JS 111: Introduction to Genetics and DNAThe Scientific Basis of DNA Typing

I. Pre class activitiesa. Quizb. Assignment and announcements

II. Learning Objectives

a. Understand why scientists study DNA.b. Introduction to Basic Genetics- Heredity

Be able to define: cell, nucleus, chromosome, genetic linkage, alleles, homozygous vs heterozygous, independent segregation and random assortmentBe able to draw a Punnett Square to illustrate allele inheritance

c. Introduction to DNA a. Understand the Basic Facts and Function of

DNAb. Be able to draw DNA structure – Base

Pairing AT, GCc. Understand DNA replication

d. Overview of Methods Used to study DNA a. Screening, Extraction, Quantification,

Typing RFLP v PCR, Interpretation

Assignments and Announcements

• See handout

• Study for exam 1

Who Cares? • Law Enforcement

– Criminal Investigation- Casework, Databanks

– Reuniting immigrant families- Paternity

– Missing persons

• Evolutionary, Agricultural and Zoological applications

– Assessing genetic diversity

– Fingerprinting endangered species and pathogens

– Assessing unrelatedness to breed for increasing genetic diversity

– Assessing relationships for all biological predictions

– Ancient DNA analyses for reconstructing history (how we populated the globe)

• Other Human Applications

– Making sense of the Human Genome project results- Bioinformatics

– Developing rapid medical diagnostics such as those associated with triplet repeat diseases (STRs)- (Moxon et al. 1999 Sci Amer. 280:94)

– Understanding the molecular basis of development, disease and aging

– Screening candidates for bone marrow/organ transplants and grafts

WE ALL DO!

Steps in Forensic DNA typing(Figure 6.1 Rudin and Inman 2001)Evaluation- Is it there?

1. Start with biological sample

2. Screen- blood? Semen? Saliva, human?Extraction- Get and clean DNA3. Open cells Get DNA

4. Methods to get DNA and purify DNA

Quantify- Determine quality and quantity?

5. Quantify- How good and how much did you get?

Type to determine and compare alleles 6. RFLP vs PCR

7. Determine alleles and compare DNA typesOr alleles present in samples and references

Interpretation of Results

DNA Facts and Jargon

Where is it? How is it stored?

DNA is found in every *cell= basic unit of life

Inside nuclei (organization center for the cell) and mitochondria (ATP powerhouse of the cell) & chloroplasts for plants- (making our food via photosynthesis)Nuclei are not found in red blood cellsIn white blood cells, saliva, skin, hair fingernails, urine, feces, vomitus, earwax etc.

Target Region for PCRTarget Region for PCR

chromosome

cell nucleus

Double stranded DNA molecule

Individual nucleotides

DNA in the CellIn nuclei, mitochondria and chloroplasts (plants) organized in

chromosomes (wound around histones)“DNA double bagging”

I. Intro to DNA : Facts and Jargon 

DNA: Deoxyribonucleic acid 

Different in every *individual 

The same in every **cell of an individual's body 

*except for identical twins that have the same DNA - "The time honored method of cloning humans"

** diseased individuals may be mosaics

DNA functionWhat’s it do?

DeoxyriboNucleic Acid : blueprints of life

Replication, Information Storage and Mutation

Central Dogma

information flow--------------->

DNA------->RNA------>protein

transcription translation

htt

p:/

/ww

w.n

cbi.n

lm.n

ih.g

ov/

ge

no

me

/gu

ide

/

1 2 3 4 5 6 7 8 9 10 11 12

13 14 15 16 17 18 19 20 21 22 X Y

DNA Organization and InheritanceHuman Genome Contains 23 Pairs of Chromosomes

It is inherited from your mom and dad

Sex-chromosomes

Basic Chromosome Structureand Nomenclature

p(short arm)

centromere

telomere

q(long arm)

telomere

Band 5

Band 3

Chromosome 12

12p312p3

12q512q5

Chromosome 12P= short arm

Q= long arm

Center= Centromere (involved in mitosis and meiosis attachment to spindle fibers)

End= Telomere (involved in aging)

D12S459D= DNA

12= Chromosome 12

S=Single copy sequence

459= 459th locus described on C12

Definitions of Locus and Allele• 2 pairs of Homologous

chromosomes (white from dad, dark from mom)

• Locus (singular) or Loci (plural) are defined locations where specific genes or markers are found

• Alleles are different forms of the same gene or marker

• When alleles have the same form on a locus they are said to be homozygous. When different they are heterozygous

Where’s Daddy?PCR product size (bp)

11 14

11

12 14

8 14

12

128

L ee fam ily p ed ig reeH a ir co lo rD = D ark

d = b lon d e

Ju lie S teve

G ab rie l S ie rra

S ie rra F u tu re m ate

g ran d k id 1 g ran d k id 2

Name Genotype Gametes possibleSteve D,D DJulie d,d d

•D

•D

• d d

•Dd Dd

•Dd Dd

Review- Mendelian GeneticsLaw of Independent Segregation-

Big D and little d will evenly segregate into the next generationAnd results in equal inheritance from mom and dad

Punnett Square

Inheritance Review

Dad is homozygous (A, A) and mom is heterozygous (A, a).

