An indel polymorphism in the hybrid incompatibility gene Lethal hybrid rescue of Drosophila is functionally relevant

Shamoni Maheshwari and Daniel A. Barbash

Dept. of Molecular Biology and Genetics

Cornell University

Ithaca, NY 14853

U.S.A.

Correspondence to:

Dr. Daniel A Barbash

Dept. of Molecular Biology and Genetics

Cornell University

Ithaca, NY 14853

ph: 607-254-5208

fx: 607-255-6523

em: dab87@cornell.edu

Abstract

Genetics: Published Articles Ahead of Print, published on August 3, 2012 as 10.1534/genetics.112.141952

Copyright 2012.

    2  

Hybrid incompatibility (HI) genes are frequently observed to be rapidly evolving

under selection. This observation has led to the attractive conjecture that selection-

derived protein-sequence divergence is culpable for incompatibilities in hybrids. The

Drosophila simulans HI gene Lethal hybrid rescue (Lhr) is an intriguing case, because

despite having experienced rapid sequence evolution, its HI properties are a shared

function inherited from the ancestral state. Using an unusual D. simulans Lhr hybrid

rescue allele, Lhr2, we here identify a conserved stretch of 10 amino acids in the C-

terminus of LHR that is critical for causing hybrid incompatibility. Altering these 10

amino acids weakens or abolishes the ability of Lhr to suppress the hybrid rescue

alleles Lhr1 or Hmr1, respectively. Besides single amino acid substitutions, Lhr

orthologs differ by a 16 amino acid indel polymorphism, with the ancestral deletion state

fixed in D. melanogaster and the derived insertion state at very high frequency in D.

simulans. Lhr2 is a rare D. simulans allele that has the ancestral deletion state of the 16

amino acid polymorphism. Through a series of transgenic constructs we demonstrate

that the ancestral deletion state contributes to the rescue activity of Lhr2. This indel is

thus a polymorphism that can affect the HI function of Lhr.

Introduction

What evolutionary forces drive speciation? A significant step towards answering

this question has been the identification of hybrid incompatibility (HI) genes, that is,

genes with “incompatible substitutions” that cause breakdown in interspecific hybrids.

The next challenge is describing the evolutionary basis for the origin of such

“incompatible substitutions”. The classic Dobzhansky-Muller (D-M) model elegantly

    3  

explains how substitutions incompatible only in an interspecific context can evolve,

however it is agnostic on the nature of the intraspecific evolutionary forces that cause

them (Maheshwari and Barbash, 2011; Presgraves, 2010). The model is equally

consistent with incompatible substitutions evolving as functionally neutral mutations

drifting to fixation or as functionally advantageous mutations being driven to fixation by

natural selection.

It is therefore particularly intriguing that so many HI genes show high rates of

sequence divergence driven by positive selection. If this divergence corresponds to the

“incompatible substitutions” then there is a direct link between the phenotype under

selection and HI. This is very likely for the hybrid sterility gene OdsH, where the

signature of selection is concentrated within the DNA binding homeodomain, because

functional analysis of OdsH orthologs has implicated divergent DNA-binding activity in

hybrid incompatibility (Bayes and Malik, 2009; Ting et al., 1998). However, such a direct

link between sequence divergence and function remains to be established for other

rapidly evolving HI genes.

The HI gene Lhr poses an interesting paradox. Lhr causes F1 hybrid male

lethality in crosses between Drosophila melanogaster and D. simulans (Brideau et al.,

2006; Watanabe, 1979). The classic D-M model describes HI as the negative ectopic

interaction between two derived loci, thus setting up the expectation that selection-

driven divergence of Lhr led to “incompatible substitutions” in one of the hybridizing

lineages. Surprisingly, however in transgenic assays Lhr orthologs from both hybridizing

species cause hybrid dysfunction (Brideau and Barbash, 2011; Maheshwari and

Barbash, 2012). This argues against the expectation that the hybrid lethal activity of Lhr

    4  

is solely the outcome of selection-driven substitutions in its protein coding sequence

(CDS) specific to D. simulans. Moreover, our recent results argue that the divergent

hybrid lethal activities of Lhr orthologs can be largely attributed to their asymmetric

expression in the hybrid background (Maheshwari and Barbash, 2012). The D. simulans

Lhr allele is expressed two-fold higher than the melanogaster ortholog in the F1 hybrid.

But it is still an open question whether divergence of the CDS might also be contributing

to the differential hybrid lethal effects of Lhr.    

Lhr orthologs have ~50 fixed differences between D. melanogaster and D.

simulans scattered throughout a protein sequence of only ~330 residues. Additionally,

Lhr from each of the sibling species D. simulans, D. mauritiana and D. sechellia has a

16 amino acid (aa) insertion relative to the D. melanogaster ortholog. The insertion is

absent in outgroup species and is therefore identified as a derived state, specific to the

common ancestor of the sibling species. This 16 aa insertion is also interesting because

it may affect the structure of a predicted leucine zipper in the LHR protein, and had

been proposed as a candidate for mediating functional differences between the D.

melanogaster and D. simulans Lhr orthologs (Brideau et al., 2006).

The discovery of D. simulans Lhr2 motivated us to further explore the effect, if

any, of this 16 aa region on the hybrid lethal activity of Lhr orthologs. Lhr2 partially

suppresses hybrid male lethality, strongly suggesting that it is a loss-of-function allele.

Interestingly, Lhr2 lacks the 16 aa insertion found in most other D. simulans Lhr alleles.

However, the Lhr2 allele also has a complex deletion in its C-terminus within a

sequence of high conservation (Figure S1). Furthermore, it was not tested if Lhr2 is wild

type in expression level, which is critical because Lhr1 is strongly reduced in expression

    5  

(Brideau et al., 2006). Thus, even if the hybrid rescue property of the D. simulans Lhr2

strain is a function of the unusual CDS of the Lhr2 allele, it is unclear whether one or

both of the aforementioned 2 major mutations are responsible for its hybrid rescue

activity.

