Programed Text Cell Death

8/8/2019 Programed Text Cell Death

1/8

ProgrammedCellDeath 4 (PDCD4) Is an Important FunctionalTargetof theMicroRNAmiR-21 in Breast CancerCells*SReceived forpublication,August 28, 2007, andin revised form, November8, 2007 Published, JBC Papers in Press,November 8, 2007, DOI 10.1074/jbc.M707224200

Lisa B. Frankel, NannaR. Christoffersen, Anders Jacobsen, MortenLindow1, AndersKrogh,

and AndersH. Lund2

From theBiotech Research and Innovation Centre, Bioinformatics Centre, Institute of Molecular Biology, andCentre forEpigenetics, University of Copenhagen, DK-2200 N Copenhagen, Denmark

MicroRNAs are emerging as important regulators of cancer-

related processes. The miR-21 microRNA is overexpressed in a

wide variety of cancers and has been causally linked to cellular

proliferation, apoptosis, and migration. Inhibition ofmir-21 in

MCF-7 breast cancer cells causes reduced cell growth. Using

array expression analysis of MCF-7 cells depleted ofmiR-21, we

have identified mRNA targets ofmir-21 and have shown a link

betweenmiR-21 and the p53 tumor suppressor protein. We fur-

thermore found that the tumor suppressor protein Pro-grammed Cell Death 4 (PDCD4) is regulated by miR-21 and

demonstrated that PDCD4 is a functionally important target for

miR-21 in breast cancer cells.

Since their discovery (14), microRNAs (miRNAs)3 have

emerged as integrated and important post-transcriptional reg-ulators of gene expression in animals and plants (5, 6). In ani-mals, miRNAs bind to partly complementary sequence motifspresent predominantly within the 3-untranslated regions(UTRs) and mediate translational repression, sometimes

involving degradation of the target mRNA (79). miRNAs have

been found implicated in a multitude of cellular processesincluding proliferation, differentiation, migration, and apopto-sis (1012). Accordingly, aberrant miRNA expression has beenlinked to diseases, including cancer (1315). Evidence for the

causal involvement of miRNAs in cancer comes from severalsources. First, mapping of fragile sites and chromosomalregions lost or amplified in cancer displays an intriguing over-lap with the localization of miRNA genes (16, 17), and detailed

mapping studies have demonstrated loss of the miR-15/miR-16genes in chronic lymphocytic leukemia and of the miR-34a

gene in neuroblastomas (18, 19). Reintroduction of these

tumor suppressor miRNAs stalls the proliferation of cancercells or induces apoptosis (18, 2022). Second, genetic studiesin model organisms have led to the identification of miRNAswith relevance for human cancer. This is exemplified by the

analysis oflet-7,whichin Caenorhabditis elegans targets let-60/RAS and in humans is lost in some lung cancers, leading tooverexpression of N-RAS (23). Third, forward genetic studies

have demonstrated a role for the miR-1792 cluster in lym-phoma development in mice predisposed to cancer (24), and

screenings of miRNA expression libraries in cell culture modelsof cancer have identified miR-372/373 and miR-221/222 ascancer-promoting miRNAs via repression of the tumor sup-pressor proteins LATS2 and p27, respectively (25, 26).

MicroRNA profiling studies of human tumors have shown

cancer type-specific deregulation of miRNA expression andhave identified a number of miRNAs with putative tumor sup-pressor or oncogenic functions (13, 15). Interestingly, miR-21stands out as the miRNA most often found overexpressed insolid tumors (27), and increased levels of miR-21 have been

found in very diverse cancer types including glioblastoma,

breast, liver, and pancreatic cancers (11, 2730). Furthermore,causal links between miR-21 expression and cancer-relatedprocesses such as proliferation, migration, apoptosis, and

tumor growth have been demonstrated in human hepatocellu-lar and breast cancer cells (11, 31).

Previously identified targets for miR-21 include the tumorsuppressors tropomyosin 1 in breast cancer cells (32) and phos-phatase and tensin homolog (PTEN) in hepatocellular carcino-

mas (11, 33). The widespread occurrence of miR-21 overex-pression in cancer and therelatively fewexperimentally definedtargets prompted us to perform expression array analyses ofbreast cancer cells transfected with miR-21 inhibitors to iden-

tify and functionally validate additional targets ofmiR-21.

EXPERIMENTAL PROCEDURES

Antibodies and Western Blot AnalysisMCF-7 cells were

seededin 6-well platesand transfected thefollowing2 days. Thecells were harvested 5 days after the first transfection, washedonce in phosphate-buffered saline, and lysed in radioimmuneprecipitation buffer (150 mM NaCl, 1% Nonidet P-40, 0.5%

sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl, pH 8, 2 mMEDTA) containing 1 mM dithiothreitol, 1 mM Pefabloc (RocheApplied Science), 1 Complete Mini protease inhibitor mix-ture (RocheApplied Science),1 mM NaVO3, 10 mM NaF,10mMpyrophosphate, and 50 mM -glycerophosphate. 15 g of pro-

*This work was supported by the Biotech Research and Innovation Centre,the Vilhelm Pedersen and Hustrus Foundation, The Danish NationalResearch Foundation, The Danish Medical Research Council, the DanishCancer Research Foundation, the Danish Cancer Society, The Associationfor International Cancer Research, and the Novo Nordisk Foundation. Thecosts of publication of this article were defrayed in part by thepayment ofpage charges. This article must therefore be hereby marked advertise-ment in accordancewith18 U.S.C.Section1734solely to indicate this fact.

S Theon-lineversionof thisarticle (available at http://www.jbc.org)containssupplemental Figs. S1S5 and Table S1.

1 Present address: Santaris Pharma A/S, DK-2970 Hrsholm, Denmark.2Towhom correspondence should be addressed: Biotech Researchand Inno-

vation Centre, Ole Maales Vej 5, DK-2200 Copenhagen, Denmark. Tel.:45-3532-5657; Fax: 45-3532-5669; E-mail: [email protected].

