N-Linked Glycosylation of GP5 of Porcine Reproductive and

N-Linked Glycosylation of GP5 of Porcine Reproductive andRespiratory Syndrome Virus Is Critically Important for VirusReplication In Vivo

Zuzhang Wei, Tao Lin, Lichang Sun, Yanhua Li, Xiaoming Wang, Fei Gao, Runxia Liu, Chunyan Chen, Guangzhi Tong,and Shishan Yuan

Department of Swine Infectious Diseases, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Shanghai, China

It has been proposed that the N-linked glycan addition at certain sites in GP5 of porcine reproductive and respiratory syndromevirus (PRRSV) is important for production of infectious viruses and viral infectivity. However, such specific N-linked glycosyla-tion sites do not exist in some field PRRSV isolates. This implies that the existence of GP5-associated glycan per se is not vital tothe virus life cycle. In this study, we found that mutation of individual glycosylation sites at N30, N35, N44, and N51 in GP5 didnot affect virus infectivity in cultured cells. However, the mutants carrying multiple mutations at N-linked glycosylation sites inGP5 had significantly reduced virus yields compared with the wild-type (wt) virus. As a result, no viremia and antibody responsewere detected in piglets that were injected with a mutant without all N-linked glycans in GP5. These results suggest that theN-linked glycosylation of GP5 is critically important for virus replication in vivo. The study also showed that removal ofN44-linked glycan from GP5 increased the sensitivity of mutant virus to convalescent-phase serum samples but did not elicit ahigh-level neutralizing antibody response to wt PRRSV. The results obtained from the present study have made significant con-tributions to better understanding the importance of glycosylation of GP5 in the biology of PRRSV.

Porcine reproductive and respiratory syndrome virus (PRRSV)is a member of the order Nidovirales, family Arteriviridae,

which also includes equine arteritis virus (EAV), lactate dehydro-genase-elevating virus (LDV), and simian hemorrhagic fever virus(SHFV) (35, 38). PRRSV has been further classified into two ge-notypes, the European genotype 1 and the North American geno-type 2. These two genotypes share approximately 60% nucleotidesequence identity (1, 18, 21, 32). PRRSV contains a positive-stranded RNA genome of approximately 15.4 kb consisting of 10open reading frames (ORFs). ORF1a and ORF1b encode polypro-teins that are processed to 14 nonstructural proteins (nsp’s) byviral protease (19). ORF2a, ORF2b, ORF3, ORF4, ORF5a, andORF5 to ORF7 encode eight structural proteins, namely, GP2a,GP2b (or -E), GP3, GP4, ORF5a, GP5, matrix protein (M), andnucleocapsid (N) (20, 23, 38, 49). All of these structural proteinshave been shown to be important for virus infectivity due to theircritical roles in virion assembly and/or interaction with cell sur-face receptors (20, 30, 48).

The major envelope protein GP5 is a transmembrane protein.GP5 possesses two to four potential N-linked glycosylation sitesthat are located in a small ectodomain (9, 16). In the mature GP5,this small ectodomain consists of the first 30 to 35 residues (9, 16).The N-linked glycosylation of GP5 is believed to be involved indiverse functions such as receptor binding, virus infectivity, andinduction of immune response. The N-linked glycans in GP5 werereported to play a role in M/GP5 complex attachment to pig sia-loadhesin (pSn) receptor, thus conferring virus tropism to mono-cyte/macrophage-derived cells (15, 42). The attachment was crit-ically dependent on the sialic acid-binding capacity of the pSnreceptor as well as on the sialic acids on the viral GP5 glycoprotein(10, 11, 25, 41). Previous studies stated that ablation of a glycan inGP5 reduced or abolished the growth of PRRSV in MARC-145cells or porcine alveolar macrophages (PAMs) (2, 47). This con-clusion was challenged by the fact that some PRRSV isolates in

which N-linked glycosylation was absent at certain sites in GP5displayed efficient growth in MARC-145 cells and infection in pigs(17, 27, 43). Similarly, the N-linked glycosylation site (N45) ofLDV was abolished by a T substitution but the mutant virusesreplicated well in cultured macrophages and mice (5). On theother hand, the N-linked glycosylation in GP5 may be associatedwith the antigenicity of the neutralization epitopes located in theectodomain. The removal of the N-linked glycosylation site atN34 or N51 from GP5 led to an increase in neutralization level astested using the mutant viruses (2, 17, 43). In addition, the N-gly-can might also be employed by the virus to shield against theneutralizing antibodies (2, 17). Viruses carrying an N-linked gly-cosylation site mutation at N35 or N51 in GP5 were more sensitiveto neutralization by antibodies (2, 43). The influence of the N44-linked glycan of GP5 on host immune response remains elusive. APRRSV isolate bearing the N-linked glycosylation mutation at theN44 site elicited a low-level neutralizing antibody response andwas resistant to antibody neutralization (17). However, elimina-tion of the N-linked glycan at position N45 in GP5 of LDVstrongly enhanced the immunogenicity of the neutralizationepitope and increased the sensitivity to antibody neutralization(5). Therefore, more genetic and immunological information isneeded to clarify the exact role of the N44-linked glycosylation inGP5 of PRRSV.

Previous studies on ablation of N-linked glycosylation of GP5

Received 9 December 2011 Accepted 26 June 2012

Published ahead of print 3 July 2012

Address correspondence to Guangzhi Tong, [email protected], or Shishan Yuan,[email protected].

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JVI.07067-11

September 2012 Volume 86 Number 18 Journal of Virology p. 9941–9951 jvi.asm.org 9941

on April 2, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1128/JVI.07067-11

http://jvi.asm.org

http://jvi.asm.org/

did not address whether the removal of the glycosylation per se orthe associated structural changes in GP5 or ORF5a protein ac-counted for the observed growth-defective phenotypes. The latterscenario is supported by the existence of field PRRSV isolates thatare devoid of GP5 N-linked glycosylation. Therefore, we hypoth-esized that the reported deleterious effects of the N-linked glycanablation on growth of PRRSV might be strain specific or that thepreviously unknown ORF5a gene was unintentionally mutated. Inthis study, we demonstrated that all of the N-linked glycans in GP5were nonessential for virus viability in vitro but critically impor-tant for virus replication in vivo. The study also showed that elim-ination of the N-glycan at position N44 in GP5 increased the sen-sitivity of mutant viruses to antibody neutralization but did notelicit higher neutralization antibody responses to wild-type (wt)PRRSV.

MATERIALS AND METHODSCells, viruses, and plasmids. MARC-145 and BHK-21 (ATCC, CCL10)cells were maintained as described in our previous study (40). PAMs wereharvested from lungs of 6-week-old PRRSV-negative piglets as describedpreviously (46) and maintained at 37°C in RPMI 1640 (Gibco) supple-mented with 10% fetal bovine serum (FBS). PRRSV JXM100 (GenBankaccession no. GQ475526) was obtained through 100 serial passages of thehighly pathogenic PRRSV JX143 strain (EU708726) in MARC-145 cells(24). The infectious PRRSV cDNA clone pAJXM was constructed fromthe cell-adapted strain JXM100 (X. Wang, L. Sun, Y. Li, T. Lin, F. Gao, R.Liu, X. Li, H. Yao, G. Tong, Z. Wei, and S. Yuan, unpublished data) andserved as the backbone for all GP5 glycosylation site mutations used in thisstudy. In each consensus sequence of N-linked glycosylation sites, N-X-T/S, the first amino acid of the motif N-encoding codon was replaced withY, S, or K or the third codon of the motif S was replaced with N or R.Site-directed mutagenesis was accomplished through splicing overlap-ping extension (SOE) PCR as previously reported (44). To generate themutant plasmid pJGP5S32N carrying an N-linked glycosylation site mu-tation at position N30, GP5 glycosylation mutagenic primers (GP5S32NFand GP5S32NR) and flanking primers (SF11422 and QNT) were used tomake intermediate PCR products SF-S32R and S32F-QNT, which werethen denatured and used as the templates for the second-round fusionPCR. The resulting PCR fragments were digested with appropriate restric-tion enzymes (AscI and NotI) and ligated into similarly digested plasmidpAJXM. The other GP5 mutants with single glycosylation sites were gen-erated in the same manner using the primers listed in Table 1. The single-site glycosylation mutants were used as backbones to generate double-,triple-, and quadruple-site mutants.