A population survey revealed that the ancestral non-insertion form is segregating

at a very low frequency in some D. simulans populations (Nolte et al., 2008). Nolte et.

al. (2008) tested 2 D. simulans strains in hybrid crosses that carried Lhr alleles lacking

the 16 aa insertion but wild type at the C-terminus. Neither of these strains produced

viable hybrid sons, leading them to conclude that the hybrid rescue property of the D.

simulans Lhr2 strain is not caused by the ancestral non-insertion form of the 16 aa

region, leaving the complex C-terminal mutation as the most likely candidate. However,

whether the presence or absence of this 16 aa region makes any contribution either to

functional differences between mel-Lhr and sim-Lhr, or to the hybrid rescue properties

of Lhr2, remains untested. Here we describe a series of transgenic assays to address

these questions.

Materials and Methods

Drosophila stocks and culturing: All crosses were done at room temperature

or at 18 ⁰C where explicitly stated. At least 2 replicates were done for each cross. Each

interspecific cross was initiated with ~15-20 1-day-old D. melanogaster virgin females

and ~30-40 3-4-day-old sibling-species males. Genetic markers, deficiencies, and

balancer chromosomes are described on FlyBase (McQuilton et al., 2012).

    6  

Nomenclature: The abbreviations mel-Lhr and sim-Lhr refer to the Lhr orthologs

from D. melanogaster and D. simulans, respectively. We refer generically to the 16 aa

region that is present in sim-Lhr and absent in mel-Lhr as the "16 aa indel". Because it

is a derived insertion in the D. simulans lineage but absent in the sim-Lhr2 allele, we

refer to it as the "16 aa deletion" in sim-Lhr2 and in mel-Lhr, and as the "16 aa insertion"

in sim-Lhr.

DNA constructs: PCR primers are listed in Table S1. To generate constructs for

transgenic experiments (Figure 1), first the wild type Lhr CDS in p{sim-Lhr} from

(Maheshwari and Barbash, 2012) was replaced by the Lhr2 CDS using a three-piece

fusion PCR strategy. The first and last PCR products, containing upstream and

downstream genomic regions, were amplified using p{sim-Lhr} as the template, with

primer pairs 691/938 and 941/664, respectively. The central PCR product containing the

Lhr2 CDS was amplified from D. simulans Lhr2 genomic DNA, with primer pair 939/940.

The three overlapping PCR products were then used as templates for the fusion PCR

using primers 691/664, cloned into the pCR-BluntII vector to create the plasmid p{sim-

Lhr2}, and sequenced completely.

A triple-HA tag in-frame with the C-terminus of Lhr2 CDS was synthesized using

a two-piece fusion PCR strategy. Two overlapping PCR products were amplified using

p{sim-Lhr2} as the template, with primer pairs 882/728 and 729/664. Fusion PCR was

then performed using these products as the templates with primers 882/664, and the

resulting product was TOPO cloned into the pCR-BluntII vector. This intermediate

construct was digested with SacII and ApaI and the fragment released was subcloned

    7  

into p{simLhr2}, generating p{sim-Lhr2-HA}. The full insert was sequenced completely

and subcloned into the MCS of pCasper4\attB using NotI and KpnI restriction enzymes.

To synthesize the construct p{sim-Lhr2-HA + 16aa}, the 16 aa insertion was

inserted into the Lhr2 CDS using a two-piece fusion PCR strategy. The two overlapping

PCR products were amplified using p{sim-Lhr2-HA} as the template, with primer pairs

691/945 and 946/664. These fragments were used as templates for the fusion PCR with

primers 691/664, and the gel-purified product was TOPO cloned into the pCR-BluntII

vector and sequenced completely. The insert was then subcloned into pCasper4\attB

exactly as in p{sim-Lhr2-HA}. The construction of p{sim-Lhr2-HA +Cter}, where the

complex mutation in the C-terminus mutation in Lhr2 CDS was replaced by 10 residues

of wild type D. simulans Lhr sequence, was done as above using primer pairs 691/942

and 943/664.

For yeast two-hybrid experiments the Lhr2 CDS was amplified from genomic DNA

using primer pair 404/405 and cloned into pENTR-DTOPO (Invitrogen) according to the

manufacturer’s instructions, and verified by sequencing. The entry vector was

recombined with the destination vectors in a standard LR Clonase (Invitrogen)-mediated

reaction. The destination vectors used were pGADT7-AD and pGBKT7-DNA-BD (K.

Ravi Ram, A. Garfinkel, and M.F.Wolfner, Cornell University; personal communication).

Transgenic fly lines: ɸC31-mediated transformants of D. melanogaster were

performed by Genetic Services. The integration site used was M{3xP3-RFP.attP}ZH-

86Fb at cytological position 86Fb (Bischof et al., 2007). Site-specificity of integrations

were tested using the PCR assays described in (Maheshwari and Barbash, 2012).

    8  

Recombination mapping of the D. simulans Lhr2 rescue activity: The D.

simulans Lhr2 rescue strain was outcrossed to the non-rescuing D. simulans v strain.

From this seven independent recombination lines were established by backcrossing 8-

10 F1 daughters to 8-10 males from the D. simulans v strain. Sons from this cross were

used to set up three hybrid crosses. Each hybrid cross was set up with approximately

30 recombinant sons, aged for 3 days, and 20 0-1 day old virgin D. melanogaster w1118

females. Individual viable F1 hybrid sons, which by definition inherit the mutation

responsible for rescue, were PCR genotyped for their Lhr alleles. In order to determine

if hybrid sons inherited the wild type Lhr or the Lhr2 allele from the D. simulans father,

we used primer pairs 409/410 to PCR across the 16 aa indel. If sons inherit wild type D.

simulans Lhr we expect to see two bands, the smaller band corresponding to the

ancestral state in D. melanogaster Lhr and the larger size corresponding to the insertion

in wild type D. simulans Lhr; however if they inherit the Lhr2 alelle, we expect to see

only one band corresponding to the ancestral state.