3The abbreviations used are: miRNA, microRNA; UTR, untranslated region;PTEN, phosphatase and tensin homolog; HEK, human embryonic kidney;siRNA, small interference RNA; PI3K, phosphatidylinositol 3-kinase; mTOR,mammalian target of rapamycin; LNA, locked nucleic acid.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 2, pp. 10261033, January 11, 2008 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

1026 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283NUMBER 2 JANUARY 11, 2008

http://www.jbc.org/content/suppl/2008/01/11/M707224200.DC1.htmlSupplemental Material can be found at:
http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1


2/8

tein/lane was separated on a 412% NuPAGE Bis-Tris gel(Invitrogen) and transferred to a nitrocellulose membrane. The

PDCD4 antibody was kindly provided by Dr. Iwata Ozaki,Japan. The p53 and CDK6 antibodies were purchased fromSanta Cruz Biotechnology. The cofilin 2 antibody was pur-chased from Cell Signaling and the vinculin antibody fromSigma-Aldrich.

miRNA Precursors, Anti-miRNA Oligonucleotides, andsiRNAsThe lockednucleic acid (LNA)-modified oligonucleo-tide inhibitors used for miRNA knock down were purchasedfrom Exiqon. The miRNA precursor hairpins were pur-

chased from Ambion. The PDCD4 SMARTpool siRNA waspurchased from Dharmacon.

Cell CultureHEK293 and MCF-7 cells were maintained inDulbeccos modified Eagles medium with 10% fetal bovineserum (Biochrom), 100 units/ml penicillin, and 100 g/ml

streptomycin (Invitrogen) and incubated at 37 C in 5% CO2.

MCF-7 cells expressing an ecotropic receptor were transducedwith pRetroSuper-shp53 (34) or the empty pRetroSuper virus toobtain theMCF-7 shp53 andMCF-7 EV celllines,respectively. For

proliferation assays, MCF-7 cells were transferred to 1.0% fetalbovine serum prior to transfections with miRNA inhibitors.

Vector Construction and Reporter AssaysA multiple clon-ing site was inserted into the pGL3 control vector (Invitrogen)at the XbaI site 3 of the luciferase gene (hereafter pGL3). Six

different fragments were PCR-amplified from human genomicDNA and cloned into pGL3. The primer sequences used forPCR amplification were as follows (restriction sites are under-lined). SOCS5 FW, 5-gggagatctgactgctaatgtatgtttct-3; SOCS5RV, 5-gggctcgagtactgatctattacaaattc-3. IL6R FW, 5-gggagat-

ctctgcagtaagggtgattctg-3;IL6R RV,5-gggctcgagccagcaggataa-gctgtcgta-3. BTG2 FW, 5-gggagatctgtattgccttcccagacctg-3;BTG2 RV, 5-gggctcgagaaggtgtacatttgtccata-3. CDK6FW, 5-gggagatcttcaagttgttctacatttgc-3; CDK6RV, 5-gggctcgagcagg-cactggtctctgcctg-3. BMPRIIFW, 5-gggagatcttatgtaagctggaat-

catcc-3; BMPRII RV, 5-gggctcgagtagtggcttaatgtcagctt-3.PDCD4 FW, 5-gggtctagagacattttataaacctacat-3; PDCD4 RV,5-aatcaatactgcttcacatg-3.

The QuikChange site-directed mutagenesis kit (Stratagene)

was used to introduce one or two point mutations into the seedregion of pGL3-PDCD4, giving pGL3-PDCD4MUT1 andpGL3-PDCD4MUT2, respectively. Mutagenesis primers usedwere as follows. MUT1 FW, 5-gtggaatattctaataaggtaccttttgta-agtgccatg-3;MUT1 RV, 5-catggcacttacaaaaggtaccttattagaata-

ttccac-3. MUT2 FW, 5-gtggaatattctaataacgtaccttttgtaagtgcc-

atg-3; MUT2 RV, 5-catggcacttacaaaaggtacgttattagaatattccac-3. The pmiR-21-luc reporter vector was constructed byinserting an oligo complementary to the mature miR-21sequence into the pMIR-REPORT luciferase vector (Ambion).

HEK293 and MCF-7 cells were seeded in 96-well plates andtransfected with 50 nM miRNA precursor or LNA, 100150 ngof luciferase vector (pGL3 constructs), and 25 ng of Renillavector (pRL-TK) using Lipofectamine 2000 (Invitrogen). 24 h

after transfection, cells were harvested and luciferase activitywas measured using the Dual-Glo luciferase assay (Promega).

Quantitative PCR AnalysisTotal RNA from transfectedcells was isolated with TRIzol reagent (Invitrogen) according tothe manufacturers protocol. Quantitative reverse transcription

PCR wasperformed using theTaqMan reverse transcription kit(Applied Biosystems) and Sybr Green 2 quantitative PCR

master mix (Applied Biosystems). PCR primers used were asfollows: FAM3C FW, 5-gctgggaggccggagcata-3 and RV, 5-tgcagcacctgctaccctcatg-3. HIPK3 FW, 5-ctctacccaggagcct-tggagtat-3 and RV, 5-tgttctcctggcaaaccttgagtct-3; PRRG4FW, 5-atgcgggagaagaagtgtttacatca-3 and RV, 5-gggagtga-

agagctccagatcaaatc-3. RP2 FW, 5

-tcagcgcgagaaggttgatcc-3

and RV, 5-caggtaagcgacctactgtttcatcc-3. SGK3 FW, 5-gtt-ctggtttcagtgggaagaagtga-3 and RV, 5-agggccatagcaggaaac-tgtttt-3. GLCCI1 FW, 5-cggaggagcagctcacctgag-3 and RV,

5-cgtggccactgtcctgtgaggta-3. SLC16A10 FW, 5-tggtcttta-agacagcatgggtaggt-3 and RV, 5-tgaagacgctgactattgggcag-3. BMPR-II FW, 5-atctgtgagcccaacagtcaatcca-3 and RV,5-gaccaatttttggcacacgccta-3. BTG2 FW, 5-cgtgagcgagcag-aggcttaag-3 and RV, 5-tggacggcttttcgggaa-3. CDK6 FW,

5-ctgcccaaccaattgagaagtttg-3 and RV, 5-cagggcactgtaggc-agatattcttt-3. IL6R FW, 5-gggctctgaaggaaggcaagaca-3 andRV, 5-cggtggggagatgagaggaaca-3. SOCS5 FW, 5-atctgtaa-cctcccactgcatcagaa-3 and RV, 5-gatggtccccaaaccaataaatgg-

3. PDCD4 FW, 5-tatgatgtggaggaggtggatgtga-3 and RV, 5-cctttcatccaaaggcaaaactacac-3. ACTA2 FW, 5-agcacatggaa-aagatctggcacc-3 andRV,5-ttttctcccggttggccttg-3.APAF-1FW, 5-tctgatgcttcgcaaacaccca-3 and RV, 5-ctttcaacaccca-agagtcccaaa-3. FASFW, 5-cctccaggtgaaaggaaagctagg-3 andRV, 5-ttcttggcagggcacgca-3. SESN1 FW, 5-actacattggaataat-

ggctgcgg-3 andRV,5-ccccaccaacatgaaggaaatcat-3. CDKN1AFW, 5-ggcagaccagcatgacagatttc-3 and RV, 5-cggatta-gggcttcctcttgg-3.