In your teams, draw the Punnett Sqaure that demonstrates the inheritance of these alleles.

What percentage of their children will be heterozygous?

Review- Mendelian GeneticsLaw of Random Assortment

• This law states that markers on different chromosomes are generally inherited independently of one another and are not inherited together more often than might be expected by chance.

• Those displaying random assortment are said to be in linkage equilibrium.

• Those that show genetic linkage such as those located close together on the same chromosome are said to be in linkage disequilibrium and are found more often together than expected by chance. Example is blonde hair and blue eyes.

• Markers that are in linkage equilibrium are desirable for forensic DNA. The product rule can be applied to those displaying random assortment thus resulting in a higher power of discrimination than those that are linked.

DNA StructureWhat is it?

Bases (AGCT) form the stairs of the ladder, are faithfully paired and exhibit differences.

PS-A : T-SP PS-G : C-SP PS-A : T-SP PS-G : C-S P

 Sugars (S) and phosphates (P) form the sides of the ladder (identical for all DNA).

Bases (AGCT) form the stairs of the ladder, are faithfully paired by hydrogen bonds and exhibit differences. A : T and G : C

A = T

G C

T = A

A = T

C G

T

C

C

A

G

G

T

A

G C

T = A

T = A

C G

A = T

A = TG C

5’

3’

3’

5’ 3’

3’ 5’denatured

strands

hybridizedstrands

Hydrogen bonds

C G C

G

G C

Phosphate-sugar backbone

DNA Structure

• Primary genetic material is composed of two complementary strands

• Form a double helix or twisted ladder

• Sides are sugar phosphate and the steps are base pairs

• Four Bases- 2 Purines – Adenine and Guanine and 2 Pyrimidines- Cytosine and Thymine

• Asian Guys are Pure!

DNA StructureNucleotides are the building blocks themselves

composed of PBS

Nucleotides-PBSPhosphate (negative charge) Base (AGCT-Asian Guys Can Teach)Sugar (deoxyribose-5C)

Phosphate-SugarsConnected by phosphodiester linkages

Basic Components of Nucleic Acids

5’end|

Phosphate|

Sugar—Base…|

Phosphate|

Sugar—Base…|

3’end

O

Base(A, T, C, or G)

HO

1’

3’ 2’

4’

5’CH2OP

H

HH

H

O

O-

HO

O

Base(A, T, C, or G)

HOH

1’

3’ 2’

4’

5’CH2OP

H

HH

H

O-

HO

PhosphatePhosphate

SugarSugar

BaseBase

DNA Structure2 Complimentary,

Antiparallel Strands held together by Base Pairs- H Bonds

A:T held with 2 H Bonds G:C held with 3 H Bonds.

PCR based systems are rapid, require less material than RFLP

and less time for typing• Molecular xeroxing

• Calvin and Hobbes example

Polymerase Chain Reaction: PCR is simply repeated rounds of DNA replication

Replication of DNA is Semi ConservativeOne old and one new

http://dir.niehs.nih.gov/dirlmg/repl.html

Enzymes of Replication

DNA is replicated or copied in our cells. When completed, the new double strands consist of one old template and one newly made strand- This is called semi conservative replication.

There are many enzymes that are required. They include unwinding (helicases, gyrases), priming (primases), copying (DNA polymerases) and touch up enzymes (DNA ligases).

O

Base(A, T, C, or G)

HO

1’

3’ 2’

4’

5’CH2OP

H

HH

H

O

O-

HO

O

Base(A, T, C, or G)

HOH

1’

3’ 2’

4’

5’CH2OP

H

HH

H

O-

HO

P-P-

OH

dNTP

3-OH’

5-P’

Template = Old

Primer5-P’

3-OH’

DNA polymerase

Mg++

DNA Replication •5 required ingredients (components)- primer, template, Mg, dntps, DNA polymerase- PTMDD-(please to make DNA doubled)

•DNA Polymerase catalyzes the template directed (A-T, G-C), incorporation of dNTPs (PP is released) forming a 3’-5’ phosphodiester linkage

• Direction of synthesis 5’3’ using primer 3’OH to attach incoming nucleotide

DNA St. Patricks Day Salute to the Molecule of HeredityFrom Biology 110- UNC 1993 Steve Lee

The molecular structure today Is heredity’s DNAWith nucleotides completely comprised of a sugar and phosphate and base

The bases you see are so keenThey include thymine and adenineCytosine and one more with guanine can store all the info with rungs in between

The sides of the ladder you know,are sugar and phosphate which showthat Franklin was rightdouble helix is tightten base pairs per turn in a row

Adenine and thymine can base pairForming two hydrogen bonds for one stairCytosine and guaninepair with three in betweenand are equal in size when compared

DNA strands are just not the sameOne is coding and one is called lame (anticoding)They are opposite in direction and thisis called antiparallel in name

Complimentary nature of strandslets replication proceed just as plannedwith A paring to Tand G pairing to Cthe fidelity is precise and quite grand

Steps in Forensic DNA typing(Figure 6.1 Rudin and Inman 2001)Evaluation- Is it there?

1. Start with biological sample

2. Screen- blood? Semen? Saliva, human?Extraction- Get and clean DNA3. Open cells Get DNA

4. Methods to get DNA and purify DNA

Quantify- Determine quality and quantity?