RT-PCR, immunofluorescence and yeast two-hybrid: RT-PCR and

immunofluorescence were performed as previously described (Maheshwari and

Barbash, 2012). Yeast two-hybrid assays were performed as in Brideau and Barbash

(2011).

Sequence and phylogenetic analyses: We examined Lhr sequences from a

recent large-scale resequencing of D. melanogaster populations and found all 158

strains contain the 16 aa deletion (Mackay et al., 2012). We also searched the short

read archive from this project, using as the query a 100 bp sequence from mel-Lhr

flanking the site of the 16 aa indel. All 26 traces from 454 sequencing fully matched the

    9  

query. In combination with our previous polymorphism sampling of mel-Lhr (Brideau et

al., 2006), we conclude that D. melanogaster is fixed for the deletion form of the 16 aa

indel. The phylogenetic tree was built by MEGA 5.05 using the maximum parsimony

method (Tamura et al., 2011). The Lhr alleles used for the analysis are published in

Brideau et. al. (2006). For phylogenetic analysis the region corresponding to the C-

terminal mutation in Lhr2 was excluded from the alignment.

Results

D. simulans Lhr2 is mutant in its coding sequence: A cross between wild type

D. melanogaster females and D. simulans males produces only sterile daughters and

no sons. The genetic basis of male lethality appears to be fixed between the two

species, as crosses between many different wild type strains fail to produce hybrid sons  

(Lachaise et al., 1986; Sturtevant, 1920). The only two exceptions are strains with

mutations in D. melanogaster Hmr or D. simulans Lhr (Hutter and Ashburner, 1987;

Watanabe, 1979).

Although we and others implicitly assumed in previous analyses that rescue in

the D. simulans Lhr2 strain is due to its unusual Lhr allele, this point has not been

established (Brideau et al., 2006; Nolte et al., 2008). We therefore first did a crude

mapping experiment to test whether the hybrid rescue function is associated with the

Lhr2 locus. We outcrossed D. simulans Lhr2 to wild type D. simulans and tested for

linkage between the Lhr2 locus and hybrid rescue. We genotyped by PCR 48 viable

hybrid sons, which by definition have inherited the rescue locus, and found that all of

them also inherited the Lhr2 allele from the D. simulans parent. This pattern of co-

    10  

segregation supports the hypothesis that the Lhr2 allele is responsible for suppressing

hybrid male lethality instead of an unrelated mutation segregating in the same genetic

background.

We next sequenced 4 kb of genomic DNA spanning the Lhr2 locus and found

only several SNPs but no insertions, deletions or rearrangements in its non-coding

regions, suggesting that the Lhr2 allele is unlikely to be mutant in its expression. Using

quantitative RT-PCR we determined that Lhr expression in D. simulans Lhr2 is not

significantly different from wild type (t-test, P = 0.2) (Figure 2A), demonstrating that the

hybrid rescue property of D. simulans Lhr2 is different from the original rescue allele

Lhr1, which is an expression mutant having nearly undetectable levels of Lhr. The Lhr2

CDS is unusual in two respects (Figures 1, S1). First, Lhr2 lacks the 16aa insertion that

is present in frequencies near fixation in other sim-Lhr alleles. Second, Lhr2 has a

complex mutation in a conserved sequence near its C-terminus, which includes a 12 bp

in-frame deletion and non-synonymous mutations causing unique substitutions in 6

adjacent aa's.

Considering that the D. simulans Lhr2 allele contains the melanogaster-like

ancestral state at the 16aa indel, it raised the possibility that Lhr2 is a recent

introgression of D. melanogaster Lhr into D. simulans. This was rejected, however, by

phylogenetic analysis that firmly groups Lhr2 with alleles from the sibling species (Figure

2B). Interestingly, Lhr2 appears to be a relatively old allele that clusters separately from

other sim-Lhr alleles.

To test conclusively whether the coding sequence of the Lhr2 allele is defective

for hybrid lethal activity, we used a transgenic assay to compare it with wild type sim-

    11  

Lhr. We used the ɸC31 site-specific integration system to generate a D. melanogaster

strain carrying a D. simulans Lhr2 transgene at the attP86Fb site on the third

chromosome (Figure 1). The Lhr2 CDS was C-terminally tagged with HA and placed

under the control of wild type D. simulans regulatory sequences (from strain w501), to

generate the ɸ{sim-Lhr2-HA} construct.

Hybrid lethal activity was assayed using the D. simulans Lhr1 complementation

test (Maheshwari and Barbash, 2012). D. melanogaster mothers heterozygous for an

experimental or control transgene were crossed to D. simulans Lhr1 fathers, Lhr1 being

a loss-of-function mutation that acts as a dominant suppressor of HI. If the transgene

has hybrid lethal activity it is expected to suppress rescue by the Lhr1 mutation. In the

control cross with ɸ{sim-Lhr-HA} no hybrid sons inheriting the transgene were

recovered (Table 1 cross 1). This full suppression of rescue is consistent with our

previous results (Maheshwari and Barbash, 2012). In contrast, ɸ{sim-Lhr2-HA} only

partially suppressed rescue, with viability in the range of 35-40% relative to the control

class (Table 1 cross 2). This assay demonstrates that the Lhr2 CDS has significantly

reduced ability to cause HI but it is not a null allele. This conclusion is consistent with

the observation that D. simulans Lhr1 rescues more strongly than D. simulans Lhr2.

When crossed to D. melanogaster w1118 at room temperature the viability of hybrid

males with D. simulans Lhr1 is ~73% relative to hybrid females (51 F1 males and 70 F1

females), while with D. simulans Lhr2 it is ~49% (107 F1 males and 219 F1 females).

Lower levels of rescue with Lhr2 compared to Lhr1 were also observed in a previous

study (Barbash, 2010).