Growth Curves and Viability AssaysMCF-7 cells were seeded

in24-well platesandtransfected the followingdaywith 50nM LNAor siRNA using Lipofectamine 2000. Cells were fixed at indicatedtime points in 4% paraformaldehyde, stained in a 0.1% crystal vio-let solution, and resuspended in 10% acetic acid. Sample absorb-ance was measuredat 620nm. Forcellviability assays, MCF-7 cells

were seeded in 24-well plates and transfected the following daywith 50 nM LNA or siRNA using Lipofectamine 2000. After 56days of growth, cells were incubated for 4 h at 37 C with 0.5mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium

bromide (Sigma-Aldrich). After incubation, supernatants werediscarded and formazan crystals were dissolved in a 10% formicacid, 90% isopropanol solution. Sample absorbance was meas-ured at 570 nm with a reference wavelength of 690 nm.

Affymetrix MicroarrayMCF-7 wells were seeded in 10-cm

plates in Dulbeccos modified Eagles medium containing 10%

fetal calf serum and triplicate independent transfections per-formed the following day with either 50 nM LNA-miR-21 orscrambled control LNA using Lipofectamine 2000. Total RNAwas harvested 24 h post-transfection using TRIzol reagent.

Affymetrix microarray analysis (HG-U133 Plus 2.0 human) wasperformed at the Microarray Center, Rigshospitalet, Copenha-gen University Hospital. Briefly, 2 g of total RNA was used tosynthesize double-stranded cDNA using Superscript Choice

System (Invitrogen) with an oligo(dT) primer containing a T7RNA polymerase promoter. The cDNA was subsequently usedas template for an in vitro transcription reaction generatingbiotin-labeled antisense cRNA (BioArrayTM High Yield RNATranscript Labeling kit; Enzo Diagnostics, Farmingdale, NY).

miR-21Targets PDCD4 inHuman Breast Cancer Cells

JANUARY 11, 2008 VOLUME 283 NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 1027



3/8

After fragmentation at 94 C for 35 min in 40 mM Tris, 30 mMMgOAc, 10 mM KOAc, samples were hybridized for 16 h toAffymetrix HG-U133 2.0 human arrays (Affymetrix, Santa

Clara, CA). The arrays were washed and stained with phyco-erythrin-conjugated streptavidin (SAPE), and the arrays werescanned in the Affymetrix GeneArray 2500 scanner, exactly asdescribed in the Affymetrix GeneChip protocol.

Bioinformatic AnalysesThe expression data were processed

using the affy package in BioConductor. Probe set intensitieswere summarized using the Robust Multichip Average methodand then transformed to generalized log values (approaches thenatural logarithm for high values) with the variance stable VSNmethod (35). In a final step, thesix arrays wereqspline-normalized.

Differentially expressed genes were selected by a t test (p

0.05), and two sets of probe sets were defined, the up and down-regulated, by additionally requiring reasonable average ex-pression intensities (2.87, 1st quartile) and high -foldchanges ( 0.168, mean 2 S.D.) (supplemental Table

S1, a and b). A third set of probe sets that do not change fromcontrol to experiment was defined by selecting probe setswith stable expression intensities (p 0.95 and expressionintensity S.D. 0.06) and reasonable expression (2.87)(supplemental Table S1c). The up, down, and no-change sets

comprised 339, 258, and 195 probe sets, respectively.The probe sets were subsequently mapped to Ensembl tran-

scripts (version 45) using the mappings provided at BioMart.Probe sets that mapped to two different Ensembl genes were

discarded. Transcripts with 3-UTR sequences shorter than 50

nucleotides and copies of transcript isoforms of the same genewith matching 3-UTR sequences were discarded. The up,down, and no-change sets comprised 402, 335, and 262 tran-scripts, corresponding to 272, 215, and 164 genes. For the anal-

ysis of seed site enrichment, miRNA sequences from miRBaseversion 9.2were used (36).The 3-UTRs of the transcripts werescanned for matching 6-, 7-1A, 7-, and 8-mer (perfect 8-nucle-otide match) miRNA seed sites (37). In thedefinition used, seedsites are contained in each other, that is, a given 6-mer site

always also corresponds to a 7 mer and 8 mer. Note that thisdefinition is different from the seed sites reported at TargetScan.The difference in the fraction of transcripts having seed sites inthe up, down, and no-change sets was evaluated using one-

sided p values from Fishers exacttest. When comparing all miRBase

miRNAs, the -fold enrichment for agiven miRNA is calculated by divid-ing the fraction of transcripts with a7-mer seed sitein the up set with thesame fraction in the down (or no-

change) set.In an unbiased word analysis, allwords of length 7 were investigatedfor over-representation in the up

versus the down sets. The words

were ranked byp values from Fish-ers exact test.

RESULTS

Suppression of MCF-7 CellGrowth by Inhibition of miR-21Several studies have demon-

strated that miR-21 is an oncogenic miRNA with anti-apoptoticpotential. Inhibition ofmiR-21 leads to growth suppression and

apoptosis in glioblastoma and breast cancer cell lines, and lossofmiR-21 can inhibit MCF-7 cell-derived tumor growth in vivo(30,31, 33). MCF-7 cells express substantial amounts ofmiR-21(supplemental Fig. S1), and consistent with previous findings,

we observed a dose-dependent suppression of MCF-7 cellgrowth upon inhibition ofmiR-21 with an LNA-derived oligo-nucleotide inhibitor (Fig. 1A). Co-transfection of the LNAinhibitor with a luciferase reporter containing perfect comple-

mentarity to the mature miR-21 sequence (pmiR-21-luc)results in marked de-repression of luciferase activity, demon-strating a highly effective inhibition of endogenous miR-21

mediated by the LNA inhibitor (supplemental Fig. S2). Theunderlying mechanism of the role of miR-21 in tumorigenesisremains unclear, as only few targets for this miRNA have beenexperimentally verified (11, 32). Meng et al. (11) have recently

shown that the tumor suppressor PTEN is a direct functionaltarget of miR-21 in human hepatocellular cancer cell lines.Given the importance of PTEN in regulating the PI3K/AKT

pathway and the frequency of PTEN mutations or silencing in a variety of cancers (38), this constitutes an appealing explana-tion for the overexpression ofmiR-21 observed in many cancer

types (27, 28). To investigate the role of the PTEN-miR-21interaction in breast cancer cells, we transfected MCF-7 cellswith a miR-21 precursor, a miR-21 inhibitor, and appropriatecontrols. Interestingly, these treatments caused only subtle

changes in PTEN protein levels (supplemental Fig. S3), suggest-ing that cell- and tissue type-specific differences may result indifferent functional miR-21 targets.