5. Quantify- How good and how much did you get?

Type to determine and compare alleles 6. RFLP vs PCR

7. Determine alleles and compare DNA typesOr alleles present in samples and references

Interpretation of Results

Review: DNA is organized inside the cell nucleus and mitochondria

DNA Extraction

After screening tests are performed, a spot of the material containing the biological sample is cut and placed into a tube.

In one type of extraction method (organic), heat and chemicals are added, and protein is removed. Then the pure DNA is recovered by filtration in which the non-DNA material goes through a sieve.(analogous to a collection of your pasta in a colander)

Different DNA Extraction Methods

The organic method generally yields the highest quantity and quality DNA. The main disadvantages are that it is tedious with lots of steps and utilizes corrosive chemicals.The Chelex method is used when the sample contains very few cells and the reduced number of handling steps is the primary advantage. The main disadvantage is that it is yields crude DNA that is not as pureFTA paper is used to collect reference samples. It can be stored at room temperature, requires minimal handling and no quantification is required.

Differential Extraction MethodFor Sexual Assault Evidence

• Isolation of DNA from mixtures of cells in sexual assault evidence

• Based on differences in cell membranes

– Spermatozoa membranes have special cross links (sulphur-sulphur bonds)

– These membranes are quite resistant to opening.

– Vaginal epithelial cells do not contain these membranes and are more easily broken open

Sperm and v cellmixture

Lysis- openv cell extractFemale DNA

Female DNA

Male DNA

Femalecell

Spermatozoa

Lysis- open

sperm extract

Male DNA

Quantification of DNA

• Following extraction, the next step is to determine the quantity of the DNA

• DNA typing methods RFLP and PCR require different amounts and different quality of DNA.

• RFLP typically required 50ng. PCR typically requires less than 0.5ng to 1 ng: 100 times less!

Quantification of DNA using Gel Electrophoresis

• Total DNA can be quantified by running the samples in a gel.

• Typically, gels are made up of agarose (a carbohydrate from seaweed).

• Known DNA quantities are included• Samples are then subject to an electric

current and is called electrophoresis.• DNA is negatively charged and will

migrate toward the positive electrode… • Comparisons of the results are done

visually or with computer software to determine the amount of DNA in the unknown sample.

(-)

(+)

wells

IntactDNA

Degraded

DNA

L K K – u u u

Direction of DNA fragment movementSmaller fragments move faster and are foundNear the bottom of the gel

Slot Blot quantification : DNA-DNA Hybridization

DNA is where it’s AT

• DNA samples may contain non human DNA

• In order to quantify the amount of human DNA in a sample, a human specific test is required

• One such test is DNA-DNA hybridization using a human specific probe: D17Z1

Slot blot hybridization• Like in yield gels, known amounts of DNA (human) are

included

• DNA hybridization of D17Z1 will occur only if the sample contains human DNA

• Detection of the hybridized fragments is done using an enzyme linked assay- yielding light or color

Real Time PCR

Quantitative PCR- QPCRhttp://pathmicro.med.sc.edu/RTPCR/rt-pcr.ppt

• Real-time QPCR has several advantages over the other methods in that it is extremely accurate and sensitive over a broad dynamic range, and it occurs in a closed-tube system, reducing the potential for carryover contamination.

• Using this technique, a forensic biologist can monitor and quantify the accumulation of PCR products during log phase amplification. (Heid et al., 1996).

• Several RT PCR human specific assays are now available that target autosomal, Alu repeats, Y chromosome and mtDNA (Andréasson et al. 2002, Nicklas et al. 2003, Green et al. 2005, Andréasson et al. 2006, Horsman et al. 2006).

• The assays may be performed on single targets or in multiplexes (Timken et al. 2005, Walker et al. 2005, Nicklas et al. 2006).

• Recently, the detection of degraded vs intact human DNA and PCR inhibitors has been reported (Swango et al. 2006).

RNA based quantification methods• Different genetic expression patterns (mRNAs) exist in different

tissue types. • Body fluid identification has been reported based on their mRNA

profiles (Juusola and Ballantyne 2003 and 2005, Nussbaumer et al. 2006)

• In addition, the age of a bloodstain was reported using analysis of mRNA: rRNA ratios (Anderson et al. 2005). This information may be useful in establishing the time of the crime.

• Advantages of the mRNA-based approach, versus the conventional biochemical tests, include greater specificity, simultaneous and semi-automatic analysis, rapid detection, decreased sample consumption and compatibility with DNA extraction methodologies.

• The quantification of the amounts of the mRNA species relative to housekeeping genes is a critical aspect of the assays (Juusola and Ballantyne 2003).