    12  

Assaying the function of the two major structural mutations in Lhr2: To

individually test the contribution of the complex C-terminal mutation and the 16aa

deletion to hybrid lethal activity, each was individually replaced in sim-Lhr2-HA with wild

type sequence to generate ɸ{sim-Lhr2-HA,+Cter} and ɸ{sim-Lhr2-HA,+16aa},

respectively (Figure 1). Initial experiments suggested that the presence or absence of

the C-terminal mutation has a much more significant impact on Lhr function compared

to the 16 aa indel. We therefore compared them to different references in our genetic

assays. For ɸ{sim-Lhr2-HA,+Cter}, where we reverted the C-terminal mutation to the

wild type sequence, we compared its activity to the wild type ɸ{sim-Lhr-HA} control and

found that it also fully suppresses rescue (Table 1, cross 3). This result demonstrates

that the conserved C-terminal region is essential for wild type Lhr function. Because

ɸ{sim-Lhr2-HA,+Cter} contains the ancestral deletion state of the 16 aa indel, this result

also demonstrates that the presence or absence of the 16 aa indel region in an

otherwise wild type sim-Lhr allele does not affect the ability of sim-Lhr to suppress

hybrid rescue by Lhr1.

For ɸ{sim-Lhr2-HA,+16aa}, where we added the 16 aa insertion to the Lhr2 allele,

a comparison to the construct ɸ{sim-Lhr2-HA} tests whether the 16 aa deletion has any

functional effect in the background of an allele that is partially impaired because it

carries the C-terminal deletion. In our Lhr1 complementation assay we detected a

significant difference in viability between the two genotypes of hybrid males (Table 1,

cross 2 vs. 4, two-tailed FET, P = 0.000). The relative viability of hybrid sons inheriting

ɸ{sim-Lhr2-HA,+16aa} was reduced to ~16% compared to ~35-41% for ɸ{sim-Lhr2-HA}.

    13  

This demonstrates that having the ancestral deletion state significantly contributes to

the hybrid rescue activity of Lhr2. This result thus shows that the polymorphic 16 aa

indel does affect Lhr function, at least in the presence of the second C-terminal

mutation.

In order to further explore the functional effects of the 16 aa indel, we turned to a

more sensitive genetic assay for Lhr function involving its interacting partner Hmr. We

have previously shown that in the background of the hypomorphic Hmr1 mutation, Lhr

orthologs exhibit significantly different degrees of hybrid lethality (Maheshwari and

Barbash, 2012). We therefore introduced each of our Lhr2 transgenes into an Hmr1

mutant background and tested the effect of the transgenes on hybrid male viability in

crosses to D. mauritiana (Table 2). D. mauritiana was chosen as the male parent

because in interspecific crosses between D. melanogaster females and sibling species

males, D. mauritiana hybrids show the highest viability (Hutter and Ashburner, 1987).

The crosses were also done at both room temperature and 18°C because hybrid

viability is temperature-dependent, with viability increasing at lower temperatures

(Hutter and Ashburner, 1987). Crosses with the wild type Lhr transgenes recapitulated

our previous experiments (Maheshwari and Barbash, 2012): Hmr1 hybrid sons carrying

sim-Lhr-HA were essentially inviable at room temperature while hybrid sons inheriting

mel-Lhr-HA had 32-44% viability (Table 2, crosses 1 and 2).

Surprisingly, hybrid sons carrying the ɸ{sim-Lhr2-HA} transgene were fully viable

at 18°C relative to their control brothers, and had substantially higher viability relative to

control brothers at room temperature (138.8-144.3%, Table 2, cross 3). Lhr2 is therefore

acting as a null allele or even an antimorph in this Hmr1 interaction assay. Reverting the

    14  

C-terminal mutation to the wild type sequence fully restored hybrid lethal effects to wild

type levels, with hybrid viability not significantly different than the wild-type ɸ{sim-Lhr-

HA} transgene (Table 2, cross 2 vs 4, two-tailed FET, P = 1.0 at both room temperature

and 18°C). These results demonstrate that the C-terminal region is critical for the strong

loss-of-function/antimorphic activity of Lhr2 in this assay.

We then compared the ɸ{sim-Lhr2-HA} allele to ɸ{sim-Lhr2-HA,+16aa}, which

differ only by the presence or absence of the 16 aa indel. We found that although hybrid

sons inheriting ɸ{sim-Lhr2-HA,+16aa} have viabilities comparable to the control class,

the relative viabilities of hybrid sons inheriting this transgene are less than that for the

ɸ{sim-Lhr2-HA} transgene. This reduction in viability is significant at 18°C (Table 2,

cross 3 vs. 5, two-tailed FET, P = 0.022). These results again show that the 16aa indel

does have a detectable effect on Lhr function in the background of the C-terminal

mutation.

The molecular properties of the LHR2 protein: We next asked whether the

LHR2 mutant protein is altered for molecular functions of LHR. LHR localizes to specific

regions of heterochromatin through interaction with Heterochromatin Protein1 (HP1)

(Brideau and Barbash, 2011; Brideau et al., 2006; Greil et al., 2007). We therefore

asked whether the reduced hybrid lethal activity of Lhr2 was reflecting a defect in

heterochromatin association. We performed yeast two-hybrid assays and found that the

interaction between LHR2 and HP1 was indistinguishable from the wild type control

(Figure 3A). Consistent with this result, LHR2-HA localized to heterochromatin in vivo

and immuno-FISH experiments showed co-localization with the dodeca satellite in a

manner indistinguishable from wild type LHR (Maheshwari and Barbash, 2012),

    15  

providing further support for wild type association with heterochromatin (Figure 3B). We

conclude that the reduced hybrid lethal activity of Lhr2 is not because localization to

heterochromatin is defective.

Discussion

The C-terminal mutation in Lhr2 identifies a region critical for Lhr function:

In this study we demonstrate conclusively that Lhr2 is a mutant allele of the Lhr hybrid

lethality gene and further show that its mutant properties are due to changes in its CDS.

Lhr2 is a weaker mutant allele than Lhr1 in its hybrid rescue ability and in transgenic

assays sim-Lhr2 complements Lhr1 more weakly than does a wild type sim-Lhr allele

(Table 1). By these criteria, Lhr2 would appear to be hypomorphic. In contrast, results

from the Hmr1 interaction assay suggest that Lhr2 has no wild type activity or is even

antimorphic (Table 2).