Identification and Validation of miR-21 Targets by Microar-ray AnalysisToidentify targets ofmiR-21 that can explain theproliferation defect observed upon miR-21 inhibition in breast

cancers cells, we performed microarray expression analysesusing total RNA harvested from MCF-7 cells 24 h after trans-fection with either LNA-miR-21 or a scrambled control LNAnot affecting cellular proliferation (Fig. 1B). We reasoned that

cellular mRNAs subjected to increased degradation due tobinding of endogenous miR-21 would be up-regulated uponmiR-21 inhibition and that specific inhibition of the endoge-

A B

FIGURE 1. miR-21 inhibition reduces proliferation. A, MCF-7 cells transfected with increasing amounts ofLNA-miR-21 exhibit a dose-dependent reduction in cellular proliferation. This effect is specific to miR-21because it is not observed for a scrambled control LNA ( B). Data are shown as the mean S.D. of threereplicates and are representative of three independent experiments.



http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1


4/8

nous miR-21 may cause fewer off-target effects than transfec-

tion with exogenous miRNA. Following normalization and sta-tistical analysis we found 737 transcripts with significantlydifferent expression between the LNA-miR-21-transfectedcells and the controls, of which 402 (55%) were up-regulated

and 335 (45%) down-regulated upon miR-21 inhibition (Fig. 2Aand supplemental Table S1). To verify the array analysis, 18up-regulated mRNAs were validated by quantitative reversetranscription PCR analysis of RNA from an independent exper-iment. Ten of the genes chosen for validation contained at least

one miR-21 7-mer seed match, twocontained a 6-mer, and six did not

contain miR-21 seed matches intheir 3-UTR. All 18 genes showed,to varying degrees, increased mRNAexpression levels upon miR-21 inhi-bition(Fig. 2B). It is unclear whether

the mRNAs without matches to themiR-21 seed sequence are directtargets or whether their regulationis a result of secondary effects.

To get a qualitative assessment ofthe data, we analyzed for the pres-ence of different types of miR-21seed matches among the genes reg-ulated by miR-21 inhibition. Nota-

bly, we found very significant over-representations of all miR-21 seedmatch categories among the genesup-regulated by miR-21 inhibition

relative to gene sets that exhibitedno change or down-regulated ex-pression, strongly suggesting thatinhibition of endogenous miRNAscan be used to identifybona fide tar-gets (Fig. 2C). In effect, the motif

complementary to a 7-mer miR-21seed sequence (or miR-590, holdingthe exact same seed sequence) isby far the most prevalent motif

when analyzing the 3-UTRs of theup-regulated transcripts againstall seed sequences present inmiRBase (36) (Fig. 2D). In addi-tion, an unbiased analysis for the

frequency of all possible 7-mersequence motifs, regardless ofwhether these match known mi-RNAs, shows that the miR-21complementary motif is very

highly enriched (p 4 1012)and represents the most fre-quently occurring sequence motifin the 3-UTRs of the up-regulated

versus the down-regulated tran-

scripts. Hence, the data stronglysuggest that expression array anal-ysis following inhibition of endog-

enous miRNAs is a strong tool to identify miRNA targets

subjected to increased mRNA degradation. Potential Involvement of p53 in the miR-21 Pathway

Among the transcripts up-regulated upon miR-21 inhibitionwe noticed the presence of several mRNAs known to be regu-lated by the p53 tumor suppressor, including FAM3C, ACTA2,

APAF1, BTG2, FAS, CDKN1A (p21), and SESN1. We validatedthe up-regulation of these p53-regulated mRNAs by quantita-tive reverse transcription PCR (Fig. 2B). A connection betweenmiR-21 and p53 was further substantiated using the Ingenuity

FIGURE 2. Identification ofmiR-21 targets. A, cluster heat map of Affymetrix microarray analyses of sixindependent biologicalsamplesshowing the 402transcripts significantly up-regulated by miR-21 inhibitioninred and the 335 significantly down-regulated transcripts in blue. B, quantitative reverse transcription PCRvalidationof 18 up-regulated transcripts from an independent transfection experiment. CDKN1A, FAS, FAM3C,HIPK3, PRRG4, and ACTA2 do not contain matches to the miR-21 seed region, BTG2 and SESN1 contain a 6-merseed match,andthe remainingmRNAs harborat leastone 7-merseedmatch. Foreach transcript thevaluesarenormalized to the LNA-scrambled control samples, and error bars represent S.D. of three replicates. C, therelative fraction of transcripts among the up-, down-, or non-regulated transcripts containing the indicatedtype of seed match. ***, one-tailed p values from Fishers exact test are: 6-mer up versus no-change, p 11013; 7-mer-1A up versus no-change,p 1.5 1012; 7-mer up versus no change,p 6.1 1016; 8-mer upversus down, p 9.6 106. D, frequency distribution of 7-mer seed matches for all miRNAs in miRBaseshowing a marked over-representation of the miR-21 seed match in the upversus down-regulated genes.miR-590 and miR-21 have identical seed sequences.



http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1


5/8

Systems pathway analysis program (data not shown). Giventhe pivotal importance of p53 in protecting cells from cancer-promoting events such as genomic instability and aberrant

oncogene activation (39) and the high frequency of miR-21overexpression found in a broad variety of tumors, we specu-lated that pathways affected bymiR-21 and p53 could be inter-connected. To address the importance of p53 in mediating theproliferation effects observed upon miR-21 inhibition, we

developed a stable p53 knockdown cell line (MCF-7 shp53) byretroviral transduction with a pRetroSuper short hairpin RNAconstruct directed against p53 (Fig. 3A). We did not observeany difference in the proliferative capacity of MCF-7 shp53 rel-ative to MCF-7 EV (not shown). Importantly, the MCF-7 shp53

cells were significantly less sensitive to the growth inhibitoryeffect of LNA-miR-21 (p 0.001), relative to control MCF-7cells transduced with an empty vector (Fig. 3B). Although wedid not observe a significant change in p53 protein levels

following miR-21 inhibition or overexpression (supplemen-tal Fig. S4), the data suggest that miR-21 antagonizes the p53pathway by inhibiting expression of p53-regulated genes,demonstrating an important functional link between thesetwo signaling pathways.