Comparison of Methods used for DNA Quantification

Method Ease Cost Sensitivity Result

UV Spectrophotometry +++++ + ++ Total DNA

Yield Gel electrophoresis +++ + + Int vs deg DNA

Slot Blot ++ ++ +++ Human DNA

Yield Gel blot + ++ +++ Int. vs. deg human DNA Pico-green microtitre plate ++++ ++ ++++ Total DNA

Alu Quant +++ +++ ++++ Human DNA

Real time PCR assays +++ +++ +++++ Human DNA

Real time PCR assays +++ +++ +++++ Int.vs. deg.Human DNA

Summary 1 (from last week)•Why study DNA

– Law enforcement, evolution, agricultural, and human applications-medical diagnostics

•DNA Biology and Genetics– DNA is contained in cells –the basic unit of life– Found in nuclei, mitochondria and chloroplasts– Organized in chromosomes. Located at positions called loci and come in different

forms or alleles. – Homozygous if the same, heterozygous if different– Alleles segregate independently and assort randomly when on different

chromosomes. Random assortment is desired for forensic DNA loci.

• DNA Function and Structure– DeoxyriboNucleic Acid : blueprints of life

Replication, Information storage and mutation RIM– Central Dogma

DNA------->RNA------>proteintranscription translation

Summary 2• DNA Structure and Function continued:

– Bases are Adenine, Guanine, Cytosine and Thymine- Asian Guys Can Teach: AGCT– Base pairing is A to T and G to C- DNA is where its AT– Sequence of Bases Store information- Like the sequence of numbers in a Phone Number– Sides of the ladder are Sugar-Phosphate backbones– Nucleotides are the building blocks (dNTPs) themselves made of phosphate base and sugar= PBS-

The only station Sierra and Gabriel can watch– DNA base pairs- DNA velcro (David Letterman

• DNA Replication – Semi-conservative- Half republican (old) /half democrat (new)– Template directed with base pairing (AT, GC)– 5 required ingredients of PCR - primer, template, Mg, dntps, DNA

polymerase (PTMDD)

Summary 3

• Steps in forensic DNA typing are – Evaluation, Extraction, Quantification, Typing and Interpretation– 1) Evaluation- Is it there? Screen- blood? Semen?

Saliva, human?

– 2) Extraction- Get and clean DNA• Open cells -Get DNA

– 3) Quantify- Determine quality and quantity?• How good and how much did you get?

• Yield Gels, Slot Blots, Real time qPCR assays

Case #2: Can you extract and type DNA from fingerprint powder that has been used to develop latent prints? If so, design an experiment with + and – controls to support your hypothesis.

RFLP- Rudin and Inman

DNA Methods 1) Extract2) Quantitate3) Distinguish

SizeContent

 RFLP : Restriction Fragment Length PolymorphismsPCR: Polymerase Chain Reaction  RFLP methods require large amounts of undegraded DNA and the process takes 1-2 weeks. PCR methods require only small amounts of DNA, are useful on degraded DNA and require much less time (as little as 1-2 days in some cases).

• The base sequence can exhibit differences in length and content between individuals.Christina Aguilera ... AAAGAAAGAAGAAAC... Lady Gaga ... AAAGAAAGAAGA...The Suburbs ... AAAGAAAGAAGT...Lady Antibellum ... AAAGAAAGAAGA...Esperanza Spalding ... AAAGAAAGAA...Eminem ... AAAGAAAGA...Train ... AAAGAAAGC...Norah Jones ... AAAGAAAGT...Boyz to Men ... AAAGAAAG…

• Although different between individuals* DNA is identical in every cell of an individuals body** Some exceptions*identical twins**diseased individuals, mtDNA (sport analogs)

Restriction Fragment Length Polymorphisms (RFLP)

LA ...GGCCAAAGAAAGAAAGGCC... 15

CA ...GGCCAAAGAAACGGCC... 12

SL ...GGCCAAAGAATGGCC... 11

1) Cut DNA with Restriction Enzymes that

recognize specific sequences : GGCC.

2) Separate the many fragments produced by gel

electrophoresis. The fragments represent a wide range of sizes.

3) Blot and probe the fragments with specific

DNA sequences that base pair only with

those that contain the sequence of interest.

GGTTTCTT : Probe

LA CA SL M M

RFLP Gel Electrophoresis separates fragments by size DNA Probe base pairs with specific fragments

BIG

Small

RFLP Spencer

Characteristic RFLP Methods PCR Methods

Time required to obtain results

6-8 weeks with radioactive probes; ~1 week with chemiluminescent probes

1-2 days

Amount of DNA needed 50-500 ng 0.1-1 ng

Condition of DNA needed high molecular weight, intact DNA

may be highly degraded

Capable of handling sample mixtures

Yes (single locus probes)

Yes

Allele identification Binning required Discrete alleles obtained

Power of Discrimination ~1 in 1 billion with 6 loci ~1 in 1 billion with 8-13 loci (requires more loci)

Comparison of RFLP and PCR

Relative power of tests

• Test type time power• RFLP-VNTR weeks +++ *• PCR:• DQAlpha- macroarray 1 day +• PM - macroarray 1 day ++• D1S80 - gel- VNTR 2 days ++• STRs -gel,CE, arrays 2 days +++• mtDNA- gel, CE, arrays 2 days +• alu -gel, CE, arrays 2 days ++

• * not useful on degraded DNA

Summary 1•Why study DNA

– Law enforcement, evolution, agricultural, and human applications-medical diagnostics

•DNA Biology and Genetics– DNA is contained in cells –the basic unit of life– Found in nuclei, mitochondria and chloroplasts– Organized in chromosomes. Located at positions called loci and come in different

forms or alleles. – Homozygous if the same, heterozygous if different– Alleles segregate independently and assort randomly when on different

chromosomes. Random assortment is desired for forensic DNA loci.

