatment. Crystal violet stain assay also showed that PTAprotected neural synapse against microglia-mediated neurotoxicityin LPS-induced co-cultures. LPS disrupts neuron synapse formationin co-cultures. Nevertheless, PTA effectively reversed LPS-inducedsynapse injury through maintaining synapse numbers and promotingsynapse remodeling (Fig. 7F and G).

3.7. PTA inhibited microglial activation and oxidative/nitrative stress inLPS-stimulated mouse

To further demonstrate the in vivo anti-oxidative and nitrativestress activity of PTA, ICR mouse were orally administrated withPTA (10 mg/kg) for 7 days, and then intraperitoneally injected withLPS (10 mg/kg) for another 3 days. Immunohistochemistry analysisby Iba-1, a marker for microglia, revealed highly activated microgliain the cortex of LPS-induced mouse. However, the number of activatedmicroglia significantly decreased in PTA-administratedmouse (Fig. 8A).Crystal violet analysis indicated that PTA protected neurons againstmicroglia-mediated toxicity in LPS-induced mouse cortex (Fig. 8B). In

addition, PTA down-regulated MDA levels in LPS-induced mouse cere-bral cortex, indicating that oxidative stress was inhibited by PTA invivo (Fig. 8C). The presence of nitrotyrosine can be used to determineperoxynitrite formation, a marker of nitrative stress. Fig. 8D demon-strated that nitrotyrosine expression dramatically increased in LPS-induced mouse cerebral cortex. Nevertheless, PTA significantly de-creased the nitrotyrosine expression, showing that nitrative stress wassuppressed by PTA in vivo.

4. Discussion

Our study demonstrates that PTA blocks the interaction of CD14 withTLR4, resulting in inhibition of NF-κB-dependent oxidative and nitrativestress in microglia, which plays a critical role in neuroinflammation.Nowadays, the role of increased oxidative and nitrative stress inneuroinflammation has aroused extensive attention [30,31]. Duringneuroinflammatory process, ROS produced by a gp91 phox-containingNADPH oxidase is involved in cellular stress and nerve injury [32].Therefore, NADPH oxidase inactivation could attenuate neurotoxicity

Fig. 8. PTA inhibited microglial activation and oxidative/nitrative stress in LPS-stimulated mouse. ICR mouse were pretreated with PTA (20 mg/kg) for 7 days, and then intraper-itoneally injected with LPS (10 mg/kg) for another 3 days. (A) PTA inhibited LPS-induced microglia activation in mouse cortex. Immunohistochemistry analysis by Iba-1, a markerfor microglia, was performed to detect activated microglia in the cortex of LPS-induced mouse. Typical Iba-1 positive microglia were marked by arrows (original magnification400×). (B) PTA protected neurons from microglia-mediated neurotoxicity in LPS-induced mouse cortex. Crystal violet analysis was performed to detect neurons. Typical neuronswere marked by arrows (original magnification 400×). (C) PTA inhibited LPS-induced MDA production in mouse cortex. MDA analysis was performed to detect oxidative stressin the cortex of LPS-induced mouse. (D) PTA inhibited LPS-induced nitrotyrosine expression in mouse cortex. Immunohistochemistry analysis by nitrotyrosine was performedto detect nitrative stress in the cortex of LPS-induced mouse. Typical nitrotyrosine positive cells were marked by arrows (original magnification 400×).

568 K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

by mitigating ROS-mediated oxidative attack on neurons. Moreover, in-creased levels of NO produced by inducible nitric oxide synthase (iNOS),amediator of inflammation, contribute to nitrative stress and cause directinjury of neuronal cells [33]. Hence, an effective immunosuppressiveagent capable of inhibition of neuroinflammatory response usually ex-hibits potential anti-oxidative/nitrative stress and neuroprotective activi-ty. Our results showed that PTA effectively inhibited NADPH oxidase-dependent ROS production and iNOS-dependent NO production inLPS-induced BV-2 microglial inflammatory process. Consistent with ourfindings in cell culture, we also observed that in vivo inhibitory effectsof PTA on oxidative and nitrative stress in LPS-challenged mouse braincortex. It is worth noting that NADPH and iNOS are two major stress-activated proteins modulated by inflammation, thus we conjecturedthat PTA might regulate a unified up-stream inflammatory signal path-way to inhibit LPS-induced oxidative and nitrative stress.