DNA transfection and recovery of mutant viruses. Mutant plasmidswere purified using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Ger-many). BHK-21 cells were grown to 70% confluence in six-well plates, and3.75 �g plasmid was transfected by using 18.75 �l Lipofectamine LTX and3.75 �l Plus reagent (Invitrogen) according to the manufacturer’s instruc-tions. Rescued viruses were designated as the primary passage (P0) andused to infect MARC-145 cells for three subsequent passages (P1 to P3)using a 103 dilution at each passage.

IFA. Indirect immunofluorescence assay (IFA) was performed for thedetection of viral antigens in infected cells. MARC-145 cells or PAMs wereinfected with the individual mutant viruses. At 24 or 48 h postinoculation(hpi), infected cells were washed twice with phosphate-buffered saline(PBS), followed by fixation in cold methanol and treatment in 1% bovineserum albumin (BSA). The cells were incubated at 37°C for 2 h with themonoclonal antibody against PRRSV N protein (D5-4, a kind gift fromShaoying Chen at Fujian Academy of Agricultural Sciences, China). Afterextensive washing with PBS, the cells were incubated for 1 h with anti-mouse Alexa-568-labeled secondary antibody (Sigma). The cells werewashed five times with PBS. Finally, the fluorescence was visualized underan Olympus inverted fluorescence microscope equipped with a camera.

Multistep growth curve. Subconfluent MARC-145 cells in six-wellplates were infected with rescued viruses (P3) at a multiplicity of infection(MOI) of 0.01. After 1 h of incubation at 37°C, cells were washed threetimes with PBS and incubated at 37°C in 3 ml of Eagle’s minimal essentialmedium (EMEM) containing 2% FBS in a CO2 incubator. At certain timepoints (12, 24, 48, 72, 96, and 120 h) postinfection, supernatants (0.2ml/well) were collected and frozen at �70°C till use. The viral titers (50%tissue culture infective dose [TCID50]/ml) were measured in MARC-145cells and calculated by the Reed and Muench method (34).

Viral plaque assay. To examine the plaque size of the glycosylationmutant viruses, 10-fold serially diluted virus suspensions (P3) were inoc-ulated into MARC-145 cells in six-well plates. After 1 h of adsorption, cellmonolayers were washed and then overlaid with a mixture of EMEMcontaining 2% FBS and 1% low-melting-temperature agarose (Cambrex,Rockland, ME). When the agarose overlay solidified, the plates were in-verted and incubated at 37°C for 4 days in a humidified CO2 incubator.The resulting plaques were stained with crystal violet (5% [wt/vol] in 20%ethanol).

Glycosylation assay and Western blotting. MARC-145 cells at 1 �106 cells/well in six-well plates were infected with the mutant viruses. At 24hpi, the cells were solubilized in lysis buffer (Beyotime). The lysates weretreated in denaturing buffer at 100°C for 10 min. Subsequently, each ali-quot was treated for 5 h at 37°C with 50 U peptide N-glycosidase F(PNGase F) according to the manufacturer’s instructions (New EnglandBioLabs, Inc., Beverly, MA). The proteins were separated by SDS-PAGE

TABLE 1 Primers used in this studya

Primer Sequence (5=–3=) Application

GP5S32NF GTGCTCGTCAACGCCAaCAACAACAACAGCTC PCR mutagenesis for N30 of GP5GP5S32NR GAGCTGTTGTTGTTGtTGGCGTTGACGAGCACGP5N35SF AACGCCAGCtACAgCAgCAGCTCTCAT PCR mutagenesis for N35 of GP5GP5N35SR ATGAGAGCTGcTGcTGTaGCTGGCGTTGP5N44KF CATATTCAGTTGATTTATaagTTAACGCTATGTGA PCR mutagenesis for N44 of GP5GP5N44KR CTCACATAGCGTTAActtATAAATCAACTGAATATGGP5N51SF CGCTATGTGAGCTGAgTGGCACAGATTGGCTGGC PCR mutagenesis for N51 of GP5GP5N51SR GCCAGCCAATCTGTGCCAcTCAGCTCACATAGCGGP5S32D/N35SF GTGCTCGTCAACGCCagaTACAGCAGCAGC PCR mutagenesis for N30 and N35GP5S32D/N35SR GCTGCTGCTGTAtctGGCGTTGACGAGCACQNT GAGTGACGAGGAGCGGCCGCTTTTTTTTTTTT SOE-PCRSF11422 ACGGTGCCAAAATTATTCTGTCTAGORF5F GGCAATGTGTCAGGCATCGTGG RT-PCR amplification for ORF5ORF5R GCGACTTACCTTTAGAGCATAa Suffixes: F, forward primer; R, reverse primer. The mutant nucleotides are indicated in lowercase letters.

Wei et al.

9942 jvi.asm.org Journal of Virology


http://jvi.asm.org/

Dow

nloaded from

http://www.ncbi.nlm.nih.gov/nuccore?term=GQ475526

http://jvi.asm.org

http://jvi.asm.org/

and transferred onto polyvinylidene difluoride (PVDF). Following trans-fer, the membranes were blocked overnight at 4°C with nonfat milk inPBS-Tween 20 (PBST). The membranes were washed three times withPBST and incubated for 2 h at 37°C with GP5 monoclonal antibody (1:1,000). Then, the membranes were washed five times with PBST and in-cubated with horseradish peroxidase (HRP)-conjugated murine second-ary antibody for 1.5 h at 37°C. Subsequently, the membranes were washedfive times with PBST. The blots were imaged using SuperSignal WestFemto maximum-sensitivity substrate (Pierce Biotechnology, Inc., Rock-ford, IL).

One-step qRT-PCR and RT-PCR. Viral RNA was extracted from140-�l pig serum samples followed by one-step quantitative real-timePCR (qRT-PCR) using a Qiagen kit. Primers and probes were designedusing Primer Express 2.0 software and are listed in Table 1. The targetedregions were located in nsp1. A plus-strand PRRSV RNA standard wasgenerated from AfeI-linearized pAJXM infectious clone DNA using aMEGAscript T7 kit (Ambion, Austin, TX). To remove all enzymes andfree nucleotides from the MEGAscript kit reaction mixtures, the tran-scripts were purified by phenol-chloroform extraction and isopropyl pre-cipitation according to the instructions. Quantitation of the transcriptRNA was performed spectrophotometrically at 260 nm. Serial dilution ofthe in vitro-transcribed PRRSV RNA was performed to yield standards of106, 105, 104, and 103 RNA copies/�l. One-step qRT-PCR was carried outin a 25-�l reaction volume containing 2 �l extracted RNA, 12.5 �l of 2�RT-PCR mix for probes, 10 pmol forward and reverse primers, 10 pmolprobe, and 0.5 �l iScript reverse transcriptase (Bio-Rad).