• DNA Function and Structure– DeoxyriboNucleic Acid : blueprints of life

Replication, Information storage and mutation RIM– Central Dogma

DNA------->RNA------>proteintranscription translation

Summary 2• DNA Structure and Function continued:

– Bases of DNA are Adenine, Guanine, Cytosine and Thymine- Asian Guys Can Teach: AGCT

– Base pairing is A to T and G to C- DNA is where its AT– Sequence of Bases Store information- Like the sequence of numbers in a Phone Number– Nucleotides are the building blocks (dNTPs) themselves made of phosphate base and

sugar= PBS- The only station Sierra and Gabriel can watch– DNA base pairs- DNA velcro (David Letterman

• DNA Replication – Semi-conservative- Half republican (old) /half democrat (new)– Template directed with base pairing (AT, GC)– 5 required ingredients- primer, template, Mg, dntps, DNA

polymerase (PTMDD)

Quantification References• Anderson S, Howard B, Hobbs GR, Bishop CP. (2005) A method for determining the age of a bloodstain. Forensic Sci Int. 2005 Feb 10;148(1):37-45. Links • Andreasson H, Gyllensten U, Allen M. (2002) Real-time DNA quantification of nuclear and mitochondrial DNA in forensic analysis. Biotechniques. 2002 Aug;33(2):402-4, 407-11. • Andreasson H, Nilsson M, Budowle B, Lundberg H, Allen M. (2006) Nuclear and mitochondrial DNA quantification of various forensic materials. Forensic Sci Int. 2006 Jan 18;• Budowle B, Hudlow WR, Lee SB, Klevan L. (2001) Using a CCD camera imaging system as a recording device to quantify human DNA by slot blot hybridization. Biotechniques. 2001 Mar;30(3):680-5. • Butler, J (2005) Forensic DNA Typing: Biology and Technology Behind STR Markers ISBN: 0-12-147952-8, 688pp. Academic Press.• Fox JC, Cave CA, Schumm JW. (2003) Development, characterization, and validation of a sensitive primate-specific quantification assay for forensic analysis. Biotechniques. 2003 Feb;34(2):314-8, 320,

322. Links • Green RL, Roinestad IC, Boland C, Hennessy LK. (2005) Developmental validation of the quantifiler real-time PCR kits for the quantification of human nuclear DNA samples. J Forensic Sci. 2005

Jul;50(4):809-25. • Heid CA, Stevens J, Livak KJ, Williams PM. (1996) Real time quantitative PCR. Genome Res. 1996 Oct;6(10):986-94. • Horsman KM, Hickey JA, Cotton RW, Landers JP, Maddox LO. (2006) Development of a human-specific real-time PCR assay for the simultaneous quantitation of total genomic and male DNA. J

Forensic Sci. 2006 Jul;51(4):758-65. • Jones (2005)- Forensic Science Handbook Saferstein editor Forensic Science Handbook, Volume II, 1/e Richard Saferstein, Bill Bliss, Arlington, VA ©1988 / ISBN: 0133268772• Juusola J, Ballantyne J. (2003) Messenger RNA profiling: a prototype method to supplant conventional methods for body fluid identification. Forensic Sci Int. 2003 Aug 12;135(2):85-96. • Juusola J, Ballantyne J. (2005) Multiplex mRNA profiling for the identification of body fluids. Forensic Sci Int. 2005 Aug 11;152(1):1-12. • Kline, M.C., Duewer, D.L., Redman, J.W., Butler, J.M. (2003) NIST mixed stain study 3: DNA quantitation accuracy and its influence on short tandem repeat multiplex signal intensity. Anal. Chem. 75:

2463-2469.• Kline, M.C., Duewer, D.L., Redman, J.W., Butler, J.M. (2005) Results from the NIST 2004 DNA Quantitation Study. J. Forensic Sci., 50(3): 571-578.• Mandrekar MN, Erickson AM, Kopp K, Krenke BE, Mandrekar PV, Nelson R, Peterson K, Shultz J, Tereba A, Westphal N. (2001) Development of a human DNA quantitation system. Croat Med J. 2001

Jun;42(3):336-9. • Nicklas JA, Buel E. (2003) Development of an Alu-based, QSY 7-labeled primer PCR method for quantitation of human DNA in forensic samples, Journal of Forensic Sciences, Vol 48, No 2, 282-291,

2003. • Nicklas JA, Buel E, (2003) Development of an Alu-based, real-time PCR method for quantitation of human DNA in forensic samples, Journal of Forensic Science, Vol 48, No 5, 936-944, 2003. • Nicklas JA, Buel E, (2003) Quantitation of DNA in Forensic Samples, Analytical and Bioanalytical Chemistry, Vol 376, No. 8, 1160-1167, 2003.• Nicklas JA, Buel E. (2006) Simultaneous determination of total human and male DNA using a duplex real-time PCR assay. J Forensic Sci. 2006 Sep;51(5):1005-15• Nussbaumer C, Gharehbaghi-Schnell E, Korschineck I. (2006) Messenger RNA profiling: a novel method for body fluid identification by real-time PCR. Forensic Sci Int. 2006 Mar 10;157(2-3):181-6.

