1996 88: 3446-3450    

 L Bi, R Sarkar, T Naas, AM Lawler, J Pain, SL Shumaker, V Bedian and HH Jr Kazazian  

targeting: RNA and protein studiesFurther characterization of factor VIII-deficient mice created by gene

http://bloodjournal.hematologylibrary.org/misc/rights.dtl#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://bloodjournal.hematologylibrary.org/misc/rights.dtl#reprintsInformation about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/subscriptions/index.dtlInformation about subscriptions and ASH membership may be found online at:

. reservedHematology; all rightsCopyright 2007 by The American Society of

Suite 200, Washington DC 20036.semimonthly by the American Society of Hematology, 1900 M St, NW, Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published    

only.For personal use at University of Pennsylvania Library on January 23, 2009. www.bloodjournal.orgFrom

Further Characterization of Factor VIII-Deficient Mice Created by Gene Targeting: RNA and Protein Studies

By Lei Bi, Rita Sarkar, Thierry Naas, Ann M. Lawler, Jayashree Pain, Sally L. Shumaker, Vahe Bedian, and Haig H. Kazazian, Jr

Previously we created two strains of factor VIII-deficient mice by insertion of a neo gene into (1) the 3’ end of exon 16 and (2) exon 17 of the factor Vlll gene. Affected mice of both strains have no plasma factor Vlll activity, yet are healthy with no spontaneous bleeding. Factor VIII-deficient females bred with affected males survive pregnancy and de- livery. We used reverse transcriptase-polymerase chain reac- tion of liver RNA to characterize factor Vlll mRNA pro- cessing. Factor VI11 mRNA of the exon 16 knockout strain contains neo sequences plus 17 bp of intron 16 due to use of a cryptic donor site in intron 16. All factor Vlll mRNA of the exon 17 knockout strain lacks exon 17 and neosequences. In

EMOPHILIA A is a severe X-linked clotting disorder H that occurs in roughly 1 in 5,000 to 10,000 males and is caused by abnormalities in factor VIII, an essential cofac- tor in the normal blood coagulation.’.’ The human factor VI11 gene is 186 kb in length and contains 26 exons. The coding region is 7.2 kb long and it codes for 2,351 amino

Genetic defects in the factor VI11 gene causing he- mophilia A include point mutations, deletions, insertions, and gene inversions. About 50% of severe hemophilia A is caused by point mutations, whereas the remaining 50% is related to gene inversion between an intron 22 sequence (gene A) and one of two other copies of gene A located about 500 kb 5’ to the factor VI11 gene.’

Because factor VI11 replacement therapy requires frequent intravenous infusions and is impractical as a maintenance therapy at the present time, correction of the phenotype by gene therapy has been suggested as an attractive alternative. Preliminary gene therapy studies have been performed in normal mice and the hemophilia A dog The natural dog model of severe hemophilia has been useful, but it is limited by its expense and the long generation time of the dog. Using gene targeting, we produced mice with factor VI11 deficiency for studies of factor VI11 function and gene therapy.’ Here we present further information on the obser- vational phenotype and factor VI11 mRNA processing of these mice. We have also obtained monoclonal antibodies (MoAbs) to factor VIII light chain which confirm the factor

From the Department of Genetics, University of Pennsylvania School of Medicine, Philadelphia and the Department of Gynecology und Obstetrics, The Johns Hopkins Vniver.sity School of Medicine, Baltimore, MD.

Submitted February 23, 1996; accepted June 17, 1996. Supported by National Institutes of Health Grant No.

ROIHL.38165 to H.H.K. Address reprint requests to Hais H. Kazazian, Jr, Department of

Genetics, University of Pennsylvania School of Medicine, 475 CRB, 415 Curie Blvd, Philadelphia, PA 19104.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with I 8 U.S.C. section 1734 solely to indicate this fact. 0 1996 by The American Societ): of Hematology. 0006-4971/96/8809-0038$3.00/0

skipping exon 17, the intron 16 donor site or a cryptic donor site 46 bp 3‘ to the intron 16 donor site are used. Thus, factor Vlll deficiency in exon 16 knockout mice is due to truncated protein, while in exon 17 knockout mice it is due to either truncated or partially deleted protein. After immunizing exon 16 knockout mice with human recombinant factor VIII, two monoclonal antibodies were obtained that recognize 4 0 0 pg of mouse factor Vlll light chain. Assay of cryoprecip- itate from the plasma of affected mice failed to show factor Vlll light chain. 0 1996 by The American Society of Hematology.