Putative Targets Are Directly Regulated by miR-21To sub-

stantiate that miR-21 is a direct regulator of the up-regulatedtranscripts, we selected six target genes containing potentialmiR-21 binding sites within their 3-UTRs for further valida-tion by luciferase reporter assays. 400500-base pair fragments

of the 3-UTRs were cloned into a modified pGL3 vector,downstream of the luciferase gene. Upon co-transfection inHEK293 cells, miR-21 significantly repressed the expression ofall six constructs relative to a lin-4 control (p 0.001) (Fig. 4A).The empty pGL3 vector was not significantly affected bymiR-21, highlighting the importance of the 3-UTR regions in medi-ating this regulation. In addition, we tested the effect of themiR-21 inhibitor on all constructs in MCF-7 cells. Only one ofthe six constructs, pGL3-PDCD4, showed a significant increase

in luciferase expression upon LNA-miR-21 treatment relative to scram-

bled LNA (p 0.001), suggestingthat additional mechanisms controlthe expression of the remainingconstructs (Fig. 4B).

To investigate miR-21 regulation

of endogenous target proteins, threetargets for which functional anti-bodies could be obtained were con-firmed by Western blot analysis.Upon transfection with the miR-21precursor, PDCD4, CDK6, and cofi-lin 2 protein levels were all reducedrelative to the lin-4 control. In addi-tion, miR-21 inhibition led to a cor-

responding increase in endogenousprotein levels relative to the effect ofthe scrambled control (Fig. 4C).

Depletion of PDCD4 Abrogates

the LNA-miR-21-mediated Pheno-type in MCF-7 CellsPDCD4 is a

tumor suppressor known to be up-regulated during apoptosis(40) and down-regulated in several cancer forms (4143). Thepredicted interaction between the PDCD4 3-UTR and miR-21is illustrated in Fig. 5A. To further substantiate a direct regula-

tion of pGL3-PDCD4 bymiR-21 we introduced a single (pGL3-PDCD4MUT1) or double (pGL3-PDCD4MUT2) point muta-tion in the seed sequence of pGL3-PDCD4. Whereas miR-21caused only a slight regulation of pGL3-PDCD4MUT1, pGL3-PDCD4MUT2 remained unaffected by miR-21, suggesting a

direct interaction between miR-21 and PDCD4 mediatedthrough the seed region (Fig. 5B). Given the evidence presentedabove of PDCD4 regulation bymiR-21 atboth the RNA and theprotein levels and considering the reported tumor suppressor

activity of PDCD4, we speculated that PDCD4 could be a func-tionally important target ofmiR-21. To investigate the biolog-ical importance of PDCD4 as a target of miR-21, we depletedMCF-7cells of PDCD4 protein by siRNA and assayed the effectofmiR-21 inhibition (Fig. 5, CandD). Although PDCD4 deple-

tion itself had no effect on cellular proliferation (supplementalFig. S5), it significantly alleviated the anti-proliferative effect ofmiR-21 inhibition from 58 to 87% of control levels (p 0.003)(Fig. 5D). The data therefore suggest an essential role forPDCD4 as a mediator of the biological effects of miR-21 in

breast cancer cells.

DISCUSSION

Over the past few years the vast potential of miRNAs as reg-

ulators of cancer-related signaling pathways has fully emerged(10, 14). Understanding the connections between miRNAsderegulated in cancer and cellular signaling pathways involvedin cancer has been hampered by our limited knowledge of

miRNA target recognition. Although several studies have dem-onstrated a central role of the miRNA seed region in targetbinding (13, 37), additional binding requirements and con-straints likely exist. In addition, studies have reported func-tional miRNA binding without perfect complementarity to the

M

CF-7shp53

M

CF-7EV

p53

Vinculin

A

0

20

40

60

80

100

120

MCF-7 EV MCF-7 shp53

Relativecell

number

LNA scramble

LNA miR-21

p < 0.001B

FIGURE 3. Linking miR-21 to the p53 pathway. A, Western blot analysis shows significantly reduced p53protein levels in MCF-7 shp53 relative to MCF-7 cells transduced with an empty control vector, MCF-7 EV.B, growth assay in MCF-7 shp53 and MCF-7 EV cells transfected with a miR-21 inhibitory LNA or a scrambledcontrol LNA. Cell numberwas quantified 5 days after transfection. Data areshownas themean S.D. of three

replicates. The p value was calculated using a two-tailed ttest.



http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1http://www.jbc.org/cgi/content/full//DC1


6/8

seed region (44, 45). Hence, there is a need for experimentalapproaches to target identification in order to gain knowledgeof the mechanisms and modalities of miRNA target recogni-

tion. A number of studies have identified putative miRNA tar-gets by microarrayanalysisof total RNAfollowing transfectionswith miRNA duplexes (7, 37, 46). Reasoning that high concen-trations of exogenous miRNAs could lead to the identificationof false positives, especially in cells where the miRNA is not

highly expressed, we took the opposite approach and inhibited

an endogenous miRNA to relieve mRNA targets from theincreased degradation observed for some mRNAs uponmiRNA binding (7, 9, 47). A similar approach was previouslyused by Stoffel and coworkers (48) to identify targets of miR-122 in the mouse liver. Although microarray analysis followingmiRNA inhibition or overexpression is a relatively simple androbust method for target identification, this approach can, perdefinition, not identify mRNAs subjected exclusively to trans-lational repression (49, 50). Therefore, the development of new

genome-wide methodologies is urgently needed to unravel thetrue importance of miRNA regulation.