Sequencing of RT-PCR products was carried out to analyze the intro-duced mutations in GP5. The fragments containing the GP5 region wereamplified by Taq DNA polymerase (TaKaRa, Dalian, China) using for-ward primer GP5F and reverse primer GP5R flanking ORF5 (Table 1).The PCR products were purified using a TIANgel mini-purification kit(Tiangen) and sequenced.

Infection of PAMs. To investigate the infectivity of the mutant vi-ruses, equal numbers of viral particles (109 RNA copy number) were usedto infect PAMs. After 1 h of incubation, fresh culture medium was added.At 24 hpi, the infected PAMs were examined in an IFA to determine virustiters (TCID50/ml).

Piglet infection. Four-week-old PRRSV-free piglets were randomlydivided into four groups, three piglets in each group. Three groups ofpiglets were injected intramuscularly with 106 TCID50/ml of vAJXM,vJGP5N44K, or vJGP5N35/44/51S, respectively. A fourth group of pigletsserved as noninfection control. Clinical signs (coughing, dyspnea, an-orexia, diarrhea, lameness, shivering, and fever) were recorded daily. Theserum samples were collected at 3, 7, 14, 21, 28, 35, 42, and 49 dayspostinfection (dpi) and assayed in a quantitative RT-PCR, a HerdChekenzyme-linked immunosorbent assay (ELISA) (Idexx Laboratories Inc.,Westbrook, ME), and a neutralizing antibody test.

PRRSV-neutralizing antibody titers in serum samples were deter-mined using fluorescent focus neutralization (FFN) as described previ-ously (2, 17, 43). Briefly, serum samples were heat inactivated for 30 minat 56°C and 2-fold diluted. Then, the serum dilutions were mixed with anequal volume of culture medium containing 200 TCID50 of PRRSV. Themixtures were incubated at 37°C for 1 h and added to MARC-145 cells orPAMs in 96-well tissue culture plates. The plates were incubated for 36 hat 37°C in a humidified atmosphere containing 5% CO2. The cells werefixed, and infected cells (foci) were detected in an indirect IFA usinganti-N monoclonal antibody (D5-4). The titers of neutralizing antibodiesagainst PRRSV were expressed as the reciprocal of the highest serum di-lution that inhibited 90% of the foci compared with those present in thenonserum control wells.

To assess viremia in infected piglets, copies of virus genomic RNA inthe serum samples were detected by qRT-PCR as described above. Thepresence of viremia in the infected piglets was also examined by inoculat-ing the serum samples into MARC-145 cells. The cytopathic effect (CPE)in infected MARC-145 cells was observed microscopically for 5 days. Fol-

lowing this, the monolayers were fixed and IFA was performed as de-scribed above.

Statistical analysis. Statistical analysis of neutralization antibody andvirus titers was performed using SPSS 12.0 for Windows (SPSS Inc., Chi-cago, IL). One-way analysis of variance (ANOVA) was used to evaluatethe differences among the geometric mean neutralizing antibody and vi-rus titers. Subsequently, the Duncan honestly significant difference testwas used to examine multiple comparisons.

RESULTSMutations at individual N-linked glycosylation sites in GP5 donot affect infectivity of rescued viruses in MARC-145 cells. Twoprevious studies showed that the ablation of N-linked glycan inGP5 decreased the production of virus particles and infectivity ofmutant viruses (2, 47). However, these investigations did not ex-amine whether the loss of glycosylation per se or other accidentalstructural alteration of GP5 or ORF5a protein due to artificiallyintroduced amino acid substitutions accounted for the observeddefective phenotypes. In this study, we addressed this issue byintroducing specific residues that existed in some field PRRSVisolates into GP5 of JXM100 virus (Fig. 1B and C). There were fourpotential N-linked glycosylation sites predicted to exist in GP5 bythe NetNGlyc 1.0 program. The full-length infectious cDNA clonepAJXM was used as the template for reverse genetic manipulation.Each consensus sequence for four potential N-linked glycosyla-tion sites in GP5, N-X-S, an N codon, or an S codon was replacedto generate the targeted amino acid residues as shown in Fig. 1C.As a result, 4 single glycosylation site mutants, pJGP5S32N,pJGP5N35S, pJGP5N44K, and pJGP5N51S, were generated.These mutants were transfected into BHK-21 cells. At 48 hoursposttransfection (hpt), supernatants of the transfected cells werecollected and used to infect fresh MARC-145 cells. As visualized inIFA, all the mutants expressed the PRRSV N protein and spreadinto the neighboring cells at 48 hpi (Fig. 2A). These results indi-cated that mutant viruses (vJGP5S32N, vJGP5N35S, vJGP5N44K,and vJGP5N51S) containing single mutations at N30, N35, N44,or N51 in GP5 retained cellular infectivity, suggesting that none ofthese 4 N-glycosylation sites in GP5 had a vital effect on virusviability.

To further characterize the mutants carrying a single glycosy-lation site mutation in GP5, the multistep growth kinetic was de-termined in infected MARC-145 cells. As shown in Fig. 2B, thegrowth kinetics of the mutants carrying single glycosylation sitemutations were similar to that of wt virus. The overall yieldswere not significantly different between wt and mutant viruses.The viral plaque size was also determined on MARC-145 cells tomonitor any phenotype changes of mutants. The plaques pro-duced by wt and mutant viruses were similar (Fig. 2C). Theseresults also suggested that the ablation of a single glycosylation sitein GP5 did not affect virus infectivity.

N-linked glycosylation of GP5 is not essential for virus via-bility in MARC-145 cells. To analyze whether multiple N-linkedglycosylation site mutations in GP5 affected the virus replication,the mutant clones (pJGP5N30/35S, pJGP5N35/44S, pJGP5N44/51S, pJGP5N35/51S, pJGP5N35/44/51S, and pJGP5Null) weretransfected into BHK-21 cells. At 48 hpt, supernatants of thetransfected cells were harvested and used to infect fresh MARC-145 cells. The growth of the mutants was examined in an IFA usingthe anti-N protein monoclonal antibody. As shown in Fig. 3A, theintracellular expression of N protein was positive for all mu-tants. These results indicated that all mutants (vJGP5N30/35S,

PRRSV GP5 N-Glycosylation Important for Replication

September 2012 Volume 86 Number 18 jvi.asm.org 9943


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org

http://jvi.asm.org/

vJGP5N35/44K, vJGP5N35/51S, vJGP5N44/51S, vJGP5N35/44/51S, and vJGP5Null) still retained virus infectivity, suggesting thatthe N-linked glycosylation of GP5 was not essential for virus via-bility in MARC-145 cells.

To further characterize the mutants carrying multiple N-linked glycosylation site mutations in GP5, their multistep growthkinetics were determined in infected MARC-145 cells. As shownin Fig. 3B, wt and mutant viruses displayed similar multistepgrowth curves. However, the overall yields of the mutants carryingdouble N-linked glycosylation site mutations were nearly 1 log lessthan that of wt virus (P � 0.5) while the mutants carrying triple orquadruple N-linked glycosylation site mutations showed approx-imately 2 logs less than that of wt virus (P � 0.5). The viral plaquesize was also examined in MARC-145 cells. As shown in Fig. 3C,the plaques generated by vJGP5N35/44S, vJGP5N44/51S, andvJGP5N35/51S were almost similar in size but smaller than theplaques generated by vJGP5N30/35S. The plaques generated byvJGP5N35/44/51S and vJGP5Null were slightly smaller than thosegenerated by the mutants carrying double glycosylation site mu-tations. These results demonstrated that all of the N-linked gly-cans in GP5 were not essential for virus viability but that their lossdecreased the infectivity of PRRSV particles.