VI11 protein deficiency, and should be useful in gene correc- tion studies with mouse factor VI11 cDNA constructs.

MATERIALS AND METHODS

Genotype determination. After tail snipping, the tail vein was immediately cauterized by silver nitrate to stop bleeding. DNA was then isolated from the tail tissue.’ Amplifications were performed on 250 to 500 ng of mouse genomic DNA in a 50-pL vol containing 400 nmol/L each primer, 200 n m o E each dNTP, 10 mmol/L TrisHCl (pH 8.3), 1.5 mmol/L MgC12, and 1 U of Taq polymerase. Two PCR reactions were used for genotyping of the factor VI11 knockout mice. To confirm the disruption of exon 16 and exon 17, the forward primer was derived from neo sequence (5’TGTGTC- CCGCCCCTTCC7TT3’) and the backward primer was derived from exon 17 (5’GAGCAAATTCCTGTACTGAC3’). Similarly, to con- firm the presence of undisrupted X chromosome, the forward primer was derived from the 5‘ end of exon 16 (S’TGCAAGGCCTGGGCT- TATIT3’) and the backward primer was derived from exon 17 (5‘GAGCAAATTCCTGTACTGAC3‘), since we did not obtain a polymerase chain reaction (PCR) product across the neo cassette of the disrupted chromosome (Fig 1A). Reactions were denatured at 94°C for 6 minutes and then subjected to 30 step of cycles. For the neo-exon 17 amplification, each cycle consisted of 94°C for 30s, 5S”C for 30s, and 72°C for 30s. For the exon 16-exon 17 amplifica- tion, each cycle consisted of 94°C for 30s, 54°C for 30s, and 72°C for 90s. Using a combination of these PCR reactions, the genotypes of normal female, carrier female, affected female, normal male, and affected male could be discerned (Fig 1B).

A COATEST VI11 Cl4 (Chromogenix AB, Molndal, Sweden) chromogenic assay was performed as pre- viously described? Factor VI11 activity of the test plasma was deter- mined using a standard curve constructed with serial dilutions of mixed normal mouse plasma.’

Whole liver dissected from adult mice was immediately lyophilized in liquid nitrogen to prevent adventitious introduction of RNases into the RNA preparation. Total RNA was isolated by homogenization in 4 mol/L guanidium thiocyanate followed by phenolkhloroform extrac- tion. I n The RNA concentration was determined by spectrophotome- try. The authenticity of the RNA isolated was shown by the absence of RNA bands in samples treated with RNase and by the preservation of 18.5 and 28s RNA in samples treated with DNase. Five, micro- grams of total RNA was primed with 0.5 pg oligo (dT) 12-18 primers in a 20-pL reaction volume. The first-strand cDNA synthesis reaction was catalyzed at 42°C by 200 U of superscript I1 RNase H-reverse transcriptase (GIBCO-BRL,, Gaithersburg, MD).”.’* To maximize the size of cDNA synthesized, the ratio of the primers to RNA was

Factor VIIl activiry assay

Reverse transcriptase (RTJ-PCR of mouse liver RNA.

3446 Blood, Vol88, No 9 (November I ) , 1996 pp 3446-3450

only.For personal use at University of Pennsylvania Library on January 23, 2009. www.bloodjournal.orgFrom

RNA AND PROTEIN STUDIES IN MURINE HEMOPHILIA 3447

MC-19 M C l 8 - 4 -

A Nnrmsl ..-.... I.