We therefore devised modified Lhr2 alleles to individually assay specific regions

for effects on hybrid lethal activity (Figure 1). We find that a highly conserved stretch of

10 residues in the C-terminus of Lhr is critical for wild type levels of hybrid lethal activity

in both genetic assays. This conclusion is consistent with the observations of Nolte et al.

(2008) who found wild type hybrid lethal activity for two D. simulans Lhr alleles that have

the deletion state for the 16 aa indel but are wild type for the C-terminal mutation.

Because this region is highly similar between mel-Lhr and sim-Lhr, this result also

supports published results that Lhr orthologs from both species can cause

incompatibility (Brideau and Barbash, 2011; Maheshwari and Barbash, 2012). Our data

here suggest that the C-terminal region is especially critical for interactions with Hmr

    16  

because ɸ{sim-Lhr2-HA} has no wild type activity for complementing Hmr1 (Table 2,

cross 3), but whether this reflects a direct physical interaction remains unknown. The

Lhr1 complementation assay is perhaps more straightforward to interpret since one is

asking whether different Lhr alleles complement a loss-of-function allele of Lhr. Since

only half of the hybrid sons inheriting the ɸ{sim-Lhr2-HA} transgene are viable (Table 1

cross 2), it is clear that the C-terminal deletion does not fully account for the hybrid

lethal activity of wild type Lhr. Therefore additional regions of the LHR protein must also

contribute to its incompatibility properties.

An effect of the 16aa indel polymorphism on hybrid lethal activity was excluded

by Nolte et al. (2008) using a population survey. They tested two D. simulans lines that

retain the ancestral state of lacking the 16aa insertion, but neither of them rescued

hybrid sons. However, in the transgenic assay we find a significant difference in hybrid

lethal activity of the Lhr2 allele with and without the insertion (Table 1 cross 2 vs. cross

4). We also detected a significant difference in the Hmr1 interaction assay (Table 2,

cross 3 vs. cross 5). The lack of any phenotypic effects observed by Nolte et al. (2008)

is most likely because the effect of the 16aa indel is revealed only in a sensitized

background. In this transgenic assay the C-terminal mutation in Lhr2 lowers the lethal

activity of Lhr, providing us with the sensitivity to assess the contribution of the 16aa

deletion.

Differential hybrid lethal activity of Lhr orthologs: coding or regulatory? Lhr

has strongly asymmetric effects on hybrid viability, as mutations in sim-Lhr but not mel-

Lhr produce viable hybrids (Brideau et al. 2006). This finding led to the hypothesis that

the hybrid lethal activity of Lhr is due to coding sequence divergence that is specific to

    17  

the D. simulans lineage. Surprisingly, we subsequently found that hybrid lethal activity is

an ancestral property shared by the coding sequences of both Lhr orthologs (Brideau

and Barbash, 2011; Maheshwari and Barbash, 2012). The different hybrid rescue

effects of Lhr orthologs instead appear to be largely the consequence of divergent gene

regulation that causes sim-Lhr to be expressed more highly in hybrids than mel-Lhr

(Maheshwari and Barbash, 2012). Our results here are consistent with these findings.

First, we have identified the site of the C-terminal mutation in Lhr2 as critical for HI.

Since this region is nearly identical between D. melanogaster and the sibling species, it

was likely present in the ancestral Lhr allele. Second, our previous transgenic

comparisons of mel-Lhr and sim-Lhr alleles did not exclude the possibility that coding

sequence divergence may make some contribution to functional divergence. Our finding

here that the 16aa indel has a functional effect, but is only detectable on the

background of the C terminal deletion, is indicative that coding sequence divergence

makes a small contribution to differences in the hybrid lethal activity of Lhr. Interestingly

though, since this difference between mel-Lhr and sim-Lhr is an indel it does not

contribute to the signature of adaptive evolution discovered for Lhr (Brideau et al. 2006).

Rigorous identification of incompatible substitutions has only been attempted for

yeast interstrain and interspecific HI genes. Single amino-acid changes have been

identified in each of two interacting genes that cause a defect in mismatch repair (Heck

et al., 2006). In the case of AEP2, a translation factor that causes mito-nuclear

incompatibility between S. cerevisiae and S. bayanus, it was narrowed down to multiple

mutations within a region of 148 aa's. In the case of MRS1, a splicing factor that also

causes mito-nuclear incompatibility between the same two yeast species it was pared

    18  

down to only 3 non-synonymous substitutions (Chou et al., 2010; Lee et al., 2008).

There is no evidence of selection acting on either of these latter two HI genes and both

have experienced relatively limited sequence divergence. There are at least 6 HI genes

known that are rapidly diverging under selection (Maheshwari and Barbash, 2011;

Presgraves, 2010). Although it is implicitly assumed that this divergence is the basis of

HI, this hypothesis remains largely unexamined.

Functional effects of indels and polymorphisms. While indels are a common

type of sequence variation, they are rarely considered in evolutionary studies. The

reason for this is that their origins and functional consequences are poorly understood.

Analysis of indels within protein sequences supports the view that they affect protein-

folding, and computational analysis of high-throughput protein interaction data sets

suggests that indels modify protein interaction interfaces, thereby significantly rewiring

the interaction networks (Hormozdiari et al., 2009; Zhang et al., 2011). Moreover,

studies comparing patterns of evolution of Catsper1, a sperm-specific calcium channel,

found evidence of positive selection for elevated rates of indel substitutions within its

intracellular domain across multiple primate and rodent species (Podlaha and Zhang,

2003; Podlaha et al., 2005). The authors suggest that the selection for indels might be a

consequence of their effect on the regulation of the Catsper1 channel, which can affect

sperm motility, an important determinant in sperm competition.