It is well documented that NF-κB is a critical control point inneuroinflammation. NF-κB activation inmicrogliamay lead to persistentneuroinflammation and neuronal degeneration in the brains [34]. In thisstudy, we found that NF-κB inhibition could down-regulate NADPH oxi-dase and iNOS activities,which further suppress ROS andNOproductions.Thus, we believed that NF-κB was involved in oxidative and nitrativestress when PTA inhibited microglia-mediated neuroinflammatory re-sponse.Meanwhile,we found PTA significantly inhibitedNF-κB activityby blocking NF-κB translocation to nucleus andNF-κB–DNA complexesformation. In addition, PTA effectively inactivated IKK and IκB, whichare NF-κB up-stream signal molecules. Therefore, PTA may exertanti-oxidative and nitrative stress via inhibition of IKK/IκB/NF-κBsignal pathway.

As a key modulator of NF-κB signal pathway, CD14 interacts withTLR4 and activates early cellular events in microglia-mediated in-flammatory process [35]. Upon binding to LPS, CD14 associates with

TLR4 and recruits series of TLR4 adaptor proteins, such as MyD88,IRAK-1 and TRAF-6 to TLR4 intracellular domain, leading to activationof down-stream NF-κB signal [36,37]. Our observation indicated thatPTA didn't affect LPS binding to the cell surface, which was confirmedby above LPS-binding assay. This is also supported by co-IP assay thatPTA couldn't interfere with the interaction of LPS with transmem-brane protein CD14. However, PTA significantly inhibited the interac-tion of CD14 with TLR4 in LPS-induced microglia, we thus concludedthat PTA might suppress LPS/CD14/TLR4 complex formation and fur-ther inhibit the translocation of LPS from CD14 to TLR4, resulting ininhibition of NF-κB signal activation and resultant oxidative andnitrative stress. Interestingly, this hypothesis was supported byco-IP assay results that PTA obviously inhibited LPS binding to TLR4in LPS-induced BV-2 cells. To sum up, interaction of CD14 and TLR4seems to be an important target for PTA's anti-oxidative and nitrativestress therapy.

In summary, our observations show that PTA effectively attenu-ates LPS-induced oxidative and nitrative stress in vitro and in vivoby blocking CD14/TLR4-dependent IKK-IκB-NF-κB signaling pathway.Therefore, PTA might be a useful agent in repairing oxidative andnitrative injuries in neuroinflammatory diseases.

Acknowledgments

This studywas supported by National Key Technology R&D Program“New Drug Innovation” of China (no. 2012ZX09301002-002-002),Natural Science Foundation of China (no. 30873072) and China Postdoc-toral Science Foundation (no. 2012M510294). In addition, Dr. Ke-WuZeng was supported in part by the Postdoctoral Fellowship of Peking–Tsinghua Center for Life Sciences.

569K.-W. Zeng et al. / International Immunopharmacology 14 (2012) 558–569

References

[1] Manton KG, Volovik S, Kulminski A. ROS effects on neurodegeneration inAlzheimer's disease and related disorders: on environmental stresses of ionizingradiation. Curr Alzheimer Res 2004;1:277-93.

[2] Yokoyama H, Kuroiwa H, Yano R, Araki T. Targeting reactive oxygen species, reac-tive nitrogen species and inflammation in MPTP neurotoxicity and Parkinson'sdisease. Neurol Sci 2008;29:293-301.

[3] Barber SC, Shaw PJ. Oxidative stress in ALS: key role in motor neuron injury andtherapeutic target. Free Radic Biol Med 2010;48:629-41.

[4] Perez-Severiano F, Santamaria A, Pedraza-Chaverri J, Medina-Campos ON, Rios C,Segovia J. Increased formation of reactive oxygen species, but no changes inglutathione peroxidase activity, in striata of mice transgenic for the Huntington'sdisease mutation. Neurochem Res 2004;29:729-33.