Confirmation of the introduced mutations and glycosylationstatus of GP5 in infected MARC-145 cells. To determine whether

the introduced mutations were maintained in GP5 of the mutants,supernatants were collected from MARC-145 cells infected witheach passage of the mutants. The cDNA fragment containing theGP5 coding region was amplified by RT-PCR followed by nucle-otide sequencing. The results confirmed the engineered deletionsin all of the passaged mutants. No other mutations were detectedin the GP5 coding region (data not shown).

To analyze the N-linked glycosylation status of GP5 and todetermine whether these four glycosylation sites were present, ly-sates from MARC-145 cells infected with mutants and wt viruswere prepared and analyzed by Western blotting. As shown in Fig.4A, GP5 from wt virus-infected cells migrated as a mass of �24.5kDa. Since each N-linked glycosylation adds 2.5 kDa of molecularmass to a protein, the fully glycosylated form of GP5 should mi-grate as a protein band of �27 kDa, which was demonstrated inFig. 4B. These results indicated that three of the four potentialN-linked glycosylation sites might be used in GP5. Treatment ofGP5 with PNGase F, an enzyme that removed all N-linked sugarsfrom the protein backbone, reduced the size of GP5 to �17 kDa.The species of �17 kDa was assumed to be the amino-terminalsignal-cleaved unglycosylated form of GP5. The mutant GP5 car-rying a single glycosylation mutation site (N35, N44, or N51) mi-grated as a protein of �22 kDa. Upon treatment with PNGase F,the mutant GP5 also migrated as a protein of �17 kDa. However,

FIG 1 Site-directed mutagenesis of N-linked glycosylation sites of PRRSV GP5. (A) Schematic representation of the 3= part of the PRRSV genome. Boxednumbers represent the open reading frames encoding structural proteins, including the recently reported ORF5a. (B) Alignment of amino acid sequences of theN-terminal portions of GP5 of different PRRSV strains. The GenBank accession numbers for GP5 of the eight PRRSV strains from top to bottom are ACV95344,EF112445, U87392, ADN42874, AAD37076, ABY68567, AF184212, and JF422072, respectively. The amino acids identical to those in GP5 of JXM100 arerepresented by dots. Four potential N-glycosylation sites (N-X-T/S) at positions N30, N35, N44, and N51 in PRRSV strain JXM100 and the corresponding aminoacids in other strains are boxed. (C) Knockout of the glycosylation signal by site-directed mutagenesis. Alignment of amino acid sequences of GP5 ectodomainsof the pAJXM backbone and mutants is shown. In the N-glycosylation consensus sequence of all mutants, N-X-T/S, the first amino acid of the motif N codon isreplaced with an S, Y, or K, or the third codon of the motif S is replaced with N or R. To avoid the regeneration of the N33 or N34 glycosylation site, when the N35glycosylation site mutant was constructed the overlapping glycosylation site NNNSS was mutated to YSSSS. The rationale of the mutagenesis is based on themutated amino acids that are present in the natural isolates as shown in panel B. (D) The amino acid mutations in the small ORF5a protein. The amino acidsidentical to those of the ORF5a protein of pAJXM are represented by dots.

Wei et al.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org

http://jvi.asm.org/

the mutant GP5 carrying a single glycosylation site mutation atN30 migrated as �24.5 kDa, which was similar to the wild-typeGP5. These observations indicated that the potential sites at N35,N44, and N51 were normally used, whereas the site at N30 (N-A-S) might not be routinely present as a glycosylated form. Themutant GP5 carrying glycosylation sites at N30/35 migrated as aprotein of �22 kDa while the mutants carrying glycosylation sitesat N35/44, N44/51, and N35/51 migrated as a �19.5-kDa protein.Treatment of all the samples with PNGase F reduced the size ofGP5 to �17 kDa. The mutant vJGP5N35/44/51S carrying glyco-sylation site mutations at N35, N44, and N51 and vJGP5Null car-rying glycosylation site mutations N30, N35, N44, and N51 pro-duced a protein band that migrated close to �17 kDa and wasresistant to PNGase F digestion. This demonstrated that N-linkedglycosylation sites in GP5 of vJGP5N35/44/51S and vJGP5Nullhad been mutated to prevent glycan addition. Thus, it was clearfrom all the above studies that three sites, at N35, N44. and N51,were used for N-linked glycosylation and that the potential site atN30 was not used for N-linked glycan addition.

Influence of hypoglycosylation of GP5 on PRRSV replicationin PAMs. It has been shown elsewhere that enzymatic removal ofsialic acids from the surface of the virions effectively reduces virusinfectivity toward PAMs (42). To investigate whether the geneticremoval of N-linked glycans from GP5 could affect the produc-tion of infectious viruses in PAMs, equal amounts of the mutantviruses were used to inoculate PAMs. The generation of infectiousPRRSV was examined at 24 hpi in an IFA using anti-N proteinmonoclonal antibody. As shown in Fig. 5A, the intracellular ex-

pression of N protein was observed in all mutants. However, themutants carrying multiple N-linked glycosylation site mutationsshowed a remarkable reduction in the number of positive PAMs.This indicated that despite the decrease in virus yields, the mu-tants with loss of N-linked glycans in GP5 replicated in PAMs andall of the N-linked glycans of GP5 were not essential for virusviability in PAMs.

To investigate the impact of the ablation of N-glycan in GP5 onviral infectivity, virus titers in the supernatants of infected cellswere determined. As shown in Fig. 5B, the infectivity of the mu-tants bearing a single glycosylation site mutation was not signifi-cantly affected by the absence of the N-linked glycan (P � 0.5).The virus titers of the mutants carrying two or more N-linkedglycosylation site mutations, except the mutant vJGP5N30/35S,were reduced about 2 to 4 logs (P � 0.5). The titer of the mutantvJGP5N30/35S was lower than those of wt virus and mutants bear-ing a single glycosylation site mutation. However, the differencesin titers of all mutants were not statistically significant (P � 0.5).The mutants vJGP5N35/44/51S and vJGP5Null with the geneticremoval of all the N-glycans from GP5 replicated at a low titer (lessthan 102 TCID50/ml) in PAMs. This suggested that the mutationof an individual N-linked glycosylation site in GP5 did not affectthe virus infectivity in PAMs, while the ablation of double N-linked glycans in GP5 dramatically reduced the production of in-fectious particles. The mutants with genetic removal of allN-linked glycans from GP5 almost failed to infect PAMs.