Given the indications that miR-21 acts as an oncogene in avariety of tumor types, and the limited knowledge ofmiR-21

targets, our aim was to identify functionally relevant miR-21targets in MCF-7 breast cancer cells. Bioinformatics analysesdemonstrate a very significant over-representation of miR-21complementary motifs among the transcripts up-regulated by

miR-21 inhibition, demonstrating the validity of the experi-mental approach. We subsequently verified a direct responsive-ness to miR-21 for a subset of the putative target mRNAs inheterologous reporter assays. Interestingly, among the six

3-UTR sequences tested in luciferase assays, only the PDCD4

sequence responded to miR-21 inhibition.The tumor suppressor PDCD4 was originally characterized

as an inhibitor of cellular transformation in a mouse cell culturemodel (51). PDCD4 expression is down-regulated or lost in

several tumor types (52, 53), and ectopic expression of Pdcd4reduces tumor formation in a mouse skin cancer model (54).Consequently, PDCD4 has been indicated by several as a prom-ising molecular target in cancer treatment (5557). At themolecular level, PDCD4 binds and inhibits the translation ini-

tiation factor eukaryotic initiation factor 4a, thereby impactingon protein translation (58, 59). In addition, PDCD4 has beenfound to inhibit AP-1-mediated trans-activation (51) and toinduce expression of the cyclin-dependent kinase inhibitor p21

0,0

0,5

1,0

1,5

pGL3

pGL3

+miR

-21

pGL3

+lin

-4

pGL3

BM

PRI

I

pGL3

BM

PRII

+miR

-21

pGL3

BM

PRII

+lin

-4

pGL3

BTG

2

pGL3

BTG

2+

miR

-21

pGL3

BTG

2+lin

-4

pGL3

CDK

6

pGL3

CDK

6+miR

-21

pGL3

CDK

6+lin

-4

pGL3

IL-6R

pGL3

IL-6R

+miR

-21

pGL3

IL-6R

+lin

-4

pGL3

PDC

D4

pGL3

PDC

D4+

miR

-21

pGL3

PDC

D4+

lin-4

pGL3

SOC

S-5

pGL3

SOC

S-5

+miR

-21

pGL3

SOC

S-5

+lin

-4

Luciferase/Renillaratio

relativetocontrol

0,0

0,5

1,0

1,5

2,0

2,5

pGL3

pGL3

+miR

-21LN

A

pGL3

+sc

rLNA

pGL3

BM

PRI

I

pGL3

BM

PRII

+miR

-21LN

A

pGL3

BM

PRII

+sc

rLNA

pGL3

BTG

2

pGL3

BTG

2+

miR

-21LN

A

pGL3

BTG

2+

scrL

NA

pGL3

CDK

6

pGL3

CDK

6+miR

-21LN

A

pGL3

CDK

6+

scrL

NA

pGL3

IL-6R

pGL3

IL-6R

+miR

-21LN

A

pGL3

IL-6R

+sc

rLNA

pGL3

PDC

D4

pGL3

PDC

D4+

miR

-21LN

A

pGL3

PDC

D4+

scrL

NA

pGL3

SOC

S-5

pGL3

SOC

S-5

+miR

-21LN

A

pGL3

SOC

S-5

+sc

rLNA

Luciferase/Renillaratio

rela

tivetocontrol

44 100

miR-21precursor

lin-4precursor

62 100

41 100

Vinculin

Vinculin

CDK6

124 100

LNAmiR-21

LNAscramble

PDCD4

344 100

Vinculin

123 100

Cofilin 2

*** *** *** *** *** ***

***

A C

B

FIGURE 4. Validation ofmiR-21 targets. A, firefly luciferase reporter assays with constructs holding 3 -UTR sequences from the indicated genes werecotransfected into HEK293 cells along with a Renilla luciferase transfection control plasmid either alone or together with miR-21 or lin-4 precursormiRNAs. Shown are relative luciferase values normalized to transfections without miRNA. Data are shown as the mean S.D. of four replicates and arerepresentative of four independent experiments. ***, p 0.001 using a two-tailed ttest. B, constructs as in panel A transfected into MCF-7 cells eitheralone or together with a miR-21 inhibitor or a scrambled control. Data are shown as the mean S.D. of four replicates and are representative of fourindependent experiments. ***, p 0.001 using a two-tailed ttest. C, Western blot analysis of MCF-7 cells transfected with miR-21 or lin-4 precursors orinhibitory miR-21 or scrambledLNAs. The bands werequantifiedrelativeto the appropriatevinculinloading controls usinga LAS-3000imager (Fuji), andthe relative quantifications are shown.





7/8

(53). As a result, loss of PDCD4 confers growth advantages to

the cells by several means and thereby facilitates the develop-ment of cancer.

We demonstrate here that PDCD4 is directly regulated bythe oncomiR miR-21. This is evident at the level of PDCD4mRNA as well as protein where endogenous PDCD4 protein

level is 3.5-fold up-regulated by miR-21 inhibition. Impor-

tantly, depletion of PDCD4 by siRNA transfection partly res-cues the reduced cellular proliferation observed upon miR-21inhibition in MCF-7 cells, demonstrating that PDCD4 is animportant functional target ofmiR-21 in this model.

A recent report demonstrated that the stability of PDCD4 iscontrolled by themTOR pathway since PDCD4 during mitogenstimulation is phosphorylated by the S6K1 kinase, which marksit for degradation by the proteasome (60). That miR-21 viarepression of PDCD4 affects the PI3K/AKT/mTOR pathway

downstream of mTOR in breastcancer cells is interesting,giventhe evidence that miR-21 in hepatocellular carcinoma cells reg-ulate the PI3K antagonist PTEN (11). Hence, in different celltypes miR-21 may target different negative regulators of the

PI3K/AKT/mTOR survival pathway. In addition, knock downof the tumor suppressor protein p53 partly abrogated the pro-

liferation decrease observed in MCF-7 cells following inhibi-tion ofmiR-21. This suggests a functional link between miR-21,the miRNA most frequently found overexpressed in cancer(27), and the tumor suppressor pathway most often found

mutated or otherwise obstructed in cancer (39). There is accu-

mulating evidence of extensive cross-talk between the p53 andthe PI3K/AKT/mTOR pathways (61), and our data may reflectsuch cross-coordination between important anti-cancernetworks.

AcknowledgmentsWe thank Ulf Andersson rom for comments on

the manuscript and Dr. Iwata Ozaki for the PDCD4 antibody.