Large structural polymorphisms are not unique to Lhr; other HI genes such as

Hmr and Prdm9 have multiple in-frame indels, as does the segregation distorter

RanGAP (Maheshwari et al., 2008; Oliver et al., 2009; Presgraves, 2007). So far the

primary focus of evolutionary analysis has been single amino-acid substitutions, and

    19  

indel variation has been largely ignored in the assessment of functional divergence.

Recent high throughput analyses on human tissues has catalogued the occurrence of

coding indels in hundreds of conserved and essential genes as well as in protein

isoforms via alternative splicing, thus highlighting indels as an abundant source of

structural variation (Mills et al., 2011; Wang et al., 2008). Our characterization of an

indel polymorphism in Lhr presents one functional argument supporting the prediction

that coding indels play an important evolutionary role. The low frequency of the deletion

state of the 16aa indel in D. simulans and its monomorphic state in D. melanogaster do

not suggest an obvious role for selection in maintaining it. Our experiments here

nevertheless demonstrate that this indel does affect Lhr function.

Acknowledgments

We thank Greg Smaldone and Shuqing Ji for help scoring flies, and Tawny

Cuykendall, Heather Flores, P. Satyaki, Michael Nachman, and the anonymous

reviewers for helpful comments on the manuscript. Supported by NIH Grant

2R01GM074737.

    20  

Literature Cited

Barbash,  D.  A.,  2010  Genetic  testing  of  the  hypothesis  that  hybrid  male  lethality  results  from  a  failure  in  dosage  compensation.  Genetics  184:  313-­‐316.  

Bayes,  J.  J.,  and  H.  S.  Malik,  2009  Altered  heterochromatin  binding  by  a  hybrid  sterility  protein  in  Drosophila  sibling  species.  Science  326:  1538-­‐1541.  

Bischof,  J.,  R.  K.  Maeda,  M.  Hediger,  F.  Karch,  and  K.  Basler,  2007  An  optimized  transgenesis  system  for  Drosophila  using  germ-­‐line-­‐specific  phiC31  integrases.  Proc  Natl  Acad  Sci  U  S  A  104:  3312-­‐3317.

Brideau,  N.  J.,  and  D.  A.  Barbash,  2011  Functional  conservation  of  the  Drosophila  hybrid  incompatibility  gene  Lhr.  BMC  Evol  Biol  11:  57.

Brideau,  N.  J.,  H.  A.  Flores,  J.  Wang,  S.  Maheshwari,  X.  Wang,  et  al.,  2006  Two  Dobzhansky-­‐Muller  genes  interact  to  cause  hybrid  lethality  in  Drosophila.  Science  314:  1292-­‐1295.

Chou,  J.  -­‐Y.,  Y.  -­‐S.  Hung,  K.  -­‐H.  Lin,  H.  -­‐Y.  Lee,  and  J.  -­‐Y.  Leu,  2010  Multiple  molecular  mechanisms  cause  reproductive  isolation  between  three  yeast  species.  PLoS  Biol  8:  e1000432.

Greil,  F.,  E.  de  Wit,  H.  J.  Bussemaker,  and  B.  van  Steensel,  2007  HP1  controls  genomic  targeting  of  four  novel  heterochromatin  proteins  in  Drosophila.  EMBO  J  26:  741-­‐751.

Heck,  J.  A.,  J.  L.  Argueso,  Z.  Gemici,  R.  G.  Reeves,  A.  Bernard,  et  al.,  2006  Negative  epistasis  between  natural  variants  of  the  Saccharomyces  cerevisiae  MLH1  and  PMS1  genes  results  in  a  defect  in  mismatch  repair.  Proc  Natl  Acad  Sci  U  S  A  103:  3256-­‐3261.

Hormozdiari,  F.,  R.  Salari,  M.  Hsing,  A.  Schönhuth,  S.  K.  Chan,  et  al.,  2009  The  effect  of  insertions  and  deletions  on  wirings  in  protein-­‐protein  interaction  networks:  a  large-­‐scale  study.  J  Comput  Biol  16:  159-­‐167.

Hutter,  P.,  and  M.  Ashburner,  1987  Genetic  rescue  of  inviable  hybrids  between  Drosophila  melanogaster  and  its  sibling  species.  Nature  327:  331-­‐333.

Ioerger,  T.  R.,  A.  G.  Clark,  and  T.  H.  Kao,  1990  Polymorphism  at  the  self-­‐incompatibility  locus  in  Solanaceae  predates  speciation.  Proc  Natl  Acad  Sci  U  S  A  87:  9732-­‐9735.

Lachaise,  D.,  J.  R.  David,  F.  Lemeunier,  L.  Tsacas,  and  M.  Ashburner,  1986  The  reproductive  relationships  of  Drosophila  sechellia  with  D.  mauritiana,  D.  simulans,  and  D.  melanogaster  from  the  Afrotropical  region.  Evolution  40:  262-­‐271.

Lee,  H.  -­‐Y.,  J.  -­‐Y.  Chou,  L.  Cheong,  N.  -­‐H.  Chang,  S.  -­‐Y.  Yang,  et  al.,  2008  Incompatibility  of  nuclear  and  mitochondrial  genomes  causes  hybrid  sterility  between  two  yeast  species.  Cell  135:  1065-­‐1073.

Mackay,  T.  F.  C.,  S.  Richards,  E.  A.  Stone,  A.  Barbadilla,  J.  F.  Ayroles,  et  al.,  2012  The  Drosophila  melanogaster  Genetic  Reference  Panel.  Nature  482:  173-­‐178.

    21  

Maheshwari,  S.,  and  D.  A.  Barbash,  2011  The  genetics  of  hybrid  incompatibilities.  Annu  Rev  Genet  45:  331-­‐355.

Maheshwari,  S.,  and  D.  A.  Barbash,  2012  Cis-­‐by-­‐Trans  regulatory  divergence  causes  the  asymmetric  lethal  effects  of  an  ancestral  hybrid  incompatibility  gene.  PLoS  Genet  8:  e1002597.