Epub 2005 Nov 9. • Swango, KL, MD.Timken, M.Date-Chong, MR Buoncristiani (2006) A quantitative PCR assay for the assessment of DNA degradation in forensic samples. Forensic Science International 158:14-26.• Timken MD, Swango KL, Orrego C, Buoncristiani MR (2005) A duplex real-time qPCR assay for the quantification of human nuclear and mitochondrial DNA in forensic samples: Implications for

quantifying DNA in degraded samples. J Forensic Sci. Sep;50(5):1044-1060.• Walker JA, Hedges DJ, Perodeau BP, Landry KE, Stoilova N, Laborde ME, Shewale J, Sinha SK, Batzer MA. (2005) Multiplex polymerase chain reaction for simultaneous quantitation of human nuclear,

mitochondrial, and male Y-chromosome DNA: application in human identification. Anal Biochem. 2005 Feb 1;337(1):89-97. • Walsh, PS, J. Varlaro, and R. Reynolds (1992) A rapid chemiluminescent method for quanititation of human DNA Nucl. Acids Res. 1992 20: 5061-5065.• Waye JS, Presley LA, Budowle B, Shutler GG, Fourney RM. (1989) A simple and sensitive method for quantifying human genomic DNA in forensic specimen extracts. Biotechniques. 1989 Sep;7(8):852-

5. • Singer VL, Jones LJ, Yue ST, Haugland RP. (1997) Characterization of PicoGreen reagent and development of a fluorescence-based solution assay for double-stranded DNA quantitation.Anal Biochem.

1997 Jul 1;249(2):228-38. Links

Steps in Forensic DNA typing(Figure 6.1 Rudin and Inman 2001)Evaluation- Is it there?

1. Start with biological sample

2. Screen- blood? Semen? Saliva, human?Extraction- Get and clean DNA3. Open cells Get DNA

4. Methods to get DNA and purify DNA

Quantify- Determine quality and quantity?

5. Quantify- How good and how much did you get?

Type to determine and compare alleles 6. RFLP vs PCR

7. Determine alleles and compare DNA typesOr alleles present in samples and references

Interpretation of Results

DNA Methods 1) Extract2) Quantitate3) Distinguish

SizeContent

RFLP : Restriction Fragment Length PolymorphismsPCR: Polymerase Chain Reaction  RFLP methods require large amounts of undegraded DNA and the process takes 1-2 weeks. PCR methods require only small amounts of DNA, are useful on degraded DNA and require much less time (as little as 1-2 days in some cases).

RFLP Spencer

Classroom RFLP

• Everyone get a base- Blue=A, Green=G, Yellow=C, Red =T

• Form GGCCAATTCCGGTTAAGATC- hold hands or papers (It is valentine’s day!)

• You are the DNA we will cut and separate on a gel (in the class)

• Set DNA in the ‘well’= front of class• Enzyme role= Cut between GG-CC• Turn on power (electrophoresis). Migrate through the gel

(classroom desks).• Stop when power is off. Observe separation

Kary Mullis Nobel Prize - 1993Kary Mullis Nobel Prize - 1993

PCR based systems are rapid, require less material than RFLP

and less time for typing• Molecular xeroxing

• Calvin and Hobbes example

Polymerase Chain Reaction: PCR is simply repeated rounds of DNA replication

PCR works for very small samples—bloodstain on hat

PCR works for very small samples—hat close-up

PCR works for degraded DNA—under the microscope,

sperm appear intact

But the yield gel shows thattheir DNA is degraded

O

Base(A, T, C, or G)

HO

1’

3’ 2’

4’

5’CH2OP

H

HH

H

O

O-

HO

O

Base(A, T, C, or G)

HOH

1’

3’ 2’

4’

5’CH2OP

H

HH

H

O-

HO

P-P-

OH

dNTP

3-OH’

5-P’

Template = Old

Primer5-P’

3-OH’

DNA polymerase

Mg++

PCR: repeated rounds of DNA Replication •5 required ingredients (components)- primer, template, Mg, dntps, DNA polymerase- PTMDD-(please to make DNA doubled)

•DNA Polymerase catalyzes the template directed (A-T, G-C), incorporation of dNTPs (PP is released) forming a 3’-5’ phosphodiester linkage

• Direction of synthesis 5’3’ using primer 3’OH to attach incoming nucleotide

Make copies (extend primers)

Starting DNA Template

5’

5’

3’

3’

5’

5’

3’

3’

Add primers (anneal) 5’3’

3’5’

Forward primer

Reverse primer

Separate strands

(denature)

5’

5’3’

3’

In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created

In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created

DNA Amplification with the Polymerase Chain Reaction (PCR)

PCR takes place in a Thermal Cycler

Thermal Cycling Temperatures

94 oC

60 oC

72 oC

TimeTemperature

Single Cycle

Typically 25-35 cycles performed during PCR

94 oC 94 oC 94 oC

60 oC60 oC

72 oC72 oC

The denaturation time in the first cycle is lengthened to ~10 minutes when using AmpliTaq Gold to perform a “hot-start” PCR

PCR Process

Separate strands

(denature)

Repeat Cycle, Copying DNA Exponentially

Make copies (extend primers)

Starting DNA Template

5’

5’

3’

3’

Add primers (anneal)5’

5’

5’3’ 3’

3’3’5’

Forward primer

Reverse primer

PCR is simply repeated rounds of DNA replication

Step 1: DenatureSeparate H bonds with heat at 95C

5’ 3’

3’ 5’

Step 2: Anneal Primers bind at lower temp 55C

5’ 3’

3’ 5’

5’ 3’

3’ 5’

Template- DNA from blood etc.