15 16 17 18 19

I 680bp I I I

E-1 6-disrupted neo-R MC-18 15 16 -17 18 19

- - I ~ ~ ~ ~ .__ n1- I420 bp -

MC-18 E-1 7-disrupted neo-R c

15 16 -7 18 19

I d

150 bp

B L

L L Q

m 0

- ‘0 Q 0 al

m

c

c c L 0 0)

m .c c

0) Q - E P

U al c 0

al

m r .c

4-680 bp

420 bp

4-150 bp

Fig 1. Genotyping of factor Vlll knockout mice. (AI By PCR, a 680- bp fragment was ampliiied from the normal X chromosome using primers outside of the disrupted region. Either a 420-bp or a 150- bp fragment was amplified from exon 16- or exon 17-disrupted X chromosomes using primers containing the neo sequence (neo-RI. (Bl Products from the two PCR reactions were combined and loaded on a 1% agarose, 2% Nusieve gel. All possible genotypes (normal female, carrier female, affected female, normal male, and affected male) were easily determined.

determined empirically for each RNA preparation. After first-strand cDNA synthesis, target cDNA was amplified in a 100-pL reaction volume using two specific oligonucleotides and Taq DNA polymer- ase. Thermal cycling parameters consisted of a preamplification de- naturation of 3 minutes at 95°C followed by 30 cycles of 95°C for 30 seconds, 55” to 65°C annealing for 30 seconds, and extension at 72°C for 45 to 60 seconds per 1 kb of target length. The RT- PCR products were then cloned into the TA-vector (Invitrogen, San Diego, CA) for subsequent characterization. Four pairs of PCR prim- ers were used: one pair amplified a region of exon 14 (P-14a and

P-14b); one pair amplified a region of exon 26 (P-26a and P-26b); one pair amplified a region from exon 15 to exon 18, across the knockout exons (MC-15 and MC-18); and one pair amplified from the neo sequence to exon 17 (R-neo and MC-17).

Two exon-I6 factor VI11 knockout mice were immunized by human recombinant factor VI11 with complete Freund’s adjuvant. Immediately after the third injec- tion, both mice died. apparently from anaphylactic shock. Spleens were dissected and splenocytes were homogenized through a homog- enizer with 80-mesh screen. Splenocytes were pelleted by centrifuga- tion at 3001: for 15 minutes incubated in 5 mL lysis buffer (0.17 mol/L NH4CI, pH 7.5) on ice for 8 minutes to lyse erythrocytes. After addition of 5 mL serum-free HY medium (90% high-glucose Dulbecco’s Modified Eagle Media [D-MEM], 10% NCTC135). cells were repelleted, and 1.1 X 10’ splenocytes were mixed with 3 X IO’ Sp2lOAg14 myeloma cells. Fusion was performed according to the procedure of Lane et all’ using Kodak PEG 1450 as fusion agent. Fusion products were resuspended in 300 mL complete HY consisting of 70% HY medium, 20% fusion-tested, fetal calf serum (GIBCO), 4 mmol/L L-glutamine, 0.15 mg/mL oxaloacetate, 50 pgl mL pyruvate, 0.2 UlmL insulin, 5% Origen hybridoma growth sup- plement (IGEN, Rockville, MD), 100 UlmL penicillin, 0.2 UlmL streptomycin, 0.1 mmol/L Hypoxanthine, and 6 mmol/L azaserine. The suspension was distributed at 150 pL per well into 20 96- well culture plates, fed with 100 pL complete HY medium without azaserine and with 2% Origen on day 6, and yellow supernatants were obtained starting on day 10.

Harvested supernatants were tested by an ELISA screenI4 using a variation of standard procedures. Falcon Pro-Bind ELISA plates (Becton Dickin- son Labware, Oxnard, CA) were coated with 50 pL of 0.2 mglmL human recombinant factor VI11 for 2 hours at 20°C. and blocked with 5% instant milk/0.05% Tween-20 (Fisher Biotech, Fair Lawn, NJ) for 2 hours. Plates filled with blocking solution were stored at -20°C and used as needed. Thawed plates were rinsed with Ca/Mg- free phosphate-buffered saline (PBS) (GIBCO), incubated for 1 hour at 25°C with 50 pL of test supernant, washed three times for IO minutes with PBS, blocked again for 10 minutes, incubated with 50 pL of a 112,000 dilution of peroxidase conjugated goat anti-mouse IgG (BMB; Boehringer Mannheim Corp, Indianapolis, IN) in blocking solution for 30 minutes washed again three times for 10 minutes with PBS, and 100 pL of ABTS substrate was added to each well. Color development was measured on a Titer Tek Multiscan plate reader (Flow Laboratories Inc, McLean, VA) at 405 nm. Hybridomas from positive wells were cloned by limiting dilution in complete HY without azaserine, and supernatants were retested by ELISA as described above.