[5] Perluigi MD, Domenico F, Giorgi A, Schinina ME, Coccia R, Cini C, et al. Redoxproteomics in aging rat brain: involvement of mitochondrial reduced glutathionestatus and mitochondrial protein oxidation in the aging process. J Neurosci Res2010;88:3498-507.

[6] Grimm S, Hoehn A, Davies KJ, Grune T. Protein oxidative modifications in the ageingbrain: consequence for the onset of neurodegenerative disease. Free Radic Biol Med2011;45:73-88.

[7] Dohi K, Ohtaki H, Nakamachi T, Yofu S, Satoh K, Miyamoto K, et al. Gp91 (phox)(NOX2) in classically activated microglia exacerbates traumatic brain injury.J Neuroinflammation 2010;7:41.

[8] Hur J, Lee P, KimMJ, Kim Y, Cho YW. Ischemia-activated microglia induces neuronalinjury via activation of gp91phox NADPH oxidase. Biochem Biophys Res Commun2010;391:1526-30.

[9] Dirksen RT. Reactive oxygen/nitrogen species and the aged brain: radical impactof ion channel function. Neurobiol Aging 2002;23:837-9.

[10] Broom L, Marinova-Mutafchieva L, Sadeghian M, Davis JB, Medhurst AD, DexterDT. Neuroprotection by the selective iNOS inhibitor GW274150 in a model ofParkinson disease. Free Radic Biol Med 2011;50:633-40.

[11] Golde S, Coles A, Lindquist JA, Compston A. Decreased iNOS synthesis mediatesdexamethasone-induced protection of neurons from inflammatory injury invitro. Eur J Neurosci 2003;18:2527-37.

[12] Witte ME, Geurts JJG, de Vries HE, van der Valk P, van Horssen J. Mitochondrial dys-function: a potential link between neuroinflammation and neurodegeneration? Mi-tochondrion 2010;10:411-8.

[13] Munhoz CD, Garcia-Bueno B, Madrigal JLM, Lepsch LB, Scavone C, Leza JC.Stress-induced neuroinflammation: mechanisms and new pharmacologicaltargets. Braz J Med Biol Res 2008;41:1037-46.

[14] Wang JY, Wen LL, Huang YN, Chen YT, Ku MC. Dual effects of antioxidants inneurodegeneration: direct neuroprotection against oxidative stress and indirectprotection via suppression of glia-mediated inflammation. Curr Pharm Des2006;12:3521-33.

[15] Kinsner A, Pilotto V, Deininger S, Brown GC, Coecke S, Hartung T, et al. Inflamma-tory neurodegeneration induced by lipoteichoic acid from Staphylococcus aureusis mediated by glia activation, nitrative and oxidative stress, and caspase activa-tion. J Neurochem 2005;95:1132-43.

[16] Barth BM, Stewart-Smeets S, Kuhn TB. Proinflammatory cytokines provoke oxida-tive damage to actin in neuronal cells mediated by Rac1 and NADPH oxidase. MolCell Neurosci 2009;41:274-85.

[17] Fatma N, Kubo E, Sen M, Agarwal N, ThoresonWB, Camras CB, et al. Peroxiredoxin6 delivery attenuates TNF-alpha-and glutamate-induced retinal ganglion celldeath by limiting ROS levels and maintaining Ca(2+) homeostasis. Brain Res2008;1233:63-78.

[18] Clement HW, Vazquez JF, Sommer O, Heiser P, Morawietz H, Hopt U, et al.Lipopolysaccharide-induced radical formation in the striatum is abolished inNox2 gp91phox-deficient mice. J Neural Transm 2010;117:13-22.

[19] Song M, Jin JJ, Lim JE, Kou JH, Pattanayak A, Rehman JA, et al. TLR4 mutation re-duces microglial activation, increases A beta deposits and exacerbates cognitivedeficits in a mouse model of Alzheimer's disease. J Neuroinflammation 2011;8:92.