N-linked glycosylation of GP5 is critically important for vi-rus replication in vivo. We also investigated whether the loss of all

FIG 2 Single mutations at N-linked glycosylation sites in GP5 do not affect the infectious virus recovery in MARC-145 cells. The mutants with single amino acidsubstitutions at N-glycosylation sites, along with the parental pAJXM full-length plasmids, were transfected into BHK-21 cells. The transfectant supernatantswere harvested at 48 hpt and inoculated into young MARC-145 cells. (A) Expression of PRRSV N protein was visualized in IFA. The infected MARC-145 cellswere fixed and stained at 24 hpi with the anti-N protein monoclonal antibody (D5-4) and anti-mouse secondary antibody labeled with Alexa Fluor. Images weretaken at a magnification of �200. (B) Multistep growth kinetics of wt and mutant viruses in MARC-145 cells. Cells in six-well plates were infected with PRRSVat an MOI of 0.01. The culture supernatants were collected at the indicated time points and titrated. The geometric mean titers with standard deviations (errorbars) from three independent experiments are shown. (C) Viral plaque size. Transfectant supernatants were 10-fold serially diluted and inoculated into youngMARC-145 cells in six-well-plates. The MARC-145 cell monolayers were cultured in EMEM containing a 1% agarose overlay, fixed at 4 dpi, and stained with 1%crystal violet.




http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org

http://jvi.asm.org/

N-glycans in GP5 affected virus propagation in piglets. The re-sults showed that piglets injected with vAJXM, vJGP5N44K, orvJGP5N35/44/51S did not show any overt clinical signs (behavior,body temperature, and body weight) compared to controls (datano shown). Serum samples were collected from these piglets andassayed by quantitative RT-PCR and virus isolation. As shown inTable 2, viremia was detected in all piglets in vAJXM- andvJGP5N44K-infected groups but not in the vJGP5N35/44/51S-infected group. The maximum viral copies/ml and occurrenceof viremia were similar for all piglets in the vAJXM- andvJGP5N44K-infected groups. The virus titers peaked at 7 dpi andthen decreased to an undetectable level at 21 dpi. Infection inpiglets was also confirmed by virus isolation in MARC-145 cells(data not shown). In addition, we assayed anti-N protein antibodyresponses in ELISA. As shown in Fig. 6A, all piglets in vAJXM- andvJGP5N44K-infected groups developed anti-N protein antibodyresponses (sample/positive [S/P] ratios of �0.4) by 14 dpi. How-ever, the vJGP5N35/44/51S-infected group did not produce sig-nificant anti-N responses (S/P ratios of �0.4). These results dem-onstrated that the mutant carrying an N-linked glycosylation sitemutation at N44 replicated in piglets as well as did wt virus. How-ever, the mutant vJGP5N35/44/51S with deletion of all N-linkedglycans in GP5 failed to replicate in piglets, which suggested thatthe genetic removal of all N-linked glycans from GP5 affectedvirus replication in vivo.

To assess the genetic stability of mutated GP5, serum samples

were collected at 14 dpi from vAJXM- or vJGP5N44K-infectedpiglets and the GP5 coding region was amplified by RT-PCR. Theresults of the nucleotide sequencing confirmed the existence ofthe engineered mutation, and no other mutations were detected inthe GP5 coding region, suggesting that the N-linked glycosylationsite mutation in GP5 was stable in vivo (data no shown).

Influence of N44-linked glycosylation on the development ofneutralizing antibody response. To study the influence of N44glycosylation in GP5 on the ability to elicit a neutralizing antibodyresponse in vivo, all serum samples were examined by FFN fortheir neutralizing activities to homologous viruses. As shown inFig. 6B, piglets in the vJGP5N44K-infected group developed anearly and robust neutralizing antibody response. Homologousneutralizing antibodies were detected in piglets infected withvJGP5N44K as early as 14 dpi. The antibody titers increasedquickly and reached the mean titer of 1:161 at 49 dpi. In contrast,homologous neutralizing antibodies were not detectable invAJXM-infected piglets till 28 dpi. At 49 dpi, the mean neutraliza-tion titer of vAJXM-infected piglets was only 1:25, which was �6-fold lower than the homologous titers of vJGP5N44K-infectedpiglets. No humoral immune response (homologous neutralizingantibody and anti-N antibody) was detected in vJGP5N35/44/51S-infected piglets throughout the course of the experiment.These results demonstrated that the N-linked glycan at N44 inGP5 affected the ability of the mutant virus to elicit a homologousneutralizing antibody response.

FIG 3 N-linked glycosylation of GP5 is not essential for virus viability in MARC-145 cells. (A) Examination of MARC-145 cells at 24 hpi with wt and mutantsbearing double, triple, or quadruple glycosylation site mutations in GP5. The IFA analysis was performed at 24 hpi using the anti-N protein monoclonal antibody(D5-4). Images were taken at a magnification of �200. (B) Multistep growth kinetics of wt and mutants bearing double and triple glycosylation site mutationsin GP5 in MARC-145 cells. Cells in six-well plates were infected with PRRSV at an MOI of 0.01. Culture supernatants were collected at the indicated time pointsand titrated. The geometric mean titers with standard deviations (error bars) from three independent experiments are shown. (C) Plaque size in MARC-145 cellsinfected with wt and mutant viruses.

Wei et al.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org

http://jvi.asm.org/

Next, we attempted to study the effects of the N-linked glycanat N44 on the neutralizing antibody response to vAJXM and mu-tants. Serum samples were collected at 49 dpi from vAJXM- andvJGP5N44K-infected piglets, and neutralizing antibodies weretitrated against homologous and heterologous viruses. Results areshown in Table 3. Although the mutant vJGP5N44K induced anearly and robust neutralizing antibody response as assessed usingthe homologous virus, serum samples from vJGP5N44K-infectedpiglets showed low neutralizing titers (1:25.3) against wt vAJXM.The differences in the geometric mean serum titers betweenvAJXM- and vJGP5N44K-infected groups were not statisticallysignificant (P � 0.5). The results also showed that higher geomet-ric mean titers (1:128 to 1:2,580) were yielded when hypoglyco-sylated PRRSV mutants were used, suggesting an increased sensi-tivity to neutralizing antibodies.

DISCUSSION

In this study, we demonstrated that single mutations at N-linkedglycosylation sites in GP5 did not affect infectious virus recovery.All of the N-linked glycans in GP5 were not essential for virusviability, but their removal decreased the infectivity in culturedcells. The study also showed that the removal of N44 from GP5increased the sensitivity of mutant viruses to convalescent antiserabut did not elicit a high-level neutralizing antibody response to wtvirus. Finally, the results showed that the removal of all N-glycansfrom GP5 affects virus replication in vivo.

GP5 of PRRSV possesses two to four potential N-linked glyco-sylation sites. The amino acids in the proximal region of the ect-odomain are highly variable (17). Potential N-linked glycosyla-tion sites have been positioned at N30, N33, N34, and N35 in thehypervariable region upstream of the neutralization epitopes ingenotype 2 PRRSV isolates (6, 17). In the present study, the sub-

stitutions of the glycosylation site N in the hypervariable regionwere revealed in some field viruses (Fig. 1B). The N44-linked gly-cosylation site located in the middle neutralization epitope in theGP5 ectodomain was more conserved than the upstream N-gly-cosylation sites in PRRSV isolates. The substitution for N44 by S,K, T, and D was found in about 2% of genotype 2 viruses (17). TheN51 glycosylation site was considered highly conserved, as about0.2% of the sequenced GP5 lacked the N-glycosylation site (6, 17).Some viruses lost specific glycosylation sites but propagated wellin MARC-145 cells or PAMs (17), which implied that the exis-tence of GP5-associated glycans per se was not vital to the life cycleof the virus. More importantly, an accidental amino acid mutationin the small ORF5a protein might also lead to the growth-defectivephenotype of the mutants that showed loss of the glycans in GP5by replacement of the N-encoding codon of ORF5 overlappingwith ORF5a (2, 47). In this study, we addressed this issue by in-troducing specific residues that existed in field PRRSV isolateswith a glycan loss to the corresponding position in GP5 of theinfectious cDNA clone pAJXM. We found that the mutant withreplacement of N44 by residue K retained efficient growth in cul-tured cells. However, the introduction of residue A to the sameposition was lethal in genotype 2 FL virus while the introductionof residue Q to the corresponding site reduced virus growth by100-fold relative to that of its parent genotype 1 LV virus (2, 47). Itis worth noting that replacements of N44 with residue K and ofS32 with residue N did not lead to the accidental amino acid mu-tation in the small ORF5a protein in our study (Fig. 1D). Thereplacement of N33 with residue Y caused mutation at positionQ36 to L in the small ORF5a protein, but this mutation did notaffect virus infectivity. Similarly, replacement of N51 with S in ourstudy was markedly less detrimental for viral growth than was theprevious change in the genotype 2 FL virus. This is consistent with