Glycine cryopre- cipitation was modified for the production of factor VI11 concentrate from mouse plasma.” Mouse blood was obtained via cardiac punc- ture and collected in 0.16 moln sodium citrate at a final ratio of 1: I O (anticoagu1ant:blood). Plasma was frozen at -80°C overnight and warmed to 0°C in an ice bath. One milliliter of mouse plasma was centrifuged at 7.0001: for 20 minutes at 0°C the precipitate was washed with 300 pL ice-cold 0.02 mol/L Tris-HCI, pH 7.0, and recentrifuged at 7 ,000~ for 20 minutes. The precipitate was then redissolved in 30 pL of 0.02 molL Tris-HCI buffer, pH 7.0 at 20°C. then 75 pL of 2.8 mol/L glycine buffer (2.8 mom glycinel0.3 mol/ L sodium chloride 0.025 molL Tris, pH 6.8) was added and the suspension was held at 20°C for 30 minutes before centrifugation at 7.0008 for I O minutes to remove the precipitate. Twelve to eighteen microliters of supernatant containing mouse factor VI11 was used for Western blotting.

Western blot was performed on human recombi- nant factor VI11 and mouse cryoprecipitated factor VIII. Samples

Production of factor VI11 MoAbs.

\.

Enzyme-linked immunosorbenr assay (ELISA) screen.

PuriJcation of factor VI11 from mouse plasma.

Western blot.

only.For personal use at University of Pennsylvania Library on January 23, 2009. www.bloodjournal.orgFrom

3448 BI ET AL

were electrophoresed on 8% polyacrylamide gel electrophoresis (PAGE) gels and transferred to nitrocellulose membranes. Filters were then blocked in 5% dry miI!dO.OS% Tween20/1X PBS, and washed three times in 0.058 Tween-ZO/lx, PBS for 5 minutes at 20°C. Filters were then incubated with cell culture supernants containing anti-mouse factor VI11 MoAbs for 1 hour at 2 0 T , and washed as above. Peroxidase conjugated with goat anti-mouse IgG (Boehringer Mannheim, Indianapolis. IN) was diluted 1:1,000 in S 8 dry milWlx PBS and used for secondary incubation for 1 hour at 20°C. After the final wash, the signals were detected by ECL (Amersham. Arlington Heights, IL).''

RESULTS

Affected mice how n mild phenotype. The oldest factor VIII-deficient mice are now about 1 year old, and they are healthy without spontaneous bleeding, illness, or reduction in activity. The only disease phenotype observed has been excessive bleeding after tail snipping. Roughly 2/3 of af- fected males die within 2 hours of tail snipping, whereas all wild-type and carrier mice survive without difficulty. Female carriers were bred with affected males of the F2 generation to produce factor VI11-deficient females in the F3 generation. Further breeding of these deficient females with affected males produced litters in which 100% of the animals have factor VI11 deficiency. Three factor VIII-deficient females have been bred with affected males. All three survived preg- nancy and delivery, and had litters of 3 to 5 pups. All new- born mice of these litters had defective factor VI11 genes as determined by PCR of genomic DNA isolated from the tail

b

Fig 2. Aberrant processing of factor Vlll mRNA in affected mice. (A) RT-PCR in exon 16 knockout, normal, and exon 17 knockout mice is shown for exon 26, exon 15 t o exon 18, exon 14, and the neo cassette to exon 17. RT-PCR of exon 26 at the 3' end of factor Vlll mRNA (P-26a and P-26bl amplified a 500-bp fragment in normal and affected mice based on the size of the PCR product. (Although ampli- fication in affected mice appears reduced in this experiment, in multi- ple other experiments the amount of 500-bp product in affected mice was similar to that in normal mice.) RT-PCR across the knockout exons (MC-15 and MC-18) amplified two smaller fragments (450 bp and 400 bp) in exon 17-affected mice but no product in exon 16- affected mice. RT-PCR of exon 14 (P-14a and P-14b) showed a 600- bp fragment from normal and exon 17-affected mice but no product from exon 16-affected mice. Finally RT-PCR from neo sequence to the 3' end of exon 17 IR-neo and MC-17) amplified a 200-bp fragment in exon 16-affected mice but no product in normal and exon 17- affected mice. Ampliied products were electrophoresed on a 1% agarose, 2% Nusieve gel. (Bl Schematic of RNA processing in factor VIII-deficient mice. The RT-PCR fragments were subcloned into the pCR II vector using the TA cloning kit from Invitrogen. Plasmid DNA was then sequenced and the splice sites were determined by compar- ison with the mouse cDNA sequence. In exon 16 knockout mice, the donor site in intron 16 has been deleted with the insertion of the neo gene. Essentially all of the factor Vlll RNA of this strain contains the neo sequence plus 17 bp of intron 16 due t o use of a cryptic donor site in intron 16. No RT-PCR amplification of exon 14 sequences is seen in these mice because reverse transcription through the neo cassette sequence in the RNA is very inefficient. In exon 17 knockout mice, the neo cassette was inserted into the exon. All factor Vlll mRNA of this strain lacks exon 17 and neo cassette sequences. Two donor sites are used in the skipping of exon 17: the intron 16 donor site and another donor site which is 46 bp from the 3' end of exon 16.