Maheshwari,  S.,  J.  Wang,  and  D.  A.  Barbash,  2008  Recurrent  positive  selection  of  the  Drosophila  hybrid  incompatibility  gene  Hmr.  Mol  Biol  Evol  25:  2421-­‐2430.

McQuilton,  P.,  S.  E.  St  Pierre,  J.  Thurmond,  and  FlyBase  Consortium,  2012  FlyBase  101-­‐-­‐the  basics  of  navigating  FlyBase.  Nucleic  Acids  Res  40:  D706-­‐D714.

Mills,  R.  E.,  W.  S.  Pittard,  J.  M.  Mullaney,  U.  Farooq,  T.  H.  Creasy,  et  al.,  2011  Natural  genetic  variation  caused  by  small  insertions  and  deletions  in  the  human  genome.  Genome  Res  21:  830-­‐839.

Nolte,  V.,  D.  Weigel,  and  C.  Schlötterer,  2008  The  impact  of  shared  ancestral  variation  on  hybrid  male  lethality-­‐-­‐a  16  codon  indel  in  the  Drosophila  simulans  Lhr  gene.  J  Evol  Biol  21:  551-­‐555.

Oliver,  P.  L.,  L.  Goodstadt,  J.  J.  Bayes,  Z.  Birtle,  K.  C.  Roach,  et  al.,  2009  Accelerated  evolution  of  the  Prdm9  speciation  gene  across  diverse  metazoan  taxa.  PLoS  Genet  5:  e1000753.

Podlaha,  O.,  and  J.  Zhang,  2003  Positive  selection  on  protein-­‐length  in  the  evolution  of  a  primate  sperm  ion  channel.  Proc  Natl  Acad  Sci  U  S  A  100:  12241-­‐12246.

Podlaha,  O.,  D.  M.  Webb,  P.  K.  Tucker,  and  J.  Zhang,  2005  Positive  selection  for  indel  substitutions  in  the  rodent  sperm  protein  catsper1.  Mol  Biol  Evol  22:  1845-­‐1852.

Presgraves,  D.  C.,  2007  Does  genetic  conflict  drive  rapid  molecular  evolution  of  nuclear  transport  genes  in  Drosophila?  Bioessays  29:  386-­‐391.

Presgraves,  D.  C.,  2010  The  molecular  evolutionary  basis  of  species  formation.  Nat  Rev  Genet  11:  175-­‐180.

Sturtevant,  A.  H.,  1920  Genetic  studies  on  Drosophila  simulans.  I.  Introduction.  Hybrids  with  Drosophila  melanogaster.  Genetics  5:  488-­‐500.

Tamura,  K.,  D.  Peterson,  N.  Peterson,  G.  Stecher,  M.  Nei,  et  al.,  2011  MEGA5:  molecular  evolutionary  genetics  analysis  using  maximum  likelihood,  evolutionary  distance,  and  maximum  parsimony  methods.  Mol  Biol  Evol  28:  2731-­‐2739.

Ting,  C.  T.,  S.  C.  Tsaur,  M.  L.  Wu,  and  C.  I.  Wu,  1998  A  rapidly  evolving  homeobox  at  the  site  of  a  hybrid  sterility  gene.  Science  282:  1501-­‐1504.

Wang,  E.  T.,  R.  Sandberg,  S.  Luo,  I.  Khrebtukova,  L.  Zhang,  et  al.,  2008  Alternative  isoform  regulation  in  human  tissue  transcriptomes.  Nature  456:  470-­‐476.

    22  

Watanabe,  T.  K.,  1979  A  gene  that  rescues  the  lethal  hybrids  between  Drosophila  melanogaster  and  D.  simulans.  Jpn.  J.  Genet  54:  325-­‐331.

Zhang,  Z.,  J.  Huang,  Z.  Wang,  L.  Wang,  and  P.  Gao,  2011  Impact  of  indels  on  the  flanking  regions  in  structural  domains.  Mol  Biol  Evol  28:  291-­‐301.

    23  

Fig. 1. A schematic of the Lhr2 constructs. The mel-Lhr-HA and sim-Lhr-HA

constructs are described in (Maheshwari and Barbash, 2012). All other constructs

contain the full sim-Lhr2 coding sequences fused to the HA epitope tag (green) with the

UTRs and genomic DNA from the D. simulans w501 strain. The white boxes represent

the 16 aa indel and C-terminal mutations. Triangles represent replacement of Lhr2 CDS

with sequence from wild type D. simulans Lhr.

Fig. 2. The Lhr2 allele is not an expression mutant or a D. melanogaster

introgression. (A) Quantitative RT-PCR analysis comparing Lhr expression in D.

simulans Lhr2 with D. melanogaster w1118 and D. simulans v strains, both of which are

Lhr+. RNA was isolated from 6-10 hr old embryos. Lhr abundance was measured

relative to rpl32. Expression levels were normalized by setting D. melanogaster w1118

strain to 1. Error bars represent standard error among biological replicates, n≥3. (B) The

evolutionary history of Lhr2 in the melanogaster subgroup was inferred using the

Maximum Parsimony method. The arrowhead indicates the branch on which the 16 aa

insertion originated. The percentage of replicate trees in which the associated taxa

clustered together in the bootstrap test (500 replicates) are shown next to the branches.

Bootstrap values are not shown for the terminal nodes within the D. melanogaster and

D. simulans clades.

Fig. 3. The sim-LHR2 protein interacts with HP1 and localizes to

heterochromatin. (A) Interaction with HP1. Wild type D. simulans LHR was used as a

positive control. Yeast two-hybrid interactions were detected by activation of HIS3 and

growth on media lacking histidine; loading controls [complete media (CM) -Leu -Trp]

contain histidine. (B) Localization of sim-LHR2-HA to heterochromatin in D.

    24  

melanogaster cycle 12-14 embryos. Top, sim-LHR2-HA was detected with anti-HA

(green) and localizes to apical heterochromatin, detected by TOPRO3 staining (red) of

DNA at the embryo surface. Bottom, immuno-FISH experiment with anti-HA (green)

detecting sim-LHR2-HA in interphase nuclei. LHR2-HA shows no overlap with the 359

bp (red) satellite but partially co-localizes with the dodeca satellite (blue).