FIG 4 Confirmation of glycosylation status of GP5 in MARC-145 cells infected with the mutants. (A) Expression profiles of GP5 of PRRSV wt and mutantscarrying single glycosylation site mutations in the infected MARC-145 cells. The infected MARC-145 cells were harvested at 24 hpi and solubilized. The lysateswere treated with (�) or without (�) PNGase F and then separated by 12% SDS-PAGE followed by blotting against anti-GP5 monoclonal antibody (HP-GP5)and staining with HRP-labeled antibody. Molecular mass markers are shown (kDa) to the left of each panel. (B) Expression profiles of GP5 of PRRSV wt andmutants carrying multiple glycosylation site mutations in the infected MARC-145 cells. The experiments were performed as described for panel A.




http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org

http://jvi.asm.org/

the previous finding that replacement of N53 with Q in genotype1 LV virus maintained efficient growth in PAMs (47). Thus, ourresults have demonstrated that mutants with deletion of a glycanin GP5 display efficient growth in MARC-145 cells and PAMsdepending on the amino acid substitutions at N-glycosylationsites. The mutant vJGP5N30/35S with deletion of a glycan at N35was expected to behave in regard to replication characteristics like

other mutants carrying a single N-linked glycosylation site muta-tion. However, the titer of vJGP5N30/35 was different from thetiters of those mutants with deletion of a glycan. We assumed thatthe mutation N32 to R in GP5 or the accidental amino acid mu-tation at position Q36 to I in the small ORF5a protein ofvJGP5N30/35S might lead to a difference between the growth phe-notype of vJGP5N30/35S and those of mutants vJGP5N35/44S

FIG 5 Infectivity of wt virus and mutants bearing multiple glycosylation site mutations in GP5 in PAMs. (A) Examination of infected PAMs in IFA. Equalnumbers of PRRSV particles were used to inoculate PAMs. The IFA was performed at 24 hpi using the anti-N protein monoclonal antibody (D5-4). (B) Titersof wt and mutants bearing glycosylation site mutations in GP5. Cells in six-well plates were infected with PRRSV at equal numbers of viral particles. Culturesupernatants were collected at 24 hpi and titrated. The geometric mean titers (TCID50/ml) with standard deviations (error bars) from three independentexperiments are shown. Means with different symbols (#, �, and §) indicate significant differences (P � 0.05).

TABLE 2 Virus titration of serum samples using qRT-PCRa

Virus Piglet no.

qRT-PCR (viral copies/ml) at dpi:

3 7 14 21

vAJXM 121 5.8 � 105 1.2 � 106 1.2 � 105 0323 8.2 � 105 1.8 � 106 7.8 � 104 0186 1.1 � 106 4.9 � 106 3.9 � 105 0

vJGP5N44K 417 3.0 � 105 2.8 � 106 2.4 � 105 0913 4.2 � 105 6.8 � 106 8.9 � 104 0346 1.2 � 105 4.3 � 106 1.7 � 105 0

vJGP5N35/44/51S 318 0 0 0 0593 0 0 0 0266 0 0 0 0

a Piglets were intramuscularly injected with wt and mutants. Serum samples were collected at 3, 7, 14, and 21 days postinfection. Viral RNA was extracted using a Qiagen RNAisolation kit. The copy number of a viral RNA extract was determined by qRT-PCR as described in Materials and Methods.

Wei et al.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org

http://jvi.asm.org/

and vJGP5N35/51S with a mutation at position Q36 to L in thesmall ORF5a protein (Fig. 1C and D). Similarly, the mutantvJGP5Null with mutation Q36 to I was less infectious than themutant vJGP5N35/44/51S with mutation Q36 to L in ORF5a pro-tein. Therefore, it is reasonably concluded that the replacement ofQ36 with L may be less detrimental for growth than the change toI in ORF5a protein.

Our results also showed that the mutants with deletion of twoor more N-linked glycans in GP5 were viable but exhibited signif-icantly low virus yields. This growth-defective phenotype of mu-tants might be caused by the absence of two or more N-linkedglycans, resulting in improper folding of GP5. The N-linked gly-cosylation is important for correct folding, targeting, and biolog-ical activity of proteins (3, 4, 14, 37, 45). It has been proposed thatN-linked glycans located within the first 50 residues at the N ter-minus of a protein play critical roles in proper folding of the nas-cent protein through interactions with the folding chaperones inthe endoplasmic reticulum (22). Therefore, it is possible that theloss of two or more glycans in GP5 may have changed its confor-mation to one that is not favorable for virus infectivity. Improperfolding of GP5 caused by the deletion of N-linked glycans may alsoaffect its intracellular transport. The transport of budded virionsthrough the Golgi apparatus to the plasma membrane may alsosuffer from this improper folding. Any of these transport defectswould affect the efficiency of budding of virions and reduce therelease of infectious viruses from infected cells (2, 8, 9, 47).

The data presented in Fig. 4 illustrate that the potential sitesN35, N44, and N51 in GP5 were normally used in wt viruseswhereas site N30 (N30-A31-S32) was not. These findings were

similar to a recent study in which one potential glycosylation sitein GP5 of the PRRSV-01 strain, which contains three glycosylationsites, at positions N30, N33, and N44, was not used for glycosyla-tion addition (43). The specific site (N-X-S/T) is essential for coreglycosylation, which has been observed in numerous examples ofglycoproteins in either unglycosylated or glycosylated form at lowlevels (7, 8, 29). Large hydrophobic amino acids (e.g., W, L, F, andY) or P present at position X in the glycosylation site (N-X-S/T)affected core glycosylation by producing an unfavorable local pro-tein structure or by blocking the access of the oligosaccharyl trans-ferase or the dolichol oligosaccharide donor to the glycosylationsite (36). Prevention of core glycosylation was also observed whena P residue was present at position Y of the glycosylation site (N-X-S/T-Y) (28, 29). However, such unfavorable amino acids werenot present in the glycosylation sites (N30-A31-S32-N33) in GP5of vAJXM virus (Fig. 1). There must be other reasons to accountfor the inhibition of core glycosylation. Bioinformatics analysisusing the SignalP 3.0 program revealed a cleavable signal sequenceof approximately 30 amino acids in GP5 of PRRSV (data notshown). The lack of glycosylation at these sites (N30-A31-S32-N33) may be due to the removal of this signal peptide by a pepti-dase that cleaves GP5 between residues A31 and S32 and thusdestroys the glycosylation site.