[20] Peri F, Piazza M. Therapeutic targeting of innate immunity with Toll-like receptor4 (TLR4) antagonists. Biotechnol Adv 2012;30:251-60.

[21] Peri F, Piazza M, Calabrese V, Damor G, Cighetti R. Exploring the LPS/TLR4 signalpathway with small molecules. Biochem Soc Trans 2010;38:1390-5.

[22] Verstak B, Nagpal K, Bottomley SP, Golenbock DT, Hertzog PJ, Mansell A. MyD88adapter-like (Mal)/TIRAP interaction with TRAF6 is critical for TLR2-andTLR4-mediated NF-kappa B proinflammatory responses. J Biol Chem 2009;284:24192-203.

[23] Medvedev AE, Lentschat A, Wahl L, Golenbock DT, Vogel SN. DysregulatedLPS-induced TLR4-MyD88 complex formation and IRAK-1 activation in endotoxin-tolerant human monocytes. FASEB J 2002;16:A287.

[24] Wu J, Hou JB, Zhang MM, Zou YP, Yu B. Protosappanin A, an immunosuppressiveconstituent from a Chinese herb, prolongs graft survival and attenuates acuterejection in rat heart allografts. Transplant Proc 2008;40:3719-22.

[25] Sasaki Y, Hosokawa T, Nagai M, Nagumo S. In vitro study for inhibition of NO pro-duction about constituents of Sappan Lignum. Biol Pharm Bull 2007;30:193-6.

[26] Jian W, Maomao Z, Haibo J, Xingtao H, Qi Z, Jingbo H, et al. Protosappanin A in-duces immunosuppression of rats heart transplantation targeting T cells in graftsvia NF-κB pathway. Naunyn Schmiedebergs Arch Pharmacol 2010;381:83-92.

[27] Shahani N, Sawa A. Nitric oxide signaling and nitrative stress in neurons: role forS-nitrosylation. Antioxid Redox Signal 2011;14:1493-504.

[28] Mori N, Yamada Y, Ikeda S, Yamasaki Y, Tsukasaki K, Tanaka Y, et al. Bay 11‐7082inhibits transcription factor NF-κB and induces apoptosis of HTLV-I‐infected T-celllines and primary adult T-cell leukemia cells. Blood 2002;100:1828-34.

[29] Lee JY, Je JH, Jung KJ, Yu BP, Chung HY. Induction of endothelial iNOS by4-hydroxyhexenal through NF-κB activation. Free Radic Biol Med 2004;37:539-48.

[30] Chapple ILC. Reactive oxygen species and antioxidants in inflammatory diseases.J Clin Periodontol 1997;24:287-96.

[31] Leonard B, Maes M. Mechanistic explanations how cell-mediated immune activa-tion, inflammation and oxidative and nitrative stress pathways and their sequelsand concomitants play a role in the pathophysiology of unipolar depression.Neurosci Biobehav Rev 2012;36:764-85.

[32] Green SP, Cairns B, Rae J, Errett-Baroncini C, Hongo JAS, Erickson RW, et al. Induc-tion of gp91-phox, a component of the phagocyte NADPH oxidase, in microglialcells during central nervous system inflammation. J Cereb Blood Flow Metab2001;21:374-84.

[33] Lee C, Park GH, Jang JH. Cellular antioxidant adaptive survival response to6-hydroxydopamine-induced nitrative cell death. Toxicology 2011;283:118-28.

[34] Bales KR, Holtzman D, Paul SM. Neuroinflammation and Alzheimer's disease: crit-ical roles for cytokine/Abeta-induced glial activation, NF-kappaB, and apolipopro-tein E. Neurobiol Aging 2000;21:427-32.

[35] Zhang GL, Ghosh S. Toll-like receptor‐mediated NF-κB activation: a phylogeneti-cally conserved paradigm in innate immunity. J Clin Invest 2001;107:13-9.

[36] Zhang GL. Molecular mechanisms of NF-κB activation induced by bacterial lipo-polysaccharide through Toll-like receptors. Innate Immun 2000;6:453-7.

[37] Matthew SH, Sankar G. Shared principles in NF-κB signaling. Cell 2008;132:344-62.