15
Mutation, Evolution, and Natural Selection Http://www.youtube.com/watch?v=ZK6YP1Smbxk DNA is found in the ______________ of the cell

Mutation, Evolution, and Natural Selection

  • Upload
    nam

  • View
    37

  • Download
    0

Embed Size (px)

DESCRIPTION

Mutation, Evolution, and Natural Selection. Http://www.youtube.com/watch?v=ZK6YP1Smbxk. DNA is found in the ______________ of the cell. Mutation . A mutation is a ____________________________________. There are many different types of mutations and causes for them. - PowerPoint PPT Presentation

Citation preview

Page 1: Mutation, Evolution, and Natural Selection

Mutation, Evolution, and Natural Selection

Http://www.youtube.com/watch?v=ZK6YP1Smbxk

DNA is found in the ______________ of the cell

Page 2: Mutation, Evolution, and Natural Selection

Mutation A mutation is a ____________________________________.There are many different types of mutations and causes for

them.Some mutations are ______________, while others can be

______________.

Page 3: Mutation, Evolution, and Natural Selection

Harmful Beneficial

Page 4: Mutation, Evolution, and Natural Selection

How does mutations work?DNA is very accurate when making copies of

itself, however, sometimes it makes a mistake.

Here’s a DNA sequenceAGCCCTTATAGGCTCWhat are the corresponding base pairs?______________________________________________Now when it’s being copied it replaces the T with

a U. Rewrite the your answer with U’s instead of T’s.

______________________________________________What amino acids will this be coded for?______________________________________________

Page 5: Mutation, Evolution, and Natural Selection

The Mutation Here’s our original DNA sequenceAGCCCTTATAGGCTCATCCCTTATAGGCTC we replaced the G with a

TNow what are the corresponding base pairs?______________________________________________Now when it’s being copied it replaces the T with

a U. Rewrite the your answer with U’s instead of T’s.

______________________________________________What amino acids will this be coded for?_______________________________________________ You can see how replacing 1 base will change

everything!

Page 6: Mutation, Evolution, and Natural Selection

Who was Charles Darwin?

• British scientist that in 1859 published The Origin of Species

• Stated that all life come from a ___________________ called _______________

• This happens by a process called _______________________.

• http://www.youtube.com/watch?v=nMgLF8n4DnA

Page 7: Mutation, Evolution, and Natural Selection

Voyage of H.M.S. Beagle, 1831 - 1836

90 feet of ship, 74 people living together for 5 years...

DarwinGalapagos

Page 8: Mutation, Evolution, and Natural Selection

Evolution

Evolution is the _______________________________ (passed on from parents to offspring) of a population over ___________________________. These traits could be physical, chemical or behavioral.

This change is caused by ____________________________________.

http://www.youtube.com/watch?v=yVqJ_mQazik

Page 9: Mutation, Evolution, and Natural Selection

AdaptationAdaptation is the evolutionary process where a

population becomes ____________________________.This process takes place over _____________________.The term adaptation may also refer to a ____________

which is ____________________________________. For example, the adaptation of horses' teeth to the grinding of grass, or their ability to run fast and escape predators.

Such adaptations are produced in a variable population by the better suited forms reproducing more successfully, which is ______________________________________________.

Page 10: Mutation, Evolution, and Natural Selection

How does Evolution Work?

Natural Selection- ________________________________

Natural selection is simply the logical result of four features of living systems:

_________________- individuals in a population vary from one another (different genes caused by mutations)

_________________- parents pass on their traits to their offspring genetically

______________ - some variants reproduce more than others

___________ - successful variations accumulate over many generations

Page 11: Mutation, Evolution, and Natural Selection

There are 2 variations of the beetles, _________________________________

The birds prefer eating the green beetles.

Over generations the ______ beetles increase in population because __________________________________

_________ survive to produce more offspring.

Over time the red beetles have been selected over the green beetles

Generations later….

Page 12: Mutation, Evolution, and Natural Selection
Page 13: Mutation, Evolution, and Natural Selection

Change through use and disuse

Why does this not work?

Page 14: Mutation, Evolution, and Natural Selection

Natural Selection’s Explanation

Ancestors had different neck lengths

Through natural selection, longer necks survived and passed on their genes.

Eventually, all giraffes had only long necks

Page 15: Mutation, Evolution, and Natural Selection

What are the different types?

What could cause all the variety?

ONE ancestor, many varieties