The engineered mutant vJGP5N44K grew well in MARC-145cells and PAMs and also infected piglets. This was consistent witha previous study in which a field isolate carrying an N44 glycosy-lation site mutation in GP5 propagated well in vitro and in vivo(17). Viremia developed in vAJXM- and vJGP5N44K-infectedpiglets in similar manners. In both groups of piglets, viremialasted less than 21 days postinfection when neutralizing antibodieswere not detectable in vAJXM-infected piglets. Therefore, neu-tralizing antibodies might not be required for resolution ofviremia in vAJXM infection. In fact, previous studies have dem-onstrated that PRRSV viremia is often resolved before neutraliz-ing antibodies are detected (12, 31, 33). No antibodies and viremiawere detected in serum samples from vJGP5N35/44/51S-infectedpigs throughout the observation period. This mutant failed to

TABLE 3 Determination of neutralization antibody responses in thewild-type virus vAJXM- and mutant vJGP5N44K-infected pigletsa

Virus

Geometric mean titer of neutralization antibodiesin serum samples from group infected with:

vAJXM vJGP5N44K vJGP5N35/44/51S

vAJXM 25.3 25.3 0vJGP5S32N 32 25.3 0vJGP5N35S 161.1 203.1 0vJGP5N44K 128 161.1 0vJGP5N51S 203.1 161.1 0vJGP5N30/35S 203.1 203.1 0vJGP5N35/44K 512 512 0vJGP5N35/51S 512 406.3 0vJGP5N44/51S 406.3 512 0vJGP5N35/44/51S 2,046 2,580 0vJGP5Null 2,580 2,580 0a Serum samples were collected at 49 days postinfection from vAJXM-, vJGP5N44K-,and vJGP5N35/44/51S-infected piglets, and PRRSV-neutralizing antibodies wereassessed against homologous and heterologous viruses. The geometric mean titers werecalculated for neutralization antibodies. The differences in antibody titers betweenvAJXM- and vJGP5N44K-infected groups were not statistically significant (P � 0.5) asanalyzed by one-way ANOVA.

FIG 6 Antibody responses in piglets infected with wt and mutants. (A) Meananti-N antibody levels. PRRSV-specific N antibody development was moni-tored throughout the experimental period and represented as S/P ratios. TheS/P ratios greater than 0.4 were considered positive. Anti-N-PRRSV antibodieswere quantitated in a HerdChek ELISA. (B) Kinetics of neutralization anti-body response to homologous viruses. Three 4-month-old piglets were inoc-ulated with the indicated viruses as described in Materials and Methods. Theneutralizing activities of serum samples were tested against homologous vi-ruses. Neutralization titers are expressed as means � standard errors of themeans.




http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org

http://jvi.asm.org/

replicate in lung or lymphoid tissues. The removal of N-glycans atmultiple sites from GP5 severely affected the propagation ofPRRSV in piglets. In the present study, an early and robust neu-tralizing antibody response was detected in pigs infected withvJGP5N44K. However, low neutralizing activities were detected inthese serum samples when heterologous vAJXM was used. Fur-thermore, low neutralizing titers were also detected in the serumsamples collected from vAJXM-infected pigs. This suggests thatthe N44-linked glycan may not be involved in the induction ofneutralizing antibody response in infected pigs. This phenome-non is consistent with a previous finding that the natural isolateN44 generated a lower level of neutralizing antibody (17). In ad-dition, hypoglycosylated PRRSV mutants were more sensitive toserum samples collected from vAJXM- or vJGP5N44K-infectedpiglets, suggesting that the integrated glycosylation in GP5 con-tributed more resistance to neutralization (2, 17). However, therole of neutralizing antibodies to GP5 in anti-PRRSV immunity iselusive (26, 31). Genetic experiments showed that GP5 was notrequired for macrophage permissiveness and that complexes ofminor envelope proteins GP2, GP3, and GP4 were essential forinfection of permissive cells (13, 39, 48). In the present study, theserum samples collected from piglets infected with wt or N44 mu-tant virus showed similar neutralizing activities when homolo-gous and when heterologous viruses were used. However, an in-crease in neutralizing titers was noted when the mutant viruseswith deletion of more glycans in GP5 were used to test these serumsamples. Thus, higher neutralization activities of serum samplesmight also be associated with decreased viral fitness. The possibil-ities that less fit viruses are easier to neutralize and that this findingis not related to GP5 glycosylation need to be addressed in futurestudies.

ACKNOWLEDGMENTS

This work was funded by the China Natural Science Foundation(30972204 and 30901078) and the EU Seventh Framework Program(245141).

REFERENCES1. Allende R, et al. 1999. North American and European porcine reproduc-

tive and respiratory syndrome viruses differ in non-structural proteincoding regions. J. Gen. Virol. 80:307–315.

2. Ansari IH, Kwon B, Osorio FA, Pattnaik AK. 2006. Influence of N-linked glycosylation of porcine reproductive and respiratory syndromevirus GP5 on virus infectivity, antigenicity, and ability to induce neutral-izing antibodies. J. Virol. 80:3994 – 4004.

3. Braakman I, van Anken E. 2000. Folding of viral envelope glycoproteinsin the endoplasmic reticulum. Traffic 1:533–539.

4. Chackerian B, Rudensey LM, Overbaugh J. 1997. Specific N-linked andO-linked glycosylation modifications in the envelope V1 domain of sim-ian immunodeficiency virus variants that evolve in the host alter recogni-tion by neutralizing antibodies. J. Virol. 71:7719 –7727.

5. Chen Z, Li K, Plagemann PG. 2000. Neuropathogenicity and sensitivityto antibody neutralization of lactate dehydrogenase-elevating virus aredetermined by polylactosaminoglycan chains on the primary envelopeglycoprotein. Virology 266:88 –98.

6. Cruz JL, et al. 2010. Vectored vaccines to protect against PRRSV. VirusRes. 154:150 –160.

7. Curling EM, et al. 1990. Recombinant human interferon-gamma. Dif-ferences in glycosylation and proteolytic processing lead to heterogeneityin batch culture. Biochem. J. 272:333–337.

8. Das PB, et al. 2011. Glycosylation of minor envelope glycoproteins ofporcine reproductive and respiratory syndrome virus in infectious virusrecovery, receptor interaction, and immune response. Virology 410:385–394.

9. Dea S, Gagnon CA, Mardassi H, Pirzadeh B, Rogan D. 2000. Current

knowledge on the structural proteins of porcine reproductive and respi-ratory syndrome (PRRS) virus: comparison of the North American andEuropean isolates. Arch. Virol. 145:659 – 688.

10. Delputte PL, Nauwynck HJ. 2004. Porcine arterivirus infection of alve-olar macrophages is mediated by sialic acid on the virus. J. Virol. 78:8094 –8101.

11. Delputte PL, et al. 2007. Porcine arterivirus attachment to the macro-phage-specific receptor sialoadhesin is dependent on the sialic acid-binding activity of the N-terminal immunoglobulin domain of sialoadhe-sin. J. Virol. 81:9546 –9550.

12. Diaz I, Darwich L, Pappaterra G, Pujols J, Mateu E. 2006. DifferentEuropean-type vaccines against porcine reproductive and respiratory syn-drome virus have different immunological properties and confer differentprotection to pigs. Virology 351:249 –259.

13. Dobbe JC, van der Meer Y, Spaan WJ, Snijder EJ. 2001. Construction ofchimeric arteriviruses reveals that the ectodomain of the major glycopro-tein is not the main determinant of equine arteritis virus tropism in cellculture. Virology 288:283–294.