snips and less than 1% factor VI11 activity by COATEST assay.

Using an RT- PCR assay of total liver RNA, exon 26 was present in liver RNA in both exon I6 and exon 17 knockout mice. Although transcription initiated from the B promoter located in intron 22'" is not ruled out, the data suggest that factor VI11 mRNA in these mice is stable (Fig 2A). While the amount of exon 14 (an exon 5' to the neo cassette insertions) appeared normal in exon 17 knockout mice, no RT-PCR product derived from exon 14 was observed in exon 16 knockout mice. When primers crossing the neo insertions were used, two amplified fragments in exon 17 knockout mice were found and they were smaller than those of normal mice. In this PCR, no amplified fragments were seen in exon 16 knockout mice (Fig 2A). PCR using primers from the neo cassette to exon 17 gave a 200-bp product in exon 16 knockout mice, but no PCR product in exon 17 knockout mice. All of these results can be explained if ( I ) neo cassette sequences are difficult

FVIII mRNA processing in deficient mice.

B Normal 15 16 1 7 1 8

1 8 E-1 6

1 6 1 7 lneo

E-1 7 . .

17 bD Knockout 1 5 1 6 1 7 1 8

only.For personal use at University of Pennsylvania Library on January 23, 2009. www.bloodjournal.orgFrom

RNA AND PROTEIN STUDIES IN MURINE HEMOPHILIA 3449

to reverse transcribe and amplify by PCR with our primers because of their high G + C content (64%) and (2) neo cassette sequences remain in transcripts of exon 16 knockout mice but are deleted from transcripts of exon 17 knockout mice. To determine the structure of the various transcripts, RT-PCR fragments were then subcloned, sequenced, and the splice sites were compared with mouse cDNA sequence. In exon 16 knockout mice, the donor site in intron 16 was deleted during insertion of the neo gene. Essentially all factor VI11 mRNA of this strain contains the neo sequence plus 17 bp of intron 16 due to use of a cryptic donor site in intron 16 (ATGETAAGC) (Fig 2B). In exon 17 knockout mice, the neo cassette was inserted into the exon. All factor VI11 mRNA of this strain lacks both exon 17 and neo cassette sequences. Two donor sites are used in the skipping of exon 17; the intron 16 donor site and a cryptic donor site 46 bp from the 3' end of exon 16 (AAGKTCT") (Fig 2B).

Production of MoAbs that react to mouse factor VIII. We decided to produce antibodies to mouse factor VI11 be- cause no commercial antibody is available that cross-reacts with mouse factor VI11 and we needed a means to measure small amounts of mouse factor VI11 protein. Human recom- binant factor VI11 was used as an antigen in deficient mice to generate MoAbs against mouse factor VIII. The rationale for using human factor VI11 injections into deficient mice was that all epitopes of human factor VI11 would be recog- nized as foreign, and some epitopes would be shared between human and mouse factor VIII. The shared epitopes should stimulate production of antibody that cross-reacts with mouse factor VIII.

The two exon 16 knockout mice that were immunized by human recombinant factor VIII both died of anaphylaxis after the third injection indicating a strong immune response to human recombinant factor VIII. We were fortunate to have Sp2 myelomas in culture, and used them for a fusion with splenocytes from the two immunized mice. Hybridoma cell lines were grown and the supemants containing antibod- ies were tested for the presence of anti-human factor VI11 by ELISA. Sixty-six positive cell lines were obtained. These 66 lines were then assayed by Western blot for their ability to detect factor VI11 in cryoprecipitated plasma of normal mice. Two of these anti-human factor VI11 antibodies cross- reacted with mouse factor VI11 light chain. Of these MoAbs, one was identified as an IgM while the other was an IgG1.