Step 3: Extend

Taq polymerase extends primer 3’OH

at 72C (dNTPs and Mg++)

Step 4: Repeated 28-30 rounds of D, A, E

5’ 3’

3’ 5’

95C

55C

72C5’

3’

3’

5’

Number of Target Molecules Created

1 0 

2 0 

3 2 

4 4 

5 8 

6 16 

7 32 

8 64 

9 128 

10 256 

11 512 

12 1024 

13 2048 

14 4096 

15 8192 

16 16,384 

17 32,768 

18 65,536 

19 131,072 

20 262,144 

21 524,288 

22 1,048,576 

23 2,097,152 

24 4,194,304 

25 8,388,608 

26 16,777,216 

27 33,544,432 

28 67,108,864 

29 134,217,728 

30 268,435,456 

31 536,870,912 

32 1,073,741,824 

Cycle Number Number of Double-stranded Target Molecules

Characteristic RFLP Methods PCR Methods

Time required to obtain results

6-8 weeks with radioactive probes; ~1 week with chemiluminescent probes

1-2 days

Amount of DNA needed 50-500 ng 0.1-1 ng

Condition of DNA needed high molecular weight, intact DNA

may be highly degraded

Capable of handling sample mixtures

Yes (single locus probes)

Yes

Allele identification Binning required Discrete alleles obtained

Power of Discrimination ~1 in 1 billion with 6 loci ~1 in 1 billion with 8-13 loci (requires more loci)

Comparison of RFLP and PCR

Relative power of tests

• Test type time power• RFLP-VNTR weeks +++ *• PCR:• DQAlpha- macroarray 1 day +• PM - macroarray 1 day ++• D1S80 - gel- VNTR 2 days ++• STRs -gel,CE, arrays 2 days +++• mtDNA- gel, CE, arrays 2 days +• alu -gel, CE, arrays 2 days ++

• * not useful on degraded DNA

Advantages of PCR• Minute amounts of DNA template may be used from as

little as a single cell.• DNA degraded to fragments only a few hundred base

pairs in length can serve as effective templates for amplification.

• Large numbers of copies of specific DNA sequences can be amplified simultaneously with multiplex PCR reactions.

• Contaminant DNA, such as fungal and bacterial sources, will not amplify because human-specific primers are used.

• Commercial kits are now available for easy PCR reaction setup and amplification.

Potential Pitfalls of PCR• The target DNA template may not amplify due to the

presence of PCR inhibitors in the extracted DNA

• Amplification may fail due to sequence changes in the primer binding region of the genomic DNA template

• Contamination from other human DNA sources besides the forensic evidence at hand or previously amplified DNA samples is possible without careful laboratory technique and validated protocols

Multiplex PCR• Target 2 or more DNA regions simultaneously with multiple

primer sets. Copy more than one locus at a time• Primers for all loci are present in the tube• Conditions are adjusted to ensure all loci will be amplified• Multiple types obtained from 1-2 ng DNA• Greater discrimination• Advantages:

– more information in the same amount of time– less expensive (lower reagents and labor)

• Challenge lies in designing PCR primers that are compatible with one another

Primer Design• Typically performed with assistance of computer program

to identify possible primer that are then tested empirically• Various computer programs:

– Gene Runner (PC), Oligo (PC/Mac), Primer Express (Mac)– Primer 3 (web based)

• Critical parameters examined:– Predicted Tm (melting temperature)- Tm=4(G+C) + 2(A+T)– Primer dimer and hairpin formation– Contiguous base runs (usually <5 bases)– GC content (number of G and C nucleotides within primer)

Schematic of Multiplex PCR

Locus A

Locus C

Locus B

A

C

B

small large

• Over 15 Markers Can Be Copied at Once

• Sensitivities to levels less than 1 ng of DNA

• Ability to Handle Mixtures and Degraded Samples

• Different Fluorescent Dyes Used to Distinguish STR Alleles with Overlapping Size Ranges

Multiplex PCR

Important PCR facts• DNA polymerase is taq polymerase from a hot springs

(can survive denaturation boiling temperatures)• Taq likes to add an extra base (non template directed

nucleotide addition to the 3’ end). Amplification of DNA fragments of 100bp in size are 101 in length.

• PCR amplification sometimes “stutters” on STRs resulting in an extra PCR product called a stutter product. Eg. Both 100 (correct type) and 96 base pair fragments are present. The stutter product is usually represented at less than 10% of the real allele.

Real Time PCR

Quantitative PCR- QPCRhttp://pathmicro.med.sc.edu/RTPCR/rt-pcr.ppt

• Real-time QPCR has several advantages over the other methods in that it is extremely accurate and sensitive over a broad dynamic range, and it occurs in a closed-tube system, reducing the potential for carryover contamination.