14. Doms RW, Lamb RA, Rose JK, Helenius A. 1993. Folding and assemblyof viral membrane proteins. Virology 193:545–562.

15. Duan X, Nauwynck HJ, Pensaert MB. 1997. Effects of origin and state ofdifferentiation and activation of monocytes/macrophages on their suscep-tibility to porcine reproductive and respiratory syndrome virus (PRRSV).Arch. Virol. 142:2483–2497.

16. Faaberg KS, Even C, Palmer GA, Plagemann PG. 1995. Disulfide bondsbetween two envelope proteins of lactate dehydrogenase-elevating virusare essential for viral infectivity. J. Virol. 69:613– 617.

17. Faaberg KS, et al. 2006. Neutralizing antibody responses of pigs infectedwith natural GP5 N-glycan mutants of porcine reproductive and respira-tory syndrome virus. Viral Immunol. 19:294 –304.

18. Fang Y, et al. 2007. Diversity and evolution of a newly emerged NorthAmerican type 1 porcine arterivirus: analysis of isolates collected between1999 and 2004. Arch. Virol. 152:1009 –1017.

19. Fang Y, Snijder EJ. 2010. The PRRSV replicase: exploring the multifunc-tionality of an intriguing set of nonstructural proteins. Virus Res. 154:61–76.

20. Firth AE, et al. 2011. Discovery of a small arterivirus gene that overlapsthe GP5 coding sequence and is important for virus production. J. Gen.Virol. 92:1097–1106.

21. Forsberg R. 2005. Divergence time of porcine reproductive and respira-tory syndrome virus subtypes. Mol. Biol. Evol. 22:2131–2134.

22. Helenius A, Aebi M. 2001. Intracellular functions of N-linked glycans.Science 291:2364 –2369.

23. Johnson CR, Griggs TF, Gnanandarajah JS, Murtaugh MP. 2011. Novelstructural protein in porcine reproductive and respiratory syndrome virusencoded in an alternative open reading frame 5 present in all arteriviruses.J. Gen. Virol. 92:1107–1116.

24. Lv J, Zhang J, Sun Z, Liu W, Yuan S. 2008. An infectious cDNA clone ofa highly pathogenic porcine reproductive and respiratory syndrome virusvariant associated with porcine high fever syndrome. J. Gen. Virol. 89:2075–2079.

25. Mardassi H, Massie B, Dea S. 1996. Intracellular synthesis, processing,and transport of proteins encoded by ORFs 5 to 7 of porcine reproductiveand respiratory syndrome virus. Virology 221:98 –112.

26. Mateu E, Diaz I. 2008. The challenge of PRRS immunology. Vet. J.177:345–351.

27. Mateu E, et al. 2006. Evolution of ORF5 of Spanish porcine reproductiveand respiratory syndrome virus strains from 1991 to 2005. Virus Res.115:198 –206.

28. Mellquist JL, Kasturi L, Spitalnik SL, Shakin-Eshleman SH. 1998. Theamino acid following an Asn-X-Ser/Thr sequon is an important determi-nant of N-linked core glycosylation efficiency. Biochemistry 37:6833–6837.

29. Meunier JC, et al. 1999. Analysis of the glycosylation sites of hepatitis Cvirus (HCV) glycoprotein E1 and the influence of E1 glycans on the for-mation of the HCV glycoprotein complex. J. Gen. Virol. 80:887– 896.

30. Molenkamp R, et al. 2000. The arterivirus replicase is the only viralprotein required for genome replication and subgenomic mRNA tran-scription. J. Gen. Virol. 81:2491–2496.

31. Murtaugh MP, Genzow M. 2011. Immunological solutions for treatmentand prevention of porcine reproductive and respiratory syndrome(PRRS). Vaccine 29:8192– 8204.

32. Nelsen CJ, Murtaugh MP, Faaberg KS. 1999. Porcine reproductive and

Wei et al.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org

http://jvi.asm.org/

respiratory syndrome virus comparison: divergent evolution on two con-tinents. J. Virol. 73:270 –280.

33. Nelson EA, Christopher-Hennings J, Benfield DA. 1994. Serum immuneresponses to the proteins of porcine reproductive and respiratory syn-drome (PRRS) virus. J. Vet. Diagn. Invest. 6:410 – 415.

34. Pizzi M. 1950. Sampling variation of the fifty percent end-point, deter-mined by the Reed-Muench (Behrens) method. Hum. Biol. 22:151–190.

35. Plagemann PG, Moennig V. 1992. Lactate dehydrogenase-elevating vi-rus, equine arteritis virus, and simian hemorrhagic fever virus: a newgroup of positive-strand RNA viruses. Adv. Virus Res. 41:99 –192.

36. Shakin-Eshleman SH, Spitalnik SL, Kasturi L. 1996. The amino acid atthe X position of an Asn-X-Ser sequon is an important determinant ofN-linked core-glycosylation efficiency. J. Biol. Chem. 271:6363– 6366.

37. Shi X, Elliott RM. 2004. Analysis of N-linked glycosylation of hantaanvirus glycoproteins and the role of oligosaccharide side chains in proteinfolding and intracellular trafficking. J. Virol. 78:5414 –5422.

38. Snijder EJ, Meulenberg JJ. 1998. The molecular biology of arteriviruses.J. Gen. Virol. 79:961–979.

39. Tian D, et al. 2012. Arterivirus minor envelope proteins are a majordeterminant of viral tropism in cell culture. J. Virol. 86:3701–3712.

40. Tian D, Zheng H, Zhang R, Zhuang J, Yuan S. 2011. Chimeric porcinereproductive and respiratory syndrome viruses reveal full function of ge-notype 1 envelope proteins in the backbone of genotype 2. Virology 412:1– 8.

41. Van Breedam W, et al. 2010. The M/GP(5) glycoprotein complex of

porcine reproductive and respiratory syndrome virus binds the sialoadhe-sin receptor in a sialic acid-dependent manner. PLoS Pathog. 6:e1000730.doi:10.1371/journal.ppat.1000730.

42. Vanderheijden N, et al. 2003. Involvement of sialoadhesin in entry ofporcine reproductive and respiratory syndrome virus into porcine alveo-lar macrophages. J. Virol. 77:8207– 8215.

43. Vu HL, et al. 2011. Immune evasion of porcine reproductive and respi-ratory syndrome virus through glycan shielding involves both glycopro-tein 5 as well as glycoprotein 3. J. Virol. 85:5555–5564.

44. Warrens AN, Jones MD, Lechler RI. 1997. Splicing by overlap extensionby PCR using asymmetric amplification: an improved technique for thegeneration of hybrid proteins of immunological interest. Gene 186:29 –35.

45. Wei X, et al. 2003. Antibody neutralization and escape by HIV-1. Nature422:307–312.

46. Wensvoort G, et al. 1991. Mystery swine disease in The Netherlands: theisolation of Lelystad virus. Vet. Q. 13:121–130.

47. Wissink EH, et al. 2004. Significance of the oligosaccharides of the por-cine reproductive and respiratory syndrome virus glycoproteins GP2a andGP5 for infectious virus production. J. Gen. Virol. 85:3715–3723.

48. Wissink EH, et al. 2005. Envelope protein requirements for the assemblyof infectious virions of porcine reproductive and respiratory syndromevirus. J. Virol. 79:12495–12506.

49. Wu WH, et al. 2001. A 10-kDa structural protein of porcine reproductiveand respiratory syndrome virus encoded by ORF2b. Virology 287:183–191.




http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org

http://jvi.asm.org/

Documents

N-Linked Glycosylation of GP5 of Porcine Reproductive and