30
Mutation, Evolution, and Natural Selection Http://www.youtube.com/watch?v=ZK6YP1Smbxk DNA is found in the nucleus of the cell

Mutation, evolution, and natural selection cook

Embed Size (px)

Citation preview

Page 1: Mutation, evolution, and natural selection cook

Mutation, Evolution, and Natural Selection

Http://www.youtube.com/watch?v=ZK6YP1Smbxk

DNA is found in the nucleus of the cell

Page 2: Mutation, evolution, and natural selection cook

While the copying of DNA is a very accurate process, what happens

when a mistake is made?

Page 3: Mutation, evolution, and natural selection cook

Mutation A mutation = change in gene sequence.Some mutations are harmful to survivalSome mutations are beneficial to survival=

adaptation

Page 4: Mutation, evolution, and natural selection cook

Harmful Beneficial

Page 5: Mutation, evolution, and natural selection cook

Types of ErrorsIncorrect pairing of nucleotide baseOnly changes one codon so only one amino acid protein is changed

Delete/ Add entire pairChanges every codon after the mistake so many amino acid proteins are changed

VC: DNA Mutation

Page 6: Mutation, evolution, and natural selection cook

Original:

TACGGGGGCGTAACCACAACTHere is the other side (copy).

1) Find the error:ATGCGCCCGCATTGGTGTTGAATGCGCCCGCATTGGTGTTGA2) Write the new RNA

3) Form the new codons (you can draw lines on RNA code above to separate)4) Translate into the new amino acids

AUGCGCCCGCATTGGTGTTGA

Methionine-Arginine-proline-histadine-

tryptophan-cysteine-stop

Page 7: Mutation, evolution, and natural selection cook

What’s the difference from the original (example B on your worksheet)?

Methionine-Arginine-proline-histadine-tryptophan-cysteine-stop

Page 8: Mutation, evolution, and natural selection cook

B: TACCGGATGCCAGATCAAATCHere is the other side. Find the error:

AT_GCCTACGGTCTAGTTTAG

Page 9: Mutation, evolution, and natural selection cook

How does mutations work?DNA is very accurate when making copies of itself,

however, sometimes it makes a mistake.

Here’s a DNA sequenceAGCCCTTATAGGCTCWhat are the corresponding base pairs?TCGGGAATATCCGAGNow when it’s being copied it replaces the T with a U.

Rewrite the your answer with U’s instead of T’s.UCGGGAAUAUCCGAGWhat amino acids will this be coded for?Serine, Glycine, Isoleucine, Serine, Glutamic Acid

Page 10: Mutation, evolution, and natural selection cook
Page 11: Mutation, evolution, and natural selection cook

The Mutation Here’s our original DNA sequenceAGCCCTTATAGGCTCATCCCTTATAGGCTC we replaced the G with a TNow what are the corresponding base pairs?TAGGGAATATCCGAGNow when it’s being copied it replaces the T with a

U. Rewrite the your answer with U’s instead of T’s.UAGGGAAUAUCCGAGWhat amino acids will this be coded for?Stop, Glycine, Isoleucine, Serine, Glutamic Acid You can see how replacing 1 base will change

everything!

Page 12: Mutation, evolution, and natural selection cook

Who was Charles Darwin?•British scientist that in 1859 published The Origin of Species

•Stated that all life today came from a common ancestor•Change from one to many is called evolution•This happens by a process called natural selection.• http://www.youtube.com/watch?v=nMgLF8n4DnA

Page 13: Mutation, evolution, and natural selection cook

Voyage of H.M.S. Beagle, 1831 - 1836

90 feet of ship, 74 people living together for 5 years...

Darwin

Galapagos

Page 14: Mutation, evolution, and natural selection cook

Evolution the change in the inherited traits

(passed on from parents to offspring) of a population over many generations. These traits could be:

physical (teeth shape) chemical (ability to use sun for energy) behavioral (run fast).

This change is caused by mutations in the genes.

http://www.youtube.com/watch?v=yVqJ_mQazik

Page 15: Mutation, evolution, and natural selection cook

PHYSICAL: This moth mimics an owl’s eyes

CHEMICAL: this orchid smells like a female bee

BEHAVIORAL: This monkey is using tools to get food

Page 16: Mutation, evolution, and natural selection cook

Common Ancestor-We did not come from monkeys, we just had a common ancestor

Page 17: Mutation, evolution, and natural selection cook

Theories on LifeTheory of EvolutionScienceBased on evidence

CreationismReligionBased on faith

Page 18: Mutation, evolution, and natural selection cook

Adaptationthe evolutionary process where a population becomes better suited to its environment.This process takes many generations.

A feature which is especially important for an organism's survival.

For example, the adaptation of horses' teeth to the grinding of grassFlat teeth (due to genetic mutation) chew

grass better

Page 19: Mutation, evolution, and natural selection cook
Page 20: Mutation, evolution, and natural selection cook

How does Evolution Work?Natural Selection- survival of the fittest

Organisms best suited to their environment

Natural selection is the result of four features of living systems:

1) variation – differences in the population because of genetic mutation

2) inheritance - parents pass on their genetic mutations to their offspring

3) selection - some organisms reproduce more (fittest) than others

4) time – happens over time, takes many generations

Page 21: Mutation, evolution, and natural selection cook

There are 2 variations of the beetles, green and red.

The birds prefer eating the green beetles.

Over generations the red beetles increase in population because they are not eaten by the birds.

More survive to produce more offspring.

Over time the red beetles have been selected over the green beetles

Generations later….

So what happens to the birds now?

Page 22: Mutation, evolution, and natural selection cook
Page 23: Mutation, evolution, and natural selection cook

INCORRECT MODEL OF EVOLUTION: BASED ON NEED

Page 24: Mutation, evolution, and natural selection cook

Change through use and disuse

Why does this not work?

Page 25: Mutation, evolution, and natural selection cook

Natural Selection’s Explanation

Ancestors had different neck lengths

Through natural selection, longer necks survived and passed on their genes.

Eventually all giraffes had long necks.

Page 26: Mutation, evolution, and natural selection cook

http://www.youtube.com/watch?v=sCEeefdaRcw

ONE Ancestor Many Varieties

• What are the different types?

•What could cause all the variety?

Page 27: Mutation, evolution, and natural selection cook

Common Ancestor-We did not come from monkeys, we just had a common ancestor

Page 28: Mutation, evolution, and natural selection cook

EFFECTS OF ISOLATION

Page 29: Mutation, evolution, and natural selection cook
Page 30: Mutation, evolution, and natural selection cook