29
NATIONAL VETERINARY RESEARCH INSTITUTE PARTYZANTOW 57 24-100 PULAWY, POLAND tel. (48) 81 8863051 fax (48) 81 8862595 http://www.piwet.pulawy.pl

NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

  • Upload
    vudang

  • View
    224

  • Download
    0

Embed Size (px)

Citation preview

Page 1: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

NATIONAL VETERINARY RESEARCH INSTITUTE

PARTYZANTOW 5724-100 PULAWY, POLAND

tel. (48) 81 8863051fax (48) 81 8862595

http://www.piwet.pulawy.pl

Page 2: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Pulawy

Page 3: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

NATIONAL VETERINARY RESEARCH INSTITUTE

established in 1945

as a scientific institution of theMinistry of Agriculture

Page 4: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

The major mission of the NVRI is applied research in veterinarymedicine and provide services for

the public veterinary sector

Page 5: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Ministry of Agriculture and Rural Development

Veterinary InspectionChief Veterinary Officer

Voivodship Veterinary InspectorateVoivodship Veterinary Officer

16

District Veterinary InspectorateDistrict Veterinary Officer

295

Border Veterinary Inspectorate27

NationalNational VeterinaryVeterinary ResearchResearch InstituteInstituteNationalNational ReferenceReference LaboratoriesLaboratories

Regional Veterinary Diagnostic Laboratories16

Branch laboratories29

Private practicioners

Scheme of veterinary services in Poland

Prime Minister’s Office

Private laboratories60

Page 6: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

NationalNational VeterinaryVeterinaryResearchResearch InstituteInstitute

Page 7: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Research staff

The Institute employs 350 persons

33 researchers with Sc.D. and Ph.D.

40 researchers with Ph.D

49 researchers with D.V.M. or M.Sc

102 technicians

Page 8: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Organization of the NVRI

Laboratories representing basic disciplines(bacteriology, virology, biochemistry, parasitology,pathology,toxicology and pharmacology, food andfeedingstuffs hygiene

Laboratories for the diseases of particular animalspecies: equine, swine, poultry, fish

Laboratories for diseases of special significance foranimals and husbandry (tuberculosis, foot and mounthdisease, mastitis) and zoonoses

Page 9: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

The NVRI contributes the activity on the following fields:

Experimental research into animal diseases

Reference activity dedicated to the regional diagnostic laboratories and the Veterinary Inspection

Active surveillance - implementation and execution of the Multiannual Monitoring Programme

Page 10: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

17.01.2005

Construction of the newlaboratories started

Page 11: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease
Page 12: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease
Page 13: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease
Page 14: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease
Page 15: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease
Page 16: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

National reference laboratories (NRL)

A network of 14 laboratories within different departments of NVRI appointed with the Act ofMinistry of Agriculture and Rural Development

of October 21, 2004 for the reference activities

Page 17: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

The most important elements in the functioning of the NRL are:

Reference duties are fully integrated with activity of NVRI departments undertaking research and training

Reference activity has its own budget

Page 18: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

PAP, medicated feedingstuff, microbiological agentsHigiene of Animal Feedingstuff

Food microbiology Higiene of Food of Animal Origin

Residues of pesticides, PCBs, toxic elements, veterinary drugs, hormones, mycotoxins

Pharmacology &Toxicology

Dioxines, nitrosoaminesRadiology & Toxicology

IHN, ISA, SV, VHS, IPN, BKDFish Diseases

FMD, SVDFood and Mouth Disease

HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., mycoplasmosis, Poultry Diseases

Q fever, chlamydiosis, CBPP,Cattle & Sheep Disease

Bovine leukosis, MVV, CAEVBiochemistry

BSE, scrapiePathology

CSF, Aujeszky’s Dis., leptospirosis, TGE Swine Diseases

BSE, rabies, IBR/IPV, EAV, EVA Virology

Brucellosis, antrax, listeriosis, tubercullosisMicrobiology

Reference activityDepartment/Laboratory

Activities of NRL (46)

Page 19: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

What are the duties of NRL?

to collaborate with the regional laboratories in terms of harmonization standards and diagnostic methods

to carry out the proficiency tests

to control the quality of diagnostic reagents used for thetests reffered to the diagnosis of infectious diseases

to collect and process epidemiological data related to animal infectious diseases and official food control

to perform laboratory examinations to confirm the resultsdone by authorized laboratories, if there are some doubts

to train the employees of the authorised laboratories

Page 20: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

NRL for Campylobacter

Located at Department of Hygiene ofFood of Animal Origin of NVRI

Page 21: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Campylobacter – mainactivities (since 2004)

Development of molecular identificationmethods (PCR)

Application of PCR and RFLP methods for differentiation of the strains

Isolation and identification of Campylobacterfrom poultry

Page 22: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

PCR methods

500asp(C. coli)

GGTATGATTTCTACAAAGCGAGATA AAAGACTATCGTCGCGTG

CC18FCC519R

m-PCR 2**

57916S rRNA(C. lari)

ATGCAAGTCGAACGATGAAGCGAC CCACTCTAGATTACCAGT TTCCC

CL55 CL632

735hipO(C. jejuni)

GAAGAGGGTTTGGGTGGTAGCTAGCTTCGCATAATAACTTG

HIP400FHIP1134R

PCR 3***

462ceuE(C. coli)