Factor VI11 light chain is undetectable in knockout mice. Figure 3 shows the factor VI11 protein levels in normal mice, female carriers, and the factor VIII-deficient mice as deter- mined by Western blot using anti-mouse factor VI11 IgGI. Factor VI11 was cryoprecipitated from the plasma of normal mice, carrier females, and the two knockout strains. Cryopre- cipitate derived from 100 pL of plasma was loaded in each lane. Factor VI11 light chain was undetectable in the plasma of either factor VI11 knockout strain (Fig 3). When cryopre- cipitate from normal plasma was diluted with cryoprecipitate from deficient plasma, the factor VI11 in a 10% normal:90% deficient sample was easily detected, indicating that this pro- cedure should detect factor VI11 protein in I O pL of normal mouse plasma or 20 pL of whole blood (data not shown). Because 200 pL of whole blood is readily obtained by tail

Fig 3. Factor Vlll light chain is absent in the plasma of affected mice. Western blot using anti-mouse factor Vlll lGgl detected no factor Vlll light chain (70 kD) in either of the factor Vlll knockout strains. Mouse factor Vlll was cryoprecipitated from plasma of nor- mal mice and the two knockout strains. Factor Vlll antigen levels in carrier females are indistinguishable from normal.

snipping, this protein assay should be useful in the detection of factor VI11 after gene correction.

DISCUSSION

The lack of spontaneous bleeding coupled with long-term survival of factor VI11 knockout mice implies that the pheno- type of severe factor VI11 deficiency in mice is significantly milder than in human beings. The fact that affected female mice are able to proceed normally through pregnancy and delivery suggests that mice do not require factor VI11 to prevent bleeding after delivery. It also suggests that there may be either an alternative to the use of factor VI11 as a cofactor of factor IX or an alternative pathway which pro- motes clotting in the absence of factor VI11 except in extreme situations, such as a snipped tail. Because mice without fac- tor VI11 are healthy, we are able to produce a line of hemo- philic mice and dispense with the need to genotype the pups. Additionally, the ability to produce a factor VIII-deficient line of mice should be quite useful for gene correction stud- ies, providing more test animals per breeding.

The mRNA processing events observed in the knockout strains indicate that factor VI11 deficiency is due to truncated protein in exon 16 knockout mice and to both truncated protein and deleted protein in exon 17 knockout mice. In exon 16 knockout mice, translation of the RNA containing a neo cassette leads to nonsense codons in the neo cassette sequence. In exon 17 knockout mice, translation of the two RNAs lacking exon 17 sequences leads to frameshifting in the case of the RNA with simple skipping of exon 17, and

only.For personal use at University of Pennsylvania Library on January 23, 2009. www.bloodjournal.orgFrom

3450 El ET AL

deletion of exon 17-encoded amino acids with addition of 16 new amino acids in the case of the RNA formed by use of the cryptic donor site in intron 16. In humans and mice, exons 16 and 17 encode a portion of the A3 domain that is at the NH,-terminal end of the light chain. Thus, factor VI11 heavy chain is probably made in the knockout mice, but its stability is unknown.

By Western blot, both anti-mouse factor VI11 antibodies recognize a protein of 70 kD, the molecular weight of the factor VIII light chain. It is interesting that so few anti- human factor VI11 antibodies crossreacted with mouse factor VI11 (only 2 of 66). However, extensive further screening of the antibodies produced by the hybridoma cell lines with cryoprecipitated mouse plasma would probably show other MoAbs not detected by the initial screening. In any case the small fraction of cross-reacting antibodies suggests that an important immunogenic epitope of the human protein is not conserved in mouse factor VIII. As discussed above, factor VI11 heavy chain could be produced in both knockout strains. Whether this truncated form of factor VI11 is stable is un- known. Since our two antibodies to mouse factor VI11 react to the light chain of the protein, we do not know whether truncated factor VI11 exists either in the plasma or within hepatocytes of affected mice. To answer this question, we have expressed various portions of the mouse cDNA con- taining an epitope tag in Escherichia coli (R. Sarkar, personal communication, January 1996). Regions of the heavy chain will be used as immunogens to produce new MoAbs in factor VIII-deficient mice. In any case, our ability to detect small amounts of intact factor VI11 in mouse plasma after simple cryoprecipitation will be a boon to gene correction studies in which mouse factor VI11 cDNA is used.