Fig. S1. Alignment of D. simulans Lhr2 protein sequence with wild type orthologs.

The 16 aa indel polymorphism and C-terminal mutations are underlined.

    25  

Table 1: Testing the two major mutations in Lhr2 for suppression of hybrid rescue by D.

simulans Lhr1.

Cro

sses were between D. melanogaster females heterozygous for the different transgenes

(genotype w; φ{ }/+) and D. simulans Lhr1 males. The transgenes carried a copy of the

No. of hybrid males

Cross

Transgenic

construct

No. of

hybrid

females

Genotype 1

+/Lhr1; +/+

Genotype 2

+/Lhr1;φ{ }/+

Relative

viability of

φ{ } males

(%)

1 φ{sim-Lhr-HA} 135 74 0 0

2 φ{sim-Lhr2-HA} 494 226 80 35.4

308 185 75 40.54

3 φ{sim-Lhr2-

HA+Cter}

269 175 0 0

187 104 0 0

4 φ{sim-Lhr2-

HA+16aa}

337 178 28 15.73

224 164 26 15.85

    26  

w+ gene so the hybrid sons inheriting the transgene, +/Lhr1; φ{ }/+ (genotype 2) were

distinguished from their +/Lhr1; +/+ siblings (genotype 1) by their eye-color. All crosses

were carried out at room temperature. Relative viability is the ratio of the number of

hybrid sons inheriting the transgene (genotype 2) compared to the control class

(genotype 1).

    27  

Table 2: Testing the two major mutations in Lhr2 for suppression of hybrid rescue by D. melanogaster Hmr1.  

Transgenic construct Temp.

No. of hybrid females

No. of hybrid males Relative viability of φ{ } males (%)

Genotype 1 Hmr1/Y; +/+

Genotype 2

Hmr1/Y; φ{ }/+

1 φ{mel-Lhr-HA} RT 446 78 25 32.1  

RT 324 67 30 44.8  

18 °C 462 184 127 69.0  

18 °C 689 265 140 52.8  

2 φ{sim-Lhr-HA} RT 305 55 1 1.8  

RT 180 35 0 0.0  

18 °C 692 283 90 31.8  

18 °C 504 198 111 56.1  

3 φ{sim-Lhr2-HA} RT 354 79 114 144.3  

RT 361 80 111 138.8  

18 °C 782 264 283 107.2  

18 °C 742 253 250 98.8  

4 φ{sim-Lhr2-HA+Cter}

RT 226 47 1 2.1  

RT 382 59 0 0.0  

18 °C 561 236 106 44.9  

18 °C 393 197 74 37.6  

5 φ{sim-Lhr2-HA+16aa }

RT 86 32 34 106.3  

RT 182 52 57 109.6  

18 °C 538 253 214 84.6  

18 °C 373 191 155 81.2  

    28  

The different Lhr transgenes were tested for interaction with an Hmr hypomorphic allele,

Hmr1. D. melanogaster w Hmr1 v; ɸ{transgene, w+}/+ females were mated to D.

mauritiana Iso105 males. Hybrid male progeny that inherit the transgene are orange

eyed (genotype 2), while the sibling brothers are white eyed (genotype 1). Relative

viability is the ratio of the number of hybrid sons inheriting the transgene compared to

the control class.

    29  

Table S1: Primers used in the Materials and Methods.

No. Sequence Capitalized

region

405 caccatgagtaccgacagcgccgaggaa

405 tcatgttctcagcgtaggccg

409 gtagctttctcttggcgctctt

410 gtaagtgaactgaagctgcgttgg

664 tcgcatAAGCTTctggcaggtggtaaccgatacgg HindIII

691 tactatAAGCTTtggttgttccacacgactttatcg HindIII

728

TGCATAGTCCGGGACGTCATAGGGATAGCCCGCA

TAGTCAGGAACATCGTATGGGTACATtgttctcagcgtag

gccg

3xHA tag

729

CCCTATGACGTCCCGGACTATGCAGGATCCTATC

CATATGACGTTCCAGATTACGCTtgactttctttcgtataaaa

tgc

3xHA tag

882 tgtcgcccgcggaacgtcgcc

938 cgtttcctcggcgctgtcggtactcat

939 atgagtaccgacagcgccgaggaaacg

    30  

940 tcatgttctcagcgtaggccgcctgg

941 ccaggcggcctacgctgagaacatga

942 ccaTTATAGCTTATTCTTTTATTGGCACTTGctacgttgg

gtcttatgttgcg Cter fill-in

943 CAAGTGCCAATAAAAGAATAAGCTATAAtggtgttagca

atgaatcaaatgatgtc Cter fill-in

945 GATTTGCAATTTGTGTACATCGTTCATCTCCCGCC

ACAGAGGTTCAGTgatttgccctttggcagccgc 16aa fill-in

946 ACTGAACCTCTGTGGCGGGAGATGAACGATGTAC

ACAAATTGCAAATCcctgaacctctgtttcgggtg 16aa fill-in

φ{sim-Lhr2-HA + Cter}

9 aa

φ{sim-Lhr2-HA +16aa}

16 aa

φ{sim-Lhr2-HA}Cter mut16 aa deletion

Lhr2

φ{mel-Lhr-HA}16 aa deletion

Lhr

Lhrφ{sim-Lhr-HA}

Fig. 1

0

0.2

0.4

0.6

0.8

1

1.2

1.4

Lhr e

xpre

ssio

n le

vel

A B

Fig. 2

D. melanogaster D. simulans D. simulans Lhr2

D. simulans

1s

12s

5s

2s

11s

3s

9s

4s

8s

6s

10s

D. sechellia

D. mauritianaD. simulans Lhr2

D. melanogaster

3m

10m

4m

6m

5m

1m

12m

11m

8m

9m

2m

7m

99

6178

38

D. yakuba