AATTGAAAATTGCTCCAACTATGTGATTTTATTATTTGTAGCAGCG

COL3MDCOL2

589mapA(C. jejuni)

CTATTTTATTTTTGAGTGCTTGTGGCTTTATTTGCCATTTGTTTTATTA

MDmapA1MDmapA2

85716S rRNA(C. coli and C. jejuni)

ATCTAATGGCTTAACCATTAAAC GGACGGTAACTAGTTTAGTAT T

MD16S1MD16S2

m-PCR 1*

Size ofPCR

amplicon(bp)

Target geneSequence (5´→3´)PrimersPCR test

* Denis M., Soumet C., Rivoal K., Ermel G., Blivet D., Salvat G., Colin P.: Development of a m-PCR assay for simultaneous identification of Campylobacter jejuni and C. coli. Lett. Appl. Microbiol. 1999, 29, 406-410.

** Linton D., Lawson A. J., Owen R. J., Stanley J.: PCR detection, identification to species level, and fingerprinting of Campylobacter jejuniand Campylobacter coli direct from diarrheic samples. J. Clin. Microbiol. 1997, 35, 2568-2572.

***Oyarzabal O. A., Wesley I. V., Barbaree J. M., Lauerman L. H., Conner D. E.: Specific detection of Campylobacter lari by PCR. Journal ofMicrob. Methods, 29, 1997, 97-102.

Page 23: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Multiplex PCR results

M 1 2 3 4 5 6 7 8 9 10 M

500 bp →

Lanes: 1 – C. jejuni and C. coli, 2 – C. coli, 3 - C. jejuni, 4 – E. coli EDL 933, 5 – negative control (H2O), 6 - C. jejuni and C. coli, 7 - C. coli, 8 – C. jejuni, 9 - E. coli EDL 933, 10 –negative control (H2O), M - 100 bp DNA marker

Page 24: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Differentiation by molecular methods

94°C/5 min, 30 cycles:48°C/1 min, 72°C/2 min, 94°C/1 min and 72°C/5

minGGATTTCGTATTAACACAAATGGTGC

CTGTAGTAATCTTAAACATTTTGflaAFflaAR

flaA typing

SmaI, SacII and bothPFGE

94°C/4 min, 40 cycles: 25°C/45 s, 72°C/1 min, 94°C/45 s and 72°C/5

min

ATGTAAGCTCCTGGGATCACAAGTAAGTGACTGGGGTGAGCG

ERIC1RERIC2

ERIC-PCR

94°C/5 min, 40 cycles:37°C/1 min, 72°C/1 min, 94°C/1 min and

72°C/10 minCAATCGCCGT CCGCAGCCAA

OPA-111254

RAPD-PCR

Amplifictions conditionsSequence (5´→3´)Primername

Method

Page 25: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

1009080706050

C. j. 3C. j. 6C. j. W20C. j. W25C. j. W35C. j. W7C. j. W11C. j. W18C. j. 21C. j. W47C. j. W40C. j. W41

ERIC-PCR results

M 3 6 21 W7 W11 W18 W20 W25 W35 W40 W41 W47 M

Page 26: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

3 6 21 W7 W11 W18 M W20 W25 W35 W40 W41 W47

100908070605040302010

C. j. W40C. j. W41C. j. W25C. j. W35C. j. 21C. j. W7C. j. W11C. j. W18C. j. W20C. j. 3C. j. 6C. j. W47

RFLP/PFGE (SmaI) results

Page 27: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Proficiency tests

• Detection of Campylobacter in chickenmatrix, organized by FEPAS, UK, November 2005

• Identification of Campylobacter, organizedby WHO Global Salm-Surv, ExternalQuality Assurance System, Denmark, October 2006

Page 28: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Selected publications• K. Wieczorek, J. Osek: Multiplex PCR assays for simultaneous identification of

Campylobacter jejuni and C. coli. [in Polish]. Medycyna Weterynaryjna 2005, 61, 797

• K. Wieczorek, J. Osek: Campylobacter as a cause of gastrointestinal infections. A review. [in Polish]. Medycyna Weterynaryjna 2005, 61, 847

• K. Wieczorek, J. Osek: The usefulness of some selected PRC techniques indifferentiating thermotolerant Campylobacter strains. [in Polish]. Zywnosc, Nauka, Technologia, Jakosc 2005, 45, 132

• K. Wieczorek, J. Osek: Prevalence of virulence markers in Campylobacter jejuniand Campylobacter coli obtained from chicken carcasses. [in Polish]. Zoonozy, 2005, 92

• K. Wieczorek, J. Osek: Identification of thermophilic Campylobacter jenuni andCampylobacter coli by multiplex PCR. Hygiena Alimentorum XXVII, 2006, 253

• K. Wieczorek, J. Osek: Differentiation of Campylobacter jejuni isolates by random amplified polymorphic DNA method. [in Polish]. Medycyna Weterynaryjna 2006, 62, 663

Page 29: NATIONAL VETERINARY RESEARCH INSTITUTE - sva.se · Food and Mouth Disease FMD, SVD HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., Poultry Diseases mycoplasmosis, Cattle & Sheep Disease

Contact

Prof. Jacek Osek, DVM, PhDNational Veterinary Research InstituteDepartment of Hygiene of Food of Animal OriginPartyzantow 5724-100 Pulawy, PolandPhone: +48 81 8863051Fax: +48 81 8862595E.mail: [email protected]