• Using this technique, a forensic biologist can monitor and quantify the accumulation of PCR products during log phase amplification. (Heid et al., 1996).

• Several RT PCR human specific assays are now available that target autosomal, Alu repeats, Y chromosome and mtDNA (Andréasson et al. 2002, Nicklas et al. 2003, Green et al. 2005, Andréasson et al. 2006, Horsman et al. 2006).

• The assays may be performed on single targets or in multiplexes (Timken et al. 2005, Walker et al. 2005, Nicklas et al. 2006).

• Recently, the detection of degraded vs intact human DNA and PCR inhibitors has been reported (Swango et al. 2006).

RNA based quantification methods• Different genetic expression patterns (mRNAs) exist in different

tissue types. • Body fluid identification has been reported based on their mRNA

profiles (Juusola and Ballantyne 2003 and 2005, Nussbaumer et al. 2006)

• In addition, the age of a bloodstain was reported using analysis of mRNA: rRNA ratios (Anderson et al. 2005). This information may be useful in establishing the time of the crime.

• Advantages of the mRNA-based approach, versus the conventional biochemical tests, include greater specificity, simultaneous and semi-automatic analysis, rapid detection, decreased sample consumption and compatibility with DNA extraction methodologies.

• The quantification of the amounts of the mRNA species relative to housekeeping genes is a critical aspect of the assays (Juusola and Ballantyne 2003).

Comparison of Methods used for DNA Quantification

Method Ease Cost Sensitivity Result

UV Spectrophotometry +++++ + ++ Total DNA

Yield Gel electrophoresis +++ + + Int vs deg DNA

Slot Blot ++ ++ +++ Human DNA

Yield Gel blot + ++ +++ Int. vs. deg human DNA Pico-green microtitre plate ++++ ++ ++++ Total DNA

Alu Quant +++ +++ ++++ Human DNA

Real time PCR assays +++ +++ +++++ Human DNA

Real time PCR assays +++ +++ +++++ Int.vs. deg.Human DNA

Potential Pitfalls of PCR• The target DNA template may not amplify due to the

presence of PCR inhibitors in the extracted DNA

• Amplification may fail due to sequence changes in the primer binding region of the genomic DNA template

• Contamination from other human DNA sources besides the forensic evidence at hand or previously amplified DNA samples is possible without careful laboratory technique and validated protocols

Tips for Avoiding Contamination• Pre- and post-PCR sample processing areas should be physically separated. • Do not move from PCR area into non PCR area without decontamination• Process one sample at a time, Avoid splashing• Separate reference samples from evidence• Wear protective gear and reagent prep care• Equipment, such as pipettors, and reagents for setting up PCR should be kept

separate from other lab supplies, especially those used for analysis of PCR products.• Disposable gloves should be worn and changed frequently.• Reactions may also be set up in a laminar flow hood, if available. • Aerosol-resistant pipet tips should be used and changed on every new sample to

prevent cross-contamination during liquid transfers.• Reagents should be carefully prepared to avoid the presence of any contaminating

DNA or nucleases. • Ultraviolet irradiation of laboratory PCR set-up space when the area is not in use

and cleaning workspaces and instruments with isopropanol and/or 10% bleach solutions help to insure that extraneous DNA molecules are destroyed prior to DNA extraction or PCR set-up

• Controls: Negative, Positive, Stochastic, Substrate

Monitoring for Contamination—Controls ‘R’ Us

Bloodstain (Evidence)

Substrate Control

Reagent Blank—for Evidence

Victim’s Reference Sample

Reagent Blank—for References

Negative Amplification Control

Quality Control Sample

Positive Amplification Control

PCR ‘quiz’

• Template = • 5’GGACTCCTATGTATGTATGCTTTAAGGCA 3’ 3’CCTGAGGATACATACATACGAAATTCCGT 5’

• Design two primers (five bases long): Remember-the 3’ OH end will be extended and DNA is antiparallel

• Be sure to amplify the entire template.• List the other required components, materials and

procedure needed to conduct a successful PCR reaction• Assume this is an STR locus. What is the repeat unit? What

is the type (number of repeats for this allele)?

Reverse Dot blot hybridizationeg. DQ alpha and Polymarker

Once amplified detection can be done by DNA battleship

Summary

• RFLP (old) required approximately 50ng of DNA at a minimum. PCR requires as little at 500pg or 100 times less!

• One method to examine variation of variable number of tandem repeats (VNTRs) is RFLP= restriction fragment length polymorphisms

• RFLP requires many steps, undegraded DNA and takes days to weeks to complete

• In contrast, typing of STRs using PCR can be performed on very small amounts of degraded DNA and takes hours to a day to complete.

Summary 2• PCR is polymerase chain reaction and is repeated rounds of

DNA synthesis. • There are 5 components needed, PTMDD.• PCR takes place in a thermal cycler• Multiplex PCR permits amplification of many loci

simultaneously and saves time• Avoid contamination and use controls • Other markers that have been used in forensic PCR assays

include, dot blot assays of DQ alpha, polymarker, and D1S80. • Mitochondrial DNA sequencing and Y chromosome STR

markers are also being used.