REFERENCES

1. Lee, R. C., Feinbaum, R. L., and Ambros, V. (1993) Cell75, 843854

2. Lee, R. C., and Ambros, V. (2001) Science 294, 862864

3. Lau,N. C., Lim,L. P., Weinstein,E. G., and Bartel, D.P. (2001) Science 294,

858862

PDCD4

Vinculin

PDC

D4siRNA

ControlsiRNA

GUGGAAUAU - - - UCUAAUAAGCUA Position 224-248 ofPDCD43UTR

AGUUGUAGUCAGACUAUUCGAU hsa-miR-21

A

C

0

20

40

60

80

100

120

Contro l siRNA PDCD4 s iRNA

%V

iablecells

LNA scramble

LNA miR-21

pGL3

PDC

D4M

UT1

pGL3

PDC

D4M

UT1

+miR

-21

pGL3

PDC

D4M

UT1

+lin

-4

pGL3

PDC

D4M

UT2

pGL3

PDC

D4M

UT2

+miR

-21

pGL3

PDC

D4M

UT2

+lin

-4

pGL3

PDC

D4

pGL3

PDC

D4+

miR

-21

pGL3

PDC

D4+

lin-4

p < 0.003

0

0,2

0,4

0,6

0,8

1

1,2

1,4

***

Luciferas

e/Renillaratio

relativeto

control

B

D

FIGURE5.PDCD4 is animportantfunctionaltargetofmiR-21.A, potentialbindingpatternofmiR-21 tothe3-UTRofPDCD4. B, firefly luciferasereporterassay

with pGL3-PDCD4, pGL3-PDCD4MUT1,and pGL3-PDCD4MUT2 co-transfectedinto HEK cellswith a Renilla luciferasetransfection control plasmid, either aloneor together with miR-21 or lin-4 precursor miRNAs. Shown are relative luciferase values normalized to transfections without miRNA. Data are shown as themean S.D. of four replicates and are representative of two independent experiments. ***,p 0.001 using a two-tailed ttest. C, verification of PDCD4 knockdown in MCF-7 cells by Western analysis. D, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide growth assay in MCF-7cells treated with PDCD4 orcontrol siRNAs and transfected with inhibitors against miR-21 or a scrambledcontrol.Cell numberwas quantified 5 days after transfection. Data areshownasthe mean S.D. of three replicates and are representative of three independent experiments. The p value was calculated using a two-tailed ttest.





8/8

4. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T. (2001)

Science 294, 853858

5. Pillai, R. S., Bhattacharyya, S. N., and Filipowicz, W. (2007) Trends Cell

Biol. 17, 118126

6. Nilsen, T. W. (2007) Trends Genet. 23, 243249

7. Bagga, S., Bracht, J., Hunter, S., Massirer, K., Holtz, J., Eachus, R., and

Pasquinelli, A. E. (2005) Cell122, 553563

8. Jackson, R. J., and Standart, N. (2007) Sci. STKE2007, re1

9. Wu, L., Fan, J., and Belasco, J. G. (2006)Proc. Natl. Acad. Sci. U. S. A. 103,

40344039

10. Kloosterman, W. P., and Plasterk, R. H. (2006) Dev. Cell11, 441450

11. Meng, F., Henson, R., Wehbe-Janek, H., Ghoshal, K., Jacob, S. T., and

Patel, T. (2007) Gastroenterology 133, 647658

12. Jovanovic, M., and Hengartner, M. O. (2006) Oncogene 25, 61766187

13. Lu, J., Getz, G., Miska, E. A., Alvarez-Saavedra, E., Lamb, J., Peck, D.,

Sweet-Cordero, A.,Ebert, B. L.,Mak, R. H.,Ferrando, A. A.,Downing, J. R.,

Jacks, T., Horvitz, H. R., and Golub, T. R. (2005) Nature 435, 834838

14. Esquela-Kerscher, A., and Slack, F. J. (2006) Nat. Rev. Cancer 6,

259269

15. Calin, G. A., and Croce, C. M. (2006) Nat. Rev. Cancer6, 857866

16. Calin, G. A., and Croce, C. M. (2007) J. Clin. Investig. 117, 20592066

17. Sevignani, C., Calin, G. A., Nnadi, S. C., Shimizu, M., Davuluri, R. V.,

Hyslop, T., Demant, P., Croce,C. M., andSiracusa, L. D. (2007)Proc. Natl.

Acad. Sci. U. S. A. 104, 80178022

18. Welch, C., Chen, Y., and Stallings, R. L. (2007) Oncogene 26, 50175022

19. Calin, G. A., Dumitru, C. D., Shimizu, M., Bichi, R., Zupo, S., Noch, E.,

Aldler, H., Rattan, S., Keating, M., Rai, K., Rassenti, L., Kipps, T., Negrini,

M., Bullrich, F., and Croce, C. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99,

1552415529

20. Tarasov, V., Jung, P., Verdoodt, B., Lodygin, D., Epanchintsev, A.,

Menssen, A., Meister, G., and Hermeking, H. (2007) Cell Cycle 6,

15861593

21. Raver-Shapira, N.,Marciano, E.,Meiri, E.,Spector,Y., Rosenfeld, N.,Mos-

kovits, N., Bentwich, Z., and Oren, M. (2007) Mol. Cell26, 731743

22. Cimmino, A., Calin, G. A., Fabbri, M., Iorio, M. V., Ferracin, M., Shimizu,

M., Wojcik, S. E., Aqeilan, R. I., Zupo, S., Dono, M., Rassenti, L., Alder, H.,

Volinia, S., Liu, C. G., Kipps, T. J., Negrini, M., and Croce, C. M. (2005)Proc. Natl. Acad. Sci. U. S. A. 102, 1394413949

23. Johnson, S. M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng,A., Labourier, E., Reinert, K. L., Brown, D., and Slack, F. J. (2005) Cell120,

635647

24. He, L., Thomson, J. M., Hemann, M. T., Hernando-Monge, E., Mu, D.,

Goodson, S., Powers, S., Cordon-Cardo, C., Lowe, S. W., Hannon, G. J.,

and Hammond, S. M. (2005) Nature 435, 828833

25. le Sage, C., Nagel, R., Egan, D. A., Schrier, M., Mesman, E., Mangiola, A.,

Anile, C.,Maira, G.,Mercatelli,N., Ciafre, S. A., Farace, M. G.,and Agami,

R. (2007) EMBO J. 26, 36993708

26. Voorhoeve, P. M., le Sage, C., Schrier, M., Gillis, A. J., Stoop, H., Nagel, R.,

Liu, Y. P., van Duijse, J., Drost, J., Griekspoor, A., Zlotorynski, E., Yabuta,

N., De Vita, G., Nojima, H., Looijenga, L. H., and Agami, R. (2006) Cell

124, 11691181

27. Volinia, S., Calin, G. A., Liu, C. G., Ambs, S., Cimmino, A., Petrocca, F.,

Visone, R., Iorio, M., Roldo, C., Ferracin, M., Prueitt, R. L., Yanaihara, N.,

Lanza, G.,Scarpa, A., Vecchione, A., Negrini, M.,Harris, C. C., andCroce,C. M. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 22572261