ACKNOWLEDGMENT

We thank Leon Hoyer for review of the manuscript and Drs Katherine High and Nathan Hagstrom for technical advice.

REFERENCES 1. Toole JJ, Knopf JL, Wozney JM, Sultzman LA, Buecker JL,

Pittman DD, Kaufman RJ, Brown E, Shoemaker C, Om EC, Amphlett GW, Foster B, Coe ML, Knuston GL, Fass DN, Hewick RM: Molecular cloning of a cDNA encoding human antihaemophilic factor. Nature 312:342, 1984

2. Gitschier J, Wood WI, Goralka TM, Wion KL, Chen EY, Eaton

DH, Vehar GA, Capon DJ, Lawn RM: Characterization of the human factor VI11 gene. Nature 312:326, 1984

3. Wood WI, Capon DJ, Simonsen CC, Eaton DL, Gitschier J, Keyt B, Seeburg PH, Smith DH, Hollingshead P, Wion KL, Delwart E, Tuddenham EGD, Vehar GA, Lawn RM: Expression of active human factor VI11 from recombinant DNA clones. Nature 312:330, 1984

4. Kaufman RJ, Wasley LC, Domer AJ: Synthesis, processing, and secretion of recombinant human factor VI11 expressed in mam- malian cells. J Biol Chem 263:6352, 1988

5. Lakich D, Kazazian HH Jr, Antonarakis SE, Gitschier J: Inver- sion disrupting the factor VI11 gene are a common cause of severe hemophilia A. Nature Genet 5:236, 1993

6. Hoeben RC, Fallaux FJ, Van Tilburg NH, Cramer SJ, Van Ormondt H, Briet E, Van Dereb AJ: Toward gene therapy for hemo- philia A: long-term persistence of factor VIII-secreting fibroblasts after transplantation into immunodeficient mice. Human Gene Ther 4:179, 1993

7. Kay MA, Rothenberg S, Landen CN, Bellinger DA, Leland F, Toman 0, Finegold M, Thompson AR, Read MS, Brinkhaus KM, Woo, SLC: In vivo gene therapy of hemophilia B: Sustained partial correction in factor IX-deficient dogs. Science 262:117, 1993

8. Bi L, Lawler AM, Antonarakis SE, High KA, Gearhart JD, Kazazian HH Jr: Targeted disruption of the mouse factor VI11 gene produces a model of haemophilia A. Nature Genet 10:119, 1995

9. Rosh S: Assay of factor VII1:C with a chromogenic substrate. Scand J Haemotol 40:139, 1984 (suppl 33)

IO. Chomczymski P, Sacchi N: Single-step method of RNA isola- tion by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156, 1987

11. Akowitz A, Manuelidis L: A novel cDNA/PCR strategy for efficient cloning of small amounts of undefined RNA. Gene 81:295, 1989

12. Kawasaki ES, Clark SS, Coyne MY, Smith SD, Champlin R, Witte ON, McCormick FP: Diagnosis of chronic myeloid and acute lymphocytic leukemias by detection of leukemia-specific mRNA sequences amplified in vitro. Proc Natl Acad Sci USA 85:5698, 1988

13. Lane R, Crissman R, Ginn S: High efficiency fusion proce- dure for producing monoclonal antibodies against weak immuno- gens. Methods Enzymol 121:183, 1986

14. Harlow ED Lane D: Antibodies, A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1988

15. Brodniewicz-Proba T, Beauregard D: Modified glycine pre- cipitation technique for the preparation of factor VI11 concentrate of high purity and high stability. Vox Sang 52:10, 1987

16. Levinson B, Kenwrick S, Game1 P, Fisher K, Gitschier J: Evidence for a third transcript from the human factor VI11 gene. Genomics 14:585, 1992

only.For personal use at University of Pennsylvania Library on January 23, 2009. www.bloodjournal.orgFrom