28. Roldo, C., Missiaglia, E., Hagan, J. P., Falconi, M., Capelli, P., Bersani, S.,

Calin, G. A., Volinia, S., Liu, C. G., Scarpa, A., and Croce, C. M. (2006)

J. Clin. Oncol. 24, 46774684

29. Iorio, M. V., Ferracin, M., Liu, C. G., Veronese, A., Spizzo, R., Sabbioni,S.,

Magri,E., Pedriali,M., Fabbri, M.,Campiglio, M.,Menard,S., Palazzo,J. P.,

Rosenberg, A., Musiani, P., Volinia, S., Nenci, I., Calin, G. A., Querzoli, P.,

Negrini, M., and Croce, C. M. (2005) Cancer Res. 65, 70657070

30. Chan, J. A., Krichevsky, A. M., and Kosik, K. S. (2005) Cancer Res. 65,

60296033

31. Si, M.L., Zhu,S., Wu, H., Lu, Z., Wu, F., and Mo, Y.Y. (2007) Oncogene 26,

27992803

32. Zhu, S., Si, M. L., Wu, H., and Mo, Y. Y. (2007) J. Biol. Chem. 282,

1432814336

33. Meng, F.,Henson, R., Lang, M.,Wehbe, H.,Maheshwari, S.,Mendell, J. T.,

Jiang, J., Schmittgen, T. D., and Patel, T. (2006) Gastroenterology 130,

21132129

34. Brummelkamp, T. R., Bernards, R., and Agami, R. (2002) Science 296,

550553

35. Huber, W., von Heydebreck, A., Sultmann, H., Poustka, A., and Vingron,

M. (2002) Bioinformatics 18, Suppl. 1, S96S104

36. Griffiths-Jones, S. (2006) Methods Mol. Biol. 342, 129138

37. Grimson, A., Farh, K. K., Johnston, W. K., Garrett-Engele, P., Lim, L. P.,

and Bartel, D. P. (2007) Mol. Cell27, 91105

38. Chow, L. M., and Baker, S. J. (2006) Cancer Lett. 241, 184196

39. Vousden, K. H.,and Lane, D. P. (2007)Nat. Rev. Mol. Cell. Biol. 8, 275283

40. Yang, H. S., Knies, J. L., Stark, C., and Colburn, N. H. (2003) Oncogene 22,

37123720

41. Chen, Y., Knosel, T.,Kristiansen, G.,Pietas, A., Garber, M. E.,Matsuhashi,

S., Ozaki, I., and Petersen, I. (2003) J. Pathol. 200, 640646

42. Gao, F., Zhang, P., Zhou, C., Li, J., Wang, Q., Zhu, F., Ma, C., Sun, W., and

Zhang, L. (2007) Oncol. Rep. 17, 123128

43. Zhang, H., Ozaki, I., Mizuta, T., Hamajima, H., Yasutake, T., Eguchi, Y.,

Ideguchi, H., Yamamoto, K., and Matsuhashi, S. (2006) Oncogene 25,

61016112

44. Jing, Q., Huang, S., Guth, S., Zarubin, T., Motoyama, A., Chen, J., Di

Padova, F., Lin, S. C., Gram, H., and Han, J. (2005) Cell120, 623634

45. Brennecke, J.,Stark, A.,Russell,R. B.,and Cohen,S. M. (2005)PLoSBiol. 3,

e85

46. Lim, L. P., Lau, N. C., Garrett-Engele, P., Grimson, A., Schelter, J. M.,

Castle, J., Bartel, D. P., Linsley, P. S., andJohnson,J. M. (2005)Nature 433,

769773

47. Christoffersen, N. R., Silahtaroglu, A., Orom, U. A., Kauppinen, S., and

Lund, A. H. (2007) RNA (N. Y.) 13, 11721178

48. Krutzfeldt, J., Rajewsky, N., Braich, R., Rajeev, K. G., Tuschl, T., Manoha-

ran, M., and Stoffel, M. (2005) Nature 438, 685689

49. Humphreys, D. T.,Westman,B. J.,Martin, D. I.,and Preiss, T. (2005)Proc.

Natl. Acad. Sci. U. S. A. 102, 1696116966

50. Bhattacharyya, S. N., Habermacher, R., Martine, U., Closs, E. I., and Filip-owicz, W. (2006) Cell125, 11111124

51. Yang, H. S., Jansen, A. P., Nair, R., Shibahara, K., Verma, A. K., Cmarik,

J. L., and Colburn, N. H. (2001) Oncogene 20, 669676

52. Jansen, A. P., Camalier, C. E., Stark, C., and Colburn, N. H. (2004) Mol.

Cancer Ther. 3, 103110

53. Goke, R., Barth, P., Schmidt, A., Samans, B., and Lankat-Buttgereit, B.

(2004) Am. J. Physiol. 287, C1541C1546

54. Jansen, A. P., Camalier, C. E., and Colburn, N. H. (2005) Cancer Res. 65,

60346041

55. Young, M. R., Yang, H. S., and Colburn, N. H. (2003) Trends Mol. Med. 9,

3641

56. Hwang, S. K., Jin, H., Kwon, J. T., Chang, S. H., Kim, T. H., Cho, C. S., Lee,

K. H., Young, M. R., Colburn, N. H., Beck, G. R., Jr., Yang, H. S., and Cho,

M. H. (2007) Gene Ther. 14, 13531361

57. Lankat-Buttgereit, B., and Goke, R. (2003) Biol. Cell95, 51551958. Goke, A., Goke, R., Knolle, A., Trusheim, H., Schmidt, H., Wilmen, A.,

Carmody, R., Goke, B., and Chen, Y. H. (2002) Biochem. Biophys. Res.

Commun. 297, 7882

59. Yang, H.S., Jansen, A. P., Komar, A.A., Zheng, X., Merrick, W.C., Costes,

S., Lockett, S. J., Sonenberg, N., and Colburn, N. H. (2003) Mol. Cell. Biol.

23, 2637

60. Dorrello, N. V., Peschiaroli, A., Guardavaccaro, D., Colburn, N. H., Sher-

man, N. E., and Pagano, M. (2006) Science 314, 467471

61. Levine, A.J.,Feng, Z., Mak,T. W., You,H.,andJin, S.(2006) GenesDev. 20,

267275




Documents

Programed Text Cell Death